Plant Biotechnology Journal (2013) 11, pp. 516–525 doi: 10.1111/pbi.

12063

A novel dominant selectable system for the selection of

transgenic plants under in vitro and greenhouse
conditions based on phosphite metabolism

pez-Arredondo† and Luis Herrera-Estrella*
Damar L. Lo
Laboratorio Nacional de Geno
mica para la Biodiversidad, Centro de Investigacio
n y de Estudios Avanzados del Instituto Polite
cnico Nacional, Irapuato,
Guanajuato, Me
xico

Received 11 December 2012; Summary

revised 4 February 2013; Antibiotic and herbicide resistance genes are currently the most frequently used selectable
accepted 9 February 2013. marker genes for plant research and crop development. However, the use of antibiotics and
*Correspondence (Tel +52 462 166 3008;
herbicides must be carefully controlled because the degree of susceptibility to these compounds
email lherrera@ira.cinvestav.mx)
† varies widely among plant species and because they can also affect plant regeneration.
Present address StelaGenomics Mexico S de
Therefore, new selectable marker systems that are effective for a broad range of plant species
RL de CV, Irapuato, Guanajuato, M
exico.
Accession numbers (GenBank/EMBL): are still needed. Here, we report a simple and inexpensive system based on providing transgenic
Sequence data from this article can be found plant cells the capacity to convert a nonmetabolizable compound (phosphite, Phi) into an
in the following accession numbers: ACT2 essential nutrient for cell growth (phosphate) trough the expression of a bacterial gene encoding
(At3g18780, http://www.ncbi.nlm.nih.gov/ a phosphite oxidoreductase (PTXD). This system is effective for the selection of Arabidopsis
nuccore?term=At3g18780), ACTINNT transgenic plants by germinating T0 seeds directly on media supplemented with Phi and to select
(GQ339768, http://www.ncbi.nlm.nih.gov/ transgenic tobacco shoots from cocultivated leaf disc explants using nutrient media
nuccore/GQ339768) and PTXD (AF061070, supplemented with Phi as both a source of phosphorus and selective agent. Because the ptxD/Phi
http://www.ncbi.nlm.nih.gov/nuccore/
system also allows the establishment of large-scale screening systems under greenhouse
AF061070).
conditions completely eliminating false transformation events, it should facilitate the develop-
Keywords: phosphite, phosphate, ment of novel plant transformation methods.
phosphite oxidoreductase (PTXD),
dominant selectable marker,
greenhouse selection.

alternative as a selective agent because it hampers the devel-

Introduction
In the process of plant genetic transformation, a small fraction
of cells exposed to the transformation treatment become stably
transformed. Hence, to enable the identification of rare stable
transformation events, it is necessary to use highly efficient
selectable marker genes that encode proteins that confer a
selective advantage to the transformed cell with respect to
untransformed cells. In addition, the selectable marker system
must allow the selective growth and differentiation of the
transformed cell. Dominant selectable marker genes for plant
transformation have been developed based on genes that
confer resistance to antibiotics or herbicides (Miki and McHugh,
2004) or that confer the ability to metabolize nonmetabolizable
agents, such as xylose (Haldrup et al., 1998), mannose (Joersbo
et al., 1998) or 2-deoxyglucose (Kunze et al., 2001), among
others. However, it has been found that some selection systems
are more effective for certain plant species and regeneration
systems than others. This is because the sensitivity of plants to
selective agents is widely variable between plant species and
tissues under selective pressure. Therefore, an ideal selectable
marker system should allow resistance to a toxic compound and
simultaneously convert it into a compound that is essential for
the growth and differentiation of cells in all plant species. Such
system should prove universal and decrease or eliminate the risk
of recovering false-positive clones that escaped the selection
scheme. In this context, phosphite (Phi) represents a promising
opment of plants (Schroetter et al., 2006; Thao et al., 2008;
Ticconi et al., 2001; Varadarajan et al., 2002) but can be
converted into an essential nutrient (Lo
pez-Arredondo and
Herrera-Estrella, 2012).
Phi is a structural analogue of phosphate (Pi) that is efficiently
absorbed by the Pi transport system and rapidly mobilized by the
xylem and phloem of plants (McDonald et al., 2001; Ouimette
and Coffey, 1990). Phi has been used as an effective fungicide
against oomycetes of the genus Phytophthora, which, together
with their capacity to induce plant defence responses, have


resulted in better yields for some plant species (Avila et al., 2011;
Carswell et al., 1996; Fo € rster et al., 1998; Moor et al., 2009).
These beneficial effects have led to the hypothesis that Phi has
also nutritional properties as source of phosphorus (P) for plants.
However, numerous reports have demonstrated that plant cells
are unable to metabolize Phi, preventing its use as a direct source
of P. Moreover, negative effects of Phi treatment on plant growth
have been reported for many plant species, including Arabidopsis,
tomato, Brassica nigra, pepper and maize (Fo €rster et al., 1998;

pez-Arredondo and Herrera-Estrella, 2012; Schroetter et al.,
Lo
2006; Thao et al., 2008; Ticconi et al., 2001; Varadarajan et al.,
2002). Phi-mediated negative effects have been observed both
under tissue culture conditions and when incorporated into the
soil or applied as foliar treatments under field conditions (Ticconi
et al., 2001; Varadarajan et al., 2002; Schroetter et al., 2006;
Thao et al., 2008; Lo
pez-Arredondo and Herrera-Estrella, 2012;

516 ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd
 Phosphite oxidoreductase as a selectable marker 517

€rster et al., 1998; Carswell et al., 1996; Moor et al., 2009;

Fo


Avila et al., 2011; Carswell et al., 1997).
The metabolic capacity to oxidize Phi into Pi has been reported
in specific isolates of Escherichia coli, Bacillus caldolyticus, Agro-
bacterium tumefaciens and Pseudomonas sp. (White and Metcalf,
2007). However, to date, PTXD from Pseudomonas stutzeri
WM88, which encodes an NAD-dependent phosphite dehydro-
genase that oxidizes Phi into Pi, is the only well-characterized
phosphite oxidoreductase (Garcia-Costas et al., 2001; White and
Metcalf, 2004). We recently reported the generation of Arabid-
opsis (ptxDAt) and tobacco (ptxDNt) transgenic plants that are

pez-Arredondo
able to efficiently use Phi as the sole source of P (Lo
and Herrera-Estrella, 2012). These plants were produced by
expressing the ptxD gene from P. stutzeri WM88 under the
control of the CaMV 35S promoter. Because Phi inhibits plant
growth by interfering with Pi sensing in plants and because plants
expressing the ptxD gene efficiently use Phi as their sole P source,
we hypothesized that the ptxD gene could be used as a dominant
selectable marker to produce transgenic plants. Here, we report
the development of such a system based on the expression of ptxD
as a dominant selectable marker and Phi as the selective agent.
Results
Effect of phosphite on Arabidopsis growth
When we previously evaluated ptxDAt and ptxDNt transgenic
lines that express the ptxD gene from P. stutzeri WM88 under
control of the CaMV 35S promoter, we observed remarkable
growth differences between wild-type (WT) and transgenic
plants in Phi-containing media (Lo
pez-Arredondo and Herrera-
Estrella, 2012). The growth of WT plants was completely
arrested, whereas transgenic lines displayed vigorous growth
because they were able to effectively use Phi as a P source.
Therefore, we decided to test whether the CaMV 35S::PTXD
construct could be used as a dominant selectable marker using
Phi as the selective agent. To evaluate the sensitivity of
Arabidopsis plants to Phi and determine the minimum and
maximum amount of Phi that could be used to select
transformed plants, we sowed seeds from WT and three ptxDAt
lines, one with high (ptxDAt-3) and two with low (ptxDAt-5 and
7) ptxD expression levels, in solid media containing 0.2, 0.4, 0.6,
0.8, 1, 3 and 5 mM Phi as the sole P source. Under all Phi
concentrations tested, we observed an effective inhibition on the
growth of WT plants (Figure 1). As previously reported, WT
seedlings displayed negative effects induced by Phi, including
leaf yellowing, stunted stems, short primary roots and very short


or aborted lateral roots (Avila et al., 2011; Carswell et al., 1996,
1997; Fo €rster et al., 1998; Lo

pez-Arredondo and Herrera-Estrel-
la, 2012; Moor et al., 2009; Schroetter et al., 2006; Thao et al.,
2008; Ticconi et al., 2001; Varadarajan et al., 2002). Even at the
lowest Phi concentrations, the growth of WT plants was arrested
at the cotyledonary or 4 leaf stage, and plants died 10–12 days
after germination (dag). In contrast, ptxDAt plants displayed
vigorous growth under all Phi concentrations, with no notable

Figure 1 Evaluation of the sensitivity of Arabidopsis transgenic plants to phosphite on solid media. Transgenic homozygous plants from lines ptxDAt-3, 5
and 7 and WT plants (18 day old) germinated and grown horizontally on 0.1X MS nutrient solid media supplemented with different concentrations of
phosphate (Pi) or phosphite (Phi) as a phosphorus (P) source under a photoperiod of 16-h light/8-h darkness and temperature of 22–23 °C. The position of
the different transgenic lines and WT control is shown in the first panel on the top left picture.

ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525
518 Damar L. Lo
pez-Arredondo and Luis Herrera-Estrella

differences between the lines with high or low ptxD expression
levels (Figure 1). Additional experiments using a higher Phi
concentration (20 mM) showed that line ptxDAt-5 whose ptxD
expression is almost 24-fold lower than that of ptxDAt-3 (the
line with the highest expression level) is still capable of growing
in media containing 20 mM Phi, whereas line ptxDAt-7, which
has an expression level 40-fold lower than that of ptxDAt-3, is
not (Figure 1 and Figure S1). Selective effects of Phi were also
observed for seeds germinated in liquid media supplemented
with 0.05, 0.1 and 1 mM Phi, for which the lowest concentration
was sufficient to kill WT plants 7–8 dag and to sustain the
growth of PTXD plants (Figure S2). These data show that the
identification of transgenic plants can be achieved over a wide
range of Phi concentrations.
Selection of Arabidopsis transgenic seedlings using the
ptxD as a gene marker and phosphite as a selective
agent
As the next step, we tested 0.1, 0.2, 0.4, 0.6, 0.8, 1 and 5 mM Phi
as a selective agent for the selection of Arabidopsis transgenic
seedlings and compared its efficiency to that obtained using the
phosphinothricin acetyl transferase (bar) gene as a dominant
selectable marker and phosphinothricin (PPT) as the selective
agent. Using a modified floral dip method (Martinez-Trujillo et al.,
2004), we inoculated Arabidopsis plants with an Agrobacterium
strain harbouring a binary vector containing the CaMV 35S::PTXD
gene construct. Because the transferred DNA also contained a
NOS::BAR gene construct (Figure S3), it was possible to assess the
efficiency of both selectable systems on the same pool of seeds.
To evaluate transformation efficiency, we sowed T0 seeds on
normal 0.1X MS media supplemented with 20 mg/L PPT or 0.1X
MS lacking Pi but supplemented with Phi as both the selective
agent and P source. Under all Phi concentrations tested, the
growth of most seedlings was rapidly arrested in a similar fashion
to that observed for untransformed controls, and only putatively
transformed seedlings grew vigorously (Figure 2a, b, Figure S2
and Figure S4). No significant difference (P < 0.05) in transfor-
mation frequency was observed between the Phi and PPT
selectable systems (Table 1).
Putative transgenic seedlings that were able to grow in Phi-
containing media had normal morphology and displayed a well-
developed root system (Figure S4). Because Phi causes root
growth inhibition, this characteristic was used as an additional
phenotype for the identification of transgenic seedlings at early
stages of development. Although transgenic seedlings were easily
identified among the background of untransformed seedlings for
all tested Phi concentrations, we observed Phi dose-dependent
differences in rosette size and leaf pigmentation (Figure S4).
Putative transformed seedlings that were selected and grown
with low Phi concentrations (0.1–0.4 mM) showed small rosettes,
albeit ones that were clearly distinguishable from untransformed
seedlings, and had dark purple leaves, features that are consistent
with the response of Arabidopsis to low Pi availability. In contrast,
plants selected using higher Phi concentrations (0.6–5 mM)
showed large rosettes with green leaves. These data suggest
that even low Phi concentrations are sufficient to compromise the
growth of untransformed seedlings, but also to support the
development of transgenic PTXD seedlings.
To confirm that seedlings selected in Phi-containing media were
true transformants and not WT escapes, the presence of the ptxD
gene and capacity of the plants to metabolize Phi were assessed.
We first assayed for the presence of the complete ptxD gene by
PCR in 61 randomly selected T0 plants obtained using different Phi
concentrations (6–8 lines per treatment). All tested plants were
found to be PCR positive for the presence of the ptxD coding
sequence (Figure S5). To confirm that the PCR-positive plants were
indeed transgenic, the T1 progeny of these plants was tested for
germination and growth in Phi-containing media. We observed

(a) (b) (c)

(d) (e)

Figure 2 Selection of Arabidopsis transformants using the ptxD gene as a selectable marker and phosphite as a selective agent. (a) WT (Col-0) seedlings,
(b) T0 seedlings from an Arabidopsis plant transformed by the floral dip method and (c) T1 seeds from a self-pollinated transgenic Arabidopsis plant
selected in (b) grown on media lacking phosphate (Pi) and supplemented with 1 mM phosphite (Phi) as a phosphorus (P) source. Plants were photographed
25 dag. (d) Southern blotting was performed to confirm the presence of the ptxD gene. Genomic DNA of homozygous Arabidopsis lines selected using
5 mM Phi was extracted using CTAB and digested with EcoRI, for which the T-DNA has a single restriction site. The pB7WG2D::PTXD expression vector was
used as a positive control (C+). (e) Real-time PCR of WT (Col-0) and homozygous transgenic Arabidopsis lines was performed using total RNA and
normalized using ACTIN2. Relative expression is presented in log 10 scale (relative to actin expression level). M: 1 Kb ladder molecular weight control.

ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525
 Phosphite oxidoreductase as a selectable marker 519

Table 1 Transformation frequencies obtained using the ptxD/Phi tabacum transgenic plants harbouring the CaMV 35::PTXD gene
system can be obtained using the Agrobacterium-based leaf disc trans-
formation method. We first conducted experiments to determine
Number of the effect of Phi on the ability of tobacco leaf explants to produce
Concentration Seeds resistant Transformation shoots on MS media supplemented with 2 mg/L BAP to induce
Selective agent (mM) sowed seedlings frequency%  SE shoot formation (shoot-inducing media) and with Phi or Pi as the P
source. Therefore, we incubated 0.7- to 1-cm2 explants in media
Phosphinothricin 0.1 5,713 19 0.3325  0.017
containing 0.2, 1, 5, 7 or 20 mM Phi or Pi (Figure 3). After three
Phosphite 0.1 5,295 19 0.3587  0.056
weeks of incubation, only the explants under the lowest Phi
0.2 5,299 15 0.2830  0.018
concentration (0.2 mM) were able to develop sporadic shoots,
0.4 5,306 19 0.3392  0.037
which grew slowly and soon lost vigour and became brownish.
0.6 5,257 17 0.3233  0.018
This result is in contrast to explants placed on media containing Pi,
0.8 6,181 15 0.2426  0.016
which produced abundant green shoots (Figure 3). Importantly,
1 4,243 15 0.3535  0.023
after five weeks, all explants placed in the Phi media turned yellow
5 6,724 22 0.3271  0.029
pale, with necrotic regions, and were not able to generate viable
The use of phosphite (Phi) as selective agent allowed the selection of transgenic shoots (Figure 4). These data suggests that possible escapes in
plants transformed with the CaMV 35S::PTXD construct. Arabidopsis plants regenerating shoots and selecting transgenic plantlets can be
were transformed using the floral dip protocol and the progeny germinated in avoided using Phi concentrations greater than 0.2 mM.
media containing either phosphinothricin or different concentrations of Phi as Regeneration of tobacco transgenic shoots using the
selective agents. 15 days after germination, the number of surviving seedlings ptxD gene as a gene marker and phosphite as a selective
was counted, and the transformation frequency (calculated as the number of agent
resistant seedlings per total seeds sowed) for each selective media was
determined. The average seeds sowed, and number of resistant seedlings and Based on these results, we decided to use MS nutrient media
transformation frequency from two independent experiments is presented. supplemented with 1 mM Phi to perform tobacco leaf disc
SE, Standard error. transformation experiments. With this aim, tobacco leaf discs
were cocultivated with an Agrobacterium strain that harboured
the CaMV 35S::PTXD construct or the empty vector and
that for all tested lines, a large proportion of the seeds were able to incubated in selective (1 mM Phi) or control (1 mM Pi) shoot-
germinate and sustain vigorous growth. In most cases, the capacity inducing media. As expected, explants cocultivated with both the
to metabolize Phi segregated in a 3 : 1 (resistant/susceptible) ratio, ptxD and the empty vector Agrobacterium strains were able to
suggesting that they had a single active copy of the CaMV 35S:: generate abundant shoots in media supplemented with 1 mM Pi.
PTXD gene construct, whereas the remaining T1 plants produced a Explants cocultivated with the empty vector strain and incubated
higher proportion of seeds able to metabolize Phi (Figure 2c and in media containing 1 mM Phi became yellowish and were unable
Table S1), likely because they contained more than one indepen- to generate shoots (Figure 4a), whereas explants cocultivated
dent copy of the selectable marker gene. Moreover, the lines with Agrobacterium strain harbouring the CaMV 35S::PTXD
identified using Phi as the selective agent were also found to be construct developed green proliferative sectors, which after
resistant to PPT, which was expected because of the presence of 4–5 weeks produced healthy shoots (Figure 4b and c). Upon
the NOS::BAR gene in the same T-DNA. transfer to fresh Phi-containing media lacking growth regulators,
Lines that segregated in a 3 : 1 ratio were selected, and these regenerated shoots rapidly developed into plantlets and
homozygous T3 seed stocks were obtained. Eleven randomly produced abundant roots (Figure 4d). Regenerated plants had
selected homozygous lines were subjected to Southern blot normal morphology, flowering time and seed production under
hybridizations (Figure 2d). Total genomic DNA was extracted and greenhouse conditions, even when the substrate used for their
digested with the restriction enzyme HindIII, which cleaves the growth was amended to contain Phi as the sole P source (Figure
T-DNA once, and then hybridized with a ptxD radiolabelled probe S6). Eighty-one T1 plants were subjected to PCR analysis to
(Figure S3). Hybridization results suggested that all tested lines amplify the ptxD gene, of which 100% were PCR positive (Figure
were indeed transgenic and contained from 1 to 5 independent S7). The expression of the ptxD gene was further confirmed by
T-DNA insertions. The expression of the CaMV 35S::PTXD qRT-PCR for some of these lines, for which we observed a range
transgene was further confirmed by qRT-PCR analysis, which of expression levels (Figure S7). Mendelian segregation of the
showed a range of expression levels (Figure 2e). CaMV 35S::PTXD construct in the T2 progeny of transgenic
Taken together, these results demonstrate that the ptxD gene tobacco plants was clearly observed in media containing Phi as
can be used as an effective selectable marker for the transfor- the sole source of P (Figure 4e). These data demonstrated that
mation of Arabidopsis using the floral dip method and that the the ptxD/Phi system is effective for regenerating and selecting
transformation frequency obtained is similar to that achieved tobacco transgenic plants from a single transformed cell.
using the bar gene. The ptxD/Phi system has the additional
The ptxD/Phi system can be used to select transgenic
advantages that the cost of Phi is significantly lower than that of
plants under greenhouse conditions using solid
the antibiotics or herbicides commonly used for plant selection,
substrates
and that Phi is not toxic to humans.
The selection of transformed plants under sterile conditions is
Effects of phosphite on tobacco shoot regeneration
labour-intensive and time-consuming and generally requires
To test whether the ptxD gene could act as a dominant selectable expensive selectable agents. Therefore, low-cost greenhouse
marker in a protocol that involves the regeneration of complete systems to screen large seed populations for the presence of
plants from transformed cells, we tested whether Nicotiana low-frequency transformation events could facilitate the estab-

ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525
520 Damar L. Lo
pez-Arredondo and Luis Herrera-Estrella

Figure 3 Effect of phosphite on shoot regeneration in tobacco explants. Tobacco leaf explants were cultivated in solid media lacking a phosphorus (P)
source (No P) or containing 1 mM phosphate (Pi) or 0.2, 1, 5, 7 and 20 mM phosphite (Phi) as P source and supplemented with 2 mg/L BAP to induce shoot
formation. All explants were incubated at 23 °C with a photoperiod of 16-h light-8-h dark.

(a)
(c) (d)

(b)

(e)

Figure 4 Generation and selection of transgenic tobacco plants using the ptxD gene as a selectable marker and phosphite as a selective agent. Tobacco
leaf discs were cocultivated with an Agrobacterium strain harbouring the CaMV 35S::PTXD construct for 48 h and then transferred to shoot-inducing 1X
MS media supplemented with 1 mM phosphite. Control leaf discs (a) were unable to regenerate shoots in media containing Phi as the only phosphorus (P)
source, whereas leaf discs cocultivated with the Agrobacterium strain containing the CaMV 35S::PTXD construct produced several shoots per leaf disc (b).
The use of Phi as both the source of P and the selective agent allows the differentiation (b) and elongation of putative transgenic shoots (c), which were
then transferred to rooting media after 8–9 weeks of culture (d). (e) Segregation analysis of the progeny of heterozygous transgenic tobacco plant in media
containing Phi as a sole P source.

ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525

lishment of new transformation protocols. To test whether
transformed seedlings could be identified among a background
of nontransformed seedlings under greenhouse conditions, we
sowed a 1 : 100 mixture of PTXD tobacco transgenic/WT seed in
a solid substrate amended with 120 mg/kg of Phi. Transgenic
plantlets could be identified among a background of nontrans-
formed plantlets as early as 5–8 dag (Figure S8a). The transgenic
nature of the selected plantlets was corroborated 35 dag, as the
selected PTXD transgenic tobacco plants displayed vigorous
growth using Phi as P source (Figure 5a). Similar results were
obtained by irrigating the substrate with a nutrient solution
containing 1 mM Phi as the only P source (data not shown). We
also performed high-density selection experiments by directly
germinating Arabidopsis T0 seeds in a mixture of sand and
vermiculite (1 : 1) amended with Phi at 120 mg/kg. Transgenic
Arabidopsis plantlets displayed considerably better growth than
nontransformed siblings 10 dag (Figure S8b) and grew vigorously
35 dag (Figure 5b).
Discussion
The simple system we have described, which is based on the
metabolism of the reduced P compound Phi, utilizes two
(a)
(b)
Figure 5 Selection of Arabidopsis and tobacco transformants using a
solid substrate amended with phosphite under greenhouse conditions. (a)
Transgenic tobacco seeds mixed with wild-type seeds at 1 : 100 ratio
were directly germinated and grown in a mixture of sand and vermiculite
(1 : 1) amended with 120 mg/kg of phosphate (Pi) or phosphite (Phi) as
phosphorus (P) source. Plants under the different treatments were
photographed 35 days after germination, placing pots with the different
treatments side by side. (b) Arabidopsis T0 seeds were directly germinated
and grown in sand and vermiculite mixture (1 : 1) amended with 120
mg/kg of Pi or Phi as P source. Plant were photographed 35 days after
germination. Treatment with no P source (No P) was included as a control.
ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525
Phosphite oxidoreductase as a selectable marker 521
important factors: the nutritional requirements of plants for Pi,
an essential nutrient, and the inability of plants to metabolize Phi.
As we demonstrated, our system can be used to effectively select
transformed plant cells under in vitro culture conditions and
regenerate plantlets from these cells or to directly select trans-
genic plants during seed germination under in vitro or green-
house conditions. Other selectable marker genes have a number
of disadvantages, for instance those converting nonmetabolizable
compounds into molecules that plant cells can use as a carbon
source are only effective for nonphotosynthetic cells, whereas in
the case of antibiotic and herbicide detoxification systems, the
sensitivity to these compounds widely varies depending upon the
plant species to be transformed. In contrast, the ptxD/Phi system
is potentially a universal selectable system because all plant
species require Pi for their growth and not a single plant species
has been reported to be capable of oxidizing Phi into Pi. However,
although we do not expect negative effects from Phi on plant
differentiation, it will be necessary to test the effect of Phi on the
regeneration process of plant species other than tobacco to fully
demonstrate the use of the ptxD/Phi system as a universal system
for plant transformation. The only requirement for the ptxD/Phi
system to be effective is that selection of transformed cells or
seedlings must be performed on media containing limiting
amounts or completely lacking Pi.
The transformation efficiency we determined using the Phi
selectable system was similar to that obtained using the bar gene
as a selectable marker. Although in these experiments, the
selectable marker genes were expressed from different promoters,
it is not expected to have a different efficiency using a weaker
promoter to drive the expression of PTXD, because seedlings with
very low levels of ptxD expression were able to grow in media
containing up to 5 mM Phi as selective agent (Figure 1, Figure 2
and Figure S1).
Untransformed cells or plantlets that escape the effect of
selectable agents (commonly known as escape events) are a
common problem when antibiotic or herbicides are used as
selectable agents. This problem is unlikely to occur with the ptxD/
Phi system because Phi must be detoxified and converted into Pi
for the plant cell or germinating seed to grow; therefore, the only
way of regenerating plants or germinating seeds in media
containing Phi as the only P source is that they acquire the
capacity to metabolize Phi. In the course of the experiments
reported here and additional experiments to search for Phi-
resistant Arabidopsis mutants, we have tested more than 50 000
EMS-mutagenized seeds, and not a single escape event has been
observed. These results suggest that in contrast to resistance to
herbicides, which can be acquired by different mechanisms,
including a decrease in herbicide transport or compartmentaliza-
tion to sequester the herbicide and avoid its toxicity or mutations
in the target enzyme, mutations that allow the use of Phi as a sole
P source are less likely to occur in plants.
The ptxD/Phi system has several advantages compared with
currently used systems: (i) sodium (Na) and potassium (K) Phi salts
are readily available from many companies and inexpensive; (ii)
Phi salts are innocuous to humans and animals, and therefore,
their use does not require special precautions; (iii) Phi salts are
water soluble and have high thermo- and photostability, ensuring
their persistence as selective agents in both tissue culture and
greenhouse conditions; (iv) because all plants need a P source to
sustain growth and not a single plant species has been reported
to be able to metabolize Phi, the ptxD/Phi system is potentially a
universal dominant selectable marker for the production of
522 Damar L. Lo
pez-Arredondo and Luis Herrera-Estrella
transgenic plants; (v) the ptxD/Phi system is useful as a selection
system under greenhouse conditions using inert substrates or a
variety of soils with low Pi content by providing the system with
Phi in the soil or the irrigating solution, which would facilitate
high-density selection experiments; and (vi) the use of direct
selection protocols using trays containing soil or an inert substrate
under greenhouse conditions will avoid the time-consuming and
expensive step of selection under tissue culture conditions and
the individual transfer of each resistant plant into pots for
greenhouse growth.
Greenhouse selection systems could be useful to develop
transformation systems similar to the Arabidopsis floral dip
protocol for other plant species or for selecting transgenic seeds
derived from transformation experiments of apical meristems by
particle bombardment that produce chimeric plants in which only
a few seeds are transgenic and large numbers of seeds must be
evaluated.
Finally, it is important to note that of the almost 60 selectable
marker systems proposed to date (Miki and McHugh, 2004), only
a few, such as the betaine aldehyde dehydrogenase (from
spinach) (Daniell et al., 2001), the rstB (from Sinorhizobium fredii
strain RT 19) (Zhang et al., 2009) and the AtTPS (from Arabid-
opsis) (Leymand et al., 2006) genes, which confer salt tolerance
and/or osmoprotection, confer a developmental advantage to
plants such that in addition to the identification and isolation of
transgenics, they are able to cope with biotic or abiotic stresses
that reduce the growth and productivity of crops. The presence of
the ptxD gene represents not only a method to identify transgenic
plants but also a competitive advantage that under field
conditions should reduce the application of P-fertilizers and
herbicides to control weed growth, as we recently reported

pez-Arredondo and Herrera-Estrella, 2012).
(Lo
Experimental procedures
General reagents
All reagents used in the experiments were from Sigma-Aldrich,
unless otherwise stated. For all experiments using solid tissue
culture media, agar Plant TC from Phytotechnology Laboratories
was used.
Biological material and in vitro growth conditions
Arabidopsis thaliana (Col-0) and Nicotiana tabacum L. cv Xanthi
were used to test Phi susceptibility and as background genotypes
in transformation experiments. For propagation and plant growth
experiments in vitro, Arabidopsis and tobacco seeds were placed in
an Eppendorf tube and then surface disinfected as follows: 1 mL
70% (v/v) ethanol was added, and the tube was shaken for 7 min.
Then, the solution was discarded, 1 mL 20% (v/v) commercial
bleach was added, and the tube was shaken for 8 min. Finally, the
solution was discarded, and the seeds were washed four times for
10 min each time using sterile-deionized water.
Hydrated tobacco seeds were used immediately after disinfec-
tion or preserved at 15 °C in sterile-deionized water until required
for experiments. Hydrated Arabidopsis seeds were stratified at
4 °C for 48 h to promote and synchronize germination. For in
vitro experiments, seeds were sown in sterile conditions in Petri
dishes or plastic containers containing Murashige and Skoog (MS)
nutrient media, as indicated for each experiment. Then, plates
and containers were incubated in a plant growth cabinet
(PERCIVAL) with controlled conditions and a photoperiod of
16-h light/8-h dark and temperature of 22  1 °C. Petri dishes
ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525
were placed vertically or horizontally, as required. For propaga-
tion purposes, all seeds were germinated in vitro, and then,
plantlets were transferred to pots with a sterile mixture of perlite/
vermiculite/Canadian peat moss (1 : 1 : 1).
The basic MS medium contained the following: 2.0 mM
NH4NO3, 1.9 mM KNO3, 0.3 mM CaCl2 2H2O, 0.15 mM MgSO4
7H20, 5 mM KI, 25 mM H3BO3, 0.1 mM MnSO4 H2O, 0.3 mM
ZnSO4 7H2O, 1 mM Na2MoO4 2H2O, 0.1 mM CuSO4 5H2O,
0.1 mM CoCl2 6H2O, 0.1 mM FeSO4 7H2O, 0.1 mM Na2EDTA
2H2O, 10 mg/L inositol, 0.2 mg/L glycine, 0.05 mg/L pyridoxine
chlorhydrate, 0.05 mg/L nicotinic acid and 0.01 mg/L thiamine
hydrochloride, in addition to the P source, Pi (KH2PO4 or
NaH2PO4) or Phi (KH2PO3 or NaH2PO3), which was added as
required (KH2PO3 from Wanjie International CAS No. 13977-65-
6). The media were adjusted to pH 5.7 and contained 5 g/L
sucrose for Arabidopsis media and 15 g/L sucrose for tobacco
media, and 10 g/L agar when required.
Experiments using a hydroponic system
To analyse the growth responses of control and transgenic
plants, experiments were performed not only in vitro (as
described above) but also using a hydroponic system. For these
experiments with liquid media, treatments with one source of P
(Pi or Phi) at 0, 0.05, 0.1 and 1 mM or with both sources of P at
proportions of 0.05/0.05, 0.1/0.1, 1/1 mM/mM were established.
Sterile 1-L plastic containers (14 cm in diameter) were filled in
with 480 mL of the medium, and a plastic mesh was placed on
the liquid surface of each container, in which 50 seeds were
sown.
Generation of the CaMV 35S::PTXD construct and
transformation of Agrobacterium
To obtain transgenic plants expressing the ptxD coding
sequence from Pseudomonas stutzeri WM88, the complete
open-reading frame of this gene was amplified from the
pWM302 plasmid (a kind gift of Dr. William W. Metcalf) and
placed under the control of the CaMV 35S promoter using
Gateway technology.
The Gateway system utilizes the site-specific recombination
reactions that enable the bacteriophage k to integrate and excise
itself in and out of a bacterial chromosome (Katzen, 2007). The
protocol is based on the presence of two essential components: (i)
recombination DNA sequences (att sites) and (ii) enzymes that
catalyse recombination reactions. Hence, to generate this con-
struction, the complete coding sequence of ptxD was amplified
by PCR using Taq DNA polymerase (Invitrogen) (3 min at 94 °C,
1 min at 94 °C, 50 s at 59 °C, 1 min at 72 °C, 7 min at 72 °C
and hold at 4 °C) and the following primers PTXD designed with
attB sites:
PTXDFWattB1 (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCT
AAATGCTGCCGAAACTCGTTATAACTC-3′) PTXDRVattB2 (5′-GG
GGACCACTTTGTACAAGAAAGCTGGGTATCAACATGCGGCAG
GCTC-3′)
Amplified PCR fragment were electrophoresed on a 1%
agarose/TAE gel and purified using GFXTM PCR DNA and a Gel
Band Purification kit (illustraTM GE Healthcare, Buckinghamshire,
UK) following the manufacturer’s instructions. The resulting ptxD
amplification fragment was subcloned into a pGEM-T Easy vector
(Promega) following the manufacturer’s instructions. Six clones
were selected and analysed by restriction analysis and PCRs to
ensure the presence of the desired gene, all of which were
positive by both assays.

One clone was selected to perform the BP recombination
reaction to introduce the ptxD gene into the pDONR221 donor
vector. The BP reaction is catalysed by the BP Clonase II enzyme
mix, which transfers the DNA fragment of interest, flanked by the
attB sites, into a donor vector carrying two attP sites, resulting in
an entry clone (pENTR) flanked by two attL sites. Six clones were
selected and analysed by restriction analysis and PCRs to ensure
the presence of the desired gene, all of which were positive by
both assays. Subsequently, one entry clone was selected to
perform the LR recombination reaction using the pB7WG2D
destination vector, which is catalysed by the LR Clonase II enzyme
mix, which transfers the DNA fragment of interest, flanked by
two attL sites (in the entry clone) into a destination vector carrying
two attR sites, resulting in an expression clone. Transformation of
E. coli with this product resulted in six positive clones containing
the ptxD gene placed under the control of the CaMV 35S
constitutive promoter and terminator. One clone was selected to
genetically transform the desired plants.
The pB7WG2D::PTXD expression vector was introduced by
electroporation to Agrobacterium tumefaciens strain GPV2260
and used to produce Arabidopsis thaliana (ptxDAt) and tobacco
(ptxDNt) transgenic lines. Transformation of Agrobacterium was
performed in a BioRad MicroPulser electroporator with the pre-
programmed settings for A. tumefaciens (2.20 kV, 1 pulse). After
transformation, 400 lL of YEB medium was added to the cells
and then incubated at 28 °C with shaking for 1.5 h. Electropo-
rated Agrobacterium cells were plated on YEB plates with
antibiotics and grown at 28 °C for 2 days. To verify the presence
of the ptxD gene, colony PCR was performed on 10 colonies. All
colonies analysed were PCR positive, and one was selected for use
in the transformation of plants.
Transformation of Arabidopsis and in vitro selection
of transformant seedlings
ptxDAt lines were generated using a modified floral dip transfor-
mation protocol (Martinez-Trujillo et al., 2004). An Agrobacte-
rium strain harbouring the pB7WG2D::PTXD expression vector
was inoculated in 5 mL of YEB medium supplemented with
carbenicillin, rifampicin and spectinomycin at 100 mg/L each and
grown to the stationary stage (OD600 approximately 2.0) at 28 °C
with shaking at 250 rpm. Then, Agrobacterium cells were
harvested from the liquid medium by centrifugation (4 °C and
5 min at 13 400 9 g) and washed twice with 0.1X MS with 5%
sucrose. The bacterial pellet was then resuspended in infiltration
medium consisting of 0.1X MS, 5% sucrose and 0.05% Silwett L-
77 (GE, Silicones) to the desired density (OD600 from 0.8 to 2.0).
This suspension was dropped onto all unopened floral buds with a
micropipette to infect them. Infected plants were kept at high
humidity under a dark plastic bag for 10 h. The inoculation
procedure was repeated 8–10 times every two days.
Pool seeds (T0) produced by infected plants were collected and
screened for resistant seedlings according to the resistant marker
of the construct. To select Arabidopsis transgenic plants, two
types of experiments were conducted: (i) using phosphinothricin
as the selective agent and (ii) using Phi as the selective agent and
P source. Disinfected seeds were sown on sterile growth solid
medium supplemented with either 20 mg/L phosphinothricin or
potassium phosphite at different concentrations. When Phi was
used as the selectable agent, potassium phosphate monobasic
(KH2PO4), the P source in standard media, was replaced with
potassium phosphite monobasic (KH2PO3) from Wanjie Interna-
tional (CAS No. 13977-65-6).
ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525
Phosphite oxidoreductase as a selectable marker 523
Transformation of tobacco and regeneration of
plantlets
To transform Nicotiana tabacum L. cv Xanthi, the basic steps of
the leaf disc transformation method (Horsch, 1985) were used.
Tobacco leaves were cut into small segments (0.7–1 cm2) and
cocultivated with the Agrobacterium culture harbouring the
pB7WG2D::PTXD expression vector under darkness and a con-
trolled temperature of 28 °C for 2 days. After this time, explants
were washed at least three times with sterile-deionized water and
one time with cefotaxime (500 mg/L) and blotted on sterilized
filter paper to eliminate excess solution. Explants were then
transferred to selection medium (1X MS, 30 g/L sucrose, 2 mg/L
BAP, 100 mg/L cefotaxime, 2.5 g/L Gelrite, pH 5.7) supple-
mented with Phi (1 mM) as the sole P source. Explants were
subcultured in fresh medium every 2–3 weeks. After 8–9 weeks
under selective conditions, the regenerated shoots were excised
from explants and cultured on MS containing Phi (1 mM) with no
plant regulators. The successful growth of all lines in Phi-
containing media confirmed that all were capable of using Phi
as a P source. The presence and expression of the CaMV 35S::
PTXD fusion were confirmed in eighty-one and eight randomly
selected lines by genomic PCR and qRT-PCR, respectively.
For cocultivation, the Agrobacterium strain harbouring the
pB7WG2D::PTXD was previously grown at 28 °C (250 rpm) for
two days in 5 mL liquid YEB medium (Sambrook et al., 1989)
supplemented with carbenicillin, spectinomycin and rifampicin
(100 mg/L each), harvested by centrifugation (4 °C and 5 min at
13 400 9 g) and suspended in 1X MS liquid medium.
Selection of Arabidopsis and tobacco transformants
under greenhouse conditions
For tobacco selection, a mixture of transgenic and WT seeds was
directly sown on a mixture of sand and vermiculite (1 : 1), which
was amended with Pi or Phi at 80 or 120 mg/kg and periodically
irrigated with MS 0.1X lacking Pi or only irrigated with 0.1X MS
containing 1 mM Pi or Phi. In the case of Arabidopsis, T0 seeds
were directly sown on mixture of sand and vermiculite (1 : 1) and
treated as above. Seeds were covered with a plastic lid to avoid
excessive loss of water.
Analysis of the presence of the ptxD gene by PCR and
Southern blot analysis
Genomic DNA was extracted from complete plantlets using the
CTAB method (cetyltrimethylammonium bromide) and cleaned
using Durapore membranes (MSGVN2250, Millipore) according
to the manufacturer’s instructions.
For genomic PCR analysis, 100–200 ng of total genomic DNA was
used to amplify the complete pxtD coding region using standard
amplification conditions (3 min at 94 °C, 1 min at 94 °C, 50 s at
59 °C, 30 s at 72 °C, 7 min at 72 °C and hold at 4 °C) and the
following primers: PTXDFW (5′-ATGCTGCCGAAACTCGTTATAA
CTC-3′) and PTXDRV (5′-TCAACATGCGGCAGGCTC-3′). PCR
products were electrophoresed in 1% agarose/TAE gels and
observed under UV light.
For Southern blot hybridization analysis, 15 lg of total DNA
was digested with EcoRI restriction enzyme (Invitrogen), sepa-
rated on a 1% agarose/TAE gel and capillary blotted onto a
Hybond-N+ nylon membrane (Amersham Pharmacia Biotech).
Nucleic acids were covalently fixed to the nylon membrane using
a UV cross-linker. A probe corresponding to the first 400 bp of
the ptxD gene (Figure S3), starting from the atg and generated by
524 Damar L. Lo
pez-Arredondo and Luis Herrera-Estrella
PCR using the following PTXDRT primers (3 min 94 °C, 1 min
94 °C, 50 s 59 °C, 30 s 72 °C, 7 min 72 °C, and hold at 4 °C),
was used for the hybridization experiments: PTXDRTFW (5′-AT
GCTGCCGAAACTCGTTATAACTC-3′) and PTXDRTRV (5′-CTGCA
AGCGATCAGCCATG-3′).
The probe was purified on a 1% agarose/TAE gel, processed
using the GENECLEAN kit (MPBIO) and radiolabelled with [32P]
using the Random Primer DNA Labelling System (Invitrogen)
according to the manufacturer’s specifications. Membranes were
blocked using a 5X Denhardt’s-based solution, hybridized with
the ptxD probe and washed according to standard protocols.
Membranes were visualized by phosphor imaging on a Storm 840
Phosphor Imaging System (Molecular Dynamics, Sunnyvale, CA).
Analysis of the expression of the ptxD gene by real-time
PCR
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad,
CA) and Qiagen RNA easy columns (Invitrogen). Real-time PCR of
the ptxD gene (PTXDRT primers) was performed in an ABI PRISM
7500 real-time thermocycler (Applied Biosystems), and reactions
for Arabidopsis Actin 2 (ACT2 primers) and tobacco ActinNt
(ACTINNT primers) were utilized for normalization.
ACT2FW 5′- ATATGGCATCATACCTTCTACAACGAGCTTCGTG-3′
ACT2RV 5′- ATATGGCATCATACCTTCTACAACGAGCTTCGTG-3′
ACTINNTFW 5′- ATATGGCATCATACCTTCTACAACGAGCTTCGTG-′3
ACTINNTRV 5′- ATCCAACACAATACCAGTTGTACGACCACTAG-′3
The relative quantification (RQ) number for each independent
transgenic line was obtained from the equation 2 DDCT, where
DDCт represents the subtraction of the CT value of internal
control from the CT value of the ptxD gene (PTXDRT primers)
(DCT(PTXD)–DCT(ACTIN)). DCT was calculated using the equa-
tion [CT(ptxD)*E] - [CT(ACTIN)*E], where E is the PCR efficiency
[(10( 1/m)) 1] (Livak and Schmittgen, 2001). Expression levels
were obtained from at least three technical replicates.
Statistical analysis
The T2 progeny of independent Arabidopsis lines, selected using
the ptxD/Phi system, was sown and germinated in Phi-containing
media. 10 days after germination, the number of resistant and
nonresistant seedlings in segregational analysis was evaluated
using the chi-squared test (P < 0.05). Transformation frequencies
obtained in Phi and PPT selection experiments were subjected
statistical analysis using ANOVA and Tukey’s tests (P < 0.05).
Acknowledgements
We thank Jose Luis Cabrera and Marco Antonio Leyva for technical
support; Enrique Ibarra Laclette for Real-time PCR analysis;
Vero
nica Limones for assistance in tobacco transformation; and
Erika Alba for the propagation of plants in the greenhouse. We are
grateful to William Metcalf for providing plasmid pWM302. This
work was supported in part by a grant from the Howard Hughes
Medical Institute (Grant 55005946) to L.H-E. DLLA is indebted to
CONACyT, M
exico for a PhD fellowship (No. 203571).
References


Avila, F.W., Faquin, V., Araujo, J.L., Marques, D.J., Junior, P.M.R., da Silva
Lobato, A.K., Ramos, S.J. and Baliza, D.P. (2011) Phosphite supply affects
ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525
phosphorus nutrition and biochemical responses in maize plants. Aust J Crop
Sci 5, 646–653.
Carswell, M.C., Grant, B.R., Theodorou, M.E., Harris, L., Niere, J.O. and Plaxton,
W.C. (1996) The fungicide phosphonate disrupts the phosphate-starvation
response in Brassica nigra seedlings. Plant Physiol. 110, 105–110.
Carswell, M.C., Grant, B.R. and Plaxton, W.C. (1997) Disruption of the
phosphate-starvation response of Oilseed rape suspension cells by the
fungicide Phosphonate. Planta 203, 67–74.
Daniell, H., Muthukumar, B. and Lee, S.B. (2001) Marker free transgenic plants:
engineering the chloroplast genome without the use of antibiotic selection.
Curr. Genet. 39, 109–116.
€rster, H., Adaskaveg, J.E., Kim, D.H. and Stanghellini, M.E. (1998) Effect of
Fo
phosphite on Tomato and Pepper plants and on susceptibility of Pepper to
Phytophthora root and Crown rot in hydroponic culture. Plant Dis. 82,
1165–1170.
Garcia-Costas, A.M., White, A.K. and Metcalf, W.W. (2001) Purification and
characterization of a novel phosphorous-oxidizing enzyme from
Pseudomonas stutzeri WM88. J. Biol. Chem. 276, 17429–17436.
Haldrup, A., Petersen, S.G. and Okkels, F.T. (1998) Positive selection: a plant
selection principle based on xylose isomerase, an enzyme used in the food
industry. Plant Cell Rep. 18, 76–81.
Horsch, R.B. (1985) A simple and general method for transferring genes into
plants. Science 227, 1229.
Joersbo, M., Donaldson, I., Kreiberg, J., Petersen, S.G. and Brunstedt, J. (1998)
Analysis of mannose selection used for transformation of sugar beet. Mol.
Breeding 4, 111–117.
Katzen, F. (2007) Gateway recombinational cloning: a biological operating
system. Expert Opin. Drug Discov. 2, 571–589.
Kunze, I., Ebneth, M., Heim, U., Geiger, M., Sonnewald, U. and Herbers, K.
(2001) 2-Deoxyglucose resistance: a novel selection marker for plant
transformation. Mol. Breeding 7, 221–227.
Leymand, B., Avonce, N., Ramon, M., Van Dijck, P., Iturriaga, G. and Thevelein,
J.M. (2006) Trehalose-6-phosphate synthase as an intrinsic selection marker
for plant transformation. J. Biotechnol. 121, 309–317.
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data
using Real-Time Quantitative PCR and the 2[-Delta Delta C(T)] method.
Methods 25, 202–208.

pez-Arredondo, D.L. and Herrera-Estrella, L. (2012) Engineering phosphoros
Lo
metabolism in plants to produce a dual fertilization and weed control system.
Nat. Biotechnol. 30, 889–893.
Martinez-Trujillo, M., Limones-Briones, V., Cabrera-Ponce, J.L. and Herrera-
Estrella, L. (2004) Improving transformation efficiency of Arabidopsis thaliana
by modifying the flora-dip method. Plant Mol. Biol. Rep. 22, 63–70.
McDonald, A.E., Grant, R.G. and Plaxton, W.C. (2001) Phosphite (phosphorous
acid): its relevance in the environment and agriculture and influence on plant
phosphate starvation response. J. Plant Nutr. 24, 1505–1519.
Miki, B. and McHugh, S. (2004) Selectable marker genes in transgenic plants:
applications, alternatives and biosafety. J. Biotechnol. 107, 193–232.
Moor, U., Poldma, P., Tonutare, T., Karp, K., Starast, M. and Vool, E. (2009)
Effect of phosphite fertilization on growth, yield and fruit composition of
strawberries. Sci. Hortc. 119, 264–269.
Ouimette, D.G. and Coffey, M.D. (1990) Symplastic entry and phloem
translocation of phosphonate. Pestic. Biochem. Physiol. 38, 18–25.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning:
A Laboratory Manual, 3rd ed. Cold Spring Harbor: Cold Spring Harbor
Laboratory Press.
Schroetter, S., Angeles-Wedler, D., Kreuzig, R. and Schnug, E. (2006) Effects of
phosphite on phosphorus supply and growth of corn (Zea mays).
Landbauforsch Vo€lkenrode 56, 87–99.
Thao, H.B.T., Yamakawa, T., Shibata, K., Sarr, P.S. and Myint, A.K. (2008)
Growth response of komatsuna (Brassica rapa var peruvirids) to root and
foliar applications of phosphite. Plant Soil. 308, 1–10.
Ticconi, C.A., Delatorre, C.A. and Abel, S. (2001) Attenuation of phosphate
starvation responses by phosphite in Arabidopsis. Plant Physiol. 127, 963–
972.
Varadarajan, D.K., Karthikeyan, A.S., Matilda, P.D. and Raghothama, K.G. (2002)
Phosphite, an analogue of phosphate, suppresses the coordinated expression
of genes under phosphate starvation. Plant Physiol. 129, 1232–1240.

White, A.K. and Metcalf, W.W. (2004) The htx and ptx operons of
Pseudomonas stutzeri WM88 are new members of the Pho regulon.
J. Bacteriol. 186, 5876–5882.
White, A.K. and Metcalf, W.W. (2007) Microbial metabolism of reduced
phosphorus compounds. Annu. Rev. Microbiol. 61, 379–400.
Zhang, W.-J., Yang, S.-S., Shen, X.-Y., Jin, Y.-S., Zhao, H.-J. and Wang, T.
(2009) The salt tolerance gene rstB can be used as a selectable marker in
plant genetic transformation. Mol. Breeding 23, 269–277.
Supporting information
Additional Supporting information may be found in the online
version of this article:
Figure S1 Expression levels of ptxD gene in Arabidopsis trans-
genic lines.
Figure S2 Evaluation of the sensitivity of Arabidopsis transgenic
plants to phosphite on liquid media.
ª 2013 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd, Plant Biotechnology Journal, 11, 516–525
Phosphite oxidoreductase as a selectable marker 525
Figure S3 Schematic representation of the construct designed to
express the ptxD gene under control of CaMV 35S promoter.
Figure S4 Selection of Arabidopsis transformants using the ptxD
gene as a selectable marker and different concentrations of Phi as
selectable agent.
Figure S5 Amplification of the ptxD gene in T1 Arabidopsis
thaliana transformants.
Figure S6 Phenotype of transgenic tobacco plants.
Figure S7 Presence of the ptxD gene in T1 tobacco transfor-
mants.
Figure S8 Selection of Arabidopsis and tobacco transformants
under greenhouse conditions using the ptxD/Phi system.
Table S1 The T2 progeny of Arabidopsis independent lines,
selected using the ptxD/Phi system, was sown and germinated in
Phi-containing media.