Bioresource Technology 144 (2013) 165–171

Contents lists available at SciVerse ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Performance of microbial fuel cell coupled constructed wetland system

for decolorization of azo dye and bioelectricity generation
Zhou Fang, Hai-Liang Song, Ning Cang, Xian-Ning Li ⇑
School of Energy and Environment, Southeast University, Nanjing 210096, China

h i g h l i g h t s

 Couple microbial fuel cell (MFC) with a continuous flow constructed wetland (CW).
 Use the CW–MFC system to recover energy from refractory contaminant wastewater.
 Microbial fuel cell enhanced pollutants removal in constructed wetland.
 Wetland plants enhanced the power density of microbial fuel cell.

a r t i c l e i n f o a b s t r a c t

Article history: A microbial fuel cell coupled constructed wetland (planted with Ipomoea aquatica) system (planted
Received 8 May 2013 CW–MFC) was used for azo dye decolorization. Electricity was simultaneously produced during the co-
Received in revised form 17 June 2013 metabolism process of glucose and azo dye. A non-planted and an open-circuit system were established
Accepted 20 June 2013
as reference to study the roles of plants and electrodes in azo dye decolorization and electricity produc-
Available online 28 June 2013
tion processes, respectively. The results indicated that plants grown in cathode enhanced the cathode
potential and slightly promoted dye decolorization efficiency. The electrodes promoted the dye decolor-
Keywords:
ization efficiency in the anode. The planted CW–MFC system achieved the highest decolorization rate of
Microbial fuel cell
Constructed wetland
about 91.24% and a voltage output of about 610 mV. The connection of external circuit promoted the
Decolorization growth of electrogenic bacteria Geobacter sulfurreducens and Beta Proteobacteria, and inhibited the growth
Bioelectricity generation of Archaea in anode.
Azo dye Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction
Energy shortage and environment pollution are the two severe
challenges that human beings are facing today. The current energy
resource structure is unsustainable and the pollution control meth-
ods are mostly high energy consuming.
Microbial fuel cells (MFCs), which can recover renewable en-
ergy from waste organic sources and convert chemical energy into
electrical energy during wastewater treatment, have drawn great
attention of scientists and researchers in recent years (Logan,
2008; Puig et al., 2012). Recently, MFCs have demonstrated the
ability to simultaneously produce energy and degrade some biore-
fractory contaminants (Luo et al., 2009; Morris et al., 2009). Dual-
chamber MFC (consisting of an anode chamber and a cathode
chamber separated by a proton exchange membrane) and mem-
brane-less single chamber MFC are both widely used in wastewa-
ter treatments (Kiely et al., 2011; Sun et al., 2009b). Some research
indicated that membrane-less single chamber MFCs had more
⇑ Corresponding author. Tel.: +86 13776650963; fax: +86 025 83795618.
E-mail address: lxnseu@163.com (X.-N. Li).
advantages than dual-chamber MFCs, such as low cost, simple con-
figuration, and high power density (Liu and Logan, 2004). Most of
the MFCs were incorporated in the sequencing batch reactors
(SBRs). The microorganisms and fuel sealed in the reactors needed
to be refreshed after the fuel was used up. It’s impossible to keep
the wastewater treatment and the current production continu-
ously in the SBRs. Furthermore, the operation and maintenance
of such systems were very complicated. In order to solve the above
problems, researchers have made efforts to develop some continu-
ous electricity generating MFCs (Feng et al., 2010).
Constructed wetlands have been used for many years as part of
the municipal wastewater treatment process. They can treat a vari-
ety of wastewater under a wide range of conditions (Dunne et al.,
2005). The construction and operation costs of constructed wet-
lands are very low due to the minimal or even no energy require-
ment. What’s more, the plants growing in the wetlands can take up
CO2 from the atmosphere and alleviate greenhouse effect. Studies
have also shown that constructed wetlands have high potential
to remove biorefractory contaminants (Wischnak and Muller,
2000).
Azo dyes, which are aromatic compounds with one or more –
N@N– groups, are among the most widely used commercial

0960-8524/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.biortech.2013.06.073
166 Z. Fang et al. / Bioresource Technology 144 (2013) 165–171
synthetic chemical dyes in the world. The discharge of dye contain-
ing wastewater into the surface water usually leads to a series of
environmental problems, such as aesthetic issues, low light pene-
tration and oxygen transfer obstruction. In addition, several studies
have indicated that azo dyes would contribute to the mutagenic
activities in the groundwater and surface water (de Aragão
Umbuzeiro et al., 2005). Because azo dyes are biorefractory organ-
ics, it is always a challenge to treat azo dye containing wastewater
with the current available physicochemical and biological methods
(Dos Santos et al., 2007).
MFC coupled with constructed wetland is a possible and eco-
nomical way to achieve the goals of both wastewater treatment
and energy generation. Some researchers have already reported
the application of MFCs in azo dye wastewater treatment. How-
ever, the treatment processes were mostly carried out in the SBRs
(Fernando et al., 2013; Sun et al., 2009b). To the best of our knowl-
edge, few studies have reported the wetland process coupled with
microbial fuel cell for electricity production and dye removal
(Yadav et al., 2012). In this research, a constructed wetland coupled
with MFC (CW–MFC) run continuously for active brilliant red X-3B
(ABRX3), a typical azo dye, treatment. The performances of CW–
MFC systems were described and analyzed. The dye decolorization
and electricity generation were studied. The bacterial communities
in the anode were analyzed.
2. Methods
2.1. Dye
Commercial purity level reactive brilliant red X-3B (ABRX3,
C19H10Cl2N6Na2O7S2) was purchased from Huibang Fine Chemical
Company Limited in Shanghai, China. There are one –N@N– bond
and some benzene rings in the molecule of ABRX3.
2.2. System construction
The planted CW–MFC reactor was made of a polyacrylic plastic
cylinder with an internal diameter of 30 cm and a length of
52.5 cm (Fig. 1). From the bottom upward, there were four layers:
bottom gravel (diameter of 3–6 mm) layer with a depth of 20 cm,
Fig. 1. Configuration of the planted microbial fuel cell and constructed wetland
coupled (planted CW–MFC) system.
the anode layer with 10 cm depth of granular activated carbon
(GAC, 3–5 mm in diameter with a specific area of 500–900 m2/g
and a packing density of 0.45–0.55 g/cm3), the middle gravel layer
with a depth of 20 cm, and the air-cathode layer (made of 12-mesh
stainless steel mesh coupled with GAC) with a depth of about
2.5 cm. The volume of the whole container was 35.3 L with a total
liquid volume of 12.4 L, while the volume of the anode was 7 L
with an anode liquid volume of 2.1 L. The stainless steel mesh
was 0.3 cm in thickness and 30 cm in diameter. Ipomoea aquatica
was planted into the air-cathode layer as the constructed wetland
plants. Titanium wires (1 mm in diameter) passing through the
middle of the polyacrylic plastic cylinder were used as the lead-
ing-out wire of the anode. External circuit was connected by the
copper conductors with an external resistance of 1000 X, and
epoxy was used to seal metals exposed to the solution. Ten sam-
pling ports with 8 mm in inner diameter were arranged at the
intervals of 5 cm throughout the height of the reactor for collecting
samples from different depths of the reactor.
A non-planted CW–MFC and an open-circuit CW–MFC were
operated under the same conditions to study the operating charac-
teristics of CW–MFC system. The same configurations were
adopted for these three CW–MFCs; the non-planted CW–MFC
had no plant in the cathode and the circuit of open-circuit CW–
MFC was disconnected.
2.3. Inoculation and system operation
Concentrated anaerobic sludge was collected from the East City
Municipal Wastewater Treatment Plant of Nanjing, China, and used
as the original anodic inoculums of the CW–MFC systems. 4 L con-
centrated sludge was added into each reactor with a concentration
of 20 g/L in mixed liquid suspended solids (MLSS).
ABRX3 (150 mg/L) and glucose (with COD of 180 mg/L) were
used as the mixed substrate in the experiments. The substrate
was diluted in a medium solution with a composition as following
(per liter of tap water): NH4Cl (0.31 g), NaH2PO4 (4.97 g), Na2HPO4
(2.75 g), KCl (0.13 g), NaHCO3 (3.13 g) and 0.1 mL concentrated
trace element solution as reported by Klass (1998).
The glucose (COD: 600 mg/L) in the medium solution was con-
tinuously pumped with a peristaltic pump into the reactors after
inoculation. The systems were formally started when the maximal
reproducible voltages were obtained. After the start-up stage, the
X-3B artificial wastewater (COD: 180 mg/L) was continuously
pumped into the reactors from the water intake at the bottom of
the reactors. The hydraulic retention time (HRT) was 3 days. Sys-
tems were operated for several days after the dye was added in
the reactor until the maximal reproducible voltages were observed
again to make the systems fully acclimate to the dye. The real-time
voltages data were collected during the whole experiment. DO,
decolorization rate, and COD of the samples from all sampling
ports were measured in triplicate. All the experiments were con-
ducted, at a constant room temperature (25 ± 2 °C).
2.4. Analytics and calculations
The dissolved oxygen concentration (DO) was determined by a
dissolved oxygen analyzer (DKK-TOA DO-31P, Japan).
Decolorization efficiency of ABRX3 was determined by monitor-
ing the decrease of absorbance at a maximum wavelength of
538 nm with a spectrophotometer (Labtech 9100B PC). Samples
with higher concentration of ABRX3 were adequately diluted prior
to absorbance measurement.
Decolorization activity was calculated using Eq. (1):
Decolorization rate ð%Þ ¼ ðA  BÞ=A  100% ð1Þ
A is the initial absorbance; B is the observed absorbance.
 Z. Fang et al. / Bioresource Technology 144 (2013) 165–171
The T-test with different samples was adopted for the compar-
ison of decolorization between different groups. The P value of dif-
ferent groups was calculated with excel 2007. If P value <0.01,
there is significant difference between groups. If 0.01 < P va-
lue < 0.05, the difference between groups is not very obvious. If P
value >0.05, there is no significant difference between groups.
The soluble chemical oxygen demands (COD) were measured
using potassium dichromate method (APHA method 5220). The
COD removal efficiency (dCOD) was calculated using Eq. (2)
dCOD ¼ ðCODin  CODout Þ=CODin  100%
Where CODin and CODout represent the initial COD concentration
(mg/L) and the observed COD concentration (mg/L) at different
depths, respectively.
All samples were filtered through a 0.45 lm syringe filter to re-
move suspended solids from the liquid media prior to the
measurements.
The cell voltages (V) generated in the planted CW–MFC and the
non-planted CW–MFC were recorded every 21.6 min by a data
acquisition module (DAM-3057 and DAM-3210, Art Technology
Co. Ltd., China).
The power density (W/m3) was calculated according to Eq. (3)
P ¼ IU=V
Where I is the current, U is the voltage, and V is the working volume
of the anode.
The internal resistance was calculated by the linear region of
polarization curve (Logan, 2008; Puig et al., 2012).
The electrode potentials were measured using a saturated calo-
mel reference electrode (INESA Scientific Instrument Co., Ltd,
China).
2.5. Bacterial community analysis
In order to find the influence of anode on the microbial commu-
nity, especially electrogenic bacteria, the anodic materials packed
in the anodic area of the reactors were sampled at the end of the
experiment. According to the preliminary results, Geobacter sulfur-
reducens (G. sulfurreducens) and Beta Proteobacteria were chosen as
the typical electrogenic bacteria in the anode. The relative abun-
dances of Bacteria, G. sulfurreducens, Beta Proteobacteria and Ar-
chaea on the surface of anodic materials were detected with the
fluorescence in situ hybridization (FISH) technique. Samples were
pretreated and fixed on the glass slides. G. sulfurreducens and Beta
Proteobacteria were determined as electrogenic bacteria (Kiely
et al., 2011; Logan, 2008). As shown in Table 1, the probes for Bac-
teria (EUB338) and Beta Proteobacteria (BET42a) were labeled with
HEX. The probe for G. sulfurreducens (GEO2) was labeled with CY3,
and used in combination with unlabeled auxiliary probes HGEO2-1
and HGEO2-2. The probes of Archaea (ARCH915) was labeled with
FITC. All of the samples were hybridized with DAPI (40 ,60 -
diamidino-2-phenylindole dihydrochloride) (Kiely et al., 2011) at
the same time. The slides were examined with a microscope
(OLYMPUS-BX42, Japan) and photos were taken by a Nikon coolpix
P7000 camera. Photos were selected randomly, and fluorescence
Table 1
Probes and sequence of fluorescence in situ hybridization (FISH).
Probe Target
EUB338 Bacteria
GEO2 G. sulfurreducens
HGEO2-1 Helper probes for GEO2
HGEO2-2 Helper probes for GEO2
BET42a Beta Proteobacteria
ARCH915 Archaea
167
intensity was detected by Image-Pro Plus. The microibal popula-
tion was counted and the relative abundance was expressed as
the percentage of each microbial group.
3. Results and discussion
3.1. Wastewater treatment performance
3.1.1. Decolorization
ð2Þ As represented in Fig. 2A, the accumulated decolorization rate
of ABRX3 increased with the elevation of reactor’s depth. The in-
crease of decolorization rate was greater in the lower half of the
reactors than in the upper half of the reactors, which was probably
due to the consumption of co-substrate. Azo dye decolorization
under anaerobic condition refers to the reductive cleavage of
–N@N– bond, which is known to require organic carbon source
as co-substrate (Khehra et al., 2006; Ong et al., 2005). The co-sub-
strate can be glucose, sucrose, acetate et.al. Glucose was consid-
ered as the best carbon source for anaerobic sludge (Kim et al.,
2008; Sun et al., 2009a) and was used as the co-substrate in this
experiment. With the addition of the glucose, the ABRX3 was
decolorized very fast. Meanwhile, the glucose was degraded very
ð3Þ quickly which mainly happened in the lower half of the reactor
(as shown in Fig. 3). In the upper half, the concentration of glucose
was very low. Although the byproducts during azo dye decoloriza-
tion could also be used as co-substrate, they weren’t as favorable as
glucose. With the reduction of glucose concentration, the ABRX3
decolorization rate decreased. On the other hand, the DO concen-
trations in the upper half of reactor was higher than the lower half
(as shown in Fig. 4). Therefore lower azo dye decolorization rates
were observed in the upper half of reactor as the aerobic condition
would inhibit the decolorization process (Li et al., 2010; Pandey
et al., 2007).
According to Fig. 2A, the closed-circuit CW–MFC showed the
highest decolorization rate of about 91.24%, in comparison with
85.85% in the non-planted CW–MFC. The open-circuit CW–MFC
obtained the lowest decolorization rate of 75.38%, which was
15% lower than the closed-circuit system. According to the T-test,
the P value of decolorization rate of non-planted CW–MFC and
planted CW–MFC was 0.013 (0.01 < P < 0.05), much larger than
that of open-circuit CW–MFC and planted CW–MFC (6.38E-5,
P < 0.01). It indicated that the difference of decolorization rate be-
tween the non-planted CW–MFC and the planted CW–MFC was
not as statistically significant as that between the open-circuit
CW–MFC and the planted CW–MFC. The results strongly suggested
the role of electrodes in promoting the decolorization process of
azo dye.
Fig. 2B showed the decolorization rates in the different layers of
the reactors. The anode layer made the greatest contribution to
ABRX3 decolorization. The decolorization rate in the anode layer
of the open-circuit CW–MFC was 45.5%, about 17% lower than in
the other layers. The decolorization rates of 54.63% and 54.91%,
in the anode layer of the non-planted CW–MFC and planted CW–
MFC, respectively, were similar (P = 0.9654); and were about 20%
higher than other areas, although the volume of anode area was
Sequence Formamide concentrations
GCTGCCTCCCGTAGGAGT 10%
GAAGACAGGAGGCCCGAAA 20%
GTCCCCCCCTTTTCCCGCAAGA 
CTAATGGTACGCGGACTCATCC 
GCCTTCCCACTTCGTTT 35%
GTGCTCCCCCGCCAATTCCT 35%
168 Z. Fang et al. / Bioresource Technology 144 (2013) 165–171
Fig. 2. Decolorization performance of ABRX3 (150 mg/L): (A) decolorization rates at
different heights; (B) decolorization rates in different areas of reactors.
Fig. 3. COD removal performance at different heights (ABRX3 of 150 mg/L and COD
of 180 mg/L).
only 19% of the whole volume. The decolorization rate in the anode
layer was obviously higher than others layers. The high specific
Fig. 4. Dissolved oxygen variation at different heights of planted CW–MFC, non-
planted CW–MFC and open-circuit CW–MFC.
surface area in the GAC significantly benefited biofilm growth.
Azo dye could be adsorbed onto the biofilm of GAC, and then be
oxidized by the microorganisms on the biofilm. During the biodeg-
radation, the adsorption positions of the GAC biofilm could be re-
sumed, and its adsorption capacity could be maintained.
The decolorization rates in the anode layer of the closed-circuit
systems were about 10% higher than the open-circuit system.
Decolorization acceleration of ABRX3 in the MFC might be attrib-
uted to the presence of the anode. In the anode area, the efficient
decolorization of azo dye was not only ascribed to the high effi-
ciency of biological activated carbon but also ascribed to the pro-
moter action of MFC. The reductive cleavage of the –N@N– bond
refers to the direct electron transfer to azo dyes as terminal elec-
tron acceptors during microbial catabolism (Dos Santos et al.,
2007; Li et al., 2010). The anode provided sufficient anaerobic ter-
minal electron acceptors to increase the metabolic rates of anaer-
obic bacteria (Li et al., 2010). This could accelerate the
conversion of the co-substrate to produce more electrons for azo
dye reduction, and realize an indirect accelerated decolorization
process for ABRX3.
The decolorization rate in the cathode layer was relatively low
compared with that in the anode area, but there was still a differ-
ence between three systems: the decolorization rates of the open-
circuit CW–MFC and planted CW–MFC were 1.69%, and 1.71%,
respectively, compared to as low as 0.88% in the non-planted
CW–MFC. Based on T-test analysis, there was a very dramatic dif-
ference between the non-planted and the planted CW–MFC
(P = 2.148E5). The root of I. aquatica became red after ABRX3
was pumped into the reactor, indicating the root absorbed some
azo dye. Furthermore, it was shown that rhizosphere microorgan-
isms can decompose and mineralize contamination effectively
(Blake et al., 1993). The degradation product could be absorbed
by the plants so as to hasten their growth. On the other hand,
the root exudates could promote the growth and metabolism of
microorganism so as to strengthen the biodegradation of contam-
ination. The rhizosphere could excreted some special compounds
as the substrates for microbial degradation and to promote the
growth of microorganisms that benefit to degradation reaction.
In this way, the synergistic effect between plants and microorgan-
isms accelerated the degradation reaction (Bais et al., 2004).
3.1.2. COD removal
According to the notes of APHA method 5220, some aromatic
amines resist oxidation cannot be oxidized sufficiently by
 Z. Fang et al. / Bioresource Technology 144 (2013) 165–171
potassium dichromate, Silver catalyst and concentrated sulfuric
acid. Preliminary experiment has shown that there was gap be-
tween the COD theoretical calculations and measured values of
ABRX3, but the glucose can be oxidized effectively. This may attrib-
uted that benzene ring in ABRX3 molecule cannot be oxidized suf-
ficiently. So the COD of the artificial wastewater in this experiment
was mostly contributed by glucose and partly contributed by
ABRX3.
As shown in Fig. 3, COD variation tendency was similar to the
decolorization, but the highest COD removal efficiency appeared
in the area between the anode and the cathode. This indicated that
most of the glucose was degraded in the lower half of the reactors.
The planted CW–MFC got the highest COD removal efficiency of
85.65%, while that of non-planted CW–MFC and open-circuit
CW–MFC were 82.67% and 73.00%, respectively. This indicated that
the presence of the anode benefited COD removal.
In the cathode, COD removal efficiency declined sharply. Aro-
matic amines are known to undergo autoxidation under aerobic
conditions and form polymeric products. But as shown in Figs. 3
and 4, the COD removal efficiency declined more obviously in the
cathode of open-circuit CW–MFC, while the DO in the open-circuit
CW–MFC cathode was much higher than the other two systems. It
indicated the aromatic amines have undergone further aerobic
degradation reactions in the cathode. Intermediates such as aniline
and sulfonated aromatic amines were considered to resist further
biodegradation under anaerobic conditions (Stolz, 2001; Van der
Zee et al., 2001), thus, many researchers have adopted anaero-
bic–aerobic (A/O) systems for complete degradation of azo dyes,
and found the aromatic amines could be degrade by aerobic treat-
ment. (Li et al., 2010; Ong et al., 2005). As mentioned before, some
of the aromatic amines could not be detected sufficiently by the
potassium dichromate method; however, the byproducts of aro-
matic amines degradation were more easily detected by this meth-
od. And the volume of cathode layer was not large enough to
degrade all the byproducts into H2O and CO2. So the COD incre-
ment in cathode was contributed by these byproducts, and the
oxygen enriched environment was more beneficial for aerobic deg-
radation of aniline and sulfonated aromatic amines.
3.2. Redox state
As showed in Fig. 4, the lowest DO was about 0.24 mg/L at the
height of 10–30 cm of the three reactors. This indicated that
the anode area of the MFC was in a reductive environment. From
Fig. 5. Electricity generation performance of non-plant CW–MFC and planted CW–
MFC.
169
the height of 30 cm to 45 cm, DO increased slowly with the in-
crease of reactor height. In the surface layer (45–50 cm), DO in-
creased sharply, and the highest DO level reached 6.31 mg/L in
the open-circuit CW–MFC. The DO in the surface layers of planted
CW–MFC and the non-planted CW–MFC were 5.09 mg/L and
4.78 mg/L, respectively. This indicated that the cathode area of
the MFC was in aerobic environment. On one hand, the increase
of DO in the surface layer was attributed to the dissolution of oxy-
gen in the air. On the other hand, the root systems of vascular
plants have strong oxygen release capabilities (Thomas et al.,
1996) and can enhance the concentration of oxygen in the surface
layer of wetland. DO in the surface layer of open-circuit CW–MFC
was about 1.22 mg/L, higher than the planted CW–MFC. This was
mainly caused by the different oxygen consumption mechanisms
in the two systems. The consumption of oxygen in the closed-cir-
cuit system (the planted CW–MFC is a closed-circuit system in this
experiment) was due to the chemical reduction during the half-
reaction of primary battery and biodegradation, but the open-cir-
cuit CW–MFC only contained aerobic microbial reactions. The reac-
tion rate of chemical reaction is higher than biological reaction.
Consequently, the oxygen consumption rate in the surface layer
of planted CW–MFC was higher than that of open-circuit CW–
MFC, as suggested by the lower DO level detected in the planted
CW–MFC.
3.3. Electricity generation
To investigate the effect of plants on electricity generation, a ser-
ies of comparative studies were done to analyze the electricity gen-
eration from the planted and non-planted CW–MFCs. Fig. 5 shows
the voltages of the two systems under a running time of 360 h. The
voltages of two systems were very stable. The voltage of the planted
CW–MFC varied in the ranges between 603 mV and 618 mV while
the non-planted CW–MFC between 522 mV and 536 mV, respec-
tively. This indicated that the plants grown in the cathode fostered
electricity generation in the MFC. As discussed in Section 3.2, the
plants enhanced the concentration of oxygen in the cathode. In the
cathode of MFCs, the protons from the anode, the electron from
external circuit and the O2 generated the reaction: O2 + 4H+ + 4-
e = 2H2O. So high concentration of oxygen in the cathode can pro-
mote this reaction, and then strengthen the cell reaction. On the
other hand, higher concentration of oxygen can enhance the cathode
potential. Therefore, the electricity generation of planted CW–MFC
had been promoted accordingly by plants.
Based on the external resistance adjustment from 5 X to
100,000 X and finally to the infinity as an open-circuit, the power
density curve and the polarization curve were obtained (Fig. 6A).
The plants significantly affected the power density. The highest
maximum power density was 0.302 W/m3 in the planted CW–
MFC (with current density of 0.848 A/m3), and only 0.191 W/m3
in the non-planted CW–MFC (with current density of 0.674 A/
m3). The power density differences of two systems during the elec-
tricity generation could attribute to the internal resistances. With-
in the linear region of the polarization curve, the internal
resistance was obtained. The internal resistances of non-planted
and planted CW–MFC were 272.9 X and 217.7 X, respectively.
The electrode potentials were also measured at various current
densities to investigate the effects of plants on the electrode per-
formance (Fig. 6B). According to Fig. 6B, when current density
was smaller than 0.5 A/m3, the cathode polarization of non-planted
CW–MFC was more obvious than planted CW–MFC. This indicated
the grown of plants reduced the internal resistance of MFC system.
The internal resistance of MFCs was contributed by the anode, the
cathode and the electrolyte. The electrolyte resistance was too
small to be measured (Fan et al., 2008). The cathode resistance
was mainly caused by the oxygen reduction reaction (Shah et al.,
170 Z. Fang et al. / Bioresource Technology 144 (2013) 165–171

Fig. 6. Electricity research of planted CW–MFC and non-planted CW–MFC: (A) power density curve and the polarization curve; (B) internal resistance; (C) electrode potential.

2009). It can be drawn from the results that the plants grown in the
cathode would reduce the cathode resistance by accelerating the
oxygen reduction reaction in the cathode. Because of the lower
oxygen reduction reaction rates in the non-planted CW–MFC, the
electron influx rate in the cathode was higher than that of elec-
trode reaction. As a result, the cathode polarization of non-planted
CW–MFC became more serious. On the other hand, the microor-
ganisms can change the properties of the attached surface, and
may reduce the resistance of the materials (Hou et al., 2012). There
were a large number of microorganisms on the plants roots.
According to the results of FISH, the total bacteria number in the
cathode of planted CW–MFC and non-plant CW–MFC were
4.380  106/cm3 and 2.702  106/cm3, respectively. The number
of bacteria in the cathode of non-planted CW–MFC was smaller
than the planted CW–MFC. The plants in the cathode could in-
crease the number of microorganisms in the cathode, changed
the surface properties, and reduced the internal resistance of
cathode.
Proteobacteria in the anode area of planted CW–MFC and non-
planted CW–MFC were much more than Archaea. However, in the
anode area of open-circuit CW–MFC, the community fraction of
electrogenic bacteria was much lower than that in the closed-cir-
cuit MFCs. The relative abundance of Archaea was in a reverse pro-
portion to electrogenic bacteria. The Open-circuit CW–MFC
contained more abundant Archaea than the closed-circuit MFCs.
These results indicated that the connection of external circuit pro-
moted the growth of G. sulfurreducens and Beta Proteobacteria and
inhibited the growth of Archaea in the anode. Archaea in the anode
would compete with the electrogenic bacteria for organic sub-
stances and influenced the electron transport. Meanwhile, the
methane generated by Archaea would disturb the system, break
the exchange of materials and electrogenesis environment, and
block the proton transfer which eventually weakened the stability
Table 2
The number of bacteria in anode of planted CW–MFC and non-planted CW–MFC
(number/cm2).

Reactor G. sulfurreducens Beta Proteobacteria Archaea

3.4. The influence of electrode in electrogenic bacteria and Archaea Non-planted CW– 1.133  107 7.212  106 1.603  106
MFC
Planted CW–MFC 1.202  107 6.869  106 2.061  106
Table 2 showed the abundance of each examined microbial Open-circuit CW–MFC 8.014  106 3.663  106 4.808  106
group. The community fraction of G. sulfurreducens and Beta
 Z. Fang et al. / Bioresource Technology 144 (2013) 165–171
of electrogenesis system (Logan, 2008). Consequently, in order to
promote the electrogenesis performance, the growth of Archaea
should be inhibited.
In all three reactors, the abundance fraction of G. sulfurreducens
was more than Beta Proteobacteria, which might caused by the
influence of anode material. Some studies demonstrated that
GAC was the most favorable material for the adhesion and growth
of G. sulfurreducens (Sun et al., 2011), which was well acknowl-
edged for their capability of electricity generation (Bretschger
et al., 2007; Nevin et al., 2009). G. sulfurreducens could transfer
the electrons directly to the electrode (Bond and Lovley, 2003).
The existence of G. sulfurreducens in the anode of MFCs can signif-
icantly improve the power generation (Bond and Lovley, 2003; Yi
et al., 2009). In the planted CW–MFC system, the continuous up-
flow supplied a suitable growing environment for G. sulfurreducens
and improved the power generation.
4. Conclusions
Simultaneous decolorization of azo dye and bioelectricity gen-
eration were successfully achieved in the CW–MFCs. 91.24% of
ABRX3 decolorization was obtained with a HRT of 3 days, while
the power density reached 0.302 W/m3. The plants enhanced the
output voltage of MFC, and reduced the cathode resistance to pro-
mote the dye decolorization. The anode could accelerate the decol-
orization rates of azo dye, while the cathode could degrade the
byproducts during the decolorization. Currents in the closed-cir-
cuit stimulated the growth of electrogenic bacteria such as G. sul-
furreducens and therefore significantly improve the electricity
generation of closed-circuit CW–MFC system.
Acknowledgements
The authors would like to acknowledge the financial support
from National Science Foundation of China (Grant No. 21277024
and No. 51109038) and the Fundamental Research Funds for the
Central Universities.
References
Bais, H.P., Park, S.W., Weir, T.L., Callaway, R.M., Vivanco, J.M., 2004. How plants
communicate using the underground information superhighway. Trends Plant
Sci. 9, 26–32.
Blake, R.C., Choate, D.M., Bardhan, S., Revis, N., Barton, L.L., Zocco, T.G., 1993.
Chemical transformation of toxic metals by a pseudomonas strain from a toxic
waste site. Environ. Toxicol. Chem. 12, 1365–1376.
Bond, D.R., Lovley, D.R., 2003. Electricity production by Geobacter sulfurreducens
attached to electrodes. Appl. Environ. Microbiol. 69, 1548–1555.
Bretschger, O., Obraztsova, A., Sturm, C.A., Chang, I.S., Gorby, Y.A., Reed, S.B., Culley,
D.E., Reardon, C.L., Barua, S., Romine, M.F., Zhou, J.Z., Beliaev, A.S., Bouhenni, R.,
Saffarini, D., Mansfeld, F., Kim, B.H., Fredrickson, J.K., Nealson, K.H., 2007.
Current production and metal oxide reduction by Shewanella oneidensis MR-1
wild type and mutants. Appl. Environ. Microbiol. 73, 7003–7012.
de Aragão Umbuzeiro, G., Freeman, H.S., Warrenc, S.H., Danielle Palma de Oliveira
Stereo, Y., Watanabe, T., Claxton, L.D., 2005. The contribution of azo dyes to the
mutagenic activity of the cristais river. Chemosphere 60, 55–64.
Dos Santos, A.B., Cervantes, F.J., Lier, J.B., 2007. Review paper on current
technologies for decolourisation of textile wastewaters: perspectives for
anaerobic biotechnology. Bioresour. Technol. 98, 2369–2385.
Dunne, E.J., Culleton, N., Donovan, G.O., Harrington, R., Olsen, A.E., 2005. An
integrated constructed wetland to treat contaminants and nutrients from dairy
farmyard dirty water. Ecol. Eng. 24, 221–234.
171
Fan, Y.Z., Sharbrough, E., Liu, L., 2008. Quantification of the internal resistance
distribution of microbial fuel cells. Environ. Sci. Technol. 42, 8101–8107.
Feng, Y.J., Lee, H., Wang, X., Liu, Y.L., He, W.H., 2010. Continuous electricity
generation by a graphite granule baffled air-cathode microbial fuel cell.
Bioresour. Technol. 101, 632–638.
Fernando, E., Keshavarz, T., Kyazze, G., 2013. Simultaneous co-metabolic
decolourisation of azo dye mixtures and bio-electricity generation under
thermophillic (50 °C) and saline conditions by an adapted anaerobic mixed
culture in microbial fuel cells. Bioresour. Technol. 127, 1–8.
Hou, B., Hua, Y.Y., Sun, J., 2012. Performance and microbial diversity of microbial
fuel cells coupled with different cathode types during simultaneous azo dye
decolorization and electricity generation. Bioresour. Technol. 111, 105–110.
Khehra, M.S., Saini, H.S., Sharma, D.K., Chadha, B.S., Chimni, S.S., 2006.
Biodegradation of azo dye C.I. Acid Red 88 by an anoxicaerobic sequential
bioreactor. Dyes Pigments 70, 1–7.
Kiely, P.D., Rader, G., Regan, J.M., Logan, B.E., 2011. Long-term cathode performance
and the microbial communities that develop in microbial fuel cells fed different
fermentation end products. Bioresour. Technol. 102, 361–366.
Kim, S.Y., An, J.Y., Kim, B.W., 2008. The effects of reductant and carbon source on the
microbial decolorization of azo dyes in an anaerobic sludge process. Dyes
Pigments 76, 256–263.
Klass, D.L., 1998. Biomass for Renewable Energy, Fuels, and Chemicals. Academic
Press, San Diego.
Li, Z.J., Zhang, X.W., Lin, J., Han, S., Lei, L.C., 2010. Azo dye treatment with
simultaneous electricity production in an anaerobic–aerobic sequential reactor
and microbial fuel cell coupled system. Bioresour. Technol. 101, 4440–4445.
Liu, H., Logan, B.E., 2004. Electricity generation using an air-cathode single chamber
microbial fuel cell in the presence and absence of a proton exchange membrane.
Environ. Sci. Technol. 38, 4040–4046.
Logan, B.E., 2008. Microbial Fuel Cell. John Wiley & Sons, New York.
Luo, H., Liu, G., Zhang, R., Jin, R., 2009. Phenol degradation in microbial fuel cells.
Chem. Eng. J. 147, 259–264.
Morris, J.M., Jin, S., Crimid, B., Prudend, A., 2009. Microbial fuel cell in enhancing
anaerobic biodegradation of diesel. Chem. Eng. J. 146, 161–167.
Nevin, K.P., Kim, B.C., Glaven, R.H., Johnson, J.P., Woodar, T.L., Methe, B.A., Didonato,
R.J., Covalla, S.F., Franks, A.E., Liu, A., Lovley, D.R., 2009. Anode biofilm
transcriptomics reveals outer surface components essential for high density
current production in Geobacter sulfurreducens fuel cells. PloS One 4, e5628.
Ong, S.A., Toorisaka, E., Hirata, M., Hano, T., 2005. Decolorization of azo dye (orange
II) in a sequential UASB-SBR system. Sep. Purif. Technol. 42, 297–302.
Pandey, A., Singh, P., Iyengar, L., 2007. Bacterial decolorization and degradation of
azo dyes. Int. Biodeter. Biodegr. 59, 73–84.
Puig, S., Coma, M., Desloover, J., Boon, N., Balaguer, M.D., 2012. Autotrophic
denitrification in microbial fuel cells treating low ionic strength waters.
Environ. Sci. Technol. 46, 2309–2315.
Shah, M., Nicholas, J.D., Barnett, S.A., 2009. Prediction of infiltrated solid oxide fuel
cell cathode polarization resistance. Electrochem. Commun. 11, 2–5.
Stolz, A., 2001. Basic and applied aspects in the microbial degradation of azo dyes.
Appl. Microbiol. Biotechnol. 56, 69–80.
Sun, M., Mu, Z.X., Chen, Y.P., Sheng, G.P., Liu, X.W., Chen, Y.Z., Zhao, Y., Wang, H.L.,
Yu, H.Q., Wei, L., Ma, F., 2009a. Microbe-assisted sulfide oxidation in the anode
of a microbial fuel cell. Environ. Sci. Technol. 43, 3372–3377.
Sun, J., Hua, Y.Y., Bi, Z., Cao, Y.Q., 2009b. Simultaneous decolorization of Azo dye and
bioelectricity generation using a microfiltration membrane air-cathode single-
chamber microbial fuel cell. Bioresour. Technol. 100, 3185–3192.
Sun, Y.M., Wei, J.C., Liang, P., Huang, X., 2011. Electricity generation and microbial
community changes in microbial fuel cells packed with different anodic
materials. Bioresour. Technol. 102, 10886–10891.
Thomas, K.L., Benstead, J., Davies, K.L., Lloyd, D., 1996. Role of wetland plants in the
diurnal control of CH4 and CO2 fluxes in peat. Soil Biol. Biochem. 28, 17–23.
Van der Zee, P.F., Lettinga, G., Field, J.A., 2001. Azo dye decolourisation by anaerobic
granular sludge. Chemosphere 44, 1169–1176.
Wischnak, C., Muller, R., 2000. Degradation of Chlorinated Compounds. Wiley-VCH,
Weinheim.
Yadav, A.K., Dash, P., Mohanty, A., Abbassi, R., Mishra, B.K., 2012. Performance
assessment of innovative constructed wetland–microbial fuel cell for electricity
production and dye removal. Ecol. Eng. 47, 126–131.
Yi, H.N., Nevina, K.P., Kim, B.C., Franks, A.E., Klimes, A., Tender, L.M., Lovley, D.R.,
2009. Selection of a variant of Geobacter sulfurreducens with enhanced capacity
for current production in microbial fuel cells. Biosens. Bioelectron. 24, 3498–
3503.