Professional Documents
Culture Documents
Kindergarten Handbook PDF
Kindergarten Handbook PDF
Dramat Writi
h ic ng
Healt s Math
Movement Blocks
Rea
usic din
Social Studie M g
s es
iv
c i e nc e ulat
gy
S
an ip
T echno lo M
Art r acy
Fiel Lit e
Cooking d Trip
s
T im e
Sen c le ch
sor C ir Wo rk b e n
y
-----Art
-----Health
-----Language Arts
-----Math
-----Music
-----Physical Education
-----Science
-----Social Studies
-----Technology
Environment - “The Learning Context”
Creating the learning context:
-----Teacher’s Role
-----Characteristics of the Five-Year-Old
-----Materials Inventory: Basic Requirements
-----Student Supply List
-----Room Arrangement
-----Classroom Management
-----First Days of Kindergarten
-----Daily Schedule
-----Kindergarten Registration
-----Mailing Information
-----Orientations
-----Home Visits
-----Parent Night/Open House
-----Volunteers
-----Conferences
-----Newsletters
-----Frequently Asked Questions
-----Teacher Resources
-----Anecdotal Records
-----Assessing Readiness for First Grade
-----The Multiple Disciplinary Team
Black-line Masters
Materials for:
-----Kindergarten Registration
-----Kindergarten Orientation
-----Parent Teacher Conferences
-----Kindergarten Assessment
Learning Processes
“How Children Learn”
What is a developmental kindergarten?
A developmental kindergarten program does not mean that teachers aren’t teaching and
that children control the classroom. A good developmental kindergarten program is a highly
organized and structured environment that teachers have carefully prepared and in which
teachers are in control.
A developmental kindergarten program does not reject curriculum goals and objectives in
favor of child-driven curriculum. All quality kindergarten programs have clearly stated
objectives toward which the teacher plans and works with children to achieve. The difference in
a developmental classroom is that those goals are appropriate for children’s age levels and
individual patterns of learning and development; respectful of their needs and interests; and
addresses all areas of human functioning, not just narrowly defined basic skills.
A child in a developmental kindergarten program does not just “play” all day. Yes, play
is important and essential for children to develop high-level social strategies and other important
learning. However, the kindergarten teacher must know why, when, and how they can help play
become an enriching, meaningful learning experience, and they must also know what
experiences and specific strategies children need to reach their learning potential.
Finally, creating a quality, developmental kindergarten program is not about how to get
ready for first grade. Kindergarten is about laying the foundation for all learning that is to come
thereafter. Developmental teachers believe that the foundations of any subject may be taught to
any child, at any age, in some form. As the curriculum develops, these basic concepts are
revisited and built upon until children grasp them fully. Just as the hierarchical nature of these
concepts makes it impossible to develop them fully in any one grade level, the developmental
kindergarten teacher knows that they also can’t be developed in one narrow
area of the curriculum.
Laying this foundation for learning in kindergarten is about integration. The kindergarten
curriculum cannot be pigeonholed into the traditional math, reading and writing categories.
Even though concepts from the traditional categories are taught every day, they are so
interrelated that they are hard for the untrained eye to distinguish one from another.
Kindergarten is an experience and the curriculum, therefore, must provide those experiences.
Since a kindergartner learns best when interacting with his environment, this integration
becomes the books and workbooks of a kindergarten curriculum.
How do theoretical perspectives on development
and learning relate to kindergarten?
All teachers have a belief system whether explicit or implicit, about how children learn
and what they should be learning, that guides and influences their practice. Theories are useful
because they help teachers understand why they do what they do and explain why something
happens. There are many theories of learning and development that explain various phenomena.
Some theories, such as those developed by Piaget (1952), Erikson (1963) and Vygotsky(1978)
are more comprehensive and explanatory, and therefore, may be more useful to kindergarten
teachers than others. It is these theories that inform this document.
Erikson (1963) describes two stages of development for kindergarten-age children. The
Initiative vs. Guilt stage (preschool years) is a period of interest, active exploration and readiness
for learning. Children in this stage need to express their natural curiosity and creativity through
opportunities to act on the environment. The Industry vs. Inferiority stage (school age years) is
characterized for children by a readiness for the challenge of new and exciting ideas and of
constructing things. Children in this stage need opportunities for physical, intellectual, and
social accomplishment with many and varied interactions with materials. Success and a feeling
of “I can do it” result in a sense of industry.
Vygotsky (1978) also provides a useful framework for categorizing, and therefore
understanding, the nature of knowledge. He distinguishes spontaneous concepts are those that
the child discovers through direct experience. School-related or scientific concepts originate in
the culture and represent the body of knowledge from past generations.
Aside from studying developmental theory, teachers can also help students by assessing
and understanding their present level of development. By using Bloom’s Taxonomy, a teacher
can determine the child’s depth of understanding, and than make appropriate evaluations and
form clearer, more specific educational goals. Since development occurs in stages from simple
to complex, Bloom’s Taxonomy helps show the hierarchy of thought, expression from
convergent to divergent thinking; the goal being to move students from the basic recall and
memorization of material to the level of evaluation.
Teachers can use the following levels of learning to perform evaluations:
By using these categories, teachers can design more effective and comprehensive
curriculum and evaluative instruments for children at various levels of cognitive growth.
The goals for a kindergarten program should address all domains - emotional, social,
cognitive and physical and should attend to the development of desirable attitudes and
dispositions, skills and processes, knowledge and understanding. Following is a goal statement
for the developmental kindergarten program. The child will:
! Develop a positive self-concept and attitude toward learning, self-control, and a sense of
belonging;
! Develop curiosity about the world, confidence as a learner, creativity and imagination, and
personal initiative;
! Develop relationships of mutual trust and respect with adults and peers, understand
perspectives of other people, and negotiate and apply rules of group living;
! Understand and respect social and cultural diversity - know about the community and social
roles;
! Use language to communicate effectively and to facilitate thinking and learning;
! Become literate individuals who gain satisfaction, as well as information, from reading and
writing;
! Represent ideas and feelings through pretend play, drama, dance and movement, music, art
and construction;
! Think critically, reason, and solve problems;
! Construct understanding of relationships among objects, people, and events, such as
classifying, ordering, number, space, and time;
! Construct knowledge of the physical world, manipulate objects for desired effects and
understand cause-and-effect relationships;
! Acquire knowledge of and appreciation for the fine arts, humanities, and sciences;
! Become competent in management of their bodies and acquire basic physical skills, both
gross motor and fine motor; and
! Gain knowledge about the care of their bodies and maintain a desirable level of health and
fitness.
The curriculum objectives should be based on the best knowledge of theory, research,
and practice about how children develop and learn, with attention given to the individual needs
and interests in a group in relation to the kindergarten program goals.
The theory of Multiple Intelligences, developed by Howard Gardner, recognizes that children
learn and excel in many different ways. All children excel in one or more of the following eight
intelligences:
! Verbal-Linguistics: Children will excel with words, rhymes and word meanings.
! Logical- mathematical: Students will excel with numerical patterns, reasoning, and logical
thinking.
! Musical: Children will excel with pitch, rhythm, and self-expression through music.
! Bodily Kinesthetic: Children will excel at gross and fine motor activities.
! Spatial: Children will excel in artistic efforts.
! Naturalist: Students will excel at noticing, and making distinctions about animal and plant
life.
! Interpersonal: Children will excel at getting along with others. They will show respect and
understanding of the thoughts, moods, and feelings of the people around them.
! Intrapersonal: Students will excel at understanding their own personal feelings and will use
their feelings to guide their behavior.
Multiple Intelligences fit nicely into a development program because this kind of program
strives to acknowledge the different ways in which students learn and excel. Learning centers
can meet the needs of all learners if the eight Multiple Intelligences are considered in the
development of centers. Examples of how Multiple Intelligences may fit into centers are listed
here:
The Art Center- The art center allows children to show what they know and express
their feelings through their art work. This center builds the Spatial, Interpersonal, and
Intrapersonal Intelligences.
The Block Center- This center allows children to use and develop their Bodily
Kinesthetic and Spatial Intelligence as they use gross motor skills to build structures.
Planning with other children requires them to use their Verbal-Linguistic and
Interpersonal intelligences.
The Dramatic Play Center- This center uses and develops children’s Interpersonal and
Verbal-Linguistic Intelligences as children interact and role-play with one another.
Students also use Bodily-Kinesthetic Intelligence as they move through space.
The Writing Center- Students who enjoy expressing themselves in writing will be using
and developing their Intrapersonal Intelligence.
! Art
! Health
! Language Arts
! Math
! Music
! Physical Education
! Science
! Social Studies
! Technology
Art
Art can become a means of communication for the kindergarten child. The art
objectives in a developmental kindergarten are devoted to this freedom of expression.
This flexibility allows the teacher to design strategies to meet art objectives that can
apply to almost all other areas of the curriculum. As learning takes place, there should
always be an art form available to children to enhance and help demonstrate mastery of a
skill. That skill may involve discoveries in science, health concepts, writing, social
studies, dramatic play or music.
Art Objectives
The student will be able to:
Health Objectives
The student will be able to:
Reading
Phonemic Awareness:
$ identify and/or name two or more words that rhyme through completion, production
and recognition activities
$ orally segment sentences into words, syllables into sounds and words into syllables
and/or sounds
$ orally blend phonemes into words
Phonics:
$ recognize names of upper and lower case letters
$ associate letters to letter sounds
$ identify beginning, ending and middle letters in a word
Reading Strategies:
$ engage personal schema to discuss, generate questions and predict outcomes
$ use picture, pattern and beginning letter sound to identify words and gain meaning
from text
$ use environmental print to locate sources for finding words
Comprehension:
$ offer relevant background information during pre-reading and demonstrate
understanding of vocabulary during post-discussion
$ identify and retell a story with the elements of character, setting, event sequence and
plot resolution
$ determine cause and effect relationships with “why”, “how” and “what if” questions
$ distinguish between fiction/nonfiction and real/pretend
Writing
$ demonstrate understanding and application of steps of writing process
$ write legibly and develop vocabulary
$ apply rules and conventions for grammar, punctuation, capitalization and spelling
$ develop and present a written narrative composition with a picture and simple
sentence that supports a central idea or is for personal and practical needs
Listening
$ listen to gain enrichment and information about various cultures
$ listen and appropriately respond to a variety of electronic and live presentations
$ listen to literature presentations from a variety of media including group assemblies
$ listen for specific information and to follow verbal directions
Speaking
$ develop awareness of speaker and audience behaviors including posture, articulation,
volume and use of complete sentences and organization
$ orally share known literature through various presentations and activities
$ express opinions and solve problems while exhibiting courteous, attentive and
appropriate behavior
Viewing
$ develop an awareness of various media
$ demonstrate understanding of main idea from various media sources
$ compare two media that present the same story
Math
The math program in a developmental kindergarten is manipulative-based.
Concepts are developed from the concrete, to the symbolic, and, finally, to the abstract
level. However, many opportunities exist to facilitate learning in the following
mathematical objectives. Cooking activities provide opportunities for explorations of
weights, measurement, volume and temperature. Block-building experiences develop
problem solving skills like sorting and comparing. The workbench center can facilitate
learning in number concepts and estimation. And finally, activities involving the
scientific inquiry process utilize math concepts like counting, addition and subtraction
and evaluating the reasonableness of answer.
Mathematics Objectives
The student will be able to:
Music Objectives
The student will be able to:
Science Objectives
The student will be able to:
1. brainstorming questions
2. conducting scientific observations
3. using scientific tools to gather data (magnifying glasses, tweezers, eyedroppers,
scales, magnets and human “tools” - the 5 senses)
4. exploring data and evidence
5. making predictions
6. exploring alternative solutions
7. communicating scientific observations
Technology Objectives
The student will be able to:
@ identify basic software icons
@ use technology to create a piece for publication including; typing own name, typing a
simple sentence and printing and illustrating personal writing
@ view instruction through the use of a TV to P.C. connection to gain knowledge of
appropriate use of software
@ demonstrate an understanding of the basic operation of computer hardware
@ demonstrate the appropriate care of computer hardware and software
@ demonstrate knowledge of the use of the keyboard
@ use appropriate vocabulary to identify the parts of a computer including; monitor,
printer, processor, keyboard, mouse, mouse pad, modem, memory, floppy disk and
hard disks
@ demonstrate knowledge of the use of click-n-drag and left/right mouse buttons
@ demonstrate starting a program from an icon
@ demonstrate shrinking/expanding and opening/closing a window
@ use appropriate technology vocabulary including; cursor, program, software and
hardware
@ understand and follow instructions given in various formats (graphic, audio)
Environment
“Creating the Learning Context”
Environment
! Teachers Role
! Characteristics of the
Five-Year-Old
! Material Inventory:
Basic Requirements
! Student Supply List
! Room Arrangement
! Classroom Management
! First Day Schedule
! Daily Kindergarten Schedule
Teacher’s Role
The role of the teacher in the kindergarten classroom offers three equally
important and often simultaneous responsibilities -- teaching, administering and
counseling. These responsibilities cannot always be separated, but the effective teacher
must incorporate all three skills.
The teacher:
# shares knowledge and information.
# listens, questions, and interacts with individuals, small groups and large groups
each day.
# responds to the child’s interest.
# evaluates progress in all areas -- emotional, social, physical and cognitive.
# exercises authority necessary to sustain the work and play life of the class.
# identifies needs and arranges for special services.
# creates an atmosphere of mutual respect and trust.
5 1/2 years - the child begins to become brash and combative in some
behaviors as if at war with themselves and the world; one
minute it’s “I love you”, the next minute it’s “you stink”
6 years - the child is smoothing out; regrouping, leveling off but may
burst into tears and appear unsure
Basic Requirements
Furniture:
# shelving units (2) on casters
# tables (8) as follows; rectangle (1) kidney (1) round (4) square/trapezoid (2)
# chairs (at least 30), lightweight
# reading loft (if space allows) or small child-sized couch/pillows
# book rack (1)
# big book holder/storage (1)
# woodworking bench
# cubbies (1) with cubbyholes for 25
# letter sorter unit (1) with compartments for 30 or more
# paint easel (1) with storage shelves
# pegboard room dividers (2)
# store front/stage unit (1)
# child-sized stove, fridge, sink unit (hardwood)
# child-sized table (1) and chairs (2)
# hinged shelving unit (1) for block storage
# sensory table
Equipment:
# hardwood unit blocks (1/2 school set)
# hollow blocks (basic set)
# networked computers for electronic education (3) with printer
# stand-alone computer with printer (1)
# listening center; headphones (4)/ cassette player
# CD player/cassette/recorder
# woodworking tools (basic set)
# globe
Materials:
# puzzles (6-20 piece) wooden/foam with rack
# toy cash register
# toy dishes/utensils (set for 4)
# basic plastic food set
# dolls (2)
# open-ended material sets (3) i.e. Duplos, Kiddie Links, Flexiblocks, etc.
# beads and strings (1 set)
# pegs and pegboards (1 set)
# self-help; dolls, frames or boxes (1)
# sewing cards (1 set)
# action play set (1) i.e. Playmobile, Fisher/Price etc.
# flannel/wipe-off/magnetic board
# felt cut-outs, magnetic letters/numbers (1 set each)
# board games (3) i.e. Lotto, Candyland. Chutes and Ladders, etc.
# rhythm instruments (1 class set)
# paint cups with lids, brushes (8)
# art carousel (1); tabletop lazy-susan type
# magnet set (1)
# magnifying glasses (4)
# class thermometer (1)
# domino set (1)
# classroom set; unifix cubes, pattern blocks, wooden inch cubes
# balance scale (1)
# hardwood vehicles (4)
# magnifier on stand (1)
Kindergarten Supply List
There are certain basic supplies that may be requested from each kindergarten
child to supplement the educational offering in the classroom.
$ 2 - #2 lead pencils
$ 1 - box of crayons
$ 2 - 4 oz. bottles of white glue
$ 1 – set of water-base felt markers
$ Consumable items assigned to a portion of the class; like paper towels, napkins or
facial tissues
Other items may be included that are unique to a specific classroom and may not
exceed a predetermined cost.
(Due to the developmental approach of kindergarten, school supplies may be pooled for use in learning centers.)
Required Items:
1. 2- #2 lead pencils.
2. Box of crayons, 16 or fewer (more colors than this do not contribute to the
kindergarten curriculum).
3. 2 - 4 oz. bottles white school glue (orange cap recommended).
4. Set of water-base felt markers.
5. Paper towels, napkins of facial tissue (to be assigned by teacher at home visit).
THE FOLLOWING ARE ITEMS WHICH MAY BE REQUIRED BY YOUR CHILD’S
TEACHER AND ARE NOT TO EXCEED A TOTAL COST OF $3.00.
6. _________________________________________________________________
7. _________________________________________________________________
8. _________________________________________________________________
9. _________________________________________________________________
Note: Backpack, book bag or other appropriate alternative is recommended.
% For the Kindergarten Curriculum Food Unit, parents may contribute $5.00 per
semester or send ingredients.
% In addition to the Food Unit, some kindergarten teachers have daily snacks. You
may receive more information from your child’s teacher regarding this.
% From time to time, you may be asked to make small donations to help your
school provide culturally enriching programs and field trips.
Because the backbone of the kindergarten program centers around first-hand experiences,
the room and its contents must be arranged with a sense of order and purpose. With good
organization, the teacher can spend a maximum amount of time and energy interacting with
children and a minimum in housekeeping and disciplining. Important considerations
include;
Young children need to be active and learn most effectively when they are in motion.
The kindergarten day should include at least 45 minutes during which the children are free to
choose activities and to move around the classroom as their interests’ dictate. Providing a
range of activities at varying levels of difficulty and projects with complex and simple
aspects enables each child to find those areas of interest that motivate free and active
participation in the learning process. The ideal learning situation is one, in which the
activities are so enjoyable that the learner considers them both work and play. Providing a
classroom rich in learning experiences will discourage wandering and disruptive behavior.
Choice is important but kindergartners feel more secure when they are able to make
choices within a structured daily schedule. The schedule may be seen as framing and
crisscrossing the day. Although they need to choose and practice socially acceptable ways
of communicating, they are overwhelmed by too much choice. The teacher should state
firmly what is not allowed, what is expected, and be consistent.
The teacher should solicit the children’s input in determining those rules, standards
and guidelines for the kindergarten classroom. This may be done in several ways. During
the first weeks of school the teacher may conduct a class meeting or discussion to brainstorm
possible general guidelines. Or the teacher may wish to develop the standards as they arise;
in the introduction of a new activity or after a problem area has been identified. Whatever
the method, the children’s ideas are important to consider and by allowing them to
contribute to the process, they are more likely to follow the guidelines and live up to the
standards they have helped establish.
The five-year-old is in the process of developing moral structure. Adults with whom
the child relates can contribute to this development in important ways. Modeling warm,
calm, respectful behavior is imperative. Some teachers find it helpful to circulate during free
choice time, supporting purposeful behavior, being sensitive to children’s signals, and
making positive contact as a child works. As children become more secure and familiar with
the classroom rules and begin to relate to one another in positive ways the teacher may be
able to focus energies to a specific center in order to help a small group with a project.
Learning to function in socially acceptable ways is a basic part of the kindergarten
curriculum and should not take a back seat to skills development. During free choice time
children are learning many democratic skills, building leadership and cooperative strategies,
and learning initiative and independence. Guidance will be necessary, usually in the form of
providing a safe, secure environment in which children can work through conflicts
themselves in an atmosphere of protection. Children need to interact with each other in a
noncoercive, nonauthoritarian atmosphere in order to decenter and become aware of
different points of view. They need experience dealing with other children without
excessive adult intervention.
# The teacher should foster a relationship of caring and mutual respect, in every
instance.
# The teacher should avoid sanctioning the child’s behavior if possible and instead,
help the child focus on the problem and allow the child to choose behavior that is
more appropriate.
# The teacher should apply sanctions when necessary and use logical or natural
consequences, such as removing a child to a quiet, isolated area.
# The teacher should strive to build empathy and ask the child to consider the effect
of their actions toward another.
# If the problem continues to surface and becomes particularly frustrating or of
concern the teacher should ask for assistance and advice. There are master
teachers and specialists in every school environment and who may be willing to
conduct an informal observation in the classroom and their feedback may be
invaluable.
First Days of Kindergarten
Responsibilities for the teacher for the first days of kindergarten include organizing,
preparing and planning.
While parents are busy with the checklist, the kindergarten teacher is free to greet
incoming parents and children. As the children finish the checklist, the teacher may gather
them in a large group area for a story. This will give latecomers a chance to finish and will
also signal to parents that school has begun and it is time for them to leave. It is best to
downplay tears and scenes of separation anxiety. (So just give mom a tissue and tell her
good-bye!)
The first priority for a new group of kindergartners is to learn the classroom routine.
An established routine provides a safe, comfortable and predictable environment for the
early learner. The teacher should strive to establish this routine, starting with the first day.
Wait to introduce the children to specialist classes like PE, music and library. Ask that
ancillary personnel wait until after at least the first week to do assessments, screenings and
health check-ups. These activities can be very disruptive and are performed much more
efficiently once a classroom routine is established and both the teacher and students are more
comfortable.
The schedule for the first day should loosely follow the pattern of a typical
kindergarten day and include; opening activities, small group work, free choice/center time,
recess and closing activities. By following this pattern, even in a very general way, the
teacher will provide a basic blueprint for the learning environment. The following is an
example of a breakdown, day by day, of the activities to be included in the first week.
Day One
~ Introduce calendar activities and the signal for “attention to teacher”
~ Introduce and model the care and use of items in the manipulative/game area
~ Small group activities with manipulatives
~ Tour of school facility, ending with recess
~ Closing activities; including story, songs and discussion
Day Two
~ Review calendar, manipulative area rules and signal bell
~ Introduce/model use of dramatic play and block center
~ Choice time; using manipulatives, dramatic play, blocks
~ Recess; introduce outdoor equipment rules
~ Closing activities; discussion of classroom standards/guidelines
Day Three
~ Calendar/review
~ Introduce/model use of art center, easels, reading loft/area
~ Choice time; with all the centers/activities introduced to date
~ Recess; introduce outdoor equipment rules
~ Closing activities; discussion of classroom standards/guidelines
Day Four
~ Calendar/review
~ Introduce/model use of library center, writing table, computers
~ Choice time; reviewing center limits
~ Recess; introduce some outside group games i.e. tetherball, hopscotch
~ Closing activities
Day Five
~ Calendar/opening activities
~ Introduce; any other centers or small group activities
~ Choice time; teacher circulates to monitor and evaluate activity
~ Recess
~ Closing activities
By Day Five, the majority of the classroom procedures, policies and routines have
been introduced. By introducing the kindergarten program in this staggered fashion, the
teacher is establishing a solid foundation upon which to build future learning. The investment
the teacher makes in introducing these routines and procedures in an appropriate, clear and
consistent manner will result in never-ending benefits throughout the entire school year.
Daily Kindergarten Schedule
The daily schedule serves as a framework around which each teacher plans the day.
However, all of the hours in the kindergarten day may not be the teacher’s to plan. If the use
of the gym or library or the services of a specialist are available, those times may be
scheduled according to a master school-wide schedule. There are, however, certain elements
of the schedule that should be part of every school day. They include: Opening/Closing
Activities, Small Group Activities, Centers/Free Choice Activities and Recess/Outside Play.
The following is a very general description of an annotated kindergarten daily schedule.
Schedules may include the same elements but in completely different arrangements.
Kindergarten teachers who are assigned two sessions per day have special considerations.
The morning and afternoon schedules should follow the same pattern and every effort should
be made to schedule specialist’s times at the same point in the sequence of the sessions. Due
to the length of the kindergarten day, scheduling two specialist’s times on the same day
should be avoided. Also, it is recommended that at least one day per week should be
provided that is without any specialist’s times or outside interruptions. This will allow an
opportunity for the kindergarten teacher to plan more comprehensive activities that develop
naturally for the children.
Environment
Kindergarten Registration
Mailing Information
Kindergarten Orientation
Kindergarten Booklet
Home Visits
Open House
Parent Night
Volunteers in Kindergarten
Parent/Teacher Conferences
Newsletters
Frequently Asked Questions/
Comments
Kindergarten Registration
Many schools offer an Open House or Kindergarten Registration day in the Spring
for prospective kindergartners. At this event, parents can formally register their child,
verify birth certificates and immunization records and briefly visit a kindergarten teacher
and classroom. For many families, this may be their first introduction to public education
and is an important opportunity to begin to establish those home/school connections. The
following is a list of types of information that may be included in the parent packet at the
time of registration.
The (insert name) School office is open during the week from 8:00
a.m. to 4:00 p.m. Please do not hesitate to call with any questions you may
have.
Sincerely,
(Signature)
Principal
SAMPLE SUPPLY LIST
Attention Parents: This list represents the supplies your child needs for a good school year
beginning. However, these items may need to be replenished occasionally.
Required Items:
1. Package of pencils.
2. Box of crayons.
3. 1 Bottle of white school glue (orange cap recommended).
4. Set of water-base felt markers.
5. Paper towels, napkins, or facial tissue (to be assigned by teacher.)
6. 2 Glue sticks.
THE FOLLOWING ARE ITEMS WHICH MAY BE REQUIRED BY YOUR CHILD'S TEACHER AND
ARE NOT TO EXCEED A TOTAL COST OF $3.00:
Tissues A-L
7. _________________________________________________________
Ziplock Baggies M-Z
8. ______________________________________________________
Stickers-seasonal
9. _________________________________________________________
________________________________________ Date:_______________________
Note: Backpack, book bag, or other appropriate alternative for kindergarten is recommended.
· For the Kindergarten Curriculum Food Unit, parents may contribute $5.00 per semester or send
ingredients.
· In addition to the Food Unit, some kindergarten teachers have daily snacks. You may receive more
information from your child's teacher regarding this.
· From time to time, you may be asked to make small donations to help your school
provide culturally enriching programs and field trips.
· S.O.S.: Sharing Of Supplies by purchasing extras and leaving them at the Principal's
office will help children less fortunate.
This list will be reviewed during the 2007 - 2008 school year and input will be welcomed.
SAMPLE CALENDAR
Adults Only
School Cafeteria
7 p.m.
Dear ___________________
It’s almost time for school to begin. The room is ready but very empty. It
needs you and the other children to make it lively and interesting. Jessi, the
mouse, and Goldie and Charlie, the fish have been at my house all summer.
They will be glad to see you, too. Some blocks are on the shelf, the paints
are mixed, the reading loft is tidy, the kitchen is set up in the dramatics area,
the puzzles and manipulatives are on the shelf, the sand table is aired, the play
dough is made. What will you choose to do? I have had a pleasant summer
doing the things I like to do best – visiting with family and friends, reading,
sewing, working in the yard, traveling. I even rode on a jet once. I do look
forward to hearing about your Summer. We will make a graph of your
favorite activity.
Sincerely,
SAMPLE OF MAILED INFORMATION SHEET
Welcome to Kindergarten
::
TIME:
We will have (2) classes of kindergarten this year, each 2 ¾ hours long.
REGULAR ATTENDANCE: ::
To get the most benefit from the kindergarten program it is vital that your child
attend regularly. If you know they will be absent for several days please call
me at home.
COMMUNICABLE ILLNESSES:
Notify me should your child develop chicken pox, mumps, measles, pink eye, impetigo,
etc. Be sure to keep your child home if they have a bad cold or cough, has a fever or has
vomited during the night or morning.
BIRTHDAYS:::
These are very special days to the children. We honor the child in a simple way in school.
::
CLOTHING:
Because your child is very active the clothing they wear should be simple and
comfortable. Children need to be able to move freely when they are crawling on the floor,
working with blocks, cars, fire engines. Kindergarten is not the place for “best” clothes.
Rather, think of kindergarten as being a place where knee patches are a way of life.
FIELD TRIPS:::
In order to provide for the most effective teaching environment, planned field trips and
excursions outside the school area will be taken from time to time. Once in a while we
will go as a large group, thus you may receive a notice of a trip at a different time than
your child’s regular class time. I hope this will not cause you any inconvenience because
these trips are important to the child.
COOKING:::
We will try to provide a variety of cooking experiences throughout the year. From time
to time we will be asking you to donate ingredients for our projects.
::
NOTICES:
Please try to read all notices your child brings home from school. They will contain
information that you may wish to mark on your calendar.
I am looking forward to a great year. Please feel free to call me at home or as school
whenever you have any questions or concerns.
_________________________________________ ___________________________
Teacher Home Phone
Kindergarten Orientation
Many teachers have found that an Orientation before or just after Home Visits has
proven to be very valuable in helping families become familiar with the school building,
school procedures, rules, the kindergarten program, and to help the child feel more secure
by having parents in the room during that first contact.
The following is one idea for conducting an orientation prior to the start of
school. The plan described is for one hour in length with both children and parents in
attendance.
Parents can do these activities while the teacher is working with the children;
• introduce themselves to each other
• read general hand-out
• sign volunteer list
• complete home visit schedule
While the children are on the tour or recess, the parents and the teacher may;
• go over information handouts
• discuss any other pertinent “housekeeping” items
• answer questions
Dear________________
Our opening days will be different than those of the first through sixth grades. We would
like you to come to an orientation just for kindergarten.
Parents need to come for just the orientation where we will talk about the “nuts and
bolts” of kindergarten; including supplies and home visit schedule. If the appointed times are
inconvenient, feel free to call me at home.
Sincerely,
Home Visits
For five-year olds who may never have been away from home before, the plunge
into an institutional setting is frightening -- even more traumatic for some. The transition
can be more comfortable for the child if the child can meet the teacher at home, where
the child has the security of family and familiar surroundings.
School and teachers are something the child has heard about, but does not know
or understand. Through the home visit the “teacher” will become a real, warm person
whom the child wants to know, like, and have as a friend. Consequently, that first day of
school will be something to look forward to with a sense of curiosity and yet a feeling of
security.
Home visits also provide a basis for a good parent-teacher relationship. Again the
teacher is discovered to be a person and not just a name associated with an institution.
This is an opportunity to establish a rapport with the parents, which will be the
foundation for a good feeling about their child’s school experience.
Another significant benefit of the home visit is the opportunity for informal
assessment. This gives the teacher an opportunity to work individually with each child in
a relaxed, comfortable atmosphere. This time should not be perceived as an opportunity
to “test” the child. However, the information gained from this meeting may enable the
teacher to provide a more meaningful program that meets the needs of each student.
The examples and suggestions here are just some of the things a kindergarten
teacher might do or take on a home visit conducted prior to the first day of school.
The teacher may use the home visit as an opportunity to gather information. The
information collected might include:
· a signed permission slip for field trips
· a sign-up calendar for classroom volunteers
· a list of people willing to serve as room parents
· a survey form to gather health history, strengths/weaknesses, personal
information,
· parental goals, etc. (see forms in black-line masters)
Open House
The teacher may schedule a kindergarten parent night separate from an open
house. Different from the traditional back-to-school night that is usually scheduled for an
entire school, the parent night would be specifically designed to inform parents about
kindergarten.
The parent would be an active participant in the night’s agenda, role-playing the
part of a student in the classroom. Parents could ask questions concerning class schedule
and curriculum, but would be encouraged to avoid trying to confer with the teacher about
individual student progress.
SAMPLE OF ACTIVITY SHEET FOR PARENT NIGHT
Tonight you will be observing and participating in some of the activities your child does in our
classroom. This will be a unique opportunity for you to learn how children learn. You will be
challenged and, I hope, enthused about this educational year for your child. Enjoy this experience
as you relive your early school experiences.
The following activities can be done in any order. Do not waste time; try to finish by ______.
Find your child’s name card on the teacher’s desk and place it in the “Glad You’re Here”
chart on the door.
Paint a picture on the easel or make something from clay at the clay table.
What is the title of the story in the listening center under the reading loft:
_______________________________________________________________
Find your child’s birthday cake (under the clock). Which month has the most birthdays?
________________ Which month has the least birthdays?__________________
Take a look in the “Kinder Store” center. Answer and do the following:
How many “sections” does the store have?_____________(frozen food, produce,
non- food, etc).
What is your favorite food in the produce section?_________________________________
What is the unbelievable price of eggs at the “Kinder Store”._______________________
Go out in the hall to the Numeral Boxes. Try at least two approaches to writing a numeral.
Write down the title of one of the books found in the reading loft that interests you.
_______________________________________________________________________
Count the number of cylinder blocks in the block center._________________________
Introduce yourself to at least one person you do not know.
Find a jack-o-lantern or a “spooky tree” in the hall that your child painted.
Describe one of the activities on the small manipulative game shelves that looks like fun to
you (shelves near the teacher’s desk).
Make a pattern with two different types of materials from the math tubs (math tubs are on the
tables in the hall).
Choose one Workjob in the hall and place six of the counters on a game board.
Find a Workbox in the hall. Open the lid and follow the directions written there.
Good work!
Volunteers in Kindergarten
The ways in which parents can be utilized as volunteers in the classroom are
applicable to a variety of situations. The following lists give examples of ways
volunteers can be used in the kindergarten classroom. They are grouped in two ways
either as specialists or as aides in the classroom. They are grouped in two ways either as
specialists or as aides in the classroom. The volunteer specialist may not be available to
help on a regular basis but still represents a valuable resource as an “expert” in a
particular field. The volunteer aide is directly involved with individual students or small
groups on a regular basis and can lighten the burden of individualization for the
kindergarten teacher.
Language
Arts storytelling
poetry
journalism
Many schools choose to set up conferences school-wide. The teacher should set
up the remaining appointment and follow with notification of the scheduled time to
parents. The teacher should indicate that all parents are being invited, not just those who
have problems and inform parents how long the conference will last. It is advisable to
schedule an easy conference first, if possible.
The following are some factors to consider in preparing for the conference:
Save samples of the student’s work during the period preceding the conference. The
materials should be from all phases of schoolwork including art, writing, assessments,
etc.
Fill out the conference information sheet for each student well in advance. Decide
the strong points and weak points you wish to discuss so that you will be sure items
are covered during the conference. Reports given to parents should be neatly and
correctly written.
In cases where the service of a specialist has been used, include that person in the
conference or have a report to be used during the conference.
If the teacher desires that the parent help at home in overcoming some specific
educational deficiencies on the part of the child, special directions should be prepared
in advance for the parent to follow.
It is advisable to carefully screen ideas and items you wish to cover in each
conference and keep them to a minimum. To attempt to cover too much will tend to
decrease the value of the interview. It takes considerable thought to determine what
is most essential, due consideration being given to the time element involved.
An “over-prepared” conference is always more successful than those with inadequate
preparation.
Classrooms and conference areas should be decorated with children’s work and
displays. Parents’ first impressions about the room environment may directly
influence their conference behavior.
The day of conferences, arrange for early-arriving parents to sit outside the
classroom, and possibly have a table with reading materials to look at including
student journals and class books.
The teacher may want to prepare some information to be sent home for the parent to
read prior to coming to school for the conference.
The Conference:
1. The teacher’s appearance and attitude are of primary importance. Many parents
see the teacher very little except at the time of the conference. A well poised,
well-groomed individual is in a favorable position. The impression the parents
carry away may have lasting influence.
2. The teacher’s greeting should be friendly and relaxed. If hurried or tense, the
parent will know it. It is difficult to discuss a problem with someone who looks
as if they wished you were not there, or would soon leave. Always begin and end
the conference with a positive statement about the child.
3. Listen and then listen some more. The teacher did not invite the parents in to
deliver a lecture, but to get, as well as to give, help. Encourage the parents to talk,
and then listen to what they have to say.
4. No conference can be a success unless there is a two-way flow of information.
The whole concept of conference reporting is based on the assumption that parent
and teacher know aspects of the child’s growth and development that, when
shared, will result in better education for the student.
5. Remember that parents are warm, human, and do care for their children. If you
are anxious, feel threatened or are defensive, the natural human interactive
relationship will be lost.
6. Be accepting. That is, accept anything the parents tell you without showing
surprise or disapproval. If the teacher cannot do this, they will not get an honest
picture of the parents’ attitudes and feelings.
7. If parents insist on revealing intimate family relationships that you do not care to
hear, make every effort to get the conversation back on the subject of the student’s
education. However, if parents insist on continuing, about all you can do is to
remain noncommittal.
8. Do not get ahead of the parents’ thinking. In other words, the teacher should not
try to push thoughts onto parents before they are ready to see it through a process
of discussion and mutual thinking.
9. Find out how parents are thinking and feeling about the child. This is important,
because the teacher cannot understand the child’s behavior until the parent’s
attitude is understood.
10. Most parents cannot be objective about their own children. Therefore, do not
criticize either directly or indirectly. Criticism is fatal to the building of a
cooperative relationship.
11. It is better not to assume that a parent wants help or advice. Such an assumption
usually brings resistance, because it implies a form of criticism.
12. If parents are worried about the child’s behavior, follow through. Find out why
they are worried. The teacher should not assume to know why. The teacher and
the parents may not feel the same way about the child.
13. If parents give reasons for a child’s behavior, accept the reasons and lead the
discussion on to the consideration of other possible causes. Behavior is the result
of many causative factors, not of one.
14. If parents suggest a plan of action, accept it if at all possible. It is better for
parents to try it than for the teacher to force a plan or action. One of the goals in
parent counseling is to try to get parents to take the initiative. If the parents’ plan
fails, it is always possible to suggest others that may strike nearer to the root of
the difficulty.
15. If the parents cannot suggest reasons for a child’s behavior, or plans of action to
deal with it, the teacher might suggest alternatives for joint consideration. This
might be a possibility – “What do you think? You know all the facts of the
situation better than I do” or “We might try this and see what happens. It may
take us awhile to find the source of the difficulty.” Such an approach makes the
parents participators in the final decision for tentative plans and leads to
discussion that helps parents to accept the plan as their own.
16. The teacher should be ready to recognize problems beyond the scope of a
teacher’s competence. Parents with complex emotional problems should be
referred to the consulting psychologist or guidance specialist on the staff.
17. Avoid giving direct advice when parents give a statement of a problem and then
lean back, and say, “Tell me what to do.” Let any advice or suggestions grow out
of mutual discussion and a growing insight on the part of parents into the reasons
for the behavior.
SAMPLE of NEWSLETTER - #1
Dear Parents,
January was certainly a busy month for kindergarten, once we got over the excitement of
Christmas (whew)!
We started off the month with a unit on Our Families. We found out how many people there are
in our families, how many brothers and sisters we have, and the many things that the children like to do
with their families. We made family portraits and special stories about things that we like to do with our
families. We talked about homes, our addresses, and made a class graph chart on our addresses to find out
which street has the most kindergarten children….McMullen has the most (a.m.) with five children and
LaHontan has the most (p.m.) with seven children! The children drew pictures of their homes, copied the
house number on it and we then placed it on a large neighborhood map. Next we will be trying to learn our
telephone numbers. Each child will have a telephone with their number on it, it will be placed above their
house on a telephone pole and once they learn their number, we will connect the wire from the pole to the
house.
As you can see, we have quite a bit of work to do before our caterpillar is complete but we have finished
our work with the initial consonant sounds Bb and Tt. We met Benji Bumble Bee and Timothy Turtle and
we found some very interesting pictures that being with these sounds.
A Special finger-painting project, using shaving cream, provided a great deal of excitement and smooth
faces in our room. So many of the children enjoyed swishing it around on the table and clapping their
hands to watch it fly all over. Of course, we had some children getting ready to shave and they had the
cream covering their entire faces. Some children experienced tasting the shaving cream and they decided
that it didn’t taste very good (yech)!
Coming events in our kindergarten include a unit on Fire Safety with (yes) a field trip to the fire
department. Of course, this is the month for Valentine’s Day and we will be spending some time on some
special projects and will have a Valentine’s Party!
OPEN HOUSE was a great success and we would like to thank all of you for your participation. The
children worked very hard in preparation and they were very excited to think that their parents were going
to get a chance to come to kindergarten.
SAMPLE OF NEWSLETTER - # 2
Dear Parents,
In the first few months of kindergarten we watched your children change in many ways. The most remarkable
transformations have occurred in the area of social competence within the group. Many new friendships have
begun and old ones have become strengthened. As each child begins to direct (name) school activities so can each
child become a director and supporter of the group; all the time recognizing the individual importance of each
kindergarten member. Each future newsletter will bring with it some “hopefully helpful parenting information” that
will go along with the newsletter and learning center spotlight! When my own daughter expresses, one restless and
fitful night, that she “kind of believed in count Dracula” I decide to do some review on children’s emotions and what
I found helped both of us get through the crisis, so I hope the information will be of interest to you. This is
accompanied by an article on children’s emotions.
Reading: The “wallpaper books” that are coming home with your “authors” are part of an important beginning for
discovering what reading is all about. Not only do the children gain knowledge of the sequencing of events of a
story but also discover important concepts such as book cover, title, page number, and story and illustration
correlation. Authorship is a sophisticated process for five-year-olds and some inconsistencies in time, place, or
sequence of events and continuation of a single story line may occur at first.
The “authors” are extremely proud and interested in their own books, so read along with them and
place their book along side others on the reading shelf. Sylvia Ashton Warner, author of Teacher and founder of a
reading approach called “Organic Reading” states:
“First books must be made of the stuff of the child, whatever and wherever the child. I reach my
hand into the mind of a child and bring out a handful of the stuff I find there, and use that as our first working
material.”
Math: The pattern unit has proven very successful, thanks to parents who cut shapes at home for us. We
experimented with dot patterns in the feather hats, shape patterns in the tepees; snap, clap, auditory patterns,
and will be doing some bead patterning soon. The concepts involved have proven difficult for some children and we
will continue to incorporate them into future math jobs. Our main focus in math now will be in classifying. They will
begin on their fourth and fifth sets of workjobs on Monday, December 3.
Science: We have begun our study of food and nutrition. (The holidays seem to be a popular time for everyone
to concentrate on EATING!) The children have an area where they can “prepare” their own meal from paper
cupboards containing pictures of food from the four food groups. We hope to have a tasting center soon where a
blindfold will make them rely only on these taste buds for discrimination of tastes!
ABC Snacks: “A” week turned out great! We made applesauce, Matt K. brought cinnamon, applesauce, Cathy
G. brought animal crackers, and Kathy M. brought apricot snacks. We will be starting on other letters of the
alphabet for December so please check the calendar for your letter. Please send ingredients if it would be simple
enough for us to put together. Or better yet come yourself and prepare it with the children. One mother last
year made enchiladas for “E” day, so do not hesitate- we will try anything!
We will be adding a new center to our kindergarten after Christmas and we will be needing some “old
worn-out” appliances, like toasters, and irons and any other mechanical things that we can take apart and discover
how they might work! (Radios, irons, music boxes, hair dryers, mixers, typewriters, old toys, vacuum cleaners,
sewing machines…and anything else you can think of!) Who knows, we might even be able to fix an old lawnmower
you thought was ready for the dump!
SAMPLE OF NEWSLETTER - #3
December is just around the corner. The Indian tepee will be replaced (somewhat reluctantly) by Santa’s Workshop, where our busy
little elves can keep busy.
Our Indian experience has given us a chance to do some dying with natural dyes, weaving, picture story writing, hear some legends
and stories about Indian children, play some Indian games, and mainly do some thinking about how we could live without some of the
things we take for granted. The “play” in the Indian tepee gives a chance to play out the role of someone in a slightly different
cultural setting. Changing from house to tepee demanded a discussion of what we could leave and what we needed to remove or
replace. To get an idea of where their thinking is, I asked if we should leave the telephone. They agreed, “No, long ago Indians didn’t
have phones”, but when asked how they did get a message to someone at a distance, they said “get on a horse and ride”, “yell loud”,
“smoke signals”, and “drive your car to where there was a phone” and “use a walkie talkie”. We forget, sometimes, how limited some
of their understanding and experience is.
This is a chance for the children to get the feeling of what another people, with different traditions and different needs or resources,
were like. We try to stress that this is long ago life…that Native Americans now live like you or me. This gave us a chance to think
about how and where we would get water and food, how we would live, what we would wear, how we would make the necessities for
our lives. In a world of supermarkets and cards and television, it stretches the mind and the imagination to think about such things. I
hope we can appreciate the great contributions the Native Americans made to our early settlers. By being Native Americans and by
being Pilgrims and eating some of the food that the Native Americans introduced to the Pilgrims, we hope there will be an
appreciation of the differences and richness in any culture and a better understanding of another way of life.
Frequently Asked Questions/Comments:
Politicians:
Through the evaluation process at a building level, kindergarten teachers should be able
to articulate to an administrator how their specific teaching strategies address the
performance standards in the five content areas. They also should be able to demonstrate
their use of well-developed assessment strategies for individual classroom use.
“What justification can you give for making kindergarten mandatory in the state?”
First of all, Idaho is just about the only state in the union that does not offer mandatory
kindergarten! We started offering public kindergarten in Idaho in the 1970’s. More that
twenty-five plus years is enough time to consider taking the next logical step –
mandatory kindergarten.
“Do you think the State of Idaho should consider full-day kindergarten?”
Most definitely! The trend towards full-day kindergarten is growing nation wide.
Changes in family economics now dictate two working parents and the days of a stay at
home parent greeting a half-day kindergartner are almost gone. The reality for most kids
is that they leave school to spend the rest of their day in childcare. From a teaching
perspective, the kindergarten curriculum is growing every year with more performance
standards and assessments and yet the kindergarten day has not gotten any longer.
Professors:
“Teaching math with physical materials is too elementary. Why aren’t we preparing
kindergarten teachers in the rigor of abstract mathematics?”
Teacher training in whole language is valuable, but training in phonics and phonological
awareness is helpful. School systems have chosen different ways to address language
arts curriculum. Some use a pure whole language approach and others use a pure phonics
approach. Still others use a combination of both. As a result, the more training and
information teachers have a about both whole language and phonics, the more prepared
they will be for the school district in which they teach.
Parents:
As more research is done on teaching reading we see that much has to happen before a
child learns to look at letters and then says the word that the letters stand for. Actually
you as a parent started to teach your child to read from the moment you both started
interacting verbally. A child needs to experiment with language before print. Hearing
sounds and differences in them is just a beginning for some very complicated skills like
rhyming or changing sounds to create new words. A child needs a wide background of
knowledge to give print meaning. You have begun the process of teaching reading.
“When I was in school, I learned the three R’s, why isn’t this good enough for my
child?”
It is! As we learn more about how young children learn we discover ways to teach the
basic things that children need to learn. Children learn best when surrounded by the
subject in all different kinds of ways. If a child loves blocks and can learn to count while
building blocks isn’t that wonderful? What if that same child can learn how to get along
with others while in blocks? Wouldn’t that be helpful when as a grown up a job needs
cooperation with others? What if that child learns how to write in blocks because a sign
is needed for roads? What if that child discovers many things while learning how to
count in blocks?
Quite frankly, your child can come to kindergarten just based on the date of birth. This is
a public school and that is one of the wonderful things about our educational philosophy
in this country.
Yes, realistically some children adjust more easily to school; some are more mature and
more capable than others at the same age. It does seem a kind thing for a caring parent to
wish to give a youngish child the gift of time and delay kindergarten placement. It may
be helpful for a teacher to provide a list of things that helps a child be more successful in
kindergarten. However, it may be more helpful for a parent to talk to a trusted adult
familiar with the child in a preschool type environment. A teacher cannot accurately
make a judgement on a child until having worked together for some time. This would not
be an easy decision for a parent to make and it would be best if the whole family agreed
on and felt good about such a decision.
“I heard that your district does not teach phonics. Why not?”
Phonics is a name given to specific reading skills usually taught at a much higher level
than kindergarten. The way to teach language-related skills at kindergarten age has been
carefully studied and is being taught in an age appropriate manner. No matter what it is
called, letter sound associations will be taught when it is needed. Many teaching
techniques will help your child develop an understanding of what language is and how it
is written.
Paper pencil activities are not always the best way to learn at this age. Your child is
doing a lot of serious schoolwork that can not come home. Probably the best way for you
to see what is actually happening is to be a volunteer in the classroom and watch.
Teachers know that that is not always possible and remind you that the best thing you can
do at home is continuing reading and discussing what is read occasionally.
Your child works very hard at school, however, if it seems like a game the teacher is
delighted and the child is delighted. None of that very important learning has been done
on paper and can not come home to you. As your child learns and grows this year you
will notice big changes.
Principals:
“There’s no money in the budget for materials, but would you like that workbook
series?”
Workbooks do not reach kindergarten children in the ways they learn best. Kindergarten
children learn best if they are offered opportunities to play, explore the world around
them and participate in hands-on activities. They also need opportunities to make
choices, communicate and socialize with peers. Five and six year olds must have their
bodies and minds actively engaged. This type of learning through play covers a wide
range of development and curricular goals and meets the needs of all students in my
classroom. Kindergarten children play with words, manipulatives, and props, sand, water
and each other. It is difficult to play with a workbook.
Workbooks do not actively engage the mind and body of a kindergarten child. They tend
to isolate specific skills with only one correct answer, therefore they do not encourage
growth at different developmental levels. Workbooks also isolate learners in a setting
that does not encourage communication among students. Workbooks do not foster
creativity in my classroom.
Thank you for the offer to buy a workbook series. How much do you think a workbook
series would cost? I am sure I could supply a center with appropriate materials for close
to the same amount of money.
Cooking has a great impact on student learning! Our cooking curriculum is set up so that
while students are cooking, they are integrating many different curricular areas. They are
developing math skills as they count, weigh and measure ingredients, literacy skills as
they read recipes, health skills as they learn about nutritious snacks, science skills as they
use their five senses, and social studies skills as they cook foods from different cultures.
Fine motor control is also developed as my students measure, chop and stir. Large
muscle groups are also involved as they knead and mix!
Cooking also helps young children develop many social/emotional skills. The children in
our classrooms are learning to work together in a shared effort. They are building
confidence and a strong self-esteem as they cook things that are good to eat. Parents are
proud of the independence their children show at home when they are able to create a
healthy snack for family members. We also teach our students polite table manners as
they eat the snack they have prepared.
Please come to my classroom on Friday at 9:30 and watch my students work together to
make a fruit salad. If you can not make it, I will be sure to save you a sample!
“Your classroom is very active, when do you plan for teacher-directed instruction?”
Thank you! Yes, I agree that my classroom is very active. Kindergarten children learn
best if they are offered opportunities to play, explore the world around them and
participate in hand-on activities. They also need opportunities to make their own
choices, communicate and socialize with peers. Five and six year olds must have their
bodies and minds actively engaged. This type of learning through play covers a wide
range of developmental goals across the curriculum, and meets the needs of all the
students in my classroom. Kindergarten children play with words, stories, manipulatives,
props, sand, water and each other.
Could you come back this morning at 10:30? We will be having a short teacher-directed
math activity on creating patterns.
Publishers:
“Would you like to know how your children compare to those in the rest of the nation?
Our test can provide that data.”
“Wouldn’t it be nice to have a description of where the child should be at the end of the
year?”
Each child enters kindergarten with its own unique experiences and abilities. Throughout
the year the goal of the teacher is to enhance each child’s experiences and abilities, but
there is not expectation that every child will be in the same place due to their original
wide-range of abilities. Therefore a description would have to be unique to each child.
“Can you see the benefits of these colorful workbook pictures over the actual objects?”
Young children learn through direct exploration of objects and the manipulation of real
materials. Therefore a workbook with only pictures of objects would be meaningless, a
waste of time and no matter how attractive, the kindergarten child will always show a
preference for real objects.
TEACHER RESOURCES
Teacher Resources
Art
Block-building
Cooking
Health
Language Arts
“A Fresh Look at Writing”, Graves, D.
“Foundations of Literacy”, Holdaway, D.
“Kindergarten Month by Month Phonics”, Cunningham, P.
“More Than the ABC’s”, Schickodanz, J.
“My Kid Can’t Spell”, Gentry, R.
“Pass the Poetry, Please”, Hopkins, L.
“Phonemic Awareness in Young Children”, Adams, M.J. & Foorman,
B. & Ingvar, L. & Beeler, T.
“Phonemic Awareness Song and Rhymes”, Jordano, K. & Callella, T.
“Phonics from A to Z: A Practical Guide”, Blevins, W.
“Ready-To-Go Phonics”, Potts, C.
“The Art of Teaching Writing”, Calkins,L.
“The Beginnings of Writing”, Temple, C.A. & Nathan, R.G. & Burris, N.A.
“What Did I Write”. Clay, M.
Math
Music
Science
Social Studies
Technology
General Resources
The following list is meant to be a starting point for teachers. Because of the high
rate at which web pages come and go, the teacher should use search engines to find the
most recent sites. Teachers need to use the individual addresses as a way to gather
valuable links. Almost every sit will suggest Additional sites with related information.
Some sites were chosen because of their links, not their specific topic. The teacher
should be aware that these sights are simply recommendations.
Search Engines
Comments to be avoided:
Teachers should foster self-esteem and creativity, and remember that each child is
developmentally an individual. The teacher should allow children to go about artistic discoveries.
Rather than searching for representation in children’s art, they should focus on the abstract,
design, qualities and shape or form. Teachers should use a “reflective” dialogue when talking
about children’s art. The elements of art provide a good framework for responding to children.
The following list of elements is both manageable and developmentally appropriate for talking
with children about their art:
• Color
• Line
• Mass or volume
• Patter
• Shape or form
• Space
• Texture
Children should not be given a model to copy, but teachers do have to model expectations,
rules and guidelines. The teacher needs to demonstrate clearly how the materials are to be used.
Some suggestions might be:
! Gather children in a circle.
! Demonstrate how to use the art items being introduced.
! Do not leave a model up.
! Stress to the children that creativity is wanted.
! Tell them that their work should not look exactly like anyone else’s.
Kindergarten students need thorough introductions to art supplies. The expectations must be
clear.
Art Supplies
The following list of suggested art supplies may be in the building’s central supply room.
These items can be used in the kindergarten room as a central community supply for children or
can be used individually. For example, if the teacher is to foster cooperative skills and
interactive language, the classroom might be set up in the following way. At the easel painting
center the blue paint may be set up only at one easel. In this way, the children are forced to use
language and cooperation skills to make full use of the center.
Many times at the easel, a child is able to paint with absorbing preoccupation and give
form and shape to personal experiences and feelings. Therefore, brush painting can be an
emotional release for children. Through painting, the child’s inner life of fantasy, imagination
and feeling is expressed.
Materials
# easels, table tops or floor
# plastic or vinyl smocks and aprons
# newsprint, 18”x24”
# shelves or racks to hold paint jars
# long-handled (10”) brushes, with a variety of bristle widths. Wash brushes after each
session and store bristles up in a container
# liquid tempera. Add liquid soap to help ease clean up
# clear plastic containers with lids or heavy glass jars for best visibility of color
# wooden laundry rack or walls for drying
! provide newsprint that is secured by clips, clothespins, or masking tape. If tape is used,
the child, when finished, may then place the painting somewhere on the wall to dry.
! allow the child to choose brushes and jars of paint from a large tray.
! allow children who are interested only in mixing colors in the jars to do so, but only as a
separate project. The supply for the other children should not be muddled. Children can
be shown how to avoid the drips by wiping the brush on the jar edge.
! have children write their names on the paintings.
! encourage painting objects (clay, cans, boxes, macaroni, carpentry products)
The teacher’s role should be to observe the child’s progress of expression and try to
understand what the child might be trying to say. The child will sense interest and not ask for
praise. The teacher should offer non-judgmental observation, such as, “You painted a long time
today, didn’t you?” “Do you want to tell something about your painting?” An adult may write on
a small paper and attach it to the artwork.
Brush Painting
Children enjoy painting on flat surfaces. This prevents dripping as can happen frequently
with easel painting and encourages mixing colors.
Materials
The space for brush painting should be large enough to hold an 18”x24” sheet of paper
and a flat tray beside it for mixing paint. (Two school-sized desks side by side work nicely.)
Paint containers (plastic cups, juice cans cut to size) can be placed along one edge of the tray
in spectrum sequence—red, yellow, blue, black, and white. Also, near the tray the teacher
should place a bowl of water, a sponge, and one or two brushes. Aluminum trays provide the
best resistance to the mixing brush and give enough space for mixing colors. However,
styrofoam meat trays, aluminum foil plates, or egg cartons will work.
Finger Painting
Finger painting is a tactile, rhythmic, free, big, expansive, colorful, gooey, and messy
activity. As a dried product, it is a meager reminder of the rich PROCESS that proceeded. On an
aesthetic level it encourages creative expression through direct contact between creator and
product and lack of any arbitrary standards. On a psychological level it offers the chance to be
expansive and sensory.
Clay
Clay is smooth, wet, slimy, chalky, sticky and gooey. It is hard and rough when dry. It can
be a very noisy, but relaxing experience. It is messy, pliable, crumbly, unreliable, heavy and a
mass (MASS). It has an earthy odor. Pounding it and throwing it down on the table are healthy,
aggressive experiences for kindergarten children.
Materials
# grapefruit-sized hunk of soft clay for each child at one table.
# square of masonite board, 18”x18”(use reverse side), will make the clean up easier
because the children can sponge off their own boards.
# covered crock for storage. (Clay should be stored as grapefruit sized balls with a deep
hole in each and filled with water. Water may be poured off the next time or worked into
the clay by the children.)
# bucket of water for clean up. (Too much clay in the sink drain may clog it.)
Source of clay: dig your own, with the children and use it in it’s sandy unrefined state, or
buy ready to use clay in a 50 lb. chunk.
Play Dough
Play dough is not a substitute for clay, but has values all it’s own. It is usually used with
rollers, cookie cutters and other tools. It is a “cleaner” material than clay. To the child who is
concerned about cleanliness, it offers less of a threat than clay. It may also serve as a stepping-
stone to the messier materials such as clay and finger paint. Even if dough is presented without
the use of tools, sensory experience is more limited than in the use of clay.
These tools are more confining than painting, water play or clay. They demand more small
muscle control and perceptual maturity. Children can create more representational drawings,
which gives them feelings of pleasure and mastery. Markers are an ideal tool to offer children
who want to draw “things,” because they move with less resistance and offer brighter colors.
Crayon Materials
# five and six year olds can control the small crayon, but may prefer the larger ones.
# all eight colors in an individual can or box, or, crayons in cans by color. (Children are
encouraged to use interactive language skills when sharing materials, and cleanup
becomes a sorting activity.)
# manila paper, 12”x18” (soaks up the crayon better than newsprint.)
Paper, glue and scissors aid in the development of the small muscles of fingers and hands,
and promote the ability to coordinate hands with eyes. As the child experiments with
manipulating the size and position of various materials, the child develops new concepts of color,
shape, texture and design. In this way, the child is extending and deepening a connection with
the world by shaping some of it to a personal scale.
Materials
# paper for background; colored construction, heavy white cardboard, roll ends or
wallpaper samples.
# glue or paste in individual containers with no brush or stick. (The sensory opportunity of
paste on the finger is an important experience.)
# scissors, some left handed, which work easily. Some scissors work with the left and right
hands. (A few loop scissors may be provided for the less dexterous child.)
# things to be glued—bits of colored paper, cut or torn.
Procedure; the teacher may:
! provide materials that are arranged on open counters or shelves and organized clearly to
stimulate creative ideas and easy self-directed access.
! provide an activity at one table for a small, self motivated group.
! allow children to select their own backgrounds from two or three choices.
! present precut or torn shapes for the first time and choose random or geometric shapes,
not figures of houses, trees or animals. (These limit the child’s creativity and focus on an
adult concept, which the child then feels must be imitated.)
! allow and encourage children to tear or cut paper into desired shapes or sizes.
! offer a gradually increased variety of materials to choose from, each with it’s own
container.
The teachers role should be to sit down with the children at first, and later, periodically. The
teacher should show them how to put glue on the back of the small shape, rather than on the
paper and clear an area for drying the pictures. The teacher should support the child who wants
to cut, but cannot, by cutting with that child from behind. Trainer scissors are recommended. The
teacher should not insist that every child take part. Each will take part as directed by time,
motivation and individual needs.
Collage
Making a collage is primarily a textural experience, both tactile and visual. It is helpful in
the development of sensory perception, spatial concepts, small muscle and eye-hand
coordination. It is the most stimulating of gluing activities, because of its three-dimensional
aspects and use of real objects.
Materials
# a strong foundation material to hold glued objects—corrugated cardboard, shirt board,
shingles, plywood scraps, meat trays, linoleum tiles.
# Equipment; scissors, staples, paper punches, tape. Small individual bottles of glue for
each child.
# collage materials can be organized by kind at first, such as feathers, beads, sticks, pine
cones, sawdust. Later, they should be organized by quality: textured, patterned, see-
through (transparent), shiny and shape. Each variety should be stored in a large, clear
container.
Constructions and mobiles are three-dimensional forms in space, offering the child
another mode of creating design and expressing individual inventiveness. Constructions
are more appropriate later in the year, as a product ultimately results from this form.
Materials
# wire of various weights, in rolls at florist supply house or from telephone company or
electricians.
# wire snips, pliers, scissors, stapler, hammer.
# colored and corrugated paper cut in long strips of various lengths
# collage materials which can be strung:
o beads o straws cut into pieces o foil.
o macaroni o sequins
# base for stability: wood block with wires attached by rug stapler.
# base for mobiles: wire coat hanger or styrofoam ball.
# bakery trays that are saved and brought from home.
The following are a sample of possible art activities appropriate for kindergarten
children. The possibilities for integrating art into other curriculum areas are limitless.
Offering experiences in art develops all concepts and objectives more fully.
Florence Cane
Susan Garrett
Art is the signature of civilization.
Beverly Sills
Susanne K. Langer
Arthur Zaidenberg
Robert Henri
Blanche Jefferson
Ann Wiseman
Nik Krevitsky
If we really believe in
a program of creative experiences,
this (the holiday) is no time
to bring out a “step-by-step” project
for each child to make
according to instructions.
Hoover
Genius At Work
by
Adelaide Holl
The satisfaction of creating sturdy, three-dimensional buildings out of wood gives a child
important feelings of power and competence, which are important for building a strong sense of
self at an age when children are feeling small and inadequate in the face of the big world. The
building process, which ideally goes on for at least an hour for the maximum involvement and
learning, requires intense thinking. (See chart for analysis of learning.) Block building offers
teachers a unique opportunity to learn who the children really are -- who can use themselves
fully. Who is inhibited and needs support and encouragement? Does that child seem less timid
when building? Whose energy could be well channeled in block building? How could the
reticent be involved so they could develop strong, active thinking skills, too? What are some
misconceptions in the children’s thinking? What content areas are they interested in? What
could be developed for the whole class? Where could we go to see how bridges span?
Teachers can get involved in blocks at appropriate times that do not intrude on the play
themes and thinking, by asking a non-threatening question, “What’s happening in this part?” or
“Does your garage have a door for cars to drive through?” A teacher’s attentiveness and
questioning during the block building tells children that blocks are considered important and that
the teacher values their work. When the teacher helps children make signs: “THIS AIRPORT
WAS BUILT BY JASON AND ERIC,” The teacher is demonstrating respect for those children.
Some teachers influence bock building by introducing accessories, which fit into the
theme being studied by the entire classroom at the time. Pictures, posters, or photographs may
be displayed to encourage new developments. Some teachers even direct building occasionally
by request for buildings made with only five blocks etc. or require a student to work in blocks
once a week.
The organization, care and location of the blocks tell children if they are valued. The
block building area should occupy a corner protected from traffic. Blocks should be stored
carefully on low shelves and arranged by shape. The block shapes can be painted on shelves or
stuck on as contact paper cutouts to enable one-to-one correlation at pick up time. Blocks should
be stored sideways, not lengthwise, to quickly recognize size relationships.
As children put the blocks away, they stack and carry them by twos, threes, and fours. If
the positions of the blocks on the shelves are marked with a 2-D representation of the blocks, and
with the block name, some children will match the picture with the block form and others might
associate the printed name with the block.
If the number of blocks provided and the space available are adequate, there need be no
formal selection of children who will play in the block area. Instead, there can be freedom of
movement in and out. When children are in the early manipulative stage, their attention span
with blocks is short. As they gain greater experience, they may work for longer periods of time.
When a teacher provides sufficient time for the children to become thoroughly familiar
with a single shape, they can see more things to do with the shape. Some teachers begin a school
year with one or two sizes of blocks available, and leave those shapes out for a period of time so
that the children may discover the many ways in which they can be combined. As a new shape is
made available, the nature of the structure becomes more elaborate. When cylinders are
introduced after one group of children have been playing for several weeks with units and double
units, the wheel is “rediscovered” and huge automobile and airplanes can be designed.
Sometimes children create a structure that is so important that they can not bear to take it
down, or they are engaged in dramatic play that they wish to continue at another time. If the
room is not shared with another group, the teacher can easily arrange to keep the structure
standing. A sign might be prepared, such as “PLEASE DO NOT KNOCK DOWN OUR
BUILDING” or “PLEASE SAVE OUR HOUSE.” If the room is shared with a second group,
arrangements can be made so that the two groups take turns from week to week. Children soon
learn to respect the structures that others have made, and realize that the area is temporarily off
limits. Buildings left standing, may be added to or elaborated the next day.
Children of any culture will play with blocks. How a teacher values block play will
determine the time allotted for this activity, the location and size of the area, the quantity of
blocks made available, and the quality of play that results. Because there are so many facets to a
teacher’s role, it is often difficult to determine the difference between a positive form of
intervention and interference. If comments are never made, the children may lack challenge. If
comments are made too often, the children may become dependent. Play stops when a teacher is
not there, or they may lose interest in the play because it is not truly theirs. Any question asked
should be open-ended and any comment made should extend learning, encourage thinking, or
clarify concepts. When a teacher mentions an individual block by its proper name it helps build
a child’s vocabulary. If there is to be purposeful play with the blocks, a teacher’s strong support
is required. This may be given in many ways. Often this means that a teacher observes in the
block area. Mere physical presence shows interest in what is happening. In a room where no
block play is going on, children usually begin to build if a teacher sits in the area. It will
probably not be necessary for the teacher to say anything. Silent support is an important role of a
teacher. However the teacher may need to find a way to direct a child toward a project, e.g., the
teacher may raise a question about procedure or involvement, or produce objects to enhance
what is happening,
The teacher may use whole group discussion to create rules for blocks. Consideration may
be given to the following:
Those doing the building may not be those who put the blocks away. If a teacher initiates
and is active in the process, the children will join. A teacher who knows the children in the
group may encourage those who do not ordinarily use them to handle them and become more
familiar with them as they put them back on the shelves.
Although blocks are sturdy and long lasting, care should be taken in handling them so that
they remain in good condition. Children learn to value them when they develop the habit of
not stepping on blocks or throwing them.
As children take risks in block building, some of their structures crash. However, good care
of blocks would mean that falling blocks should not be intentional and the teacher can help
the child find an orderly way of taking down blocks without having the structures fall.
A heap of blocks is not enticing to children. Hence it is important that they be returned to the
shelves so that floor space can be made available for the next group. An orderly arrangement
on the shelf is in itself, a stimulus for construction.
When the block area is carefully supervised, blocks are a very safe medium and can be used
in a variety of ways. Sometimes children build structures higher than themselves or test their
strength by carrying big stacks. If a teacher is comfortable with this and close by that may be
a teacher’s choice. However, many teacher feel it advisable to limit height or amount
carried.
Some teachers feel that blocks should be reserved for the block area. Some teachers
encourage blocks to be used in other areas of the room. They can be combined with drama to
enhance play and enrich the props in a creative and versatile manner.
While considering enhancing block building it is helpful to remember that there are natural
developmental stages.
Carrying blocks around.
Repeating patterns.
Bridging.
Making enclosures.
Making decorations with or without symmetry.
Building function designs and naming.
Dramatizing.
Unit blocks are considered by many educators of young children to be the most important
teaching material in the kindergarten. They are unstructured, “raw” and offer multiple
opportunities for learning on many levels.
Unit blocks:
» foster skill in manipulating. ---fine motor
» give opportunity for creating 3-D forms in space ---M, S
» stimulate a growing understanding of the organization and function of the real world,
through the building of representational models ---SS, S, M
» develop relationship thinking as the child makes size selections ---M
» help build concepts of space and dimension ---M
» encourage language development through the communication of ideas and vocabulary
building --- R, SS
» establish working relationships with other children ---SS
Many math concepts and skills are developed as children play with blocks. If blocks are
placed on shelves in categories according to size and shape, children become aware of ordering
and classification. As blocks are put away they are sorted matched and classified according to
shape and size. When there is a pictorial representation of each shape on the shelves, children
have the experience of relating a 3-D object to a 2-D form. ---M
If shelves are labeled with the block name, children identify the block with a symbol. In
handling blocks, children become aware of similarities and differences. ---R
When stacking or making a series of stacks, the child practices one-to-one correspondence in
keeping the stacks equal. ---M
Blocks in a tower are part of the whole structure and the concept of whole and its relationship
to its parts are important to understanding basic mathematical processes of addition, subtraction,
multiplication and division. Experience, as with units and double units, helps the child to
recognize equivalency relationships. If a child builds a structure higher than wanted it will be
required to subtract one or two from the whole. As blocks are carried a child deals with
multiples. When deciding to make a single lane road into two lanes a child practices division. In
building a tower, a child gains experience with sets. The constant size and shape of blocks
permits the child to establish internal units of measure. ---M
If the teacher refers to the blocks using special terminology these terms may build a child’s
vocabulary and establish recognition for the requirement for special technical words in
specialized fields. ---R
Children may create a map with blocks. Streets, buildings and parks are often created for
wooden road signs and small vehicles. After a zoo trip children often build animal cages. Farms
are often made with various fields and enclosures using wooden farm animals. ---SS
Pillars Triangle
Hollow blocks involve the whole child and have all the properties and values of unit
blocks. The size of hollow blocks allow a child to use large muscles and build structures where
the child can actually be a part of the construction.
Free exploration is of immense value and cannot be ignored. If there is no free play the
child will need to explore anyway and risk doing so despite the teachers wishes. Hollow blocks
should be used later in the year however, and only after class rules and expectations are solidly
understood. After some free play, teachers often use hollow blocks to extend classroom themes
either remaining in the block center or as a part of another center. Dramatic play props and
posters can be added to influence or direct projects being created.
Hollow blocks can take an enormous amount of room and so are often used in the circle
area where they must be cleaned up quickly and often. However, an ideal placement would be in
a separate spot adjacent to the Dramatic Play Center. Then the extra space can be used and
structures can be left day after day to extend Dramatic Play.
As with Unit Blocks clean up can be a learning experience and as useful as actual play.
Placing shapes matching the blocks on the wall behind where blocks should be stacked helps in
organization. Introducing a few at a time is also a good idea.
The teacher may talk through rules for hollow blocks. Leading conclusions with
questions may help children realize the danger of roofs, or outside behavior like sliding,
climbing, or running. The teacher’s attitude about this being a place to build and not “fool
around” will help this guidance.
Blocks should be stored in an organized way, matching shapes drawn on a storage shelf. The
putting-away process thus becomes a purposeful perceptual differentiation at clean-up time.
A copy of outlines for defining block storage and an illustrated letter showing how blocks
teach many areas of the curriculum follow:
Use these outlines for defining unit block storage area.
Pillar
Large Buttress
Half Pillar
What is provided first with blocks is EXPERIENCE WITH A MATERIAL, combining
structure and freedom in a felicitous way.
Working with blocks in the kindergarten, the young child learns about:
Classification
Order
Number
Fractions
Measurement
Volume
Area Depth
Width
Height
Length
Inequality (more than, less than)
Equality (same as)
Shape symmetry
Mapping visual perception
Eye-hand coordination
Feeling of competence
Cooperation
Respect for the work of others
Shape recognition
Size relations
Signs
Labeling
Directions
Exchange of ideas
Planning of building
Naming of building
Stories about buildings
! Autonomy
! Self-direction
! Construction ! Security
! Dramatic play ! Power
! Self-expression ! Independence
! Pleasure ! Discovery
! Initiative
! Feeling of Competence
! People and their work ! Cooperation ! Awareness of others
! Interdependence of Society SELF ESTEEM ! Clean-up ! Awareness of differences
! Symbolic Representation ! Respect for work of others
! Mapping
! Patterns
PHYSICAL ART
DEVELOPMENT
BLOCKS
! Weights
! Inclined plane ramps
! Size: equality/inequality ! Interacting with children
! Space ! Area ! Questions about concepts
! ! Volume ! Exchange of ideas
!
Shape
Symmetry ! Measurement SCIENCE ! Planning of building
! Mapping ! Depth ! Interaction of forces ! Naming of building
! Width ! Function of building
! Height ! Stories about building
! Gravity
! Length ! Stability
! Trial and Error
! Inductive thinking
! Discovery
! Properties of matter
In addition to making a transition into the learning environment, Circle Time has
an important impact on many social/emotional goals common to Kindergarten
classrooms. The whole group activities help students increase their attention span,
develop listening and speaking skills, and practice appropriate audience behaviors.
Circle Time is also an opportunity for students to generate topics, express opinions,
identify problems and develop problem-solving skills. Many Circle Time activities are
pre-academic in nature as they encompass literacy, math and science activities. Circle
Time activities are valuable in building vocabulary, developing concepts of number,
providing exposure to environmental print, as well as, developing science concepts such
as weather and seasons.
A teacher must first determine when they want Circle Time to occur in their daily
schedule. Although most begin their day with a Circle Time, some teachers prefer to
start the day with a story, activity, or centers and then move into Circle time. Individual
schedules and personal preferences will help determine the best time for Circle Time.
After a time has been established, consider a meeting place in the classroom that
is large enough for the whole class, always available, comfortable and conducive to
teacher-to-student interactions, as well as, student-to-student interactions. Many classes
participate in Circle Time activities while they are seated on the floor in a circle. Other
teachers prefer to have a chair available for each student.
When developing circle time activities, teachers should plan for active
participation and allow for student responses. Center time is filled with a variety of
activities and allows time for children to be physically and verbally engaged. Although
well-planned activities often hold the interest of children, flexibility in schedules must be
maintained for spontaneous, student-generated interactions and topics.
Circle Time Activities
The following activities will help the kindergarten teacher work towards the
social/emotional and pre-academic goals appropriate for kindergarten, as well as, provide
children with enjoyable, stimulating activities to begin their day:
Calendar Activities:
Students study the calendar during Circle Time using Math Their Way Calendar
activities or Calendar Math activities. They are learning about days of the week,
months and seasons, holidays, state and federal holidays, and historical events.
The calendar develops calendar concepts such as yesterday, today and tomorrow,
builds holiday and seasonal vocabulary, and math concepts such as rote counting,
numeral recognition, skip counting and place value.
Weather Activities:
There are many ways to keep track of the daily changes in weather. Some
kindergarten programs use graphs to depict the number of rainy, sunny, cloudy,
windy, etc. days experienced in each month. Other activities involve dressing a
doll or teddy bear appropriately for the weather outside. Whatever program is
chosen, the vocabulary and weather concepts will be valuable. (a sample weather
graph follows)
Music and Poetry:
Music and poetry are essential to the development of language, rhythm, memory
and pleasure. Center Time is a perfect opportunity to encourage appreciation of
all types of songs and poems, including holiday and seasonal, silly, along with
songs and poems from diverse cultures. Songs and poems can be found to
supplement any thematic unit.
Music and poetry is another means through which children can learn to express
themselves. Working over time with repetitive phrases found in music and poetry
gives students opportunities to develop important auditory discrimination and
phonemic awareness skills. These skills include working with alliterations,
onset/rimes, and rhyming words, developing vocabulary, and focusing on
frequently used words.
If the teacher chooses to write out the songs or poems on chart paper, and point to
the written words as student sing or speak, students will also develop their
conventions of print as well as symbol-sound relationships. While thinking of
music and poetry to add to Circle Time, remember fingerplays and nursery
rhymes should be added, which encourage children to retell and sequence stories.
They also provide role-playing extensions for the Dramatic Play center during
center time. Adding actions and movements and instruments to songs and poems
encourages active participation.
Current Events:
Local newspapers and Internet services provide pictures and articles about
interesting current events that may be shared during circle time. Many
times, students will bring articles of interest to share with the class.
Current events may be used to develop thinking and problem solving
skills. This is also a good time to promote thinking skills by using
questioning techniques that encourage higher levels of thinking (as
described in Bloom’s Taxonomy) in students.
Discussions:
Many circle time activities lead to discussions. Kindergarten students are
easily reminded of experiences and love to share their personal stories.
These stories open up discussions that encourage children to share exciting
moments, fears, problems and concerns. Such discussions develop
appropriate audience behaviors, listening and speaking skills, vocabulary,
and the sharing of problem solving ideas. Teacher posed questions can
encourage higher levels of thinking (as described in Bloom’s Taxonomy).
Sharing:
Children love to bring items from home to share with their classmates.
Sharing encourages children to speak before a group with confidence. On
a designated day, children may be asked to bring a share item carefully
hidden in a bag. With a family member, they may write several clues to
read to the class so classmates can guess what is in the bag. Teachers may
ask students to bring items that begin with a specific letter or items that go
well with a thematic unit.
Closing Circle:
Many teachers also hold a short closing circle time at the end of the day.
This time is for students to share creations made or written during the day,
discover solutions to problems that may have occurred, sum up an activity,
interpret a graph made in class, or discuss plans for the next day. Teachers
may encourage students to recall specific activities that occurred in school
so the children have something to report to parents when they get home.
sunny Weather chart
windy
rainy
cloudy
snowy
foggy
COOKING ACTIVITIES
SNACK
Cooking can provide many opportunities for cognitive, social and cultural
learning. ---SS. Children can use their five senses to explore cooking activities. ---S.
Kindergartners also begin to learn about units of weights and measure, how to use tools
properly, and the language of cooking. –M,R. Through cooking activities the children
learn to work together in a sharing effort. –SS. Because foods and cooking illustrate
cultural difference, children can be exposed to ethnic groups and diversity. –SS
People may be alike and different as they have different tastes. John likes cooked
carrots and Mary does not; but both like vegetable soup. Safety and sanitation are
practiced. The teacher stresses careful use of tools and ingredients in food preparation.
Children can be guided to emulate certain behaviors i.e., sitting straight to digest food,
taking turns serving, taking a fare share of food when eating, to help develop self-respect,
as well as, respect for other children. —SS
Cooking experiences help a child become more aware and appreciate family roles
and how working together, sharing tools, and dividing work benefits all. Children enjoy
hearing about and seeing different foods from different countries. They discover much
about their own family background and ethnic backgrounds through food. Differences in
climate and culture can come alive through stories, pictures, and projects. Geography,
transportation, lifestyles, and media impact can determine where food comes from,
availability and food choices. --SS
Science concepts are learned as a child investigates and discovers the nature of
food. The child finds the origin of food – plant, animal and synthetic. Food changes
from one state or form to another as the child mixes and creates temperature changes.
Field trips enhance knowledge of food processing and food quality. Kindergarten is a
good time to begin the study of the origin of food and growing things. How does a plant
grow, what does a plant need to grow, where does it grow, and when does it grow? What
is an egg, and why does it hatch? What effect does food have on the way we feel, look,
and behave? –S,H
As children prepare and eat food, the opportunities to learn, express, write and
read new concepts are endless. As the teacher works with children, the teacher should
use the correct term for the food, equipment, or process i.e., pop corn, dissolve powder in
liquid, squeeze oranges, melt butter, boil water, taste bitter, etc.—R. The child
recognizes and differentiates shapes, sizes, and signs, and begins to read labels and
follow recipe directions. –R,M,S The child expresses questions, concerns and exchanges
ideas. Children may want to bring home a recipe to share with families. Picture recipes
for the year may make a great Mother’s Day present. Letters to parents help to reinforce
classroom objectives. –SS
A cooking activity can center around culture studies (e.g., Native Americans),
literature (e.g., “The Gingerbread Man”, “Stone Soup”), ethnic backgrounds (e.g., tacos,
kugel), alphabet letters (e.g. A is for applesauce, B is for butter), or holidays. The
number of times in a year that a class cooks is a teacher and group preference. Cooking
is fun and it offers kindergartners a wide variety of experiences and learning
opportunities. –SS,R, W,H
SAMPLE PLANNING SHEET FOR
TEACHER USE IN COOKING ACTIVITIES
Date____________________________ Project_______________________________
Type: all children prepare small groups (circle one)
Consider: foods in season, experience, weather (CHOICE: hot or cold food)
Procedure – step by step (include preliminary preparation if any and what assistant
cooking volunteer can do)
1. _______________________________ 6. ________________________________
2. _______________________________ 7. ________________________________
3. _______________________________ 8. ________________________________
4. _______________________________ 9. ________________________________
5. _______________________________ 10. ________________________________
SAMPLE
“Applesauce”
A is for Applesauce
1. 6-8 medium sized apples
2. peel , slice and remove seeds
3. put sliced apples in pan
4. add 1 teaspoon of cinnamon
5. add ¼ cup of honey Honey
1 lettuce leaf 1 cherry tomato 1 celery piece 1 carrot stick peas from 1 slice zucchini Toss in a
torn halved cut cut a pea pod cut Salad bowl
dressing:
sour
cream vinegar sugar salt
1. Wash (carrots)
2. Peel (carrots)
3. Grate (carrots)
In (bowl):
Snack time is another opportunity to integrate basic concepts and good nutrition into the
kindergarten program. Snack time can be a whole group activity or a small group activity.
A calendar may be sent home monthly with a child’s name assigned to each day if snack
is done on a daily basis. A basket sent home the day before as a reminder and a carrier is helpful
when snack is done daily. The reminder may also be a simple as a sticker the day before.
Dear Parents,
Starting October 17, we will have a self-help snack area set up in our
kindergarten room during our area time between 9:00-10:00 for morning, and
12:15-1:15 in the afternoon.
The area is set up for children to sign in by name, shape, or anything being
worked on that day. They rotate into other areas when they have finished their
snack, to let other children have a turn. Please make snacks easy for the child to
prepare, i.e., with enough napkins, spoons, cups, or whatever is necessary. You
may also want to tell your child or write a note telling how many each child is
allowed, i.e., 2 crackers and 2 pieces of cheese, or 2 slices of apple, or 1 bag of
popcorn. Not all snacks have to be prepared by children - be creative – this is a
fun time for the kids.
Birthdays may still be celebrated in a large group snack if the child wishes.
There are 24 children in the morning with a few helpers and 25 with a few helpers
in the afternoon.
We all appreciate the nutritional snacks that we have been eating; fruit,
celery and peanut butter, popcorn, trail mix, peanut butter balls (a big hit), and
many, many more. Thanks for your support.
Bon Appetit!
Setting up the Snack Table
Snacks served as a center activity and during center times need to be set up so that
children can take care of the process with little adult supervision. There needs to be a limit to
how many can be at the table at one time. Hand washing and cleaning up after a child is finished
eating should be required. The child bringing the snack can create directions for how to serve
the snack. Any special features of the snack may also be written at home or at school. Children
are interested in snacks that begin with the letter of the week or follow a theme that is being
explored class wide
Snacks served altogether need to be set up by the child providing them and a helper. The
other children may use this time to wash hands and to take a bathroom break.
Many schools have a milk program and serve milk during snack time. Some schools purchase
the milk through the PTA or other sources. Some ask parents to send in a fee for the year.
Teachers may choose to purchase milk every day or may decide to supply it less often,
dependent upon the nutritional needs of the class.
As a whole group, the class may write directions together and discuss any specifics about
that particular snack. A teacher may have the class decide about hand washing and cleaning up
rules. The school nurse may be available to come in and demonstrate the best technique.
Having an authority talk about why this is important always causes thought. Discussing how
nice it is to eat at a clean table help others remember to follow through.
Sponges by the sink and a spray bottle with vinegar and water help keep things tidy.
The dramatic play center is just such a medium for learning. Through this center,
the kindergarten teacher can create the conditions where process and content are woven
together, as they are in our everyday lives. The process areas of language like; reading,
writing, speaking and listening can be naturally integrated with the content areas of
mathematics, science and social studies.
No matter how the dramatic play theme is chosen collaboration, at some point,
between the children and teacher is an important part of the process. The theme should
fit certain criteria:
! does it directly relate to a life situation that is meaningful for the children?
! is there enough physical space to produce constructive and valuable play?
! can the theme be supported by gaining information from other sources; such as, field
trips, classroom visitors, audiovisuals or books?
! will the choice of theme lend itself to opportunities to expand children’s interests,
experiences and concepts?
! does it offer opportunities for discussion and problem solving of social situations as a
means of fostering personal growth and building a sense of community?
Materials in the dramatic play center can be very simple and will vary with the
integration of thematic units. The materials should be set up in a contained area of the
classroom. It may be located next to an adjacent center where interaction and
cooperative play would be appropriate. The items in the center should be arranged in an
orderly manner. The orderliness invites constructive use. A system of labeling, plus
thoughtful arrangement will facilitate clean up and foster independence. The equipment
should be sturdy enough for group use and small enough for a child to use alone. Many
times materials from other centers can be appropriated to enhance the dramatic play
center. Hollow blocks are particularly useful in “building” the foundation for furniture
and other play structures in the center.
Introducing the center and modeling the kind of play to take place there is critical.
We shouldn’t assume that children would know how to use the materials appropriately.
Role-playing some brief activities in the center provides an ideal opportunity to solicit
the children’s help in setting limits and developing rules for play. Depending on the type
of dramatic play center, four children at a time has proven to be a reasonable number in
most classrooms and is an effective playgroup.
Development
The kindergarten year in Ms. Sample’s room, started with a house theme
in the dramatic play center. Ms. Sample chose this theme because she felt all
children could relate to some type of home environment, the theme was part of
her school curriculum and she could use materials and props that were readily
available. After several weeks of initial free play in the center, Ms. Sample
noticed the children consistently role-playing as customers and waiters. She then
guided the class in a discussion of eating establishments. They explored the roles
of the workers and customers in a restaurant and Ms. Sample scheduled a field
trip to a local pizza parlor. They decided their next center would be the “Kinder
Cafe”.
Set Up
With the children’s help, Ms Sample gathered materials for the cafe and
decided what furniture from the house could be used. She decided to use the
same house area because it was relatively self-contained and far enough away
from quieter areas of the room. In an adjacent area, the block center, she placed a
wooden steering wheel platform and hollow blocks that could be used to “build” a
car to take diners to the restaurant. Within the cafe space she arranged two
seating areas and a kitchen. Props included:
! play food: sorted into six ! glass coffee pot (painted brown
labeled containers (meat, to look full)
vegetables, bread, fruit, dessert ! silk flowers in a vase (2)
and drinks) ! student-made menus with
! cash register magazine cut-outs to match the
! table service for four six food categories
! checkered tablecloths ! serving tray
! telephone
! aprons and chef’s hat play ! salt and pepper shakers (2 sets)
money
! teacher-made “Guest Check”
booklets with the same six
divisions
Introduction
Ms. Sample asks the class to gather around the “Kinder Cafe”. She
chooses individuals to help model the parts of customers, server and chef. The
customers are given wallets or purses with play money and told to “call” the cafe
to make “reservations”. A board with class names is next to the telephone and the
server crosses off the customers’ names when they arrive. The chef is busy
writing on a wipe-off board that’s labeled: “Today’s Special”. After seating the
customers with menus, the server returns with silverware and cups and asks for
the order. Ms. Sample shows how the server takes the order form to a board
labeled “Orders In”. The chef fills the order, puts the filled dishes on a serving
tray and then moves the form to “Orders Up”. Ms. Sample guides the server in
delivering the food and tallying up the check. The customers leave a “tip” on the
table and pay the check at the cash register. As they leave, Ms. Sample models
“Please come and see us again!” She’s sure to have steady customers!
# telephones (2)
# full length mirror / hand mirror
# high chair
# cradle
# clothes rack
# steering wheel platform
# housekeeping set (broom, mop, and dustpan)
# set of toy pots/pans
# dress-up clothes
# grocery cart
# play money
# ironing board/iron
# doll stroller
Dramatic Play Center Themes
Public Service
Fire Station
Driver’s License Bureau
Hospital
Library
Police Station
Post Office
Airport
Weather Department/ TV Station
The following are curriculum connection ideas for the dramatic play center.
Although all play center themes will not relate as easily to some curriculum areas as
others, the kindergarten teacher should strive to focus on at least one or two areas for
each thematic center. By nature, the dramatic play center is a language-rich environment.
The process areas of reading, writing, speaking and listening are easily integrated. But
many opportunities exist to incorporate ideas that will enhance learning in the content
areas of math, science and social studies, as well.
Labeling center props and environmental print are two of the easiest ways to
bring reading into the center. Many times writing opportunities are best served in a
separate center where the writing assignment serves as a “ticket” to enter the dramatic
play area. Cooking activities and science experiments that are part of the play center will
need to be simple and designed for independent child use with little adult supervision
needed.
Homes:
! print labels for common household props; telephone, couch, dresser,
stove, refrigerator, window ---R
! measurement activities related to cooking ---M
! environmental print labels; Hoover, Comet, SONY, Whirlpool ---R
! pad/pencil set to create “To Do” list of household chores ---W
! artifacts and reproduction tools; animal skins, arrowheads, mortar and pestle
(teepee) ---SS
Recreation Areas:
! simple mapping activities; north/south, mountain, mileage key (campsite) ---SS
! labeled exhibits; mammals, reptiles, coral reef, open ocean (zoo/aquarium) ---S
! score-keeping with a tallying system (bowling alley) ---M
! matching menu items to guest check booklets (cafe) ---R
! wipe-off board for announcing show times/play titles (puppet theater) ---W
Public Service:
! poster illustrating the water cycle (TV station) ---S
! filling out simple health forms (hospital) ---W
! labeling basic road signs (driver’s license bureau) ---R
! I.D. tags for emergency room workers; ambulance driver, nurse, doctor, orderly
(hospital) ---SS
FIELD TRIPS
The purpose of a field trip should be to extend the child’s knowledge of the
environment. The goal is to provide the opportunity for the child to gather and assimilate
knowledge in order to gain a more complete understanding about the real world. The trip
is most meaningful when its purpose is to seek answers to children’s questions or satisfy
curiosities about a particular concept that has been introduced in the classroom.
Kindergarten children enjoy first hand experiences; they want to go see for themselves.
People resources, stories, videos, pictures and discussions can supplant these
experiences. Later in the classroom, this information can be assimilated and transformed
by dramatic play in order to produce real learning.
An important criterion for choosing field trips for kindergarten children is a trip
that allows children to be active participants and not merely on-lookers or a captive
audience. The teacher should explore possibilities within the community that will meet
the children’s needs. In all cases, the teacher should scout the trip site and chat with the
people being visited. The teacher should arrange transportation well in advance, whether
it is by bus or volunteer drivers. This would be a good occasion to include mothers,
fathers, grandmothers, or grandfathers, as a way of involving them in the education life of
the group and to extend their own perspectives of the community.
The teacher should prepare the children by discussing with them a few days in
advance where you are going and why. The teacher should speculate with them about the
anticipated experience and formulate some simple questions that the trip might answer.
This will give the trip a focus. Kindergarten children need practice developing the
concept of “what is a question?” The teacher may want to role-play asking questions and
have the students determine true questions from telling stories.
The teacher should plan on carrying a traveling first-aid kit, tissues and a cell
phone. A portable microphone system is helpful. It may be utilized on the bus trip as
well as, to enhance the presentation and help the group stay focused. The teacher or a
volunteer should plan to take a camera to document the experience and add to follow-up
reinforcement activities.
The teacher should review basic safety rules; stay with the group and hold your
partner’s hand. Adults should space themselves strategically at the front, middle, and end
of the group and be assigned to a small group of children. A 5:1 child to adult ratio is
recommended. Controls are necessary and procedures for travel must be spelled out
clearly and carried through, but over-insistence on perfect lines and handholding will kill
the spirit of the event. Five-year-olds are orderly in a general way but do not expect
army efficiency in conforming to rules.
On the bus ride to and from the field trip, the teacher may utilize previously
learned songs, finger plays, chants and poetry. Open-ended songs/chants that adults can
join work best i.e. “Who Stole the Cookies?” as well as, songs that can have student
names inserted and children’s classics i.e.: “Eency, Weency Spider.” Rhythmic clapping
activities are good time-fillers and help to hold the group together if it is beginning to
disintegrate. Doing pattern searches outside the bus windows is another management
idea. If a portable microphone/speaker system is available, passing the microphone
around the bus and allowing children and adults to introduce themselves is another
helpful idea. A battery operated cassette/CD player would be useful to keep the children
in tune or just as a quiet “listening” activity. (The bus driver will especially appreciate
this one!)
During the presentation the teacher can model and express genuine interest by
asking questions in thought-provoking terms; i.e., “I wonder how . . . What do you
suppose . . . “ with out pressing for an instant answer. This will help guide the children
when the opportunity arises for asking their own questions.
After the trip, when the children have digested their impressions, the teacher may
initiate discussions, starting with the main question, and making other simple generalities
using whatever props are appropriate.
While the field trip may be a good example of a first-hand experience, it may not
always be the most practical. It is often easier to bring the resources into the classroom.
There are people who work in the community who may be willing to come into the room
to share their working lives and even their tools with children. In planning for a visitor,
the possibilities for learning should not be overlooked by the teacher. Children need to
have their curiosities aroused. The teacher will want to plan for the visitor and perhaps
write a group invitation and have questions formulated in advance. Follow-up activities
might include a special note of thanks and role-playing and dramatic plays based on
identification with the guest.
Healthy Lifestyles:
! Go for a walking field trip to a local park and on the way talk about the importance of
exercise
! Bring a snack to eat at the park, in a group setting. Or, have a discussion about
health, snacks, prior to the field trip.
! Eat the snack in a large group and have each child tell why their snack is healthy.
! Notice safety signs and safety procedures on a walk and discuss how there are
different behavior expectations at school, home or on a field trip.
! Talk about bathroom hygiene and the spread of disease then take a trip to the
bathroom and have everyone practice appropriate hand washing skills.
Risk Taking Behaviors:
! Discuss behaviors they think may get them into trouble and explore each suggestion
(This discussion may well cover many other aspects of the health curriculum as
children talk about smoking, drinking, or drugs)
Consumer Health:
! Explore a variety of drug store products and sort them according to safe and unsafe,
health and unhealthy.
! View common symbols to help identify poisons.
! Help develop a hospital in the dramatic play center.
! Visit with fire fighters that come to the school with their fire truck, or go on a field
trip to the local fire station, hospital, dentist, or police station.
LIBRARY – LISTENING
The library center is a comfortable, quiet spot for children to choose, explore and
enjoy a variety of written materials. Reading in this center can be shared with others, or
students can read quietly alone. This center provides a wonderful extension for thematic
units that are occurring in the classroom.
The teacher should choose an area in the classroom that will be designated as the
library center. The reading that takes place in this center tends to be a quiet activity, so it
is best to locate this center close to other quiet centers. Many classrooms are able to
define their library center with a reading loft. If reading lofts are not available, a carpet
with beanbag chairs, a small child-sized couch with pillows, a tent, or even an old bathtub
full of pillows may define the space. Whatever is chosen to use for the library center, it
should be kept in mind that the purpose of the library center is to provide children with a
quiet, comfortable place to enjoy books.
When choosing books for the library center, a variety of genres should be
represented. Fact and fiction, poetry, and charts, predictable books, magazines, and class-
made books should be included. Most importantly, books the children have enjoyed
during a class shared reading activity should be put into the library Center to provide
children with independent practice. Too many books in this center may overwhelm
children, so only a few books that are appropriate to thematic units and from class read
alouds should be used. Books should be changed often so students do not become tired of
the materials in this center.
Listening Center
Like the library center, the listening center is a quiet place for students to listen to
cassettes and CDs. The listening center provides children with an opportunity to hear a
story repeatedly, developing the associations between written and spoken words.
Conventions of print are also developed in this center as students independently follow a
text with the spoken word. The listening center is a wonderful extension for thematic
units that are being taught in the classroom.
A quiet place is needed for the listening center. The center is often placed near the
library center. This center includes a tape player and/or CD player, as well as, headphones
for a specific number of children. The teacher may choose to have a specific tape with
multiple copies of a book in this center, or students may be provided with a choice of
books and tapes. Children also enjoy listening to music and following along in
songbooks.
For management of tapes and books, it is helpful to color code tapes and
corresponding books so children may operate the listening center independently. It is also
convenient to put color codes or markings on the tape player itself so children can also
learn to operate the tape player independently.
Baer, Gene. 1989. Thump, Thump, Rat-a-Tat-Tat. New York: Harper and Row.
Bagert, Brod. 1997. Gooch Machine: Poems for Children to Perform. Honesdale, PA: BoydsMiII
Press.
Baskwill, lane. 1989. Pass the Poems Please. Halifax, NS: Wild Things Press.
Bayer, lane. 1984. A My Name is Alice. New York: Dial.
Baylor, Byrd. 1986. I'm in Charge of Celebrations. New York: Scribner.
Bedard, Michael. 1992. Emily. New York: Doubleday.
Blumenthal, Deborah. 1996. Chocolate-Covered-Cookie Tantrum. New York: Clarion.
Branley, Franklyn. 1986a. Air Is All Around You. New York: Harper and Row.
1986b. Snow Is Failing. New York: Harper and Row.
1986c. What Makes Day and Night? New York: Harper and Row.
Brett, Jan. 1989. The Mitten. New York: G. P Putnam.
. 1992. The Trouble with Trolls. New York: G. P. Putnam.
Brown, Margaret Wise. 1947. Goodnight Moon. New York: HarperCollins.
1949. The Important Book. New York: HarperCollins.
Brown, Ruth. 1981. A Dark Tale. New York: Dial.
Browne, Anthony. 1989. The Tunnel. New York: Knopf.
Bucknall, Caroline. 1988. One Bear in the Picture. New York: Dial.
Bunting, Eve. 1989. The Wednesday Surprise. New York: Clarion
1991. Fly Away Home. New York: Clarion.
Burningham, John. 1985a. Colors. New York: Crown.
1985b. John Burningham's 1 2 3. New York: Crown.
1996. Shopping Basket. Cambridge, MA: Candiewick.
Burton, Virginia Lee. 1942. The Lillie House. Boston, MA: Houghton Mifflin.
1976. Mike Mulligan and His Steam Shovel. Boston, MA: Houghton
Mifflin.
Day, Alexandra. 1989. Carl Goes Shopping. New York: Farrar, Straus and Giroux
DePaola, Tomie. 1989. The Art Lesson. New York: G. P. Putnam.
1996a. Baby Sister. New York: G. P. Putnam.
1996b. Strega Nona. New York: G. P Putnam.
de Regniers, Beatrice. 1988. Sing a Song of Popcorn. New York: Scholastic.
Diller, Harriet. 1996. Faraway Drawer. Honesdale, PA: Boyds Mill Press.
Dorros, Arthur. 1991. Follow the Water from Brook to Ocean. New York: Harper and Row.
1992. This Is My House. New York: Scholastic.
Dunrea, Olivier. 1989. Deep Down Underground. New York: Macmillan.
Duvoisin, Roger. 1962. Our Veronica Goes to Petunia's Farm. New York: Knopf.
Geisel, Theodore. 1957. The Cat in the Hat. New York: Random House.
Gibbons, Gail. 1985. The Milk Makers. New York: Macmillan.
Giganti, Paul, Jr. 1992, Each Orange Had 8 Slices. New York: Greenwillow
Greenfield, Eloise. 1972. Honey, I Love. New York: Thomas Y. Crowell.
1991. First Pink Light. New York: Black Butterfly Children's Books.
Hague, Michael. 1992. Twinkle, Twinkle, Little Star. New York: Morrow.
Hale, Sarah losepha. 1990. Mary Had a Little Lamb. New York: Scholastic.
Harley, Bill. 1996. Sitting Down to Eat. Little Rock, AR: August House.
Harris, Robie H. 1996. Happy Birth Day! Cambridge, MA: Candiewick.
Hartman, Gail. 1991. As the Crow Flies: A First Book of Maps. New York: Bradbury
Hayes, Sarah. 1986. This Is the Bear. Cambridge, MA: Candlewick.
Heller, Ruth. 1981. Chickens Aren't the Only Ones. New York: Grosset and Dunlap.
1991. Chrysanthemum. New York: Greenwillow.
Henkes, Kevin. 1996. Lillys Purple Plastic Purse. New York: Greenwillow.
Hest, Amy. 1995. In the Rain with Baby Duck. Cambridge, MA: Candlewick.
1996. Baby Duck and the Bad Eyeglasses. Cambridge, MA: Candiewick.
Hill, Eric. 1981a. Spot Visits His Grandparents. New York: G. P. Putnam.
1981 b. Spot's First Walk. New York: G. P. Putnam.
Hoban, Tana. 1989. Of Colors and Things. New York: Greenwillow. -.
1990. Exactly the Opposite. New York: Greenwillow.
Hoberman, Mary Ann. 1978. A House Is a House for Me. New York: Scholastic.
Hopkins, Lee Bennett. 1988. Side by Side: Poems to Read Together. New York: Simon and
Schuster.
Houston, Gloria. 1992. My Great Aunt Arizona. New York: Harper and Row.
Howe, James. 1984. The Day the Teacher Went Bananas. New York: E. P. Dutton. -,
1986. There's a Monster Under My Bed. New York: Atheneum.
Hutchins, Pat. 1968. Rosie's Walk. New York: Macmillan.
1972. Goodnight Owl. New York: Macmillan.
1986. The Doorbell Rang. New York: Greenwillow.
MacDonald, Amy. 1990. Little Beaverand the Echo. New York: G. P. Putnam.
Manushkin, Fran. 1990. Lalkes and Applesamce. New York: Scholastic.
Martin, lane Read, and Patricia Marx. 1996. Now I Will Never Leave the Dinner Table. New York:
HarperCollins.
Martin, Bill, Jr. 1993. Old Devil Wind. New York: Harcourt Brace.-. 1994. Wizard. New York:
Harcourt Brace.
Martin, Bill, Jr., and lohn Archambault. 1986. Barn Dance! New York: Henry Holt.
1988. Listen to the Rain. New York: Henry Holt.
Martin, Mary lane. 1996. From Anne to Zach. Honesdale, PA: Boyds Mill Press.
Mayer, Mercer. 1987. There's an Alligator Under My Bed. New York: Silver, Burdett andGinn.
McBratney, Sam. 1994. Guess How Much I Love You? Cambridge, MA: Candiewick
1996. Dark at the Top of the Stairs. Cambridge, MA: Candlewick.
McDermott, Gerald. 1974. Arrow to the Sun. New York: Viking.
McDonald, Megan. 1995. Insects Are My Life. New York: Orchard.
Merriam, Eve. 1993. Twelve Ways to Get to Eleven. New York: Simon and Schuster.
Micklethwait, Lucy. 1993. Child's Book of Art: Great Pictures, First Words. New York:
Dorling Kindersley.
Murrow, Liza Ketchum. 1989. Good-Bye, Sammy. New York: Holiday House.
Nikola-Lisa, W. 1994. Bein'with You This Way. New York: Lee and Low.
Opie, Iona, ed. 1996. My Very First Mother Goose. Cambridge, MA: Candlewick.
Pallotta, Jerry. 1986. The lcky Bug Alphabet Book. Watertown, MA: Charlesbridge.
Peek, Merle. 1985. Mary Wore Her Red Dress. New York: Clarion
1987. The Balancing Act. New York: Clarion.
Penn, Audrey. 1993. Kissing Hand. Washington, I)C: Child Welfare League of America.
Perkin, Rex. 1948. The Red Carpet. New York: Macmillan.
Peterson, Cris. 1996. Harvest Year. Honesdale, PA: Boyds Mill Press.
Potter, Beatrix. 1901. Peter Rabbit, New York: Viking Penguin.
Prelutsky, lack. 1983. The Random House Book of Poetry for Children. New York:
RandomHouse.
Ouackenbush, Robert. 1973. Go Tell Aunt Rhody. New York: Lippincott.
Rogers, Fred. 1996. Let's Talk About It: Divorce. New York: G. P. Putnam.
Rosen, Michael. 1989. We're Going on a Bear Hunt. New York: Margaret K. McElderry Books.
Rounds, Glen. 1990. I Know an Old Lady Who Swallowed a Fly. New York: Holiday House.
Royston, Angela. 1992. Eye Openers: Sea Animals. New York: Macmillan.
Rylant, Cynthia. 1985. The Relatives Came. New York: Bradbury Press.
1996. Old Woman Who Named Things. New York: Harcourt Brace Jovanovich,
Sampson, Michael, and Mary Beth Sampson. 1997. Star of the Circus. New York: Henry Holt.
Schwartz, David M. 1985. How Much Is a Million? New York: Scholastic
Sendak, Maurice. 1962. Chicken Soup with Rice. New York: Scholastic.
Shea. Peg! Deitz. 1996. New Moon. Honesdale, PA: Boyds Mill Press.
Shelby, Anne. 1991, Potluck. New York: Orchard.
Sis, Peter. 1989. Going Up. New York: Greenwillow.
Slate, Joseph. i996. Miss Bindergarten Gets Ready for Kindergarten. New York: E. P.Dutton.
Small, David. 1994. George Washington's Cows. New York: Farrar. Straus and Giroux.
Smith, Sarah. 1995. The Library. New York: Farrar, Straus and Giroux.
Snowball, Diane. 1995. Chickens. Greenvale, NY: Mondo.
Steig, William. 1969. Sylvester and the Magic Pebble. New York: Trumpet Club
Stevenson, Robert Louis. 1990. My Shadow. New York: G. R Putnam,
Stoeke, Janet Morgan. 1994. Hat for Minerva Louise. New York: E. P. Dutton.
1996. Minerva Louise at School. New York: E. P. Dutton.
Taberski, Sharon, ed. 1996. Morning, Noon, and Night: Poems to Fill Your Day. Green-vale, NY:
Mondo.
VanAllsburg, Chris. 1988. Two Bad Ants. New York: Houghton Mifflin.
Voake, Charlotte. 1996. Ginger. Cambridge, MA: Candlewick.
Literacy is the ability to use reading, writing, thinking, and speaking in the real word.
Literacy implies that a student will not only read and write in school, but they will also
apply their literacy skills to everyday situations. Literacy acknowledges the reading and
writing connection.
This section deals mostly with the reading aspect of literacy. Writing information can
be found in the “Writing” section.
Children enter kindergarten classrooms with valuable literacy skills already in place.
They are often able to read environmental print such as the names of favorite restaurants
and favorite toy stores. They possess emerging writing skills such as scribbling or picture
drawing. Their skills have been developed through meaningful situations at home and/or
in a preschool setting.
Kindergarten, being the first year in a public education setting, is a crucial time in the
literacy development of a young child. The goal must be to instill a love of literacy in
children. They must see themselves as readers and writers. Teachers must value the
literacy skills children already possess and help them develop those skills so they enter
first grade with useable knowledge about print. What kindergarten teachers are required
to teach in the area of literacy has changed dramatically in the past five years. Mandated
tests for kindergarten are being implemented to assess how well teachers and students are
doing in this area.
New research shows that children need to enter first grade with a strong knowledge
about literacy in order for them to be successful. This knowledge can be grouped into five
main areas:
! Alphabet recognition: Knowing the names of the letters and the sounds they
represent, as well as, the Alphabetic Principle; which includes an understanding that
each phoneme has its own graphic representation.
! Conventions of print: These concepts are also referred to as print awareness skills and
they refer to print concepts such as directionality and book knowledge. Students must
also have the ability to identify the language terms used in reading instruction, such
as word, sentence, space, beginning, middle, end, sound, period and question mark.
! Phonemic Awareness: The knowledge that a word is made up of specific phonemes,
or sounds, and the ability to verbally manipulate these sounds.
! Phonics: The ability to apply the specific sounds in words to our written symbols.
This goal encompasses decoding, word analysis, and word recognition strategies
necessary to reading.
! Instructional language: The ability to identify terms used in reading instruction, such
as word, sentence, space, beginning, middle, end, sound, period and question mark.
! Comprehension Strategies: Kindergarten students must have many opportunities to
listen to literature, retell and sequence stories, predict outcomes, identify the main
characters and the setting of a story. Comprehension strategies also include
questioning techniques used by the teacher to encourage higher levels of thinking, as
described in Bloom’s Taxonomy.
The many different teaching styles used to teach children how to read; phonics, Whole
Language, sight word methods, direct instruction, phonemic and phonological awareness,
and developmental activities, all have their place in a kindergarten classroom. It has been
learned over the years that reading programs should not focus on only one aspect of
reading and exclude other areas.
For many years teachers have taught letter recognition through “Letter of the Week”
activities in which the focus is on identifying letters, applying sound-symbol
relationships, and writing the symbol for one letter each week.
Now teachers are moving away from the letter of the week activities, and moving
toward a more balanced approach using meaningful activities that focus on true literacy,
not only sounds and symbols. These activities tend to be thematic units based on topics of
great interest to the children in their classroom. In a balanced approach students learn the
Alphabetic Principle in relation to thematic units. They are not taught in alphabetical
order or with a one-letter–a- week focus.
1. Letter Names:
begin the year teaching only the names of the letters. Knowing only the names of the
letters helps children understand the alphabetic principal. This first step will provide you
with instructional labels to use as the year continues.
2. Alphabet Songs:
notice that many children have learned the letter names by singing the “Alphabet Song”
or other alphabet songs, poems or raps that are commercially available. Many cassettes
and c.d.’s can be found which have variations of the alphabet song. One example is
Chicka Chicka Boom Boom by Bill Martin and performed by Ray Charles.
3. Alphabet Books-
Begin activities centered on recognizing the written symbol and the sound-symbol
relationships after students are able to say, sing and/or rap the alphabet. Alphabet books
are wonderful resources for developing sound -symbol relationships as well as building
vocabulary. Children may recreate their own alphabet books following a similar pattern
to an alphabet book the class has read. Wiley Blevins book Phonics from A to Z has
many great ideas for teaching alphabet recognition skills.
4. Alphabet Center-
Create an alphabet center in the classroom and stock it with a variety of alphabet forms
(such as magnetic letters, sandpaper letters and rubber stamps). Also included should be
materials that can be molded into letters (such as play dough, or pipe cleaners) and a
variety of writing materials (such as chalkboards or dry erase boards). Teachers should
allow students time to explore and duplicate letters in this center.
5. Alphabet Cereal-
Help children to discriminate between the similarities found in letters and then look for
the differences found in letters. Alphabet cereal can be used to sort letters according to
similarities and differences.
6. Letter Writing-
Introduce letter writing practice along with letter recognition activities. Learning to write
the letters helps children remember the shapes. Students should be provided with lots of
unlined paper as they begin the writing process.
7. Clever poems-
Use clever poems as a memory tool to help students remember how to write their letters.
Scholastic Spelling (1998) has a poem for each letter for this purpose as well as the
D’Nealian Writing program. Waterford Early Reading Program also has a set of sayings
to go along with each letter.
3. Book Club:
Pull a group of three or four children together and, over a several day period, read many
versions of one story such as the Three little Pigs. The teacher can lead the small group
in discussions that encourage children to compare and contrast the stories.
4. Picture/word/sentence:-
Take a photo of each student (a digital camera works well for this) and mount it on a
sturdy piece of paper. Under each photo the teacher can write the student’s first name and
put all the photos into a notebook. After looking at the photos and reading the one word
written under each photograph, the notebook can be placed in the writing center for
several weeks. When students are familiar with the names of their classmates, the teacher
may gather the class together with the notebook and ask students to help you write one
sentence under each photo which will help you learn more about each student. As the
teacher writes the sentences, a description of how the sentence has more than one word,
spaces between words and punctuation marks at the end may be added. Students will love
to study the photo directory in the writing center.
1. Rhymes-
♦ copy a favorite poem with rhyming words onto chart paper. As the class reads the
poem, the teacher can change the poem by inserting different rhyming words.
♦ make rhyming word strings by saying three rhyming words to the class such as
“man, can, fan…..” and encouraging the class to think of as many words as
possible to add to the string, such as “…tan, van”.
♦ play Read My Mind. The teacher says, ”I am thinking of a word that rhymes with
dog and starts /h/… “hog”.
♦ use cloze activities and ask students to complete sentences with a silly rhyme,
such as:
“There once was a dog who had a funny ______”.
2. Alliterations-
Make a class book using alliterations that have been written and illustrated by students.
One student can write alliteration, such as “Pink pigs play Ping-Pong” and then another
student can illustrate the alliteration. They may be placed in a book in the library center.
4. Taking Roll-
Write each student’s name on a card and place in a pocket and choose a question each
morning such as “Does your name start with a /s/?” The teacher may write a question on
a sentence strip and place at the top of the pocket chart. As students arrive at school they
will find their own names and put them into the YES row or the NO row. Later in the
day, read the pocket chart with the class and count the number of names in each row.
This same activity can be used for beginning, medial and final consonants and also
counts as a math extension activity in graphing.
4. Silly Names-
Write each student’s name on an index card. Place the cards in a pocket chart. Select one
capital letter and write it several times on separate index cards. Cover the first letter of
each child’s name with the capital letter. Invite children to read the new silly names.
$ Rubber Band Stretch: The teacher may give each student a fairly large rubber band
and ask them to “lock” their thumbs and forefingers around the rubber band and
stretch out words. The teacher tells students “we are going to stretch out the word
cat”. Students may slowly stretch out the rubber band as they say the word
“CCCCCCCCAAAAAAAAATTTTTTTTT” then snap the word back together again
and say “Cat”.
1. Journal writing:
Encourage students to apply their phonemic awareness skills to written words through
journal writing activities. (See “Writing” section for journal activities).
2. Sound swap:
Read a rhyming book such as Dr. Suess’s Green Eggs and Ham, and then write a word on
the board, then demonstrate how to swap beginning letters to make rhyming words using
word examples found in the book, such as box and fox.
3. Word Wall:
Choose several words each week from a phonics lesson and post the words on a word
wall (maybe in alphabetical order) where the whole class can see them. Then the teacher
may encourage children to practice them daily with reading and writing activities.
Alphabetic Principal: The idea that each phoneme has a graphic representation.
Phonemes: Units of speech that are represented by written symbols such as the alphabet.
Phonetics: The way in which speech sounds are articulated, such as how the teeth,
mouth, tongue and vocal chords are used to produce a sound.
Phonics: The system in which symbols represent sound. A method of teaching reading
and spelling that emphasizes sound-symbol or sound-spelling relationships.
ALPHABET BOOKS A TO Z
*********************************************************************
For additional books, see "Read-Aloud Books for Developing Phonemic Awareness: An
Annotated Bibliography" by
Hallie Kay Yopp. The Reading Teacher 48, no. 6, March1995.*
*********************************************************************
Development of Manipulatives
Setting Up Manipulatives
Introducing Manipulatives
Play with manipulative materials develops fine motor skills, but specific activities can
be designed by the kindergarten teacher to develop dexterity in arm and finger
movements. These activities are more relevant to a child’s development than exercises in
copying letters. The following are some of these activities:
! Typing at a center with an old typewriter
! Sewing with darning needles in Styrofoam meat trays or burlap
! Kneading, squeezing, pouring, in cooking projects
! Woodworking that includes hammering and removing nails and sawing
! Tracing of simple line drawing through tracing paper
! Cutting scraps of material and paper for collage
! Drawing and painting on easels or tables with a variety of media using different size
paper and brushes or markers
! Finger painting
! Playing in water using a baster, sponges, funnels and eyedroppers
! Using tongs and tweezers to pick up blocks or beads
! Playing in rice, sand, and/or water with utensils and containers
! Playing with play dough and clay
! Stringing beads
! Building with construction materials
! Playing with puzzles
! “Writing” in a variety of ways using a multi-sensory approach:
. with finger in a tray filled with salt or cornmeal
. on a partner’s back and see if the partner can guess the symbol written
. with finger, nose, knee, elbow in the air
. in zip-lock freezer bag filled with jelly-like material
. with a magnet using a container filled with iron filings
. using bleach on a cotton swab on black paper
. with finger over word which has been written with glue and then sprinkled with
cornmeal, salt or sand
You can say these direction words for the capital letters as you and your students
practice forming them.
You can say these direction words as you write the letters,
Math is in every center and part of each day in the kindergarten classroom. Math
experiences may be done in a variety of ways including whole group, small group,
individual child, or center style. Mathematics Their Way, a K-2 program by Mary
Baratta-Lorton, provides a variety of tubbing ideas that may be used for math activities.
Mathematical development in young children is nurtured when children are allowed to
pattern, classify, compare, manipulate concrete objects, count and develop an
understanding of number through free exploration, and through guided learning.
In addition to the materials for Math Their Way and collected materials,
Workjobs and Workjobs II by Mary Barratta-Lorton provides ideas for adult-made
manipulatives that may also be incorporated. Vital in setting up math activities is
organization. As each manipulative or math job is introduced it must be labeled with a
corresponding labeled area to store it. Organization helps teach students independence,
allowing them to do math activities independently. Part of that organization is record
keeping, be it check lists, stickers, or completed job sheets.
Critical to the introduction of any math activity, is the concept of free exploration.
By allowing children to spend time experiencing the materials on their own terms, then
the teacher directed activities will be much better received and children will be more
likely to stay on task. It is also important to discuss rules and expectations. Teachers
should introduce mathematical concepts as actions on things. Children should be
involved in a variety of activities that focus on the process rather than on the answer.
Kindergarten children need rich and varied experiences with these concepts.
When introducing number operations, teachers should only ask children to work
with the quantity of objects that they can count, or one beyond, to provide a manageable
complexity. They should construct a variety of arrangements of numbers of objects using
a range of materials from their environment over an extended period of time. The
concept of conservation should be introduced and developed in this way. Activities
involving counting forward (addition), counting backwards (subtraction) and counting be
twos (multiplication) should also be introduced this same way and teachers should
always remember that doing and understanding these activities is more important than the
verbal expression of the actions. The design of the math program should provide for this
gradual evolution of ideas.
The following are examples of strategies to teach math objectives and are
organized according to specific curriculum objectives. For each objective, the teacher
may have children:
Perform computations:
! at snack time, count snacks and eat one then see how many are left
Problem-solving skills:
! draw maps to a location charting the shortest distance then use them to check
reasonableness
Apply technology:
! use a calculator in a dramatic play center, such as a store or bank
Measurements:
! use one inch links to measure objects from around the classroom
Music provides a natural form of expression for the child, beginning with
rhythmic movement and basic sound syllables. An appreciation of music is developed
through singing, listening, creative movements, and playing instruments. The child learns
new words, concepts and cultural understanding through music.
The beginnings of music for children are rooted in motor-sensory experiences and
natural play. Children continue to experiment with movement and sound, gradually
learning to associate them with meaningful ideas. Music becomes a deep, integral part of
the personality—an expression of feelings and thinking comparable to painting.
The teacher will need to enjoy music with children in many ways. Singing
spontaneously during cleaning, transitions and circle time are a few ways. Children
actually enjoy a simple sounding voice, so don’t worry about your talent. Kindergarten
student’s sing because it makes them feel good. Teachers should work towards the same
goal, regardless of talent!
Musical experiences that involve the whole child should be provided. The teacher
should use verse or familiar tunes while giving directions or doing daily opening or
transition activities. Teachers should include activities throughout the course of the year
that include the following areas, which are vital to a good music program. These can be
considered goals for a kindergarten music program.
Pulse
Find the basic underlying beat.
(singing games, clap/pat/tap, counting beats)
Pitch/Melody
. Identify high and low sounds.
Creative Movement
. Perform actions to a song.
. Perform a dance to a song.
. Play games with movement.
. Move in response to tempo changes.
. Move parts of body (walk, jog or gallop) to a steady beat.
. Explore free movement with a steady beat
Instruments
. Play non-pitched instruments loudly or softly.
. Play non-pitched instruments to a steady beat.
. Play non-pitched instruments as rhythmic accompaniment to the rhythms of a
song or poem.
The teacher should offer easy to play instruments such as tambourines, xylophones,
bells, maracas and shakers. Children can make many of these at the art table. Also,
introduce each item and describe how you would like it used. Talk about what might
happen to the instruments if they are misused. Children should be given an appropriate
amount of time to explore with the instruments, before they can be expected to reproduce
rhythmic patterns or play on cue.
Singing
. Become familiar with new songs and fingerplays.
. Sing in a regular voice instead of a shouting voice.
. Choose songs for the class to sing together.
Teachers should select songs that are easy and fun to sing and sing with the children.
The teacher should use both high and low sounds and teach the children how to produce
them, but choose songs in a limited range of just a few notes and avoid wide skips across
the scales. Many experiences for making up different words to familiar tunes should be
provided.
Listening
. Recognize the presence of sound—Auditory Awareness.
(Move to a sound, change directions, freeze to a signal)
. Distinguish between sounds and categorize them such as high/low, loud/soft, or
fast/slow—Auditory Discrimination. (Indoor/outdoor sounds, different rhythms)
. Reproducing sounds in a particular order—Auditory Sequencing. (Echo games,
pulse activities, water filled jars for high/low)
Due to the nature of gross motor development and the wide range of equipment
children use, safety is key in instruction. With the use of a few classroom materials and a
readily available playground, physical development activities can easily be part of each
kindergarten week, aside from a physical education class or recess. The main areas of
responsibility for the classroom teacher include the ability to move through space, the
ability to maintain body position, walking and running skills, balance, and throwing and
catching skills.
Many physical development activities are group games and circle time lends itself
well to introducing activities, going over rules and discussing safety standards. Another
format for physical development activities is through the use of centers. Once children
are aware of rules and expectations they may easily rotate to centers with independence
and success.
• 20’ parachute
! Bean bags (alphabet bean bags)
! Hula hoops (6)
! Sponge balls – variety of sizes
! Jump ropes (6)
The following are examples of strategies to meet physical development goals and are
organized according to specific curriculum objectives. For each objective, the teacher
may have children:
Balance skills;
# Practice balancing and walking on a thin line out on the playground. (It is easy to
take the class to recess and play Follow the Leader, challenging students to see if they
can stay on the line without stepping off.)
A good science center does not require a great quantity of expensive materials.
Some basic equipment may be used, like magnifiers (hand held and stand variety)
balance scales, and magnets, and other items may be changed according to the themes
used during the year. By using materials common to their environment, children become
comfortable with the freedom to investigate. A covered water table or a child height desk
would be an excellent place for an inquiry center. Water cannot be used constantly but
often is an extension of the inquiry activities. As in most centers, there should be a limit
to the number of children allowed. Two children can often interact well in this small
center. Since this center is not used whole group (although often introduced whole
group) it can be small and more or less tucked into a small space. This could be a good
use for a few feet to the side of a hall type space even next to a door where the traffic
flow is only when the entire class is going in or out of the room. Posters with a science
content relating to the current activity or theme can be placed on the wall above the table.
Small independent experiment instructions can also be displayed in this manner.
Children come to school with a sense of wonder, already knowing a lot about
themselves and the world. Teachers should strive to build on their existing knowledge
and let their sense of wonder grow and flourish. As a teacher begins a science center, the
children’s interest may dictate areas of inquiry. A teacher may also have a particular
interest in a material or topic and would like the children to share in that area. The
teacher should also consider what themes are being taught throughout the year and what
topics need to be addressed as curriculum goals.
Free exploration is important. Yet the wise teacher should identify rules and
expectations for the children. Most science center materials can be moved easily to a
whole group to introduce, demonstrate, create curiosity, and then returned to be used
independently. The first few days of a new emphasis may be a good time to have a
volunteer “hover” near the inquiry table. Some activities that need a lot of supervision
may need a checklist and a volunteer to make sure every child has a chance to do the
experiment. A teacher may wish to develop a chart to post near the science table for
volunteers to read while helping.
SAMPLE CHART
FOR GUIDING THE INQUIRY PROCESS
SCIENCE
Child will initiate project, work only at Science Area, and clean space and
return materials to proper space when finished. If interest expands into another
area, an adult must be available and observing.
Examples:
! Water and bubbles may be moved outside on the lawn or in the sink
! Constructing ramps for velocity and weight experiments may end up in blocks or
on large tables.
! Magnets would need to be moved to discover what objects in the room would
attract or repel.
Such integration is desirable. However, this needs adult supervision so materials can
be returned and children remain on task.
Children of kindergarten age need to “rediscover knowledge” themselves.
Resist the temptation to explain. Instead, ask “Why did this happen?” “What might
happen if . . .?” “How could we make . . .?” Accept answers. Ask children to explain the
reason they think something is. Deal with the process. Encourage problem solving,
curiosity, interest, and allow the materials and activity to stretch the mind and
integrate the scientific method into all phases of life.
Volunteers may opt to take dictation, write stories or equations from what
happens. These may be hung up or shared with the whole group.
Purpose:
Everyday materials can encourage children to explore, manipulate, and
experiment with life in general. The process of understanding cause and effect; and
making guesses and testing them is the basis for all science.
Recommended List of Science Materials- listed in order of priority
! tweezers
! eyedroppers
! clear containers
! small magnets (marble, on sticks etc.)
! thermometer
! compass
! basic set of slides /hair sample, insect leg etc.
! binoculars
! animal container like aquarium, ant farm etc.
! household type consumables:
. vinegar . ammonia . sugar
. baking soda . bluing . balloons
. salt . briquettes . cotton
. cornstarch . baking powder . zip sealing bag
A popular science center activity is a sink and float exploration. Many different
variations can be found in most young children science books. The following is an
example of how a simple experiment can include all of the parts of a classic scientific
inquiry experiment.
Lead a discussion about water. Preferably after there has been adequate time for
free exploration in a water table with many different objects available. Ask what there is
about water that can be investigated. Tell the class that they are all scientists if they just
follow certain steps. The first thing is to find an area of interest about water that can be
made into an experiment. List all suggestions. Agree that you think all these areas could
be investigated. Ask permission to help the class devise a plan to investigate sinking and
floating. Most children would be obliging.
Guide the class in discovering a way to sort what sinks or floats. Take all
suggestions. Ask questions about how to keep the water off the floor, how to separate
items, how to remember and make clear to everyone which place is for floating and
which is for sinking. Most classes will want three containers one for unsorted, one for
sinking items clearly marked, and one for floating items clearly marked. You may
suggest a combination of both words and pictures for marking. The class usually decides
to have a laminated paper on the bottom of a container with sponges or towels. Some
think of permanent markers, some even wish clear containers with paper underneath.
Allow the class to spend some time in experiments with no permanent data keeping.
Explore data and evidence.
Discuss how the class is ready for the last three steps of scientific inquiry. (After
some explanation of terminology the children will love the big term and use it.) Try to
have the class remember all the data they have discovered. It will become evident that
they can not accurately remember what it was that happened and there will even be
different opinions about what did and did not sink. You may explore with them a method
of keeping track of what happens or you may present them with a solution. The latter
works well the first time children are confronted with such a problem. This age is not as
quick to come up with a symbolic method of record keeping as they will be in actually
doing the experiment.
A simple chart is best. Divide the paper in halves and label each side exactly like
the actual container used in the experiment. Have a short list on each side.
sink float
1.___________________ 1.____________________
2.___________________ 2.____________________
Some Hints;
. Have two children work at a time, one to record and keep the paper dry, the other to
actually place the objects in the water.
. Mark objects with a number or letter (letters actually seem to work best)
. Limit the number of objects.
. Check the water table hints under the Sensory Activity section of this guide.
After modeling the procedure, allow students to turn in one paper each over several days.
Now explore data and evidence.
The children will be able to prove whether all the objects sank or floated. They
will love making predictions and as a whole group you may model how to predict and
then test using several never before used objects. Try to discover some unusual items.
This of course may start many new avenues of scientific inquiry explorations. The class
may request formal experiments to explore by prediction which will sink first, how can
things be prevented from sinking, (try salt, soap, blocking the bottoms)! Such
excitement!
The following areas of inquiry are for possible inclusion in a science program.
The science program, of course, is not limited to these areas, does not require the use of
every activity here and is considered an integral part of all other areas of the curriculum.
The science center is an excellent place to meet science curriculum objectives, as well as,
objectives from other content areas.
Exploration Table
The children’s current interests may dictate the focus of the exploration table as
they contribute “found” items and observe, experiment, and predict. Again, the teacher
may have a personal collection of materials to share with the class or curriculum goals
may dictate the theme of the exploration table.
The teacher should introduce exploration activities to the class as a whole group,
even if this means moving items to a different area to facilitate the introduction. The
teacher should model the use of scientific tools with items on the table. The teacher
should guide the children in a discussion of rules and guidelines. Some items on the table
may be described as “just look” and it can be explained that other items can be touched.
The distinctions should be made clearly to the children.
Fossils:
Items may include: fossils of shellfish, plants, insects and animals/non-fossils may
include; beef, chicken, pork, and reptile bones. Also included: models of fossil skeletons,
museum postcards, seashells, and animal teeth
! sorting activities to discriminate fossils from non-fossils --M
Birds:
Items may include: types of nests, feathers, eggs and eggshells, preserved specimens, owl
pellets
! responding to posted questions i.e. “What do birds have that no other animal have?”
--R
Insects /Spiders:
Items may include: ant farms, old aquarium with butterfly larva, polyurethane specimen
blocks, live specimen containers, nests and hives, web models.
! weaving materials may include variegated yarn and sticks to make webs.--A
Signs of Autumn:
Items may include: leaves, vegetables, cones, seedpods, nuts, fruits, fur samples
! cultural artifacts may be included to illustrate fall harvest celebrations.--SS
Five Senses:
Items may include: food specimens, dried flowers and herbs, candles, animal hides,
geological specimens, recordings of animal sounds, individual slide projector with slides,
kaleidoscopes, mirrors, and telescopes
! illustrate the sounds on the animal recording. --A
Human Anatomy:
Items may include: models of the ear, eye, heart, skeleton, brain, and posters illustrating
body systems
! matching pictures of healthy habits to related body parts. --H
Plant Life:
Items may include: bulbs, nuts, pinecones, fruits/vegetables, leaves, bonsai plants, seeds
sprouts, various types of plants, soil samples, mulch, water, terrarium.
! growing log to document plant growth. --W
! leaf rubbings, fruit prints, and collages. --A
Geology: Rocks
Items may include: globe, types of rocks; metamorphic, sedimentary, volcanic, etc.
fossils, polished stones, sand, and water
! sort and classify rocks.--M
The Environment:
Items may include: living/non-living items, trash collected from a clean-up walk, man-
made and natural “trash”, recycling signs w/sample items
! list ways to conserve energy.--W
! sort trash by recyclable and garbage. --M
Animal Groups:
Items may include: collections of small animals to illustrate groups like; pets, zoo, exotic,
extinct, farm, wild, endangered, fictional
! animals are graphed according to each group. --M
! illustrations for each animal group. --A
! write stories about animals.—W, R
The teacher’s role is to provide the materials and stimulate the learning toward
more specific discovery. The suggestions listed later are often inter-disciplinary in scope.
They are meant to be pursued if the right opportunity in the learning situation presents
itself.
Anything small, safe, and interesting can be used in a sand table for sensory
experiences. Beans, rice and other grains are often used. They can be placed in a tub on
top of another table, or placed on the floor inside a large shallow box to facilitate cleanup.
Teachers can discover unusual items of great interest to kindergartners to use in a sensory
table. Little nubs that are replaced with steel studs in snow tires have been introduced
during dinosaur units to replicate lava beds. A teacher can design mass conservation
activities if clear unbreakable containers and scoops are provided in a sensory table.
Often unguided exploration allows a child to rediscover many important math and
science facts. Sand and water are important enough to warrant the following specific
instructions, but these instructions can be easily modified to address many other types of
media.
Sand, like water, can be used in many open-ended activities. Not only can this
calm and interest a child with high movement needs but touch facilitate learning as
nothing else can.
A teacher can provide materials and be available for extensions in the sand center
including; labeling and dictation. Adding or simplifying accessories can guide
discoveries, as, well as using open-ended questioning techniques.
Children should have access to both wet and dry sand as well as the fine and
coarse varieties. Plenty of opportunity should be provided for the children to experiment
with these properties. (Silicon sand should not be used, due to the fact that it has been
linked to respiratory problems). A solid sand table or a waist high large container should
be on an easily swept floor surface. Small handheld brooms and dustpans help children
be responsible for clean up. Long handled brooms are not recommended as they can be
clumsy for use by children. There is an overlap between sand and water. Many of the
containers used for water may also be used with sand.
Sand Table
Add props for any thematic unit. Dinosaurs, cars, people, buildings, etc. will
create even more opportunities for social interaction. --SS, S, M
SAND
Care must be taken that sand not get into eyes! Whenever sand appears
on the floor, the children need to stop and sweep it up right away (Small brooms
and dustpans are available). A child must ask an adult when water is wanted.
AN ADULT MAY HELP BY:
# observing and listening
# taking dictation
# making labels
# guiding exploration with questions. Questions should not expect a right or
wrong answer.
# pointing out similarities of what is happening in the sandbox to the pictures
above the area.
Purpose:
Sand is a good medium for experimentation and necessary to internalize
mass, conservation, and other scientific concepts. The tactile experience is
valuable for some learners, as, well as relaxing. The social interaction and drama
possibilities are endless.
Water Table Center
Water play often begins on the sensory or free exploration level. Splashing and
pouring, messing and mopping, moving hands and containers through the water are
important parts of learning. Water play can be relaxing and satisfying, especially to the
child who tends to be explosive and scattered, immature, or withdrawn and insecure.
Water is an open-ended medium that can be used to observe and understand many
important physical properties. Experimentation with water initiates and answers many
scientific and mathematical questions. Water is also essential for all life and can be
interesting to a child lover of plants and animals. Free play can be guided by the
addition of specific items. Seasonal considerations lead naturally into snow, ice, or even
soap additions. The suggestions listed later are just a few ideas for integrating this
versatile center. They are good to keep in mind for the right moment. The goal is to
stretch the mind of the child, awaken curiosity, and enhance understanding.
Water play has often been avoided by kindergarten teachers because of the
potential for messiness, yet water is one of the most open-ended, familiar, and easily
obtained learning materials in the child’s world. A waist high container (preferably a
small water table) on easily mopped surfaces (or, with an adult observer, outside) helps
avoid cleanup problems. Specific rules and expectations can create an environment of
experimentation, exploration, and curiosity rather than just wild play. A smaller tub in
the sink may be used for a specific water assignment like sink or float experimentation
centers. A towel on the counter to place objects also helps in cleanup. Children can
become very responsible with a bowl of cleanup sponges that are always available.
Social Studies is the study of how people that share a common environment define
the conduct, standards, organization and activities of their society. Within a
developmental kindergarten classroom, all the learning that takes place could be called
social studies. Social Studies concepts are often the ideas that generate the thematic units
that connect the kindergarten curriculum.
The social environments of study for kindergarten are; the concept of self, family
and the community. In addition to these, the kindergarten teacher may develop additional
units that cover other concepts identified in the social studies objectives. Thematic unit
ideas may also generate from the kindergarten children themselves, as the teacher
recognizes a particular interest in their play and conversation. Wherever the idea comes
from; curriculum dictated, teacher assigned, or student generated, social studies objectives
can be easily met through any thematic unit.
Materials for use in social studies come from life situations and require very little
commercial materials. A globe, some maps, posters and some puppets may be all that is
provided in the classroom. The majority of materials can be gathered from real life, as
props and artifacts. Field trips, classroom visitors, audiovisuals and books also support
the social studies concepts. A good literature list is critical to setting up social studies
activities in the kindergarten classroom.
An important area for the introduction of social studies concepts is through the
dramatic play center. A well-developed center can provide opportunities for discussion
and problem solving of social situations as a means of fostering personal growth and
building a sense of community. This center can also provide opportunities for children to
interact with real props and artifacts in order to facilitate their understanding of social
concepts that may be beyond their own experiences. These concepts may be taught
through centers such as dramatic play, but can also be the focus of whole group
discussions.
Curriculum Connections:
The following is a sample of a social studies thematic unit that illustrates some of
the curriculum connections that can be implemented in a kindergarten classroom.
Thematic Unit Sample: “Community Helpers”
Art Activity -
Provide a variety of fruits and vegetables that might be found in a grocery produce
department, cut in half, dipped in paint and used to create food prints
Block-building Center -
Use empty cereal boxes (taped shut) to “build” food displays - use empty cans (with safe
edges) for stacking pyramid-style
Cooking Activities -
Create a lunch menu using ingredients purchased from a field trip to the grocery store,
each ingredient or item coming from a different section of the store
Field Trip -
To local grocery store; with class organized into small groups (4 or 5) with an adult
leader; children complete an assigned checklist (see sample)
Health Activities -
Classroom visitors from the health professions; such as, a doctor, EMT, or dental
hygienist to present information about their careers
Library/Listening Center -
To Town, by J. Cowley Daddies/Mommies at Work, by E. Merriam
Jamal’s Busy Day, by W. Hudson Doctor De Soto, by W. Steig
Night City, by M. Wellington Fire Trucks: Nut and Bolts, by J. Boucher
Bruno the Baker, by L. Klinting Little Nino’s Pizzeria, by K. Barbour
Building a House, by B. Barton Mommy’s Briefcase, by A. Low
Officer Buckle and Gloria, by Whose Hat? by M. Miller
P. Rathmann
Literacy Activities -
A shared reading activity with the book Don’t Forget the Bacon by P. Hutchins (a story
that plays with rhyme and is about a little boy who is going shopping for his mother)
Math Activities -
Balance scales and other types of scales used to compare/contrast food items
Food items in the grocery store may have “prices” added
Physical Development -
Children form “train” by locking arms with elbows and “chugging” up a hill
Science Activities -
Place small pieces of food into empty film containers, (peanuts, lemons, cinnamon, etc.),
children smell the contents and match a picture to the smell
Sensory Table -
Sand table; children draw city map in the sand and add props like vehicles, miniature
block houses, small plastic trees, small train set and tracks
Technology Applications -
“Richard Scarry’s Busytown” by Davidson
Workbench Center -
Set up a “REPAIR SHOP”; place old appliances at the workbench and use small hand
tools (screwdriver, hammer, pliers, clamps, etc.) to “fix” and take apart
Writing Activities -
As a group, children generate a list of items to be purchased at a grocery store, children
add cut-outs from food ads and magazines, this list is posted in the writing center with
strips of paper for children to write a shopping list before entering grocery store (dramatic
play)
Some other Social Studies thematic ideas might include units called:
! All About Me
! Transportation
! Babies/Growing
! Food
! Clothing
! The Farm
! Holidays/Seasons
! Pets
! My Family
! Machines
! The Neighborhood
SAMPLE CHECKLIST FOR GROCERY STORE FIELD TRIP
Produce Section:
# How many different kinds of apples can you find? _________________
# What is the price per pound of potatoes? _______________________
Frozen Food Section:
# Write down a brand name of chocolate chip ice cream.______________
# Find a kind of frozen food that is served for breakfast.______________
Non-Food Section:
# Find a brand of toothpaste that starts with letter “C”._______________
# Which cost more Johnson & Johnson Band Aids or the store brand of
bandages?___________________________________________
Canned Foods Section:
# Find a food that comes in a can and rhymes with horn.______________
# Name a kind of meat that comes in a can_______________________
Boxed Foods Section:
# Name a cereal that is made from oat bran.______________________
# Find a box of macaroni and cheese dinner. Look on the back and write
down how many servings it makes.___________________________
Bakery:
# Find a bread that comes in a white bag with balloons on it.___________
# Name a kind of pie that you found in the bakery.__________________
Dairy Section:
# How many different types (1%, skim, etc.) of milk can you find? ________
# How many different sizes of eggs can you find? ___________________
Meat Section:
# Name a type of meat that comes from a pig (pork)_________________
# Name a meat that is sold as ground meat._______________________
♠♠♠♠♠♠♠♠♠♠♠♠♠♠♠♠♠♠♠
TECHNOLOGY
APPLICATIONS
After the teacher previews new software, the teacher may gather the class around
one computer. The teacher may introduce the name of the program and talk about the
options available. For instance, some programs will be simple letter identification. There
are also word processing and publishing programs. The teacher should let the students
know what the program is about and demonstrate some areas they can explore.
Reading
Sound It Out Land
Kidspeak—Transparent Language
Dr. Seuss ABC’s
Bailey’s Book House
Franklin’s Reading World
Writing
Kidworks--Davidsons
Storybook Weaver—MECC
Math
James Discovers Math
Millie’s Math House
Number Maze
Nick Jr. Play Math
Science
The Backyard—Broderbund
The Treehouse—Broderbund
The Playroom—Broderbund
Multimedia Bug Book
Sammy’s Science House
Zoopolis—Kidsoft
McGee Series—Davidson
Social Studies
Richard Scarry’s Busytown—Paramount
Great Adventure Series—Fisherprice
Gus Goes to Cyberstone Park—Kidsoft
Miscellaneous
Trudy’s Time and Place House
Thinkin’ Thing’s, Col. 3—Edmark
Tessel Mania Deluxe--MECC
Crayola’s Amazing Art Adventure
Putt Putt Goes to the Moon
Madeline Pre-K and K Deluxe
Ready for School
Madeline’s Rainy Day
Computers do many jobs for us. Each part of the computer has its own job.
There are:
4Parts to receive information
4Parts to give information
4Parts to do work
4Parts to remember things while the power is on (short term memory)
4Parts to remember things when the power is off (long term memory)
Printer Output
Processor Work
Keyboard Input
Mouse Input
CD Rom Storage
WORKBENCH CENTER
A workbench center helps children to express creativity using wood as the media,
and offers building as a means of non-verbal expression. The workbench center offers
children an opportunity to plan and work with others to solve common problems and also
to relieve tensions. Whether it is as a carpentry bench or a take apart center, these
activities help children to discover concepts of quantity, length and inequality, develop
large muscle coordination, problem solve and improve eye-hand coordination.
The teacher may place a log on end to teach hammering. The grain is open and a
nail can be driven in easily. Roofing nails are easy to hammer into a log. The heads are
wide and the length is short enough to allow children to pull it back out. Later in the year
the teacher may introduce the saw, soft wood scraps, and a nail assortment. It is best to
use only a log, goggles, roofing nails, and hammers during the first hammering
experience.
The log on should be the floor in a position where dividers, walls or the table
surrounds children while hammering. All children must wear safety glasses and it is
recommended to have an adult sized Plexiglas divider surrounding the carpentry table.
The teacher can draw the shape of the hammers, goggles, saw, and nail containers
on a table or shelf to facilitate cleanup and safety. The saw teeth should be placed against
a barrier to the far left of the table so while a child is hammering the teeth are against a
wall and not in a position to cut hands. Some teachers prefer hanging all equipment on a
divider. The shapes of the equipment can be drawn on the pegboard in the wanted
position. The vise is for holding the wood while being sawed. It should be on the far-left
edge of the table (directly in front of the saw). There should be room for the wood to
extend out through the vise to the left of the table. That is where children will stand
while sawing. Consideration should be given to lighting, storage, ease of cleanup, and
adequate space for movement. Some teachers mark the floor with a line to show where
no one may pass while the center is in use.
When starting woodworking for the first time, the teacher should be available
during the whole time for close supervision. Children should be taught that tools must be
kept at the workbench and that they are to be used only for the purpose for which they are
designed. They will need instruction in learning to use the tools properly. The teacher
should point out the seriousness of using adult tools and may want to arrange for a
carpenter to visit the classroom. One child is the safest number to allow in a carpentry
center. It may be advisable to only allow one child as a watcher. In a whole group setting
the teacher should discuss the names of the tools and where they are kept. A child model
may be used to introduce log hammering first, and later, when children are adept at
hammering, sawing and hammering soft wood pieces may be introduced. The teacher
can lead the demonstration using a 13-oz. hammer that is the easiest for most children to
handle, but some children will do well with the 16 oz. The teacher or model should grasp
the hammer near the end of the handle. This gives maximum leverage power and drive.
The head is raised by a backward movement of the forearm and is terminated by a
forward flip of the wrist. The weight of the hammerhead should provide the added force
to drive the nail. The teacher demonstrates tapping the nail till it stands by itself. Then
moves the hand holding the nail out of the way so that fingers and thumb are safe. A
good way to limit time is to allow a child to hammer only three nails. Later when the
desire to hammer has decreased and there are few waiting, children may be shown how to
pull out nails.
When the teacher decides it is time to introduce the saw and soft wood scraps, the
saw may be introduced in the same manner as the hammer. The vise should be used for
holding the wood. When sawing, the teacher should demonstrate placing feet facing the
workbench, slightly apart for balance and control and sawing with the elbow in a straight
line with the saw, and the other hand resting on vise for balance. The teacher can
demonstrate putting the saw teeth on the wood near the handle end and pulling the saw
towards the body several times and making a groove. When sawing, a slow steady
rhythm is better than short fast movements. The teacher may repeat, “Back and forth,
back and forth,” to demonstrate the rhythm. If the elbow is not in a straight line with the
saw, the saw will bend and not cut. The saw should be held at a 45-degree angle. If the
wood vibrates while being sawed, the wood should be moved into the vise or clamp as
near to the place being sawed as possible and still permits freedom of movement. The
vise serves as an extra hand.
Strict rules should be enforced about always setting the saw back into its place
when not in use. A saw lying around is very dangerous. If a proper place for the saw
exists and it is put away while not actually sawing it will limit accidents. A saw in the
way, while hammering or moving wood, is easily bumped with hands.
After introducing the carpentry bench the teacher may review the following
procedures:
! Choose two pieces of wood (narrow one on top).
! Choose proper nail (should go 2/3 of way into bottom piece of wood).
! Hold the hammer? (near the end of the handle)
! Begin with a few short taps.
! Then move hand out of the way.
! How do we put tools away? Why is it important to put them away?
At circle time, the teacher may have children who have hammered talk about their
experiences.
Many children find satisfaction simply by sawing wood for the supply box and
watching a pile of sawdust grow, or pounding nails into a large, soft chunk of wood. The
teacher should not expect children to create finished products, although some children
will.
Softwoods should be selected for children to use, as they need to feel progress
quickly. It takes about half the time to saw through a piece of softwood as it does to saw
through a piece of hardwood. Working with hard wood is very frustrating to children and
they give up when success is hard to achieve. However, hardwood can be used later in
the year for gluing structures together. The desirable softwoods are white pine, balsa,
poplar and basswood. Plywood is not good for young children. It splinters on one side
when sawed.
Accessories
. cigar boxes . linoleum . wire
. buttons
. empty spools scraps . string
. bottle caps
. glue . metal jar tops . tubes from
. cardboard
. leather scraps . pieces of cloth paper towels
. cedar
. lids . pieces of soft
. cheese boxes
Closet poles and broom handles may be cut and drilled to make wheels.
Children who are using tools for the first time will be interested in nailing and sawing for
its own sake and be content to do just that. --Fine Motor.
They may nail one nail after another into a piece of wood. Some may arrange odds and
ends of wood and nail them together without design or purpose. The teacher should not
insist that children work with a plan while they are going through this exploratory stage.
Most kindergartners will not go beyond this. The teacher needs to permit them to
manipulate and invent according to their desires. --S
Some children may name their product after they have finished because it resembles
something. An adult may make labels at this point or even help write stories. --R, W
As children develop and acquire skills, they have a tendency to begin working with more
definite purpose in mind, and they can carry the job through to completion. They are also
more interested in having their products look realistic. They will use real tools to make
measurements and problem solve. --M
Children often love to add items to their creations and even paint them. This is when a
teacher may add the odd items from the accessory list. --A
Architects drawings, blueprints and illustrations may be displayed in the center to help
children relate skills to a profession.--SS
The Take Apart Center extends the child’s fine motor skills, problem solving
behavior, and cooperative skills. A child will learn to select the appropriate tool and
discover the inner workings of everyday items.
The Take Apart Center can be introduced at a point in the year when students are
independently discovering extensions. It can be a challenging activity for those who like
to spend long periods in detail oriented activities.
The Workbench provides a flat solid surface for the Take Apart Center. Safety
glasses and a wide variety of tools are also required. A strong container for tools and
another for parts help keep the bench organized. The teacher should place only one item
at a time in the center to be taken apart. Care should be taken not to use items that can be
dangerous. A request for parents to send broken and unwanted items usually gets good
results.
The teacher should establish names and functions of each tool with a mini lesson,
i.e. screwdrivers can pry but needle nosed pliers will be damaged. The teacher should
emphasize the difference between take apart and pound apart. Take apart is often a
project that needs two people, one to hold while the other works. The teacher may use a
volunteer to assist or to bring ratchet screwdrivers, wrenches, etc. and demonstrate more
complicated versions of these basic tools.
Recommended List of Take-Apart Center Tools - listed in order of priority;
! two pair of safety goggles
! small and large headed, long and short screwdrivers
! small and large headed, long and short Phillips screw drivers
! pliers, regular and needle nosed
! old electrical appliances
Besides the obvious fine motor practice, problem solving, and patience building,
with some extensions Take Apart can become an interesting part of the curriculum.
This is an exciting opportunity for the child to actually see what is inside things and can
connect to cultural artifact discussions. --SS, S
A volunteer may help children tape parts onto a poster and label them. --R, W
As children tape parts onto a prepared poster listing common parts, classifying and
counting concepts could be developed. --M, R
Adding a large magnet would help children explore the concept of magnetism.--S
The teacher can encourage children to use discovered wire, glue, and tape to create a new
object. This could be written about, discussed, and displayed.--R,W,S,A
WRITING ACTIVITIES
A strong relationship exists between reading and writing. Many students learn
to read through the writing process. The child becomes a reader when they share
their own writing with an audience, and often times a child’s first reading is
something meaningful which they have written. Robert Gentry, author of My Kid
Can’t Spell!, claims that writing… “Opens the gateway to literacy by helping
children to break the code and learn about sounds in words”. Kindergarten
teachers must strive to develop, in each child, the belief that they are readers
and writers.
Writing Activities
This center is created to let students practice their developing writing skills by writing
books, stories, invitations, notes, letters, lists and signs. Most writing forms have been
modeled for children in a group lesson. The writing center provides students with an
opportunity to practice what they have learned in group lessons. Children will be
working at their own developmental stage and their creations will be personal and
meaningful. The teacher’s responsibility is to equip the center with a variety of tools that
will encourage students to write in a variety of genres. The writing center should offer a
table or several desks, which allow children to work together. It can be equipped with
pencils, colored pencils, crayons, markers, chalk boards, dry erase boards, a typewriter, a
computer, and a wide variety of paper and envelopes, ABC charts, number charts,
classmate’s names, and First Dictionaries for student references are also helpful. Book-
making materials may also be necessary, such as hole punches, yarn, staples and tape.
Children enjoy dating their work with a date stamp.
Holidays and seasonal activities fit well into the writing center. Students will
enjoy making up menus for Thanksgiving dinners, Christmas cards and gift tags
for families and friends, letters to Santa Claus, Valentines, and other holiday
messages.
The writing center can become a starting point before moving to other
centers. Students may write a story and then move into the art center to illustrate
it. After writing a shopping list, students may move into the grocery store for a
shopping trip. A student may draw out their plans for a building, before moving to
the block center. Students also enjoy writing simple stories to be performed in the
Puppet Theater. The writing center may easily be converted to an office center
by adding telephones and adding machines.
2. Name Writing
A child’s name is one of the first and most personal words they will ever learn
to read and write. Kindergarten classes will find several name charts around the
classroom to be helpful teaching tools. Students can study the name charts and
participate in the following activities:
Sorting
Students will enjoy sorting names by the number of syllables, number of
letters,
names that start with the same letter, names that end with the same letter,
short
names/long names.
Rhyming
The class can invent rhymes with names or cover the first letter of each
name with a
different letter.
3. Classroom Mailbox
The teacher may support the reading/writing connection by placing a mailbox
in the classroom. Students can write notes to friends and teachers and place
them in the mailbox for delivery. The student who is designated as the mail
carrier that day can deliver the notes. Children are always excited to get mail
from their teachers and friends.
4. Journal Writing
5. Author’s Chair
The “write aloud” activity described here may be completed in large or small
groups. Language experience activities are based on something that all the
students experienced such as a cooking activity, a fieldtrip, or a special visitor.
The teacher and students compose the text together. The teacher writes on a
large poster board or chart paper as the children watch and listen. While writing,
the teacher will say and spell the words aloud, commenting on spaces,
punctuation and capital letters. Through this reading / writing activity, students
are watching as their spoken language is turned into written symbols. They are
developing knowledge about conventions of print, sound-symbol relationships,
sight words and phonemic awareness.
7. Interactive Writing
Step 1: Fold the chart paper in half. The bottom half of the paper is used to
write the
class sentence. The top half of the paper is for instructional purposes, such as
showing rhyming words, word families, word endings, punctuation etc.
Step 2: A sentence is chosen which is based on an experience common to
everyone in the group. At the beginning of the year short, simple sentences are
more workable for beginning readers and writers. As the year continues the
sentence chosen can become more complex.
Step 3: After the sentence has been chosen the teacher and students repeat
the sentence several times and count the number of words in the sentence.
Step 4: Next, a student is chosen to stand by the teacher to become the
“space holder”.
Step 5: Students determine the first word of the sentence and begin to
segment that word orally to determine the beginning letter. Once someone is
able to correctly identify the first word in the sentence they are asked to come to
the chart paper, identify the starting point, and write the first letter on the paper. If
a mistake is made the teacher provides guidance using the ABC letter chart, the
mistake is covered with “boo-boo” tape and the student writes the correct letter
on the chart paper. For difficult spellings such as silent letters, the teacher may
write the letter using a different color marker. As the year goes on, students work
together to make sure only they get to write the letters and the teacher’s marker
is never used! This process is continued until a word is competed. Only
conventional spelling is used. At the end of each word, the “space holder” puts
their hand on the chart paper to hold the space between words.
Step 6: This process continues until all the words and spaces in the sentence
have been written on the chart paper. The space holder may choose the correct
punctuation for the end of the sentence if they wish.
Step 7: Using the pointer, the class reads the sentence aloud, pointing to
each word as they read. Some students will enjoy a turn reading independently
to their classmates. Hang the chart in the room so children may read again later
in the day.
As students become familiar with the process, the teacher may add to the
Interactive Writing lesson using the following statements and questions:
- How many words are in our sentence?
- How many words have we written so far? How many words do we have
left to write?
- Now that we have finished this word, what comes next? (A space) What is
the next word?
Stretch out the words. What sounds do you hear? What letter makes that
sound? How many sounds do you hear? How many syllables are in that word?
8. Dictation
Kindergarten news can be a single page divided in five boxes, one for each
day of the week. During closing circle a student (maybe the helper of the day) is
chosen to write or draw a picture in the square designated for that day. The
writing/drawing pertains to something all students experienced in school.
Depending on the students’ writing abilities, the teacher may write the simple
sentence under the picture as the student dictates. This activity is not only
important for developing writing skills, it also a quick method of family
communication.
Anecdotal Records
The following is lists of characteristics that may help the kindergarten teacher
recognize an immature or developmentally delayed child.
8 The “profile” is marked four times during the school year – with the corresponding
numeral 1, 2, 3 or 4
8 Progress should be marked as moving to the right – a higher number should always
be to the right of a lower number.
8 The “Citizenship Standards” section is the only area that is not a continuum. All
satisfactory areas are marked with the appropriate numeral and areas of concern are
marked with an asterisk and then expanded upon in the comment section.
Only those children whose behavior, progress or health fits into the extreme
edges of the developmental scale should be considered. A child whose parents request
testing, or one for whom a second year of kindergarten seems advisable, should also be
scheduled.
The team may recommend testing or further observation. The results should be
shared with the team and a special course of action may be assigned to the proper
specialist, the classroom teacher, or a combination. Then a conference with the parents
and the test administrator may be set up. It is advisable for the classroom teacher to be
present at the conferences.
The role of the speech and language pathologist in the kindergarten classroom is
many fold. Early in the year, all kindergartners may be screened for speech, language
and hearing problems. Those children found to have problems might be enrolled in the
Speech and Language program in a group or on an individual basis. Most kindergartners
in the programs are working on language acquisition, building vocabulary and
categorization skills. The SLP may choose to work in the classroom or in a speech
room. The SLP may also be available to the kindergarten teacher on a consultant basis to
handle problems that may not require direct services. The SLP should also be available
to counsel parents regarding normal speech and language development and to help
parents encourage good language in their children.
Resource Teachers
The role of the school nurse in the kindergarten classroom might be to:
4do some health teaching in the classroom to help meet health curriculum objectives
4share with the teacher the results of immunization surveys, multiphase screening (i.e.
vision, dental, height, and weight) and make referrals and do follow-up, as necessary,
on all students including new arrivals throughout the school year
4act as a consultant and resource person when problems arise with students, i.e.
excessive absences, prolonged illness, concern of abuse or neglect, etc.
4 cooperate with special education services by gathering and recording health
information on students with special physical, psychological, or developmental needs
4 manage communicable disease programs through consistent enforcement of
existing school policies; including HIV awareness presentations
4help maintain a safe and healthful school environment so that conditions which might
interfere with the teaching-learning climate are minimized
4maintain good communication between parent, school and community health
agencies to share resources and facilitates and foster community health education
Counselor
Psychologist
In the near future your child will be receiving a report of student progress called, “Profile of
Developmental Outcomes”. Since this report may be new to you and not look like any of the report
cards from your educational experiences, this letter is being sent to help you in interpreting the
information on the profile.
First of all, this profile does not use the concept of grades. Student progress is marked with
a number 1-4 to identify progress on a continuum of learning for each quarter. (The number “1”
being first quarter, “2” second quarter and so on.) The continuum is like a bar graph that is located
above a description of five developmental steps or stages. The steps are organized from left to right
in increasing order of difficulty. The skill written on the left side of the bar graph describes a skill
that is most widely recognized as a beginning skill in kindergarten. The skill written on the right side
of the graph describes what skill is recognized as a goal for mastery for most kindergartners. You
may notice that your child has a variety of left, middle, and right side placements - this is very typical
of an average kindergarten child. Every child is unique and should only be compared to their own
progress over the course of this year.
If you have any questions concerning specific skill levels and the answer is not found in the
comment section, please call me at school. If you need more than a short “chat” we can make an
appointment to get together.
Sincerely,
Some kindergarten teachers may feel the need to report more quantifiable
information to parents. This can be accomplished several ways. The comment section
in the “Profile of Developmental Outcomes” form is extensive. There are no limits on
the amount of comments and each section can be identified with the date of the report.
In addition, the bar graphs above each skill area may accommodate a brief note that
directs parents to more information in the comment section. At any time, the teacher
may choose to conference with parents and share the information on the “Kindergarten
Assessment” form.
Auditory Discrimination
Rhyme:
“Tell me if these words rhyme.” (Like ‘hair - chair’)
cat - hat ball - tall man - van
bed - rug boy - girl pill - hill
Generate Rhyme:
“Tell me a word that rhymes with . . . “
cap_____ dog_____ ten_____ bug_____ rain_____ card_____
Sound Segments:
“Can you stretch the sounds in these words one at a time.” (Like cat,/c/, /a/,/t/)
pot bun pig can stop clap
Sound Blending:
“What word do these sounds make when you put them together?” (like /f/-/a/-/t/, fat)
bed pot lip man fast card
Letter-Sound Relationships:
“What letter do these words begin with?” (Like diaper “D”-child names letter.)
bear dog sun pen tent vest jar red
nest lip fat kite window hat garden
Beginning Sounds:
“Tell me the first sound you hear in these words.” (Like /d/-/o/-/g/-child repeats first
sound.)
top cake rug fish
Ending Sounds:
“Tell me the last sound you hear in these words.” (Like /l/-/o/-/g/-child repeats last
sound.)
fit kiss ham ball
Middle Sounds:
“Tell me the middle sound you hear in these words.” (Like /p/-/i/-/t/)
hog cap sit hen
Syllable:
“Clap how many beats you hear in these words.” (Like dra - gon, clapping 2 x’s)
cup baseball boat bicycle garden
Visual Discrimination
Sight Words:
“Can you read these words?”
MOM DAD CAT DOG LOVE
the and was see to said
of go we have
Mathematics
Problem Solving:
“Tell me what comes next in these patterns.” ABAB AABAAB ABCABCA
Number Concepts:
. Rote Counting - “Let me hear you count.”
. One-to-one - “Count these blocks.”
. Conservation of Number - “Does this row have more, the same, or less than this
row” (Teacher provides visuals.)
. Number Value/Symbol - “Show me the group with this ___ many.” (0-8)
(Teacher provides visuals.)
Physical Development
Large Motor:
. Balance - “Let’s see how long you can balance on one foot?”
. Alternate Movement - “Can you skip, hop, etc.?”
. Catching/Throwing - “Throw/catch this bean bag.”
Fine Motor:
. Writes Name
. Use Crayons/Pencil - “Copy these shapes.” (Teacher provides model.)
. Scissors - “Cut out this circle.” (Teacher provides sample.)
. Trace/Copy #’s Letters - 12345 . . . ABCDE . . . abcde . . .(Teacher provides
model.)
Personal Knowledge
. Age - “How old are you?”
. 1st/Last Name - “What is your first and last name?”
. Phone # - “What is your phone # (area code)?
. Address - “What is your address?”
. Birthdate - “What is your birthdate (month/day)?”
Using the Kindergarten Assessment Booklet
These skills are sequenced to the Profile of Developmental Outcomes, from
beginning level to mastery level. Therefore, the teacher may determine that an
individual student need only be assessed to frustration level (ceiling). The booklet
does not indicate divisions or time periods. Teacher should view the booklet as a
flexible tool to accommodate a variety of skills.
Auditory Discrimination
Detect Rhyme/Generate Thyme: The teacher may decide that nonsense words are an
acceptable response.
Syllable: The teacher may find it helpful to demonstrate syllable by saying a word
with their lips closed and clapping the beat.
Sound Blending/Sound Segments: The teacher may wish to demonstrate blending
sounds with a visual aid, such as a rubber band or pulling fingers apart and together.
Letter Sounds: The teacher may wish to emphasize the beginning sound with a hand
motion.
Identify Beginning, Middle, and Ending Sounds: Reminder! These items are
developmentally sequenced. The teacher may use discretion in continuing the
assessment with a student who is struggling.
Visual Discrimination
The teacher may find it helpful to use a blocking method to isolate assessment
sections.
Color/Name/Shapes: The teacher may use a separate sheet to assess color
recognition. This section may also be used to assess recognition of color words.
Numbers: The sequence of the number identification is coordinated to the profile.
The teacher can see at a glance if the student recognizes numbers to their age.
Letters/Upper/Lower: The teacher may individualize the assessment by starting with
the letters in the child’s name.
Sight Words/Identify Letter/Word/Sentence: These words are sequenced according
to high interest, followed by words from the word bank on the Idaho Reading
Indicator.
Mathematics
Problem Solving: The teacher may wish to model “reading” the first pattern, i.e. –
circle, square, circle, square. The teacher draws the response in the space provided.
The child may have another name for the symbols and still have a correct response.
At this time, the teacher may wish to assess more in-depth classification/sorting skills,
using junk boxes or manipulatives.
Rote Counting/One-to-One/Number Value/Symbol: The teacher refrains from using
the number name while evaluating number value/symbol. Instead, the teacher shows a
separate number card (in random order) and asks the student to show the group
represented by that number symbol.
Conservation of Number: The teacher may wish to use a blocking method to isolate
the activity and focus attention to one group at a time.
Physical Education
Large Motor: The sequence of the large motor skills follows physical education
guidelines.
Fine Motor/Uses Crayons/Pencils/Scissors: The teacher may wish to have the
student write their name on a separate piece of paper. They may also wish to attach
the cut out circle.
Trace: The teacher may wish to initially have the child trace shapes, letters, and
numbers. Then move to copying.
Copy: This area is very open-ended. The teacher may wish to have the child copy the
numbers in the first assessment. Then, extend the sequence at a later assessment. The
teacher may wish to use a separate piece of paper.
Personal Knowledge
These are not sequential skills. The teacher may wish to utilize adult helpers to gather
this information.
Using the “Profile of Developmental Outcomes”
Key
1 = First nine weeks
2 = Second nine weeks
3 = Third nine weeks
4 = Fourth nine weeks
Visual Discrimination: begins with colors, names, shapes and proceeds to lower case
letters – assessment booklet.
Reading: somewhat subjective, but IRI information can be utilized and information
from the assessment booklet.
Mathematics
Problem-solving: may be assessed with patterning and classification activities and the
assessment booklet.
Number Concepts: can be assessed using hands-on materials and the assessment
booklet.
Learning Behaviors
All areas are subjective, based on teacher observation.
Physical Development
Large Motor: some subjective, but can be demonstrated and recorded in the
assessment booklet.
Personal Knowledge
Citizenship Standards
This area is also not a continuum. Teachers determine if skills have been mastered
and record the corresponding number for that area. Any areas of concern are marked
with (*) and then explained in the comment section. The following list may be helpful
in identifying the characteristics that define these district-adopted values. (see chart)
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Live the values of Respect, Dignity, Honesty, Responsibility and Teamwork.
TEAMWORK is work done by several people with each doing a share of the work
The child who understands teamwork. . .
# pitches in to help others
# asks and encourages others to participate
# changes habits to meet the group’s need when working on a group project
# encourages others to express their points of view
Kindergarten Profile of Developmental Outcomes -
Student Teacher School
Key: 1=first quarter 2=second quarter 3=third quarter 4=fourth quarter INDEPENDENT SCHOOL
Any area marked with (*) is addressed in the comments section. DISTRICT OF BOISE CITY
Beginning Level Mastery Level 8169 West Victory Rd.
Language and Literacy Boise, Idaho 83709
Oral language
Comments
Is non-verbal Uses language to Uses language often in Describes real Speaks with well-developed 1st Conference
satisfy basic wants/needs work and play with peers or imaginary situations vocabulary and sentences
Auditory Discrimination
Scribbles and Uses letters or Uses letters to Copies words Invents spelling of
uses writing- letter-like signs represent words spontaneously words, uses phonetic clues
like behavior to represent writing
Reading
"Reads"/retells "Reads" from "Reads" signs Discriminates between Uses reading 1st Semester
a story using memory word high interest and letters, words, strategies independently
pictures for word sight words sentences (context clues, phonics)
Attitudes Towards Literacy
Counts by Demonstrates one-to-one Relates number Understands conservation Uses knowledge of number
rote correspondence values to symbol of number (# remains to solve real problems
(counts objects) same, group/shape changes) 3rd Quarter
Learning Behaviors
Attention Span
Has rapidly Focuses attention Focuses attention Works indepen- Follows complex
changing on self-selected on teacher-selected dently on self- directions,
focus of tasks tasks selected and maintains focus
attention teacher-selected tasks
Initiative
Observes Prefers familiar Tries new tasks Accomplishes tasks Uses previous
rather than tasks with efficiency knowledge to solve
participates tasks independently
Curiosity
Does not Communicates with Participates in group Participates responsibly Is sensitive to and
seek help adults primarily to get conversations in group activities articulate about needs
when needed help of others
Physical Development
Large Motor
Uses crayons Uses scissors Traces shapes, Copies shapes, Demonstrates detailed
or pencils efficiently letters, numerals letters, numerals work with good eye-hand 1st Semester 2nd Semester
appropriately coordination Days Present
Personal Knowledge (This is not a continuum.) Days Absent
Times Tardy
Knows age Knows first, last Knows birth date Knows telephone # Knows address
name (month/day) (including area code) (including city, state) Assigned next year to:
Principal: Date
This report card was created with the Hurd PCS Report Card Program. This software was custom created for Boise School District by Hurd PCS, Boise, Idaho.
To: Kindergarten Parents,
Your child is receiving a report of student progress called a “Profile of Developmental Outcomes.” This
type of report may be new to you and not look like any of the report cards from your educational experiences.
This guide is intended to help you interpret the assessment your child is bringing home.
This profile does not use the concept of grades. Student progress is marked with a number 1-4 to
identify progress on a continuum of learning for each quarter. (The number “1” being first quarter, “2” second
quarter and so on.) The continuum is like a bar graph that is located above a description of five developmental
steps or stages. The steps are organized from left to right in increasing order of difficulty. The skill written on
the left side of the bar graph describes a skill that is most widely recognized as a beginning skill in kindergarten.
The skill written on the right side of the graph describes what skill is recognized as a goal for mastery for most
kindergarteners.
You may notice that your child has a variety of left, middle and right side placements. This is very
typical of an average kindergarten child. Every child is unique and should only be compared to his or her
progress over the course of this year. We hope this profile will help you understand where your child is
beginning in each skill area and where you can expect him or her to progress over the year.
MATHEMATICS
Problem solving: Problem-solving is a necessary skill in all of mathematics. Children are given materials to
explore and use to develop their understanding of mathematical concepts such as sorting, patterning (from
simple to complex designs), classifying and comparing a variety of objects.
Number Concepts: The child’s world of numbers includes: counting from memory, counting objects one at a
time, and understanding the value of a number when represented by a symbol. A more difficult concept is that
an amount of objects is conserved, or does not change, if it is resized or regrouped. Children then move on to
applying math concepts to real situations.
PHYSICAL DEVELOPMENT
Gross motor development such as body control, balance, skipping and throwing; closely align with abilities in
the fine motor areas. Experiences that involve eye-hand coordination lead to success in handling scissors and
writing tools.
PERSONAL KNOWLEDGE
The personal knowledge area of the Profile of Developmental Outcomes is the only area that is not presented as
a continuum. It is important for children to know this information and it is reported as it is learned, which may
occur in any quarter.
BLACK-LINE
MASTERS
(Black-line masters are organized in the sequence in which
they are referenced in the preceding document.)
Before you go: 1. Think about what you want to tell the teacher about your child.
2. How does your child feel about school?
3. What does your child like to do after school?
4. What special interests does your child have (dinosaurs, cars, art, sports,
cooking, etc.)?
5. Is there anything you would like to tell the teacher that would help in
understanding your child?
At the
Conference: 1. Arrive on time.
2. The teacher will be prepared to tell you about your child’s school
work. Here are some questions you might want to ask.
a. In what subject does my child do well?
b. What needs improvement?
c. Are there any special programs that could help my child?
d. What can I do at home to help my child?
3. Ask questions about any part of the school program that you have
questions about (homework, recess, test results, etc.).
4. Leave promptly when your conference time ends.
When you
get home: 1. Tell your child something good that the teacher said.
2. Jot down any important points to share with your spouse.
3. Keep communicating with the teacher throughout the year by telephone
and notes.
How You Can Help Your Child in Kindergarten…
Your child must be encouraged for their own efforts and must be taught
the value of learning, why it is important, and how it can benefit them in
every day life.
Your child is now working at their own rate in the classroom. And, with
the two of us working together, your child will work up to their own
capacity and ability. Your child needs both of us to help them succeed.
Boise School District
Preschool
Screening
Services are available for children
with special needs through the Screening Dates
Boise School District Early
Childhood Special Education
August
Program. Please call to set up an
appointment for a screening if you
September
have a child who is from 3 to 5
years old and may have possible
October
problems in one or more of the November
following areas:
December
! Self-Help Skills
! Speech/Language
January
! Social/Emotional February
! Concepts March
! Vision
! Motor Skills
If you work outside the home, where is your child before and after the kindergarten session?
______________________________________ _______________________________________
before after
Please explain any allergies (Note: Kindergarten children have snacks at school.)
________________________________________________________________________________
________________________________________________________________________________
_________________________ ___________________________________________________
Date Signature of Parent or Guardian
Permission Slip
_________________________ ___________________________________________________
Date Signature of Parent or Guardian
I also give permission for my child to have his/her picture taken either for publicity purposes or for
general kindergarten use.
___________________________________________________
Signature of Parent or Guardian
Child’s name:____________________________________________________________
Address:________________________________________ Phone:_________________
Name of babysitter________________________________________________
Address__________________________________ Phone:________________
4. Does your child have any particular problems that concern you?
(Stumbling a lot, short interest span, bed wetting, temper tantrums, food or animal
allergies)________________________________________________________________
________________________________________________________________________
______________________________________________________
5. What do you hope the kindergarten experiences will mean to your child?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
___________________________________________________
Child’s name:______________________________________________________________
Parent’s name:_____________________________________________________________
Address:________________________________________ Phone:___________________
There are so many ways that you can help make this year a special one for your child and all
the children at kindergarten. Kindergartners learn best when they are active and self-
directed. This type of program needs extra help if it is to work smoothly.
_______ babysitting for another parent so they can volunteer in the classroom.
If you or someone in your family has a special ability or interest which has not been listed,
please add it here_____________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
_______ drive children in my car and meet the teacher at the destination.
I can help on ___ Monday ___ Tuesday ___Wednesday ___ Thursday ___ Friday.
PLEASE SHARE WITH THE SCHOOL
Dear Parents:
We need volunteers to help us with our kindergarten program. You can share your time by
helping while you are at home or at school. If you want to share in any way, please let us
know.
Are you interested in volunteering this year? ______ YES ______NO
Comments:_________________________________________________________________
__________________________________________ ____________________________
Name Phone
Kindergarten Questionnaire
Child’s Name_______________________Nickname:___________________
From school:
3 POLIO
4 DTP
1 MMR
3 HEP B
SAMPLE ALPAHBET CHART #1
a A b B c C d D e E
f F g G h H i I j J
k K l Lm Mn N o O
p P q Q r R s S t T
u U v Vw Wx X y Y
z Z
SAMPLE ALPAHBET CHART #2
a A b B c C d D e E
Kindergarten Orientation
Summer Learning Ideas for You and Your Kindergartner
! Plan a trip to your local nature center. When you return, help your child write a story or tell what
was observed at the center.
! Act out a favorite book or story.
! As your child experiences new things (sea shells, birds, plants), start a scrapbook of photographs,
drawings or samples and help your child write about them.
! Write a family story. Have each member write a section. Smaller children can “tell” their portion to
an older family member who can write it down for them.
! Have a “creative day.” Every family member has to create something (a poem, a drawing or
painting, a sculpture of toothpicks, etc.). Family members will tell what they were trying to do and
how they went about it.
! When a family member reads a book, have him/her give a brief (limit to a few minutes) book report
at the dinner table. Encourage discussion.
! Have children plan the family menu for a meal, prepare a shopping list (using available coupons)
and allow them to serve it.
! Plan a treasure hunt using verbal or picture clues.
! Draw a hopscotch grid. Number all the squares. When jumping from square to square, say the
number out loud.
! Spin a globe. Have a family member stop the globe by randomly pointing at a spot. Then name it
by land or water.
! Plan a make-believe vacation in a distant land. Talk about the types of things you would see.
! Have a “guess how many beans in the jar” contest. Let everybody write down a guess. Everybody
helps count. Everybody shares the “method” they used to make their guess.
! Help your child write a letter to a friend or family member.
! Have each family member start a “collection.” Keep it going all summer and one-day plan an
exhibit. Each person should display the collection (bottle caps, leaves, pressed flowers, cans,
whatever) and explain what they learned.
! Write a family “newsletter” together about summer activities and events. Include an article about
each family member.
! While riding in the car, blindfold one member of the family (other than the driver, of course). Have
the rest of the family members describe the scenery. Include sights, sounds, smells, heat/cold, and
textures.
! Keep track of the high temperature each day by using a graph.
! Take a weekly trip to the library. Keep a list of each book read.
! Keep a journal of where you’ve been and what you’ve done while traveling. Make sure things are
listed in the order in which they occurred.
! Examine the phone book and introduce your child to the various headings on the emergency page.
Prepare your child to handle any problem that might arise.
! Cut letters out of headlines and ads in the newspaper. Draw pictures or write a word using each
letter.
! Prepare to go to school by making a list of what is needed in the way of clothes and school supplies.
Ready...
Set...
Learn!
I hope you will feel free to contact me with any questions, comments,
suggestions or concerns about our school. We believe we have an
outstanding educational environment and we are always willing to do
anything we can to improve.
Our doors are always open to you. Let's join hands in Educating Today
for a Better Tomorrow.
____________________________
Principal
____________________________
Telephone
Ready . . .
Beginning School
Since the Kindergarten year lays the foundation for future success in
learning, both parents and teachers are anxious for children to get a good
start in school. Here are some suggestions to help your child get off to a
good start:
Set . . .
Establishing a Positive Home Environment
Parents are the first and most important teachers a child will ever have.
The home is a powerful factor in determining how well a child will do in
school. Parents want their child to succeed in school and often ask,
"How can I help?"
The ideas in this booklet are intended to help you continue to be your
child's most important teacher and to become a partner in their
Kindergarten experience.
Learn!
Reading/Visual Discrimination
HOW TO HELP YOUR CHILD WITH THEIR MAGNETIC LETTERS
OTHER IDEAS
I Choose a letter and look for that letter as you read a book
together.
I Write a grocery list with your child by involving them in identify-
ing letter names.
I Play memory games with upper and lower case alphabet cards.
I Play a riding in the car game that involves identifying familiar
signs and logos in the environment.
I Look for letters on cereal boxes, ads, food products, clothes, etc.
I Provide opportunities for your child to name colors.
A B x y z
C
Page 5
Learn!
Writing/Fine Motor
HOW TO HELP YOUR CHILD WITH THEIR NAME WRITING STRIP
I Using the strip, have your child trace their name saying each
letter, progress to writing their name on their own.
I Placing a thin piece of paper over the strip, have your child copy
their name. Using that paper cut it apart and have your child
reassemble it.
I Pour salt onto a plate and allow your child to write their name in
the salt using the name strip as a model.
I Provide clay or play dough and have your child shape the clay
into the letters of his name on or below the name strip.
OTHER IDEAS
Learn!
Language/Auditory Discrimination
HOW TO HELP YOUR CHILD WITH THEIR PICTURE CARDS
I Lay out the cards and help your child identify each picture.
I Find pictures that rhyme.
I Present three cards, two that rhyme. Ask your child which one
does not rhyme.
I Lay out the cards. Help your child identify the beginning sounds
by having them repeat just the first sound after saying the word.
I Present three cards, two that start with the same sound. Ask your
child which one does not belong.
I Choose one card. Give descriptive clues about the picture until
your child guesses correctly. Take turns.
OTHER IDEAS
I Ask your child to retell a story with a beginning, middle and end.
I Play "I Spy" while driving in the car. Say, "I spy with my little eye
something that is red, and round. What is it?" Focus on develop-
ing descriptive language.
I Read a book with rhyming text. After reading several times let
your child fill in the missing rhyme. Extend the activity and
challenge children to begin identifying other rhyming words,
including nonsense words.
I Have your child name as many items in a category as they can.
How many fruits can you name? How many animals can you
name?
I Help your child learn their address or phone number by making
up a tune to go with it.
I Once your child learns their phone number, allow them to call
your house and leave a message.
Page 7
Learn!
Math
HOW TO HELP YOUR CHILD WITH THEIR NUMBER CARDS
I Lay out the cards and help your child identify each number.
Begin with 0-5.
I Sequence the numbers, beginning with 0.
I After sequencing, remove one card. Ask the child to guess which
one is missing.
I Match the number card to numbers in the environment, the
clock, the television, the microwave, etc.
I Respond to questions by holding up a number card. Say, "How
many fingers on your hand? How many wheels on a car?"
OTHER IDEAS
1 2
3
Elementary School Phone Numbers
Adams . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3430
Amity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3800
Cole . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3805
Collister . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3436
Cynthia Mann . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3504
Franklin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3440
Garfield . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3445
Hawthorne . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3450
Highlands . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3454
Hillcrest . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3457
Horizon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3725
Jackson . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3808
Jefferson . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3460
Koelsch . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3812
Liberty . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3464
Longfellow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3474
Lowell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3478
Madison . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3484
Maple Grove . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3815
McKinley . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3818
Monroe . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3488
Mountain View . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3824
Owyhee . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3495
Pierce Park . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3500
Riverside . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3643
Roosevelt . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3505
Shadow Hills . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3817
Trail Wind . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 424-3200
Valley View . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322-3828
Washington . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3511
White Pine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3493
Whitney . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3515
Whittier . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3520
William Howard Taft . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 338-3508
OLS E DUCATIO
HO N
SC FO
IC
L
U
UB
ND
EP
AT
• BOIS
ION
Page 4
Alphabet magnets
Stickers or stamps
Please carefully review each of the suggested activities, decide which one you will be demonstrating and make sure you
have the materials you need. Ask the parent or guardian to find the correlating page in their handbook. Please tell the
guardian or parent which activity you are modeling.
Page 5
Sentence Strip
Vis-a-vis
Please carefully review each of the suggested activities, decide which one you will be demonstrating and make sure you
have the materials you need. Ask the parent or guardian to find the correlating page in their handbook. Please tell the
guardian or parent which activity you are modeling.
I Using the strip, have your child trace their name saying each
letter, progress to writing their name on their own.
I Placing a thin piece of paper over the strip, have your child copy their name. Using that paper cut it apart and
have your child reassemble it.
I Pour salt onto a plate and allow your child to write their name in the salt using the name strip as a model.
I Provide clay or play dough and have your child shape the clay into the letters of his name on or below the name
strip.
Language/Auditory Discrimination
Page 6
Picture Cards
Please carefully review each of the suggested activities, decide which one you will be demonstrating and make sure you
have the materials you need. Ask the parent or guardian to find the correlating page in their handbook. Please tell the
guardian or parent which activity you are modeling.
I Lay out the cards and help your child identify each picture.
I Find pictures that rhyme.
I Present three cards, two that rhyme. Ask your child which one does not rhyme.
I Lay out the cards. Help your child identify the beginning sounds by having them repeat just the first sound after
saying the word.
I Present three cards, two that start with the same sound. Ask your child which one does not belong.
I Choose one card. Give descriptive clues about the picture until your child guesses correctly. Take turns.
Math
Page 7
Number Cards
Please carefully review each of the suggested activities, decide which one you will be demonstrating and make sure you
have the materials you need. Ask the parent or guardian to find the correlating page in their handbook. Please tell the
guardian or parent which activity you are modeling.
I Lay out the cards and help your child identify each number. Begin with 0-5.
I Sequence the numbers, beginning with 0.
I After sequencing, remove one card. Ask the child to guess which one is missing.
I Match the number card to numbers in the environment, the clock, the television, the microwave, etc.
I Respond to questions by holding up a number card. Say, "How many fingers on your hand? How many wheels on
a car?"
Registration Forms
This is where district forms are filled out and any other materials are distributed. At this station, schools may choose to
provide an alternate activity for the children. Ideas may include a refreshment table, tour of the building, visit to the
Kindergarten classroom or school bus.
BLACK-LINE MASTERS FOR:
• Kindergarten Assessment
Booklet (8 pages)
• Class Record Sheet (3 pages)
Kindergarten Assessment
Booklet
AUDITORY DISCRIMINATION
Detect Rhyme:
“Tell me if these words rhyme.” (Like ‘hair – chair’)
1) cat – hat________ 2) bed – rug________ 3) ball – tall________ 4) man – van________ 5) boy-girl________ 6) pill – hill ________
Generate Rhyme:
“Tell me a word that rhymes with . . .”
can__________ dog________ ten________ bug________ rain________ card________
Syllable:
“Clap how many beats you hear in these words.” (Like dra-gon, clapping 2x’s)
cup________ baseball________ kite________ bicycle________ garden________
Sound Blending:
“What word do these sounds make when we put them together?” (Like /f/-/a/-/t/ - “fat”.)
bed________ pot________ lid________ man________ fast________ card________
Sound Segments:
“Can you stretch the sounds in these words?” (Like “cat” - /c/,/a/,/t/.)
pot________ bun________ pig________ can________ stop________ clap________
Letter-Sound Relationships:
“What letter do these words begin with?” (Like /diaper/ - “d” – child names letter.)
bear________ dog________ sun________ pen________ tent________ vest________ jar________ red________
nest________ lip________ fat________ kite________ window________ hat________ garden________
First Name: “Find your name on this paper.” (Teacher provides page with class list.)
3 5 2 1 4 6 9 7 8 0
12 10 15 17 13 16 14 18 11
20 26 39 43 52 55 68 74 100
Letters: “Name these letters.” (Underline those identified correctly.)
UPPER CASE:
O X A T S I B J Z
E P R C D F K M
H G V Q W N Y L U
LOWER CASE:
x i e o s c j z u
f r a k y h m d
p t g w l n q v b
Sight Words: “Can you read these words?” (Underline those read correctly.)
ABCABCA
Number Concepts:
Rote Counting – “Let me hear you count.”__________ One-to-one – “Count these blocks.”__________
Number Value / Symbol – “Show me the group with this many 1__ 2__ 3__ 4__ 5__ 6__
(Teacher shows separate numeral cards in random order.)
!!! !!! !!
!! !!
!!! !
! !!! !
Conservation of Number – “Does this row have more, the same, or less than this one?”
!!!!! ! ! ! ! !
Physical Development:
Large Motor:
Balance – “Let’s see how long you can balance on one foot?”________ Alternate Movement – “Can you jump_____hop_____skip_____?
Catching/Throwing – “Throw_____catch_____this bean bag.”
Fine Motor:
Use Crayons/pencil – “Write your name here.”
1 2 3 4 5
A B C D E
a b c d e
Personal Knowledge:
Age – “How old are you?”________ First/Last Name – “What is your first and last name?” _______________________________________.