Journal of Investigative and Clinical Dentistry (2017), 8, e12189

ORIGINAL ARTICLE
Oral Microbiology

Significant increase of oral bacteria in the early pregnancy

period in Japanese women
Natsumi Fujiwara1, Keiko Tsuruda1, Yuko Iwamoto1, Fuminori Kato1, Teruko Odaki2,
Nobuko Yamane2, Yuriko Hori2, Yuka Harashima3, Ayako Sakoda3, Akira Tagaya4,
Hitoshi Komatsuzawa5, Motoyuki Sugai1 & Mayumi Noguchi6
1 Department of Bacteriology, Hiroshima University Graduate School of Biomedical Sciences, Hiroshima, Japan
2 Hiroshima City Asa Hospital, Hiroshima, Japan
3 Japanese Red Cross Hiroshima College of Nursing, Hiroshima, Japan
4 Nagano College of Nursing, Nagano, Japan
5 Department of Oral Microbiology, Kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima, Japan
6 Department of Maternity Nursing, Japanese Red Cross Toyota College of Nursing, Toyota, Japan

Keywords
Candida species, development, oral
microbiota, periodontal pathogens,
pregnancy.
Correspondence
Dr M. Sugai, Department of Bacteology,
Hiroshima University, 1-2-3 Kasumi, Minami-
Ku, Hiroshima 734-8551, Japan.
Tel: +81-82-257-5635
Fax: +81-82-257-5639
Email: sugai@hiroshima-u.ac.jp
Received 10 April 2015; accepted 30 June
2015.
doi: 10.1111/jicd.12189
Abstract
Aim: Oral microflora during pregnancy is critical to oral health care in the
mother and her child. We examined the changes in the oral microbiota
between pregnancy and nonpregnancy periods.
Methods: The study was performed using 132 healthy pregnant women
enrolled from Hiroshima City Asa Citizens Hospital and 51 healthy nonpreg-
nant women as control. During pregnancy, 132 subjects were assessed for seven
microbial species by the cultured method and polymerase chain reaction at the
early (7–16 weeks gestation), the middle (17–28 weeks), and the late (29–
39 weeks) pregnancy periods. Pregnant women completed a series of question-
naires regarding oral and systemic health and lifestyle habits.
Results: The total cultivable microbial counts in the early pregnancy were sig-
nificantly higher than that of the nonpregnant women (P < 0.05). The inci-
dences of Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans
in gingival sulcus during the early and middle pregnancy were significantly
higher than the nonpregnant group (P < 0.05), while Prevotella intermedia and
Fusobacterium nucleatum did not change. Candida species were more frequently
detected during the middle and late pregnancy.
Conclusion: The data suggest that pregnancy, especially in the early periods,
promotes the proliferation of microorganisms in the oral cavity and facilitates
a colonization of periodontal pathogens.

been reported.4 Epidemiological studies have demon-

Introduction
In Japan, the low birth rate is becoming a major social
issue. This trend has further emphasized the importance
of health control of women during pregnancy for a safe
delivery, and recent attention has focused on oral health
care during pregnancy.1–3
An association between oral diseases such as
periodontitis and gingivitis and systemic diseases has
strated that periodontal disease is associated with
increased risk of preterm birth and low birth weight,5
and that maternal periodontal disease and disease pro-
gression during pregnancy conferred a significantly
increased risk for preterm birth.6,7 Therefore, it has
been recognized that dental health care as well as gen-
eral health care during pregnancy is required for preg-
nant women.

ª 2015 Wiley Publishing Asia Pty Ltd 1 of 8

Oral microbial development in pregnancy
Early studies have raised the possibility that
lipopolysaccharides (LPS) from Gram-negative periodon-
topathic bacteria such as Porphyromonas gingivalis
increase local inflammatory mediators including PGE2,
and that these mediators stimulate systemic inflammatory
mediators which can lead to preterm birth.4 The female
hormones also stimulate prostaglandin production in the
gingiva when exposed to the LPS from periodontal patho-
gens.8 Increased levels of circulating prostaglandins caused
by periodontitis are suggested to invoke labor, thus caus-
ing premature delivery.4
Regarding oral health care during pregnancy, the effi-
cacy of periodontal treatment in pregnancy for prevention
of preterm birth and adverse pregnancy outcomes remains
controversial. Han9 reviewed that during the intervention
phase, a few small-scale, single-center studies reported
improvement of birth outcome following periodontal
treatment, whereas the large-scale multicenter studies did
not demonstrate efficacy. Problems with regard to patient
population, disease type, and therapy were also pointed
out. Han et al.10 also demonstrated the first human evi-
dence that Fusobacterium nucleatum originated from the
mother’s subgingival plaque and translocated to the pla-
centa and fetus, causing acute inflammation leading to the
fetal demise. Thus, knowing the mother’s microbiota in
oral cavity during pregnancy is important for designating
effective oral treatment based on etiological agent and a
safe delivery. We determined the change in oral micro-
biota during pregnancy, with special attention to the sys-
temic disease associated pathogens and subgingival
periodontal pathogens in Japanese women. Further, we
determined whether the risk factors for smoking and for
late childbearing women affect the microbiota.
Material and methods
Subjects
One hundred thirty-two healthy pregnant women (mean
age 28.9
6.4 years) who were at the early phase of their
pregnancy were recruited from the obstetrics clinic of
Hiroshima City Asa Hospital, and 51 healthy nonpreg-
nant women (mean age 28.0
8.0 years) participated as
volunteers for this study. The pregnant women were
examined three times during pregnancy. Briefly, the first
visit was at 7–16 weeks gestation (early pregnancy), next
at 17–28 weeks (middle pregnancy), and the final at 29–
39 weeks (late pregnancy). Nonpregnant women were also
examined at the start of the experiment. All participants
received information concerning the purpose of the study
and provided informed consent before participation. The
subjects had not received oral treatment or antibiotic
therapy during the previous 3 months. This study was
2 of 8
N. Fujiwara et al.
performed according to the rules of the Ethics Committee
of The Japanese Red Cross Hiroshima College of Nursing.
Thirty-four of 132 subjects were lost to follow-up in this
study. Thus, 98 subjects remained at the end of the fol-
low-up period.
Recording of maternal characteristics
Self-reported questionnaires were utilized at a baseline
examination to obtain information on oral health features
such as bleeding around the teeth, frequency of oral
hygiene practices including tooth brushing, and lifestyle
behavior including smoking and drinking. The gingival
bleeding in 6 months before pregnancy and since becoming
pregnant were ascertained by self-certification using forced
choice questions. Medical history such as hypertension and
diabetes and maternal characteristics including age, body
mass index, and employment status were also gained.
Collection of microbial samples
Samples of subgingival plaque were taken with paper
points from each woman. Supragingival plaque was
removed from the mandibular first molar with sterile cot-
ton rolls, and three paper points (GC Inc., Tokyo, Japan)
were inserted into the subgingival crevice. They were
placed in tubes of 1 mL Tris/EDTA buffer, and then a
saliva sample was taken. Whole unstimulated saliva was
collected by expectoration for 5 min into a sterile plastic
tube. The subgingival plaque samples were dispersed
using vortex for 30 sec, and then stored at 20°C until
used for polymerase chain reaction (PCR).
Culture procedures
The saliva samples were ten-fold serially diluted in phos-
phate buffered aline (PBS), and then an aliquot of 0.1 mL
of the appropriate dilutions was placed on 5% sheep
blood agar plates supplemented with Hemin and vitamin
K for enumeration of the total anaerobic bacterial count.
Samples were also plated onto staphylococci medium No.
110 plates (Nissui, Tokyo, Japan) for the selective isola-
tion and enumeration of Staphylococcus aureus, Mitis Sali-
varius Agar (Becton, Dickinson and Co., Franklin Lakes,
NJ, USA) plates for the selective isolation and enumera-
tion of oral streptococci, and selective Candida GE agar
(Nissui) plates for the detection and enumeration of Can-
dida species. The plates except for culture of Candida
spp. were incubated at 37°C in anaerobic jars for
3–5 days. Candida GE plates were incubated at 37°C aer-
obically for 3–5 days. The numbers of bacteria and fungi
were measured by counting the colony-forming unit
(CFU) on the cultured plates.
ª 2015 Wiley Publishing Asia Pty Ltd
N. Fujiwara et al. Oral microbial development in pregnancy

Microbial identification by PCR Table 2. General characteristics of pregnant women (N = 132) at

first visit
The subgingival plaque and the saliva samples were used
Characteristics
for PCR amplification with the species-specific primer Age (years) 28.9
6.4
pairs based on 16S ribosomal RNA. The sequences of the Body mass index (kg/m2) 20.9
3.4
primers used in this study are shown in Table 1. Their Brushing times per day (%)
specificities and sensitivities for the target organisms have Once 14.0
been reported previously.11 The PCR amplification was Twice 57.8
carried out in a thermo-cycler (Applied Biosystems, Fos- Three times or more 28.1
Gingival bleeding status (the status before pregnancy, %)
ter, CA, USA) and the amplification products were ana-
Never 46.4 (35.2)
lyzed using electrophoresis with a 2% agarose gel: then Rarely 29.6 (39.2)
stained with ethidium bromide and photographed in Sometimes 19.2 (24.8)
ultraviolet. Frequently 4.8 (0.8)
Tooth mobility (the status before pregnancy, %)
Never 97.6 (93.6)
Statistical analysis Rarely 1.6 (4.0)
Sometimes 0.8 (2.4)
Statistical analysis was performed using the StatView 5.0 Frequently 0 (0)
software package (SAS Institute Inc., Cary, NC, USA). Pus discharge of gingiva (the status before pregnancy, %)
Pregnant women were divided into three subsets of the Never 100 (99.9)
gestational stage. One-way ANOVA with Fisher’s post-hoc Rarely 0 (0.1)
Sometimes 0 (0)
least significant difference (PLSD) test was applied to
Frequently 0 (0)
detect differences of bacterial number on cultivable plates Smoking status (%)
and burden of periodontal species. The chi-squared test Never smoked 67.4
was used to compare the frequencies of the periodontal Former smoker 27.1
bacteria during the pregnancy. The significance threshold Current smoker 5.4
was set at 0.05. The data are expressed as the mean value Drinking status (%)
and standard deviation. Abstainer or irregular 52.0
Noncurrent 45.7
Current 2.4
Hypertension 0
Results Diabetes 0.008
Late childbearing (>35 years) (%) 12.1
Profile of pregnant women on self-reported
questionnaire
The general characteristics of the pregnant women at the subjects chose “never”, the 29.6% chose “rarely”, “some-
first visit in this study are presented in Table 2. The preg- times” was indicated by 19.2%, and “frequently” by 4.8%.
nant women in this study had no hypertension and dia- Only 13.6% of the subjects changed from low to higher
betes except for one pregnant woman with diabetes at the frequency when they became pregnant. None of the early
first visit. Of the subjects, 85.9% reported tooth brushing pregnancy subjects reported pus discharge of gingiva, and
twice per day or more. As for the question about the gin- only three subjects (2.4%) felt the mobility of teeth dur-
gival bleeding frequency at tooth brushing: 46.4% of the ing pregnancy.

Table 1. Species-specific primer pairs based

Size
on 16S ribosomal RNA for PCR identification
Target Primer sequence (50 –30 ) (bp) GeneBank

A. actinomycetemcomitans Forward GCTAATACCGCGTAGAGTCGG 445 FN547976

Reverse ATTTCACACCTCACTTAAAGG
P. gingivalis Forward AGGCAGCTTGCCATACTGCG 404 L16492
Reverse ACTGTTAGCAACTACCGATGT
P. intermedia Forward AACGGCATTATGTGCTTGCAC 588 L16468
Reverse CTCAAGTCCGCCAGTTCGCG
F. nucleatum Forward CGTGCCAGCAGCCGCGGTA 627 AJ133496
Reverse AACTTAATGATGGTAACATACGAA

ª 2015 Wiley Publishing Asia Pty Ltd 3 of 8

Oral microbial development in pregnancy N. Fujiwara et al.

(39.4–55.1%) in both pregnant and nonpregnant women

Comparisons of microbiota in pregnant and
nonpregnant women
Seven of 132 pregnant subjects were excluded because of
lack of the cultivable samples at baseline. The ANOVA
revealed a significant difference in total cultivable micro-
bial number between nonpregnant and each stage of preg-
nancy (Table 3). Fisher’s PLSD showed that total
microbial count was significantly higher at the early stage
of pregnancy compared to nonpregnant women. There
were no significant differences in CFU of streptococci,
staphylococci and Candida species (Table 3). As the inci-
dence of Candida species (average 43.6%) was below 50%
in each subject groups, the prevalence of Candida species
was analyzed by using a chi-squared test (Figure 1a). Sig-
nificantly higher prevalence in Candida species was found
in the middle and late pregnancy groups by comparison
with the nonpregnancy group. Regarding the pathogenic-
ity of microbiota in the periodontal crevice, both the
expanse of microbial species as well as the constitution of
microorganisms are important. Thus, the number of peri-
odontal pathogenic species (from 0 to 4) by PCR detec-
tion in pregnant and nonpregnant women was analyzed
(Table 3). The number of periodontal species in late-stage
pregnancy was significantly lower compared to the early
and middle stages of pregnant subjects. Although the
periodontal species tended to expand in the early stage of
pregnancy, it was not significant.
Incidence of periodontal pathogens in oral cavity
The prevalence of four periodontal pathogens was
assessed by PCR detection in saliva and subgingival sam-
ples taken with the paper point. The most commonly
detected species in the subgingival plaque was F. nuclea-
tum (64.9–82.4%) followed by Prevotella intermedia
(Figure 1). In these species, there was no significant dif-
ference between pregnant (early or middle) and nonpreg-
nant women. Interestingly, P. gingivalis (2.0–14.4%) and
Aggregatibacter actinomycetemcomitans (2.0–11.9%) are
less frequent than F. nucleatum and P. intermedia; how-
ever, the prevalence of these bacteria in pregnant women
(except the late group) was significantly higher than in
nonpregnant women (P < 0.05). The frequency of detec-
tion of these species in the saliva was similar to that of
the subgingival plaque.
The putative influence factor for microbiota in
pregnancy
We investigated if there were factors in pregnancy that
affect the oral microbiota mass and population. In
Table 4, the microbial counts and the prevalence are
compared for smokers and nonsmokers in the pregnant
women at the first visit (the early pregnancy). There was
no significant difference between the smokers (including
former smokers) and the nonsmokers. Comparing the
ages of the pregnant women, the incidence of A. actino-
mycetemcomitans in the subjects with late childbearing
(>35) was significantly higher than that of younger preg-
nant women (≤34). However, there was no statistical dif-
ference in other oral bacteria in this study.
Discussion
We provide the microbiological data for maternal oral
health care during pregnancy in this study. We here
demonstrated that the number of cultivable planktonic
microbiota in the saliva during early pregnancy was sig-
nificantly higher compared to that of the nonpregnant
women. However, streptococci, staphylococci, and Can-

Table 3. Oral cultivable bacterial number and burden of periodontal pathogenic species of subgingival plaque in pregnant and non-pregnant sub-
jects

Pregnant women

Nonpregnant Early stage Middle stage Late stage

women (N = 51) (N = 125) (N = 98) (N = 98) P-value*

Salivary bacterial counts on cultured plates (CFU/mL)

Total count (9106) 3.74
4.24 * 15.3
28.7 8.34
7.40 8.16
6.60 0.035
Streptococci (9106) 4.07
4.57 9.10
28.7 6.30
8.41 6.08
6.17 0.469
Staphylococci (9102) 7.10
45.7 30.4
63.8 47.0
141.7 33.7
74.1 0.300
Candida sp. (9102) 0.06
0.11 2.10
11.2 1.70
7.40 0.96
4.30 0.603
Total occurrence of periodontal pathogenic species by PCR detection in subgingival plaque
Number of species (0–4) 1.50
0.81 1.62
1.00 1.52
1.04 1.21
0.91 0.025

Each value represents the mean
SD.

One-way ANOVA: *P < 0.05, Fisher’s PLSD.

4 of 8 ª 2015 Wiley Publishing Asia Pty Ltd

N. Fujiwara et al. Oral microbial development in pregnancy

Figure 1. Prevalence of periodontal path-

ogenic species and cultivable microorganisms
in pregnant and non-pregnant women: (a)
the prevalence (%) of periodontal pathogenic
species and cultivable microorganisms in
saliva; (b) the prevalence (%) of periodontal
pathogenic species in subgingival plaque.
Non, non-pregnant women; early, early
pregnancy; middle, middle pregnancy; late:
late pregnancy; A.a, A. actinomycetemcomi-
tans; P.i, P. intermedia; P.g, P. gingivalis; F.n,
F. nucleatum; Str, streptococci; Sta, staphy-
lococci; Can, Candida species; *, statistically
significant differences as compared to non-
pregnant women (P < 0.05, chi-square test).

dida species in those numbers had no significant changes
among the subject groups, including nonpregnant
women. In the early and middle stage of pregnancy, the
prevalence of P. gingivalis and A. actinomycetemcomitans
significantly increased in comparison with nonpregnant
women. In addition, the prevalence of Candida species
was significantly higher in the middle and late stages of
pregnancy.
Various factors in pregnancy, such as a change in the
physiological condition, may affect bacterial and fungal
numbers, and female hormones have been described as
growth factors to promote the proliferation of multiple
bacterial species such as Lactobacillus, Bifidobacterium,
Streptococcus and Escherichia coli.12 Several studies
reported increases in the proportion of P. intermedia dur-
ing pregnancy.13–16 This increase has been attributed to
the increased female sex hormones substituting for the
naphthoquinones such as vitamin K or menadione
required for the growth of P. intermedia.15 However,
other studies demonstrated no difference in the ratio of
P. intermedia in the subgingival microflora between preg-
nant and nonpregnant women.17,18 Although various
groups have investigated the effects of progesterone and
estrogen on the subgingival microflora during pregnancy,
the results have been inconclusive.19 Here we found no
difference in the prevalence of P. intermedia between
pregnant and nonpregnant women. However, we found
that the incidence of A. actinomycetemcomitans and P. gin-
givalis in subgingival plaque significantly increased during
early and middle pregnancy (P < 0.05), while the corre-

ª 2015 Wiley Publishing Asia Pty Ltd 5 of 8

Oral microbial development in pregnancy N. Fujiwara et al.

sponding prevalence was minimally detected in the non-

F. nucleatum
pregnant women. Recently a cohort study demonstrated

35 (83.3)
74 (85.1)

35 (83.3)
93 (85.3)
0.800

0.800
the proportions of the periodontal pathogens showed no
differences throughout pregnancy, although correlations
were found between maternal hormone levels and P. gingi-

P. intermedia
valis and P. intermedia numbers.20 With the data of Car-

25 (59.5)
52 (59.8)

7 (43.8)
64 (58.7)
rillo-de-Albornoz20 we analyzed the frequency of detection

0.979

0.979
of periodontal pathogens in their study using the chi-
squared analysis. This indicated the frequency of these bac-
teria in pregnant women was higher in comparison to the
P. gingivalis

nonpregnant women. This is in good agreement with our

5 (11.9)
10 (11.5)

2 (12.5)
13 (11.9)
0.946

0.948
findings except for the frequency of P. intermedia. Our
results suggest the physiological changes in pregnancy may
promote a general proliferation of bacteria in the oral cav-
A. actinomycetemcomitans

ity rather than in specific bacterial species, resulting in an

increase in the mass of the oral microbiota. Statistically sig-
nificant high incidences of A. actinomycetemcomitans and
P. gingivalis in the early and middle stages of pregnancy
suggest that this period of pregnancy facilitates the colo-
Prevalence of bacteria‡ (%)

11 (12.6)

5 (31.3)

0.021*

nization of periodontal pathogens.

3 (7.1)

9 (8.3)
0.347

In addition to the presence of specific pathogens, the

significance of total periodontal pathogenic burden as a
factor associated with a systemic disease was
Candida sp.

reported.21,22 Regarding total burden of periodontal spe-

17 (40.5)
35 (40.2)

5 (31.2)
45 (41.3)
0.979

0.444

cies in this study, the subjects in early pregnancy tended

to have a higher burden of periodontal bacterial species
Table 4. Relationships between each oral microorganisms and risk factors in the pregnant women

than the nonpregnant women and other pregnant peri-

Staphylococci

83.2
62.7

67.4
70.9

ods, but that was not statistically significant. Unexpect-

edly, pregnant women in late-stage period had a
36.0

29.5

28.1

32.6

0.912

0.894
(9102)

significant lower burden of these periodontal species

Cultivable microbial number† (CFU/mL)

compared to the early and middle pregnant subjects.

The increasing awareness of oral health care of mothers
16.4
9.50

2.46
12.4
Streptococci

rather than the effects of physiological changes in preg-

9.66

6.20

4.44

7.36

nancy may have caused this result. Further investigation

(9106)

0.118

0.737

is required for oral self-care behavior and awareness of

mothers during pregnancy.
†Each value represents the mean
SD: Mann–Whitney U test.

Both C. albicans and S. aureus are well known as

6.88
4.48
14.6
24.5
11.0
22.0

12.9
24.2
Total count

opportunistic microorganisms. They cause oral com-

0.286

0.888

plaints that are frequently found in women in meno-

(9106)

pause.23 Opportunistic microorganisms are present at low

‡Difference determined using the chi-squared test.

levels in the normal healthy oral cavity, whereas these

opportunists increase in number during compromised
Nonsmoker (N = 87)

conditions such as immune-compromised subjects.24,25 In

*Yates’ continuity correction (P < 0.05).
Smoker (N = 42)

>35 (N = 109)

our study, the levels of the number and the incidence of

≤35 (N = 16)

Candida species in nonpregnant women were low

Category

P-value

P-value

(Table 3). In contrast, the prevalence of Candida species

during middle and late pregnancy were significantly
higher compared to nonpregnant women. These findings
Late child-bearing

suggest that pregnancy may promote the colonization of

Candida species in the oral environment. Candida species
Risk factor

is considered to be an etiological agent in vaginitis, a

Smoking

common medical problem in women.26 Estrogens have

age

been described to promote Candida infection, enhancing

6 of 8 ª 2015 Wiley Publishing Asia Pty Ltd

N. Fujiwara et al. Oral microbial development in pregnancy

the ability of Candida to adhere to vaginal epithelial
cells.27 Vulvovaginal candidiasis occurs more frequently in
pregnant women and is one of the causes of preterm
birth.28 It may also be important to pay attention to the
existence of Candida species in the oral cavity during
pregnancy, especially the late period.
Our results indicated that the early stage of pregnancy
is a critical period in which to intervene to improve oral
health. Since smoking and late childbearing that are gen-
erally regarded as risk factors for pregnancy29,30 did not
affect the oral microbiota during pregnancy, physiological
changes of pregnancy might be responsible for quantita-
tive microbiological increase in early pregnancy. American
guidelines on oral health during pregnancy and early
childhood31 states that preventive services should be pro-
vided as early in pregnancy as possible, and that primary
prevention including measures to avoid infection and col-
onization of cariogenic Streptococcus mutans and sobrinus
is an important strategy as preventive care during preg-
nancy.32 Our results indicated that adequate plaque con-
trol including professional tooth cleaning in the early
stage of pregnancy is important for establishing a healthy
oral environment and preventing oral and systemic health
problems of woman in oral health care during pregnancy.
Furthermore, the results of this study showed that it is
also necessary to avoid infection and colonization of peri-
odontal pathogenic species as well as cariogenic species in
this period.
In conclusion, our study demonstrates the level of total
bacteria was significantly elevated in early stage of preg-
nancy. The incidence of A. actinomycetemcomitans and
P. gingivalis were also significantly higher in the early
pregnancy period. The data suggest that a physiological
change in early pregnancy has a significant impact on the
bacterial mass in the oral cavity, and may promote the
colonization of various microorganisms, especially peri-
odontal pathogens, that may be a risk factor for the
health of pregnant women.
Acknowledgments
We thank Naomi Saeki, Fumie Yamane, Sachiko Naka-
gawa, and Sonoko Sugai for their technical assistance. This
study was supported in part by Grants-in-Aid for Scientific
Research (B) #18390596 (M.N.) from Japan Society for the
Promotion of Science.
Conflict of interest
The authors declare no conflicts of interest.

nancy outcomes in a cohort of preg- amplification with the polymerase

References
1 Boggess KA, Urlaub DM, Moos MK,
Polinkovsky M, El-Khorazaty J, Lorenz
C. Knowledge and beliefs regarding
oral health among pregnant women. J
Am Dent Assoc 2011; 40: 399–402.
2 Hashim R, Akbar M. Gynecologist’s
knowledge and attitudes regarding
oral health and periodontal disease
leading to adverse pregnancy out-
comes. J Int Soc Prev Community Dent
2014; 4: S166–72.
3 Vamos CA, Walsh ML, Thompson E,
Daley EM, Detman L, DeBate R.
Oral-systemic health during preg-
nancy: exploring prenatall and oral
health providers’ information, motiva-
tion and behavioral skills. Matern
Child Health J 2015; 19: 1263–75.
4 Kim J, Amar S. Periodontal disease
and systemic conditions: a bidirec-
tional relationship. Odontology 2006;
94: 10–21.
5 Alchalabi HA, AlHabashneh R, Jabali
OA, Khader YS. Association between
periodontal disease and adverse preg-
nant women in Jordan. Clin Exp
Obstet Gynecol 2013; 40: 399–402.
6 Offenbacher S, Boggess KA, Murtha
AP et al. Progressive periodontal dis-
ease and risk of very preterm delivery.
Obstet Gynecol 2006; 107: 29–36.
7 Offenbacher S, Lieff S, Boggess KA
et al. Maternal periodontitis and pre-
maturity. Part I: obstetric outcome of
prematurity and growth restriction.
Ann Periodontol 2001; 6: 164–74.
8 Elatter TM. Prostaglandin E2 in
human gingiva in health and disease
and its stimulation by female sex ster-
oids. Prostaglandins 1976; 11: 331–41.
9 Han YW. Oral health and adverse
pregnancy outcomes – what’s next? J
Dent Res 2011; 90: 289–93.
10 Han YW, Fardini Y, Chen C et al.
Term stillbirth caused by oral Fu-
sobacterium nucleatum. Obstet Gynecol
2010; 115: 442–5.
11 Slots J, Ashimoto A, Flynn MJ, Li G,
Chen C. Detection of putative peri-
odontal pathogens in subgingival
specimens by 16S ribosomal DNA
chain reaction. Clin Infect Dis 1995;
20(Suppl 2): S304–7.
12 Pelzer ES, Allan JA, Theodor-
opopoulos C, Ross T, Beagley KW,
Knox CL. Hormone-dependent bacte-
rial growth, persistence and biofilm
formation – a pilot study investigat-
ing human follicular fluid collected
during IVF cycles. PLoS One 2012; 7:
e49965.
13 Jensen J. The effect of female sex hor-
mones on subgingival plaque. J Peri-
odontol 1981; 52: 599–602.
14 Kornman KS, Loesche WJ. The subgin-
gival microbial flora during pregnancy.
J Periodontal Res 1980; 15: 111–22.
15 Kornman KS, Loesche WJ. Effects of
estradiol and progesterone on Bac-
teroides melaninogenicus and Bac-
teroides gingivalis. Infect Immun 1982;
35: 256–63.
16 Raber-Durlacher JE, van Steenbergen
TJ, Van der Velden U, de Graaff J,
Abraham-Inpijn L. Experimental gin-
givitis during pregnancy and post-
partum: clinical, endocrinological,

ª 2015 Wiley Publishing Asia Pty Ltd 7 of 8

Oral microbial development in pregnancy
and microbiological aspects. J Clin
Periodontol 1994; 21: 549–58.
17 G€ursoy M, Haraldsson G, Hyv€ onen M,
Sorsa T, Pajukanta R, K€ on€
onen E.
Does the frequency of Prevotella inter-
media increase during pregnancy? Oral
Microbiol Immunol 2009; 24: 299–303.
18 Jonsson R, Howland BE, Bowden
GH. Relationships between periodon-
tal health, salivary steroids, and Bac-
teroides intermedius in males,
pregnant and non-pregnant women. J
Dent Res 1988; 67: 1062–9.
19 Kumar PS. Sex and the subgingival
microbe: do female sex steroids affect
periodontal bacteria? Periodontol 2000
2013; 61: 103–24.
20 Carrillo-de-Albornoz A, Figuero E,
Herrera D, Bascones-Martınez A.
Gingival changes during pregnancy:
II. Influence of hormonal variations
on the subgingival biofilm. J Clin
Periodontol 2010; 37: 230–40.
21 Spahr A, Klein E, Khuseyinova N
et al. Periodontal infections and coro-
nary heart disease: role of periodontal
bacteria and importance of total
pathogen burden in the Coronary
Event and Periodontal Disease (COR-
ODONT) study. Arch Intern Med
2006; 166: 554–9.
8 of 8
22 Andriankaja O, Trevisan M, Falkner K
et al. Association between periodontal
pathogens and risk of nonfatal
myocardial infarction. Community
Dent Oral Epidemiol 2011; 39: 177–85.
23 Scala A, Checchi L, Montevecchi M,
Marini I, Giamberardino MA. Update
on burning mouth syndrome: over-
view and patient management. Crit
Rev Oral Biol Med 2003; 14: 275–91.
24 Dahlen G, Blomquist S, Carlen A. A
retrospective study on the microbiol-
ogy in patients with oral complaints
and oral mucosal lesions. Oral Dis
2009; 15: 265–72.
25 Smith AJ, Jackson MS, Bagg J. The
ecology of Staphylococcus species in
the oral cavity. J Med Microbiol 2001;
50: 940–6.
26 Sobel JD. Epidemiology and patho-
genesis of recurrent vulvovaginal can-
didiasis. Am J Obstet Gynecol 1985;
152: 924–35.
27 Carr PL, Felsenstein D, Friedman RH.
Evaluation and management of
vaginitis. J Gen Intern Med 1998; 13:
335–46.
28 Oleszczuk JJ, Keith LG. Vaginal infec-
tion: prophylaxis and perinatal out-
come – a review of the literature. Int
N. Fujiwara et al.
J Fertil Womens Med 2000; 45: 358–
67.
29 Bonzini M, Coggon D, Palmer KT.
Risk of prematurity, low birthweight
and pre-eclampsia in relation to
working hours and physical activities:
a systematic review. Occup Environ
Med 2007; 64: 228–43.
30 Africa CW. Oral colonization of
Gram-negative anaerobes as a risk
factor for preterm delivery. Virulence
2011; 2: 498–508.
31 CDA Foundation. Oral health during
pregnancy and early childhood: evi-
dence-based guidelines for health
professionals. 2010. [cited 1 Aug
2010]. Available from: http://
www.aapd.org/library/docs/
poh_guidelines.pdf.
32 G€unay H, Dmoch-Bockhorn K,
G€unay Y, Geurtsen W. Effect on
caries experience of a long-term
preventive program for mothers
and children starting during preg-
nancy. Clin Oral Investig 1998; 2:
137–42.
ª 2015 Wiley Publishing Asia Pty Ltd