Journal of Photochemistry & Photobiology, B: Biology 179 (2018) 66–73

Contents lists available at ScienceDirect

Journal of Photochemistry & Photobiology, B: Biology

journal homepage: www.elsevier.com/locate/jphotobiol

Light quality affects flavonoid production and related gene expression in T

Cyclocarya paliurus
⁎
Yang Liua, Shengzuo Fanga,b, , Wanxia Yanga,b, Xulan Shanga,b, Xiangxiang Fua,b
a
College of Forestry, Nanjing Forestry University, Nanjing 210037, PR China
b
Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: Understanding the responses of plant growth and secondary metabolites to differential light conditions is very
Cyclocarya paliurus important to optimize cultivation conditions of medicinal woody plants. As a highly valued and multiple
Light quality function tree species, Cyclocarya paliurus is planted and managed for timber production and medical use. In this
Flavonoid biosynthesis study, LED-based light including white light (WL), blue light (BL), red light (RL), and green light (GL) were used
Leaf biomass
to affect leaf biomass production, flavonoid accumulation and related gene expression of one-year C. paliurus
Gene expression
seedlings in controlled environments. After the treatments of 60 days, the highest leaf biomass appeared in the
treatment of WL, while the lowest leaf biomass was found under GL. Compared to WL, the total flavonoid
contents of C. paliurus leaves were significantly higher in BL, RL, and GL, but the highest values of selected
flavonoids (kaempferol, isoquercitrin and quercetin) were observed under BL. Furthermore, the greatest yields of
total and selected flavonoids in C. paliurus leaves per seedling were also achieved under BL, indicating that blue
light was effective for inducing the production of flavonoids in C. paliurus leaves. Pearson's correlation analysis
showed that there were significantly positive correlations between leaf flavonoid content and relative gene
expression of key enzymes (phenylalanine ammonia lyase, PAL; 4-coumaroyl CoA-ligase, 4CL; and chalcone
synthase, CHS) in the upstream, which converting phenylalanine into the flavonoid skeleton of tetrahydroxy
chalcone. It is concluded that manipulating light quality may be potential mean to achieve the highest yields of
flavonoids in C. paliurus cultivation, however this needs to be further verified by more field trials.

1. Introduction shikimate pathway [9]. Phenylalanine links secondary metabolism and

Plants, especially woody plants, are natural sources of bioactive
compounds including flavonoids with commercial use as pharmaceu-
tical substances. Flavonoids are a group of phenolic constituents natu-
rally occurring in fruits, seeds, flowers and leaves of plants and vary
greatly among different compounds and subgroups [1]. Flavonoids
have many biological functions in plants, such as protect plant against
UV light [2], attract pollinators [3], and increase resistance to en-
vironmental changes and wounding [4,5]. Flavonoids have been re-
ported to possess a lot of beneficial bioactivities in human health, such
as anti-allergenic, anti-inflammatory, anti-bacterial, anti-carcinogenic,
and anti-viral activities [1,6,7]. Quercetin and isoquercitrin have been
found to promote human health through reducing lipid peroxidation
and radical oxygen species (ROS) production [6,8]. Another flavonoid,
kaempferol, was reported to have remarkable potential to lower the
risks of heart disease and improve free-radical-scavenging activity [7].
Flavonoids are biosynthesized from the key precursors of malonyl-
CoA and phenylalanine, which are produced by the TCA cycle and a
primary metabolism [7], and is converted into cinnamic acid by phe-
nylalanine ammonia-lyase (PAL) (Fig. 1). Cinnamic acid is changed to
p-coumaric acid by cinnamate-4-hydroxylase (C4H) [10], while the p-
coumaric acid is then converted into 4-coumaroyl-CoA mediated by 4-
coumaroyl CoA ligase (4CL) [7]. Chalcone synthase (CHS) catalyzes the
conversion of 4-coumaroyl-CoA into the flavonoid skeleton of tetra-
hydroxy chalcone [11]. Finally, the tetrahydroxy chalcone is turned
into different flavonoid molecules by various enzymes, such as chalcone
isomerase (CHI), flavanone 3-hydroxylase (F3′H), dihydroflavonol 4-
reductase (DFR), flavonol synthase (FLS) and anthocyanidin synthase
(ANS) [12].
Flavonoid accumulation and biosynthesis in plants were affected by
many environmental factors, such as light, temperature, water and soil
type [13–15]. Light intensity and quality are important environmental
factors for plant growth and development [13,16]. Specifically, changes
in light quality strongly affect plant morphological, biochemical, and
physiological parameters [16]. For example, red light is reported to
contribute to photosynthetic apparatus development and may increase

⁎
Corresponding author at: College of Forestry, Nanjing Forestry University, Nanjing 210037, PR China.
E-mail addresses: fangsz@njfu.edu.cn, fangsz@njfu.com.cn (S. Fang).

https://doi.org/10.1016/j.jphotobiol.2018.01.002
Received 24 July 2017; Received in revised form 23 November 2017; Accepted 8 January 2018
Available online 11 January 2018
1011-1344/ © 2018 Elsevier B.V. All rights reserved.
Y. Liu et al.
starch accumulation by inhibiting the translocation of photosynthate
out of leaves [17–19]. Blue light is important for chloroplast develop-
ment, chlorophyll formation, photosynthesis, and chemical composi-
tion of plants [20]. Green light shows distinct effects on seedling ger-
mination, leaf expansion, leaf hyponasty, stem elongation,
photosynthesis, and biomass accumulation [21–23]. Moreover, re-
search of light conditions in recent years suggested that the impacts of
light quality on the production of flavonoids in plants are species spe-
cific [24]. For example, enhanced blue light strongly improved the
production of epidermal flavonoids in pepper plants [25], whereas UV
light specifically induced the biosynthesis of flavonoids in young berries
of Cabernet Sauvignon [26]. Gerhardt et al. [27] also found that the
flavonoid accumulation and composition in Brassica napus can be al-
tered by the amount of UV-B (290–320 nm) and far-red light. Mean-
while, Fu et al. [28] found that accumulation of a total of 12 flavonoids
in tobacco leaves was higher under ultraviolet (350–400 nm), blue light
(455–490 nm), and green light (515–540 nm), compared with yellow
light (580–600 nm), and red light (610–710 nm). It has been suggested
that flavonoid compounds accumulated in the epidermis can protect
plants from the damage caused by specific light wavelengths [29,30].
Cyclocarya paliurus (Batal) Iljinskaja belongs to the Juglandaceae
family and is widely distributed in mountainous regions of sub-tropical
China [31]. Leaves of this plant are traditionally used in China as a
medicine or nutraceutical tea because of its unique taste [32]. Many
studies have demonstrated that C. paliurus possesses a variety of
bioactivities, including hypoglycemic activity [33], antihypertensive
activity [34], anti-HIV-1 [35], antioxidant activity [36], and anticancer
[37]. Therefore, cultivation of C. paliurus for its leaf production has
been done in recent years for its medical applications. For example,
some studies have been carried out to determine the impact of light
intensity, genotype and fertilization on growth and phytochemical ac-
cumulation in C. paliurus [32,38]. Fang et al. [32] have also reported
that both isoquercitrin and quercetin contents in C. paliurus leaves were
greater than those from some fruits (Malus pumila, Prunus armeniaca,
Fragaria ananassa, etc.), medicinal plants (Eugenia jambolana Lam,
Azadirachta indica, Terminalia arjuna, etc.) and vegetables (Pisum sa-
tivum, Brassica oleracea, Spinacia oleracea, etc.) [39,40], while the
67
Journal of Photochemistry & Photobiology, B: Biology 179 (2018) 66–73
Fig. 1. Biosynthetic pathway of individual fla-
vonoids in plants. PAL: phenylalanine ammonia
lyase; C4H: cinnamate-4-hydroxylase; 4CL: 4-
coumaroyl CoA-ligase; CHS: chalcone synthase;
CHI: chalcone isomerase; FHT: flavanone 3β-hy-
droxylase; F3′H: flavonoid 3′-hydoxylase; FLS:
flavonol synthase; 3′OMT: 3′-Omethyltransferase
(quoted from Schmidt et al. 2010).
content of kaempferol in C. paliurus leaves was found to be comparable
with that of spinach [41]. In previous studies, Deng et al. [38] and Liu
et al. [42] also found that flavonoid accumulation in C. paliurus leaves
significantly increased under higher light intensities, but no knowledge
of light quality on flavonoid accumulation was available for this plant.
Furthermore, it remains unclear how the genes of flavonoid biosynth-
esis in C. paliurus respond to different light conditions.
The objectives of this study were to investigate the inter-relation-
ship of light quality on leaf biomass and flavonoid accumulation in C.
paliurus seedlings, to clarify how the genes of flavonoid biosynthesis
pathway respond to different light conditions, and to determine the
light quality that optimizes flavonoid production. Findings from the
study are expected to be of great value for better understanding the
responses of plant secondary metabolite accumulation to differential
light environment, and to provide a theoretical basis for improving
growing conditions for higher production of functional flavonoids in C.
paliurus cultivation.
2. Materials and Methods
2.1. Plant Materials and Experimental Procedures
The experiment was carried out during the 2016 growing season in
Nanjing Forestry University (31° 59′ N, 119° 18′ E). Seeds of C. paliurus
were collected from a superior tree (based on tree age, stem form and
growth vigor) in its location at Jinzhongshan (24° 36′ N, 104° 57′ E),
Guangxi province, China in late October 2015 and then subjected to
exogenous gibberellin A3 (GA3) treatments and stratification treat-
ments to break seed dormancy in early January 2016 following the
method of Fang et al. [31]. After a 3-month stratification treatment, the
germinated young seedlings were then transplanted into nonwoven
containers (8.0 cm diameter, 10.0 cm height) filled with a substrate
mixture of perlite: fowl manure: peat: soil (2: 2: 4: 2, v/v/v/v). The
substrate was a loam with pH 6.44, organic matter content of
73.3 g kg−1, total N content of 72.35 g kg−1, total P content of
2.19 g kg−1, and total K content of 9.55 g kg−1. Seedlings were covered
with one layer of shading net at 2 m height and kept well-watered once
Y. Liu et al.
a day.
Eight weeks later, when the fourth compound leaf extended, plants
with most close to mean base diameter (3.0 mm) and height (36.5 cm)
were selected and moved into climate chamber and then exposed to
LED lamps (Guangdong PHILIPS Lamp Co., China). Four LED light
treatments were WL (white light as control, 445 and 560 nm), BL (blue
light, 456 nm), RL (red light, 653 nm), and GL (green light, 514 nm),
respectively. The total light intensity of LED lamps used in each treat-
ment was expressed as photosynthetic photon flux density (PPFD) and
about 800 ± 50 μmol m−2 s−1 was set for all the treatments, which
was measured by a LI-6400 system (Li-Cor, Nebraska, USA). Each
treatment contains 3 replications and 15 plants per replication (each
container had a single plant). All treatments were kept at 25 ± 2 °C
and 70% relative humidity (RH) during the day, 21 ± 2 °C and 70%
RH at night with a 12 h dark/light photoperiod. The plants were kept
well-watered every two days until the end of the experiment.
The expanded mature leaves which received enough light (the third
or the fourth from the top) were collected four times (0, 20, 40, and
60 days after treatment) from three replicates of each treatment. Leaf
samples were divided to two parts, one was cleaned with tissues and
immediately frozen in liquid nitrogen for the analysis of gene expres-
sion of flavonoid biosynthesis, while the other was dried and ground
into fine powder for the determination of contents of total and selected
flavonoids.
2.2. Biomass Assessment
Based on the measurements of height and base diameter, three in-
tact plants with most close to mean diameter and height were harvested
in each treatment for leaf dry biomass analysis at 0, 20, 40, and 60 days
after treatment, respectively.
2.3. Extraction and Analysis of Total and Selected Flavonoids
Flavonoids were extracted using an ultrasonic-assisted method with
minor modifications [43]. Briefly, 25 mL of 70% ethanol was added to
each leaf sample (about 2.0 g) and the extraction was conducted for
60 min at 70 °C, and then centrifuged at 10,000g for 15 min.
The total flavonoid content was determined by using a colorimetric
method with minor modifications [44]. Exactly 0.15 mL of 5% NaNO2
was added to a 0.5 mL extract in a 10 mL volumetric tube, and the
mixture was kept for 5 min at room temperature. Addition of 0.15 mL of
10% AlCl3·6H2O to the mixture, which was incubated for another 5 min,
was followed by the addition of 1 mL of 1 M NaOH. After 15 min of
incubation at room temperature for color development, the absorbance
at 415 nm was measured. Total flavonoid content was calculated using
the standard rutin curve and expressed as milligrams rutin equivalent
per gram of dry mass (mg/g dm).
Analysis of selected flavonoids (kaempferol, isoquercitrin and
quercetin) was performed using a HPLC system (Waters, Milford, MA,
USA). The extract was filtered through a 0.22 μm organic phase filter
and then separated on an Eclipse Plus C18 column (250 mm × 4.6 mm,
5 um) at 25 °C. The mobile phase was composed of A (water/acetic acid
(98:2, v/v)) and B (100% acetonitrile). The flow rate was 0.6 ml min−1
and the detection wavelength was 360 nm. The gradient program was
as follows: 0–30 min,92–50% A;30–35 min,50% A; and 35–40 min,
50–92% A. The standards of isoquercitrin, kaempferol and quercetin
(Sigma-AldrichInc., St. Louis, USA) were used to obtain an external
calibration curve. The RP-HPLC chromatogram of three selected fla-
vonoids (quercetin, kaempferol, and isoquercitrin) in leaves of C. pa-
liurus (sampled at 0 day) and their responding standards are shown in
Fig. 2, and then content of each flavanoid under different light condi-
tions was calculated according to the calibration curve.
68
Journal of Photochemistry & Photobiology, B: Biology 179 (2018) 66–73
2.4. Expression Analysis of Flavonoid Biosynthesis-Related Genes
Total RNA was isolated from C. paliurus leaves (three samples from
each light treatment) following the method of Pang et al. [45] and then
transcribed to cDNAs using a cDNA synthesis kit (Toyobo, Osaka,
Japan). The expression levels of flavonoid biosynthesis-related genes
(PAL, 4CL, CHS and F3′H) along with an 18sRNA gene used as a re-
ference were determined by quantitative real-time PCR (qRT-PCR)
using an ABI PRISM 7500 Sequence Detection System (Applied Bio-
systems, Foster City, CA, USA) and a SYBR Green PCR Master Mix
(Applied Biosystems) was performed in triplicate [16] (Table 1 presents
primer information for the studied genes).
2.5. Statistical Analysis
Variation of leaf biomass, contents of total and selected flavonoids,
flavonoid yield per plant and gene expression among light treatments
was performed by Duncan multiple range test and standard error of
differences between means was calculated (with p set to 0.05), using the
SPSS 16.0 statistical software program (SPSS, Chicago, IL, USA).
Relationships between flavonoid contents and relative gene expression
were evaluated using the Pearson's correlation analysis. The data were
tested for normality (Shapiro–Wilk normality test) before analysis of
variance.
3. Results
3.1. Variation in Leaf Biomass
Light quality had a significant effect (p = .0005) on leaf biomass
production of C. paliurus seedlings at the end of the experiment
(Table 2). On the 60 day of treatment, leaf biomass per plant was in the
order of WL > BL ≥ RL > GL treatment. Compared with the value of
WL treatment, the leaf biomass per plant reduced by 8.4%, 11.9% and
29.7% under BL, RL, and GL conditions respectively, after the treatment
of 60 days (Table 2). Thus, monochromatic blue, red and green lights
significantly inhibited the growth of C. paliurus seedlings, when com-
pared to white light.
3.2. Variation in Flavonoid Content
Contents of total and selected flavonoids of C. paliurus leaves dif-
fered significantly (p = .0021, 0.0001, 0.0209 and 0.0001 for total
flavonoid, kaempferol, isoquercitrin and quercetin, respectively) among
four light treatments after the treatment of 60 days (Table 3). The
content of total flavonoid in plants under all light conditions displayed
a significant increase over time. On treatment day 60, the highest
content of total flavonoid in C. paliurus leaves was achieved at GL
treatment. Compared to WL treatment, total flavonoid content in the
leaves of BL, RL and GL treatments increased by 37.7%, 29.6% and
43.0% respectively. However, the highest values of kaempferol, iso-
quercitrin and quercetin on treatment day 60 were observed at BL, and
the lowest values were detected at WL. Compared to WL treatment,
contents of kaempferol, isoquercitrin and quercetin in BL on treatment
day 60 increased by 372.2%, 125.6% and 184.6%, respectively.
3.3. Variation in Flavonoid Yield per Plant
Based on the flavonoid content and leaf biomass, total and selected
flavonoid yields (flavonoid content × leaf biomass) in C. paliurus leaves
per seedling were calculated for different light treatments. Total and
selected flavonoid yields per plant under four light conditions all dis-
played a significant increase over time. The ANOVA indicated that the
effects of light quality were significant on yields of kaempferol
(p = .0001), isoquercitrin (p = .0203) and quercetin (p = .0001) on
treatment day 60, as well as the yield of total flavonoid (p = .0415)
Y. Liu et al. Journal of Photochemistry & Photobiology, B: Biology 179 (2018) 66–73

Fig. 2. A HPLC chromatogram of the responding standards (A) and the sample of C. paliurus (from treatment day 0) (B) for kaempferol, isoquercitrin and quercetin.

Table 1 Table 3
Primers used for the quantification of flavonoid biosynthesis-related gene expression le- Variation in flavonoid content (mg g−1) of C. paliurus leaves at 0, 20, 40 and 60 days after
vels by qRT-PCR. treatment (WL = white light, BL = blue light, GL = green light, and RL = red light)
(mean ± SD). Bars with different letters indicate significant differences (p < .05 by
Gene name Sequence (5′ → 3′) Tm (°C) Duncan's test) between treatments (n = 3).

PAL Up-5′GCCAACATAGTCGCAGTTCTTTC 3′ 62.3 Treatment Sampling time (days after treatment)

Down-5′ATCTGTCCAGGGTGGTGCTT 3′ 61.9
4CL Up-5′ATGGGGAGAATCCAAACCTCTAC 3′ 61.7 0 20 40 60
Down-5′TCGTAATCCGCAAAGAAAGACA 3′ 62.0
CHS Up-5′GCGAGGTTGGGCTTACATTC 3′ 61.9 Total
Down-5′GGTGTGCGATCCAAAAGAGAG 3′ 62.1 WL 13.3 ± 0.61a 14.5 ± 0.39a 18.8 ± 0.35b 20.8 ± 1.59b
F3′H Up-5′GGAGAAAGGTGACGGAGGAG 3′ 61.2 BL 13.3 ± 0.61a 15.9 ± 1.25a 25.1 ± 0.85a 28.6 ± 1.11a
Down-5′TGTGAGGTCTGGCTGTGGA 3′ 61.5 GL 13.3 ± 0.61a 15.7 ± 1.09a 22.9 ± 1.07a 29.7 ± 1.01a
18sRNA Up-5′AGTATGGTCGCAAGGCTGAAA 3′ 62.0 RL 13.3 ± 0.61a 15.8 ± 1.03a 16.3 ± 1.00b 26.9 ± 1.71a
Down-5′CAGACAAATCGCTCCACCAA 3′ 62.2
Kaempferol
WL 0.03 ± 0.00a 0.01 ± 0.00b 0.12 ± 0.00b 0.14 ± 0.01d
BL 0.03 ± 0.00a 0.41 ± 0.06a 0.26 ± 0.01a 0.64 ± 0.00a
Table 2 GL 0.03 ± 0.00a 0.05 ± 0.01b 0.13 ± 0.01b 0.29 ± 0.01c
Variation in biomass production (g) of C. paliurus leaves at 0, 20, 40 and 60 days after RL 0.03 ± 0.00a 0.03 ± 0.00b 0.06 ± 0.01c 0.37 ± 0.04b
treatment (WL = white light, BL = blue light, GL = green light, and RL = red light)
(mean ± SD). Bars with different letters indicate significant differences (p < .05 by Isoquercitrin
Duncan's test) between treatments (n = 3). WL 0.76 ± 0.02a 0.60 ± 0.03a 0.64 ± 0.01c 0.62 ± 0.02c
BL 0.76 ± 0.02a 0.76 ± 0.07a 1.43 ± 0.12ab 1.40 ± 0.26a
Treatment Sampling time (days after treatment) GL 0.76 ± 0.02a 0.68 ± 0.03a 0.80 ± 0.09bc 0.98 ± 0.09bc
RL 0.76 ± 0.02a 0.68 ± 0.02a 1.52 ± 0.11a 1.09 ± 0.02ab
0 20 40 60 Quercetin
WL 0.54 ± 0.09a 0.43 ± 0.03b 0.62 ± 0.04b 0.53 ± 0.05c
WL 4.65 ± 0.08a 5.28 ± 0.14a 6.15 ± 0.43a 6.32 ± 0.14a BL 0.54 ± 0.09a 0.98 ± 0.04a 2.00 ± 0.10a 1.53 ± 0.03a
BL 4.65 ± 0.08a 4.83 ± 0.20a 5.83 ± 0.06ab 5.79 ± 0.01b GL 0.54 ± 0.09a 0.46 ± 0.07b 0.81 ± 0.05b 0.62 ± 0.02b
GL 4.65 ± 0.08a 4.55 ± 0.33a 4.60 ± 0.11b 4.44 ± 0.17c RL 0.54 ± 0.09a 1.10 ± 0.06a 0.77 ± 0.02b 0.67 ± 0.00b
RL 4.65 ± 0.08a 4.77 ± 0.07a 4.89 ± 0.23b 5.57 ± 0.11b

3.4. Variation in Relative Expression of Flavonoid Biosynthesis Related

Genes

(Fig. 3). The greatest yields of total and selected flavonoids in C. pa-
Effects of light quality on relative gene expression of phenylalanine
liurus leaves per seedling on treatment day 60 was achieved in treat-
ammonia lyase (PAL), 4-coumaroyl CoA-ligase (4CL), chalcone syn-
ment BL, followed by treatment RL, whereas the lowest value was found
thase (CHS), flavonoid 3′-hydoxylase (F3′H) in C. paliurus leaves were
in WL treatment. Compared to the WL treatment, total flavonoid yield
significant (p = .0001) and varied among different treatment periods
in the BL treatment increased by 24.1%, while the yields of kaempferol,
(Fig. 4). Generally, the relative expression of studied genes showed
isoquercitrin and quercetin increased by 333.1%, 106.5% and 161.0%
increasing tendency with light treatment periods, except that of F3′H
respectively.
under WL and GL (Fig. 4). Across the light treatment periods, relative
expression of the studied genes of PAL, 4CL, and CHS was consistently

69
Y. Liu et al.
highest under GL on treatment day 60, followed by BL treatment.
However, the highest gene expression of F3′H was observed at BL on
day 40 (Fig. 4). Pearson's analysis across the light treatment periods
showed that the relative gene expression of PAL, 4CL, and CHS was
significantly correlated with the content of total and selected flavonoids
(especially for total flavonoid, the correlation coefficients reaching
0.980, 0.974, and 0.936, respectively), and similar correlations were
also found at each sampling time (Table 4). These results indicated that
the expression levels of PAL, 4CL, and CHS are notably correlated with
flavonoid content in C. paliurus leaves. Meanwhile, the relative gene
expression of F3′H also showed significant correlations with total and
selected flavonoid contents (except kaempferol), especially with that of
quercetin (0.956) (Table 4) across the light treatment periods.
4. Discussion
It is known that plant growth and the biosynthesis of flavonoids are
stimulated by multiple factors, including the specific characteristics of
visible light qualities [46]. Our study confirmed that light quality af-
fected both leaf biomass and flavonoid content in C. paliurus (Tables 2
and 3). White light accumulated more leaf biomass (Table 2), whereas,
blue, red, and green lights accumulated more flavonoid compounds in
C. paliurus leaves (Table 3), in consistent with reports from Fu et al.
[28] and Taulavuori et al. [46] who had found that green light or blue
light increased the flavonoid content in tobacco leaves and red leaf
lettuce. The reduction of leaf biomass under blue, red and green lights
70
Journal of Photochemistry & Photobiology, B: Biology 179 (2018) 66–73
Fig. 3. Variation in total flavonoid (A), kaempferol (B),
isoquercitrin (C) and quercetin (D) yield in C. paliurus
at 0, 20, 40 and 60 days after treatment (WL = white
light, BL = blue light, GL = green light, and RL = red
light) (mean ± SD). Bars with different letters in-
dicate significant differences between treatments
(p < .05 by Duncan's test) (n = 3). (For interpretation
of the references to color in this figure legend, the
reader is referred to the web version of this article.)
may due to the absence of the other wavelengths [17–23], while the
increase of flavonoid content under these treatments might be a means
of plant defense when resources (such as light) become limited [47,48].
The protection offered by plants against stress from specific light
quality (BL, GL, UV, etc.) through photoreceptors regulated gene ex-
pression may be direct via the induction of chloroplastic proteins and
indirect via regulating the phenolic pathway (flavonoids included),
DNA repair, photomorphogenesis or other antioxidants (Fig. 5).
Compared with WL treatment, contents of total and selected flavo-
noids were observed to have a significant increase under BL, RL and GL
when biomass accumulation was inhibited after the treatment of
20 days (Tables 2 and 3). Several theories have been proposed to ex-
plain the potential trade-offs between plant growth and the synthesis of
secondary metabolites [47]. Our results support the resource avail-
ability hypothesis, which suggests that the optimal level of plant de-
fense will increase if the potential growth rate of the plant decreases,
when resources (such as light, water and nutrient) become limited [48].
Furthermore, the hypothesis predicts that plants in resource-rich en-
vironments will grow faster, but with a decreased allocation to sec-
ondary metabolism, which is also confirmed by the growth rate and
flavonoid accumulation from treatment of white light in our study
(Table 3).
The temporal changes in phytochemical content and composition
also reflect the response of plant seedlings to different growing condi-
tions [42,46]. For example, our previous studies had indicated that
shading treatment not only reduced flavonoid content but also delayed
Y. Liu et al. Journal of Photochemistry & Photobiology, B: Biology 179 (2018) 66–73

Fig. 4. Variation in relative gene expression (A: PAL,

B: 4CL, C: CHS, and D: F3′H) in C. paliurus leaves at 0,
20, 40 and 60 days after treatment (WL = white light,
BL = blue light, GL = green light, and RL = red light)
(mean ± SD). Bars with different letters indicate sig-
nificant differences between treatments (p < .05 by
Duncan's test) (n = 3). (For interpretation of the re-
ferences to color in this figure legend, the reader is
referred to the web version of this article.)

Table 4
Pearson correlation coefficients between gene expression and leaf flavonoid content at
different sampling dates (n = 12) and across time (n = 48).

Sampling time Gene Flavonoid content (mg g−1)

expression
Total Kaempferol Isoquercitrin Quercetin

20d PAL 0.960** 0.617* 0.545* 0.433*

4CL 0.997** 0.836* 0.440* 0.449*
CHS 0.859** 0.897* 0.687* 0.489*
F3′H 0.585* 0.704 0.671* 0.991**
40d PAL 0.978** 0.608* 0.639* 0.771*
4CL 0.885* 0.474* 0.994** 0.554*
CHS 0.902** 0.634* 0.830* 0.516*
F3′H 0.492* 0.509 0.880* 0.990**
60d PAL 0.977* 0.806* 0.716** 0.562*
4CL 0.995** 0.809* 0.703* 0.511*
CHS 0.803* 0.774** 0.535* 0.515*
F3′H 0.502* 0.315 0.891** 0.972*
Fig. 5. Proposed response model of C. paliurus to different light qualities.
across time PAL 0.980** 0.556* 0.727** 0.496*
4CL 0.974** 0.632** 0.716** 0.504*
CHS 0.936** 0.717** 0.640** 0.595* to vary from one to another sampling date within the treatment group
F3′H 0.532* 0.473 0.616* 0.956**
(Table 3), which indicated that plants may change their phytochemical
* and ** indicate correlation is significant at the 0.05 and 0.01 level, respectively. content and composition to increase the competitive ability and de-
fense, especially when limited resources (light, water, etc.) can be ob-
the appearance of the highest flavonoid content in C. paliurus leaves tained [49]. Compared with red light, blue light and green light seemed
during its growing season [42], while regulation of soil moisture in the to induce a higher flavonoid accumulation in C. paliurus leaves, espe-
growing seasons also significantly changed leaf flavonoid content in cially key health-promoting flavonoids such as kaempferol, iso-
Cistus clusii and Ginkgo biloba [16–17]. Contents of individual flavo- quercitrin and quercetin (Table 3). These results indicated that specific
noids under BL, RL and GL conditions in this study were also observed light quality may enhance the production of certain phytochemicals

71
Y. Liu et al.
[50]. Overall, manipulation of light quality is essential to stimulate
flavonoid accumulation, particularly for production of key health-pro-
moting flavonoids in C. paliurus leaves.
Light has been found to affect the gene expression patterns of sec-
ondary metabolism in many plants [16,51]. Flavonoid biosynthesis in
C. paliurus leaves requires coordinated expression of genes that encode
enzymes in phenylpropanoid pathway such as PAL, 4CL, CHS and F3′H
(Fig.1) [7]. PAL links secondary metabolism and primary metabolism,
and high expression level of PAL is often reported with high flavonoid
contents in plants [52], which is consistent with results under light
treatments in our study (Table 3; Fig. 4). Prolonging of the blue light
and green light treatments resulted in higher gene expression of PAL.
Meanwhile, genes of 4CL and CHS showed the similar changing pattern
with PAL under different light treatments (Fig. 4), and significantly
positive correlations were found between the relative gene expression
(PAL, 4CL, and CHS) with total and selected flavonoid contents
(Table 4). These results indicated that the expression levels of PAL, 4CL,
and CHS are notably correlated with flavonoid contents in C. paliurus
leaves. In this study, we also found that gene expression of F3′H under
light treatments was different from that of PAL, 4CL, and CHS. The
relative gene expression of F3′H showed significantly higher positive
correlation with quercetin (0.956) (Table 4). These differences in
transcript levels of related genes indicated that biosynthesis of in-
dividual flavonoids may be controlled by different genes (Fig. 1) [7].
Overall, exposure to green and blue lights resulted in greater transcript
levels of related genes of flavonoid biosynthesis, which led to increased
flavonoid content in C. paliurus leaves.
In C. paliurus plantations with harvesting their leaves for commer-
cial use of pharmaceutical substances or functional foods, the goal is to
obtain not only higher flavonoid content but also higher yield (equal to
flavonoid content multiplied by dry leaf biomass). Deng et al. [38]
reported that full sunlight treatment (no shading) obtained the highest
flavonoid content in C. paliurus but not the greatest dry leaf biomass,
while shading treatment with one layer net achieved the highest ac-
cumulation of total flavonoid due to a higher leaf biomass. Thus, how to
get the best trade-off between leaf flavonoid content and leaf biomass
production is quite important in the production practices aimed at
obtaining the higher yield. In the present study, blue light was the most
effective way to induce flavonoid accumulation because it resulted in
the highest yield of functional flavonoids with the prolonging of
treatment (Fig. 4). Green light induced higher flavonoid content in C.
paliurus leaves with increasing treatment time but less dry leaf biomass
(Tables 2 and 3). Overall, in order to achieve the highest flavonoid yield
per area in C. paliurus plantations, it is important to manipulate
growing conditions such as light quality and intensity. However, high-
yield production of flavonoid in C. paliurus through manipulating light
conditions needs to be further confirmed with better designed tests in
both greenhouse planting and field planting trials, such as adding sui-
table plastic films or LEDs with spectral characteristics during night or
cloudy days.
Acknowledgments
This work was supported by the National Natural Science
Foundation of China (Project numbers: 31470637, 31270673), the
Priority Academic Program Development of Jiangsu Higher Education
Institutions (PAPD) and the Doctorate Fellowship Foundation of
Nanjing Forestry University.
Author Contributions
Shengzuo Fang and Xiangxiang Fu conceived and designed the ex-
periments. Yang Liu conducted the experiment and prepared the
manuscript. Wanxia Yang and Xulan Shang contributed to the chemical
72
Journal of Photochemistry & Photobiology, B: Biology 179 (2018) 66–73
analysis and data collection. Shengzuo Fang also supervised the study,
reviewed and edited the work. All authors have read and approved the
final manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
References
[1] I. Erlund, Review of the flavonoids quercetin, hesperetin, and naringenin. Dietary
sources, bioactivities, bioavailability, and epidemiology, Nutr. Res. 24 (2004)
851–874.
[2] C.Y. Wang, C.T. Chen, S.Y. Wang, Changes of flavonoid content and antioxidant
capacity in blueberries after illumination with UV-C, Food Chem. 117 (2009)
426–431.
[3] R.E. Koes, F. Quattrocchio, J.N.M. Mol, The flavonoid biosynthetic-pathway in
plants: function and evolution, BioEssays 16 (1994) 123–132.
[4] A. Azuma, H. Yakushiji, Y. Koshita, S. Kobayashi, Flavonoid biosynthesis-related
genes in grape skin are differentially regulated by temperature and light conditions,
Planta 236 (2012) 1067–1080.
[5] L. Chalker-Scott, Environmental significance of anthocyanins in plant stress re-
sponses, Photochem. Photobiol. Sci. 70 (1999) 1–9.
[6] A. Ciancolini, M. Alignan, M.A. Pagnotta, G. Vilarem, P. Crinò, Selection of Italian
cardoon genotypes as industrial crop for biomass and polyphenol production, Ind.
Crop. Prod. 51 (2013) 145–151.
[7] S. Schmidt, M. Zietz, M. Schreiner, Genotypic and climatic influence on the con-
centration and composition of flavonoids in kales (Brassica oleracea var. sabellica),
Food Chem. 119 (2010) 1293–1299.
[8] G. Palazzolo, P. Horvath, M. Zenobi-Wong, The flavonoid isoquercitrin promotes
neurite elongation by reducing RhoA activity, PLoS One 7 (2012) e49979.
[9] K.M. Davies, Modifying anthocyanin production in flowers, Anthocyanins. Springer
New York Pp, 2009, pp. 49–80.
[10] G. Dinelli, A. Bonetti, S. Elementi, L.F. D'Antuono, P. Catizone, Biosynthesis of
Polyphenol Phytoestrogens in Plants, Phytoestrogens in Functional Foods, CRC
Press Taylor and Francis Group, Boca Raton, 2006, pp. 19–80.
[11] S. Besseau, L. Hoffmann, P. Geoffroy, C. Lapierre, B. Pollet, M. Legrand, Flavonoid
accumulation in arabidopsis repressed in lignin synthesis affects auxin transport
and plant growth, Plant Cell 19 (2007) 148–162.
[12] A. Nakatsuka, D. Mizuta, Y. Kii, I. Miyajima, N. Kobayashi, Isolation and expression
analysis of flavonoid biosynthesis genes in evergreen azalea, Sci. Hortic. 118 (2008)
314–320.
[13] Y. Xu, G.B. Wang, F.L. Cao, C. Zhu, G. Wang, Y.A. El-Kassaby, Light intensity affects
the growth and flavonol biosynthesis of Ginkgo (Ginkgo biloba L.), New For. 45
(2014) 765–776.
[14] I. Hernández, L. Alegre, S. Munné-Bosch, Drought-induced changes in flavonoids
and other low molecular weight antioxidants in Cistus clusii grown under
Mediterranean field conditions, Tree Physiol. 24 (2004) 1303–1311.
[15] L. Wang, H. Shi, J.S. Wu, F.L. Cao, Alternative partial root-zone irrigation enhances
leaf flavonoid accumulation and water use efficiency of Ginkgo biloba, New For. 47
(2016) 377–391.
[16] Y. Liu, L.L. Song, W.W. Yu, Y.Y. Hu, X.H. Ma, J.S. Wu, Y.Q. Ying, Light quality
modifies camptothecin production and gene expression of biosynthesis in
Camptotheca acuminata Decne seedlings, Ind. Crop. Prod. 66 (2015) 137–143.
[17] A. Sæbø, T. Krekling, M. Appelgren, Light quality affects photosynthesis and leaf
anatomy of birch plantlets in vitro, Plant Cell Tissue Organ Cult. 41 (1995)
177–185.
[18] H. Shimizu, Y. Saito, H. Nakashima, J. Miyasaka, K. Ohdoi, Light environment
optimization for lettuce growth in plant factory, Proceedings of the 18th IFAC
World Congress, Vol. 18 2011, pp. 605–609.
[19] K. Kobayashi, T. Amore, M. Lazaro, Light-emitting diodes (LEDs) for miniature
hydroponic lettuce, J Opt. Photon. 3 (2013) 74–77.
[20] S.W. Hogewoning, G. Trouwborst, H. Maljaars, H. Poorter, W. van Ieperen,
J. Harbinson, Blue light dose-responses of leaf photosynthesis, morphology, and
chemical composition of Cucumis sativus grown under different combinations of red
and blue light, J. Exp. Bot. 61 (2010) 3107–3117.
[21] C.L. Ballaré, Keeping up with the neighbours: phytochrome sensing and other sig-
nalling mechanisms, Trends Plant Sci. 4 (1999) 97–102.
[22] J. Schmitt, R.D. Wulff, Light spectral quality, phytochrome and plant competition,
Trends Ecol. Evol. 8 (1993) 47–51.
[23] Y. Wang, K.M. Folta, Contributions of green light to plant growth and development,
Am. J. Bot. 100 (2013) 70–78.
[24] K.R. Cope, B. Bugbee, Spectral effects of three types of white light-emitting diodes
on plant growth and development: absolute versus relative amounts of blue light,
HortSci. 48 (2013) 504–509.
[25] A.M. Hoffmann, G. Noga, M. Hunsche, High blue light improves acclimation and
photosynthetic recovery of pepper plants exposed to UV stress, Environ. Exp. Bot.
109 (2014) 254–263.
[26] K. Koyama, H. Ikeda, P.R. Poudel, N. Goto-Yamamoto, Light quality affects flavo-
noid biosynthesis in young berries of Cabernet Sauvignon grape, Phytochemistry 78
Y. Liu et al.
(2012) 54–64.
[27] K.E. Gerhardt, M.A. Lampi, B.M. Greenberg, The effects of far-red light on plant
growth and flavonoid accumulation in brassica napus in the presence of ultraviolet B
radiation, Photochem. Photobiol. 84 (2008) 1445–1454.
[28] B. Fu, X. Ji, M. Zhao, F. He, X. Wang, Y. Wang, L. Niu, The influence of light quality
on the accumulation of flavonoids in tobacco (Nicotiana tabacum L.) leaves, J.
Photochem. Photobiol. B 162 (2016) 544–549.
[29] G. Agati, C. Brunetti, M. Di Ferdinando, F. Ferrini, S. Pollastri, M. Tattini,
Functional roles of flavonoids in photoprotection: new evidence, lessons from the
past, Plant Physiol. Biochem. 72 (2013) 35–45.
[30] A.E. Stapleton, Ultraviolet radiation and plants: burning questions, Plant Cell 4
(1992) 1353–1358.
[31] S.Z. Fang, J. Wang, Z. Wei, Z. Zhu, Methods to break seed dormancy in Cyclocarya
paliurus (Batal) Iljinskaja, Sci. Hortic. 110 (2006) 305–309.
[32] S.Z. Fang, X.L. Chu, X.L. Shang, W.X. Yang, X.X. Fu, C.Q. She, Provenance and
temporal variations in selected flavonoids in leaves of Cyclocarea paliurus, Food
Chem. 124 (2011) 1382–1386.
[33] H. Kurihara, H. Fukami, A. Kusumoto, Y. Toyoda, H. Shibata, Y. Matsui, T. Tanaka,
Hypoglycemic action of Cyclocarya paliurus (Batal.) Iljinskaja in normal and diabetic
mice, Biosci. Biotechnol. Biochem. 67 (2003) 877–880.
[34] M.Y. Xie, L. Li, S.P. Nie, X.R. Wang, F.S. Lee, Determination of speciation of ele-
ments related to blood sugar in bioactive extracts from Cyclocarya paliurus leaves by
FIA-ICP-MS, Eur. Food Res. Technol. 223 (2006) 202–209.
[35] J. Zhang, N. Huang, J. Lu, X. Li, Y. Wang, L. Yang, K. Xiao, Water-soluble phenolic
compounds and their anti-HIV-1 activities from the leaves of Cyclocarya paliurus, J.
Food Drug Anal. 18 (2010) 398–404.
[36] J.H. Xie, M.Y. Xie, S.P. Nie, M.Y. Shen, Y.X. Wang, C. Li, Isolation, chemical com-
position and antioxidant activities of a water-soluble polysaccharide from
Cyclocarya paliurus (Batal.) Iljinskaja, Food Chem. 119 (2010) 1626–1632.
[37] J.H. Xie, X. Liu, M.Y. Shen, S.P. Nie, H. Zhang, C. Li, M.Y. Xie, Purification, phy-
sicochemical characterisation and anticancer activity of a polysaccharide from
Cyclocarya paliurus leaves, Food Chem. 136 (2013) 1453–1460.
[38] B. Deng, X.L. Shang, S.Z. Fang, Q. Li, X.X. Fu, J. Su, Integrated effects of light
intensity and fertilization on growth and flavonoid accumulation in Cyclocarya
paliurus, J. Agric. Food Chem. 60 (2012) 6286–6292.
[39] B. Sultana, F. Anwar, Flavonols (kaempeferol, quercetin, myricetin) contents of
73
Journal of Photochemistry & Photobiology, B: Biology 179 (2018) 66–73
selected fruits, vegetables and medicinal plants, Food Chem. 108 (2008) 879–884.
[40] L.S. Huber, R. Hoffmann-Ribani, D.B. Rodriguez-Amaya, Quantitative variation in
Brazilian vegetable sources of flavonols and flavones, Food Chem. 113 (2009)
278–1282.
[41] A.M. Nuttila, K. Kammiovirta, K.M. Oksman-Caldentey, Comparison of methods for
the hydrolysis of flavonoids and phenolic acids from onion and spinach for HPLC
analysis, Food Chem. 76 (2002) 519–525.
[42] Y. Liu, C.Y. Qian, S.H. Ding, X.L. Shang, W.X. Yang, S.Z. Fang, Effect of light regime
and provenance on leaf characteristics, growth and flavonoid accumulation in
Cyclocarya paliurus (Batal) Iljinskaja coppices, Bot. Stud. 57 (2016) 28–41.
[43] W. Huang, A. Xue, H. Niu, Z. Jia, J. Wang, Optimised ultrasonic-assisted extraction
of flavonoids from Folium eucommiae and evaluation of antioxidant activity in multi-
test systems in vitro, Food Chem. 114 (2009) 1147–1154.
[44] J. Bao, Y. Cai, M. Sun, G. Wang, H. Corke, Anthocyanins, flavonols, and free radical
scavenging activity of Chinese bayberry (Myrica rubra) extracts and their color
properties and stability, J. Agric. Food Chem. 53 (2005) 2327–2332.
[45] Y.Z. Pang, G.A. Shen, W.S. Wu, X.F. Liu, J. Lin, F. Tan, X.F. Sun, K.X. Tang,
Characterization and expression of chalcone synthase gene from Ginkgo biloba, Plant
Sci. 168 (2005) 1525–1531.
[46] K. Taulavuori, V. Hyöky, J. Oksanen, E. Taulavuori, R. Julkunen-Tiitto, Species-
specific differences in synthesis of flavonoids and phenolic acids under increasing
periods of enhanced blue light, Environ. Exp. Bot. 121 (2016) 145–150.
[47] D.A. Herms, W.J. Mattson, The dilemma of plants: to grow or defend, Q. Rev. Biol.
67 (1992) 283–335.
[48] P.D. Coley, J.P. Bryant, F.S. Chapin, Resource availability and plant antiherbivore
defense, Science 230 (1985) 895–900.
[49] C.J. Ballarě, Light regulation and plant defence, Annu. Rev. Plant Biol. 65 (2014)
1–15.
[50] Q. Li, C. Kubota, Effects of supplemental light quality on growth and phytochem-
icals of baby leaf lettuce, Environ. Exp. Bot. 67 (2009) 59–64.
[51] S. Xu, L. Cao, W. Shi, X. Chen, Z. Su, Blue light irradiation affects anthocyanin
content and enzyme activities involved in postharvest strawberry fruit, J. Agric.
Food Chem. 62 (2014) 4778–4783.
[52] C. Lillo, U.S. Lea, P. Ruoff, Nutrient depletion as a key factor for manipulating gene
expression and product formation in different branches of the flavonoid pathway,
Plant Cell Environ. 31 (2008) 587–601.