Microbial Pathogenesis 52 (2012) 206e216

Contents lists available at SciVerse ScienceDirect

Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath

Induction of TNF-alfa and CXCL-2 mRNAs in different organs of mice infected with
pathogenic Leptospiraq
Josefa B. da Silva a, b, *, Enéas Carvalho a, Ambart E. Covarrubias c, Ana Tung C. Ching a,
Vania G.M. Mattaraia a, Delhi Paiva d, Marcelo de Franco e, Regiane Degan Fávaro a, Martha M. Pereira f,
Silvio Vasconcellos g, Telma T.M. Zorn c, Paulo Lee Ho a, b, *, Elizabeth A.L. Martins a, b, *
a
Centro de Biotecnologia, Instituto Butantan, São Paulo, SP, Brazil
b
Pós-graduação Interunidades em Biotecnologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, Brazil
c
Laboratório de Biologia da Reprodução e Matriz Extracelular, USP, Brazil
d
Instituto de Matemática e Estatística da Universidade de São Paulo, SP, Brazil
e
Laboratório de Imunogenética, Instituto Butantan, SP, Brazil
f
WHO Collaborating Center for Leptospirosis, Instituto Oswaldo Cruz/FIOCRUZ, Rio de Janeiro, Brazil
g
Laboratório de Zoonoses Bacterianas, Faculdade de Medicina Veterinária e Zootecnia, São Paulo, Brazil

a r t i c l e i n f o a b s t r a c t

Article history: The role of innate immune response in protection against leptospirosis is poorly understood. We
Received 9 November 2011 examined the expression of the chemokine CXCL2/MIP-2 and the cytokine TNF-a in experimental
Received in revised form resistant and susceptible mice models, C3H/HeJ, C3H/HePas and BALB/c strains, using a virulent strain of
27 December 2011
Leptospira interrogans serovar Copenhageni. Animals were infected intraperitoneally with 107 cells and
Accepted 3 January 2012
Available online 8 February 2012
the development of the disease was followed. Mortality of C3H/HeJ mice was observed whereas C3H/
HePas presented jaundice and BALB/c mice remained asymptomatic. The infection was confirmed by the
presence of leptospiral DNA in the organs of the animals, demonstrated by PCR. Sections of the organs
Keywords:
Leptospira
were analyzed, after H&E stain. The relative expression of mRNA of chemokine CXCL2/MIP-2 and cyto-
C3H/HeJ mice kine TNF-a was measured in lung, kidney and liver of the mice by qPCR. The concentrations of these
Chemokine proteins were measured in extracts of tissues and in serum of the animals, by ELISA. Increasing levels of
CXCL2/MIP-2 transcripts and protein CXCL2/MIP-2 were detected since the first day of infection. The highest
TNF-alfa expression was observed at third day of infection in kidney, liver and lung of BALB/c mice. In C3H/HeJ the
expression of CXCL2/MIP-2 was delayed, showing highest protein concentration in lung and kidney at the
5th day. Increasing in TNF-a transcripts were detected after infection, in kidney and liver of animals from
the three mice strains. The expression of TNF-a protein in C3H/HeJ was also delayed, being detected in
kidney and lung. Our data demonstrated that Leptospira infection stimulates early expression of CXCL2/
MIP-2 and TNF-a in the resistant strain of mice. Histological analysis suggests that the expression of
those molecules may be related to the influx of distinct immune cells and plays a role in the naturally
acquired protective immunity.
Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction identified. Rodents infected by Leptospira become carriers, and shed

Leptospirosis is a worldwide zoonosis caused by the highly
invasive spirochete Leptospira. Currently more than 250 Leptospira
pathogenic serovars, potentially able to infect humans, have been
q Financial support: FAPESP, CNPq and Fundação Butantan.
* Corresponding authors. Centro de Biotecnologia, Instituto Butantan, Av. Vital
Brasil 1500, 05303-900 São Paulo, SP, Brazil. Tel.: þ55 11 37267222; fax: þ55 11
37269233.
E-mail addresses: josilvab@butantan.gov.br (J.B. da Silva), hoplee@butantan.
gov.br (P.L. Ho), martins@butantan.gov.br (E.A.L. Martins).
bacteria through their urine into water or soil, promoting infection
of other hosts via skin contact. After infection, the bacteria
disseminate through the systemic circulation and colonize target
organs, specially: liver, lungs, and kidneys. The clinical symptoms
vary widely from almost asymptomatic or mild manifestations
to very severe forms as for example multiorgan failure (Weil’s
syndrome). Antibiotic treatment applied during early stages of
infection can be effective in most cases, but untreated infections
may lead to severe tissue damage [1,2].
The mechanisms by which leptospires activate the immune
system have been pointed out in several studies. Production of

0882-4010/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.micpath.2012.01.002
 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216
cytokines and chemokines in response to infection has been
proposed to be involved in the pathogenesis of leptospirosis. Thus,
the identification and characterization of the mediators of the
inflammatory responses triggered by pathogenic Leptospira may
contribute for better understanding of the molecular basis of the
pathophysiology of leptospirosis and progress of the infection,
providing new insights for therapy and for development of an
effective vaccine [3e7].
Chemokines are considered key regulators of leukocyte migra-
tion, playing important roles in a number of physiological and
pathological immune and inflammatory processes. The majority of
chemokines have four cysteines, being 28 of them assigned to the
CC family (so-called because of the juxtaposition of the first two
cysteine residues) and 16 assigned to the CXC family (which
possesses a single variable amino acid between the first two
cysteines). The two smaller subfamilies are represented by single
members, the CX3C family (three amino acids between the first two
cysteines) and the XC family (which lacks the first and third
cysteines present in other families) [8].
Inflammatory response is inducible, normally in transient form,
operating at any site that has been damaged or infected. Inflam-
matory chemokines can be expressed by numerous types of cells in
almost any tissue. The chemokines CC and CXC have been recog-
nized as important mediators in inflammation and infection. It was
shown that CXC chemokines induce neutrophil chemotaxis and
stimulate neutrophil activation in inflammatory responses. In
humans, CXC chemokines can be produced by epithelial cells from
renal tubule. Circumstantial observations have suggested that CXC
chemokines induce the influx of polymorphonuclear neutrophils
(PMNs) to promote renal interstitial inflammation [3,8].
In a previous study we analyzed the expression of chemokines
in mice from leptospirosis susceptible or resistant strains. We
demonstrated that the levels of the CXC chemokines, CXCL1/KC (IL-
8) and the CC chemokines, CCL2/JE (MCP-1) and CCL3/MIP-1a, were
increased in leptospirosis susceptible mice strain. In addition it was
showed that these chemokines are earlier produced in resistant
mice strain, after infection with pathogenic Leptospira. The
aggressive nature of the infection in the susceptible strain may be
related to an uncontrolled production of these chemokines, sug-
gesting that the non-functionality of Toll like-receptor 4 (in lep-
tospira susceptible C3H/HeJ strain) alters the expression profile of
these inflammatory mediators [7].
The tumor necrosis factor (TNF) is a pleiotropic cytokine that
regulates a broad range of biological events, including cell differ-
entiation, proliferation, tissue development and death, as well as
inflammation, innate and adaptive immune responses. It is well
documented that multiple factors from bacteria, virus and parasites
stimulate the production of TNF-a in the host [9], including Lep-
tospira infection [10e12].
Primarily, vasculitis is a characteristic lesion found in leptospi-
rosis, leading to cellular damage [1]. Fluid and cell leakage occur in
the presence of few leptospires, suggesting the involvement of
factors from either the spirochete or the host. It was reported
a significant increase of TNF-a in human patients of leptospirosis
[10]. The levels of TNF-a in the plasma were associated with
severity of the disease and mortality [11]. The knowledge of the
molecular mechanisms implicated in the in vivo response to
leptospires would shed new light for the understanding of the
differences in the immune response on severe and mild forms of
the disease.
Experimental leptospirosis in 3 weeks old C3H/HeJ mice has
shown that this strain is highly susceptible to infections with Lep-
tospira interrogans serovars Icterohaemorrhagiae, Manilae and
Copenhageni. C3H/HeJ mice carry a mutation which inactivates the
tlr4 gene, resulting in higher susceptibility to leptospirosis than
207
other strains of mice [4,7,13,14]. Infections with L. interrogans
serovars Copenhageni are typically lethal for C3H/HeJ, while the
parental strain C3H/HePas develops only jaundice. In contrast, the
infection of BALB/c mice with the same dose of Leptospira often
results asymptomatic. It has been shown that TLR4 is indeed
involved in the clearance of Leptospira [4].
The aim of this study was to evaluate the induction of chemo-
kine CXCL2/MIP-2 and cytokine TNF-a during leptospirosis in C3H/
HeJ, C3H/HePas and BALB/c mice strains, in order to point out
possible correlation between production of these chemokines/
cytokines and the progression of the disease.
2. Materials and methods
2.1. Leptospira strain maintenance
The virulence of L. interrogans serovar Copenhageni (ATCCÒ
BAA-1198) was maintained by passages in golden hamster (Meso-
cricetus auratus). Leptospires isolated from animals were cultured
in liquid Ellinghausen McCullough Johnson and Harris (EMJH)
medium at 30  C under aerobic conditions [40]. After 6 days of
culture, bacteria were counted in PetroffeHausser counting
chamber and suspensions were used for infection of mice.
2.2. Experimental infections
The animals were provided by Instituto Butantan and Instituto
de Ciências Biomédicas of Universidade de São Paulo (SP, Brazil).
Groups of twenty-five mice of each strain, C3H/HeJ, C3H/HePas and
BALB/c, were used. Twenty animals of each group were infected
intraperitoneally with 1  107 leptospires and the remaining five
animals of each strain were kept uninfected as control. In parallel,
four 3e4 weeks old hamsters were infected with the same dose to
confirm the virulence of the bacteria. Samples from blood, liver,
kidneys and lungs of five mice were collected at days 0 (uninfected
animals), 1, 3, 5 and 7 after inoculation for analysis. The protocol
used in this study was approved by the Ethical Committee for
Animal Research of Butantan Institute.
2.3. Extraction and detection of leptospiral DNAs in organs of mice
Liver and kidney of the infected mice were collected in liquid
nitrogen and kept at 80  C. Total DNA was extracted using DNA
extraction kit e DNeasy tissue e (QIAGEN) according to manufac-
turer’s procedures. Purified DNA from L. interrogans serovar
Copenhageni was used as template in PCR as positive control. The
primers used for PCR triplex reaction were G1/G2 [41], 34_516 [42]
and flab-F1 and flab-R1 [43]. The three pairs of primers were used
in the same PCR reaction being expected products of 793, 516 and
285 bp respectively. The condition of reaction was 600 ng of DNA
template samples and 4 ng of leptospiral DNA as positive control,
20 pmoles of each primer, 10 mM dNTP mix, 1.25 mL of 25 mM
MgCl2, 1 unit of Go Taq DNA polymerase (Promega) and 1 Go Taq
DNA polymerase buffer in a 25 mL final reaction. The amplification
profile was 30 cycles of denaturation at 95  C/30 s, annealing at
50  C/30 s and extension at 72  C/1 min. PCR products were
analyzed by electrophoresis in agarose gel.
2.4. Morphological studies
Histological analyses were performed in kidney, liver and lung
from 3 animal of each group, collected 7 days after infection and in
kidney, liver and lung from non-infected animals (control). The
organs were fixed in neutral-buffered 4% paraformaldehyde
(Sigma, USA) processed routinely and embedded in paraffin.
208 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216
Samples were cut into 5 mm sections and the slices were adhered
onto glass slides covered with 0.1% poly-L-lysine (Sigma, St. Lois,
MO) and the sections were stained with Hematoxylin and Eosin
(H&E). Kidney, liver and lung from uninfected mice were used as
negative control. Sections were examined and captured using
a Nikon Eclipse E600 microscope with a digital camera Nikon DP-72
(Nikon, Japan) and Image Pro Plus software (Media Cybernetics,
Silver Spring, MC, USA).
2.5. Soluble organ extracts and cytokine analyses by ELISA
Half of the kidney, half of the lung, and ¼ of the liver, were
macerated in 1.5 mL of lyses buffer containing 0.5% Triton X-100,
150 mM NaCl, 15 mM Tris, 1 mM CaCl2 and 1 mM MgCl2, pH 7.4. The
suspensions were centrifuged and the supernatants stored
at 80  C. Cytokines were measured in duplicate using commercial
ELISA kits (Duo set R&D systems, Minneapolis, MN).
2.6. Extraction of total RNA and quantitative real-time PCR analysis
The organs of mice were collected in liquid nitrogen and kept
to 80  C. Total RNA was isolated using TRIZOL (Invitrogen). The
concentration and purity of RNA were measured in a Nanodrop-
1000 spectrophotometer (ThermoScientific). RNA integrity was
determined by agarose gel electrophoresis. An aliquot of 2 mg RNA
of each sample was transcribed to cDNA using SuperScript III kit
(Invitrogen). The primers selected for this study (Table 1) were
designed from published sequences using a Primer Express soft-
ware (Applied Biosystems) and analyzed by Gene Runner 3.05 and
IDT SciTools OligoAnalyzer 3.1. Quantitative real-time PCR (qPCR)
analysis was performed using the Applied Biosystems 7300 Real-
Time PCR System. Cycle threshold (CT) values for specific genes
were normalized to the CT value for glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) gene as reference. The specificity of the
qPCR was controlled using no-template as controls. The qPCR
reaction was carried out with the Syber Green Master Mix (PE
Applied Biosystems) using 100 ng of cDNA, 5 mmoles of each
forward and reverse primer in 12 mL final reaction. The PCR thermal
cycle conditions were as follows: initial step at 95  C/10 min, fol-
lowed by 40 cycles of 95  C/15 s and 60  C/1 min. The relative levels
of mRNA of each selected gene were analyzed using 2DDCT method
described by Livak and Schmittgen [44]. All expression levels were
normalized by GAPDH cDNA level measured in the same sample
using primers for GAPDH. Amount of mRNA was calculated as the
ratio of the normalized value of each sample to the corresponding
untreated control. All real-time PCR reactions were performed in
triplicate and the results are the average of two consecutive
experiments.
2.7. Statistical analysis
The results presented are average and standard deviation of
data collected from 5 mice at each time. The statistical analysis
Table 1
Primers used for quantification of GAPDH, CXCL2 and TNF-a mRNA.
Gene GenBank accession Orientation Primer sequence
no.
CXCL2/ NM_009140 Forward CGCTGTCAATGCCTGAAGAC
MIP-2 Reverse ACACTCAAGCTCTGGATGTTCTTG
TNF-a NM_013693 Forward CACAAGATGCTGGGACAGTGA
Reverse TCCTTGATGGTGGTGCATGA
GAPDH NM_008084 Forward CGGCCGCATCTTCTTGTG
Reverse CCGACCTTCACCATTTTGTCTAC
was performed using KruskaleWallis and ManneWhitney test for
time comparisons. Differences were considered significant for
p values 0.1.
3. Results
To analyze the importance of CXCL2/MIP-2 and TNF-a in the
injuries caused by Leptospira infection in the animal tissues, three
strains of mice, C3H/HeJ, C3H/HePas and BALB/c, were inoculated
with L. interrogans serovar Copenhageni.
BALB/c mice showed to be resistant to infection. C3H/HeJ mice
strain, which is deficient for TLR4, presented moribund state
around 5th to 7th day after inoculation and death was observed
after this period, while mice from the parental strain, C3H/HePas,
presented jaundice around 5th day after infection (data not
shown).
3.1. Detection of leptospiral DNAs in organs of mice
The organs of the animals were removed at different times after
infection and the presence of leptospiral DNAs was detected by
PCR amplification in kidneys and liver of mice from all three
strains, confirming the infection (Fig. 1). It was shown that,
although BALB/c mice did not develop symptom of the disease,
they were carrying leptospiras until the seventh day after infec-
tion. BALB/c samples generated lower amplification of leptospiral
DNA at the 7th day after infection, being necessary the use of
higher amount of DNA template for detection (L7 and K7, Fig. 1),
indicating some level of bacteria clearance. Though no animal from
C3H/HePas group died during the assay, they presented jaundice
from the 5th day after infection and leptospiral DNAs were
detected in kidney and liver until the 7th day. In contrast, C3H/HeJ
mice were susceptible to infection, resulting in death of 1 animal
and a moribund state for the other four animals at the 7th day
after inoculation.
3.2. Morphological analysis of organs from infected mice
Slices of kidneys, livers and lungs of mice from C3H/HeJ, C3H/
HePas and BALB/c strains were analyzed for possible morphological
alterations.
Infected kidneys from BALB/c mice showed enlarged interstitial
spaces, where few leukocytes were present. Some necrotic
epithelial cells were observed in both proximal and distal tubules.
Necrotic cells were less numerous than found in C3H/HePas and
C3H/HeJ. No evident morphological alteration was observed in the
glomeruli (Fig. 2A,B).
Fig. 1. Detection of leptospiral DNA, by PCR, in DNA samples extracted from liver and
kidney of mice infected with L. interrogans serovar Copenhageni. M ¼ Molecular
marker; C ¼ Positive control using DNA (4 ng) of cultured L. interrogans serovar
Copenhageni; DNA from kidney or liver of C3H/HeJ, C3H/HePas and BALB/c were
extracted at days 0 (animal not infected), 3 and 7 days after infection. A pool of DNA
samples from organs of 3 animals of each strain was used as template; 600 ng of
template DNA were used in every reaction, except for reactions L7 and K7 where
1200 ng were used (L7 and K7 are BALB/c liver and kidney extracted at day 7 after
infection, respectively).
 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216 209

Fig. 2. Photomicrographs of kidneys of BALB/c (AeB), C3H/HePas (CeD), and C3H/HeJ (EeF). Observe the normal structures of the kidneys, tubules (þ) and glomerulus (head
arrows) from non-infected BALB/c (A), C3H/HePas (C) and C3H/HeJ (E). (B) Kidney from infected BALB/c showing enlarged interstitial spaces (arrows), leukocyte infiltration around
the tubules (*). (D) Kidney from infected C3H/HePas showing disorganization of tubules (#), acute leukocyte infiltration around the tubules (*). (F) Kidney from C3H/HeJ mice
showing necrotic tubular epithelial cell (N). Few leukocytes are present inside and around the tubules (*). Only vestigial glomeruli (arrow head) is present in the organ. Scale bar:
50 mm.

Infected kidneys from C3H/HePas mice were characterized by
tubules dilatation mainly in the proximal convoluted tubules,
resulting in a structural disorganization of the organ. In these
tubules many epithelial cells were swelling, besides necrotic and
apoptotic cells were also observed. Leukocytes, mainly neutrophils,
were present around the tubules (Fig. 2C,D).
The infected kidneys from C3H/HeJ mice were characterized by
degenerative citoplasmatic changes, mainly cellular swelling.
Compared to the previously described groups, kidneys from C3H/
HeJ showed high tubular necrosis, characterized by loss of nuclei,
fragmentation of cells and, in some areas, loss of cohesion between
cells. In this group of animals only few leukocytes, predominantly
neutrophils, were observed inside and around tubules. However,
severe alteration was observed in the glomeruli, identified as
groups of degenerated cells (Fig. 2E,F).
Infected livers from BALB/c mice showed no alterations in the
hepatocytes organization. Compared with the control, sinusoids
were dilated and Kupffer cells were hypertrophic. Leukocytes,
particularly neutrophils, were accumulated inside sinusoidal
capillaries (Fig. 3AeC and Fig. 1A supplementary material).
Infected livers from C3H/HePas, similarly to BALB/c mice,
showed no important alteration in the organization of the
hepatocytes. However, this group showed a notable increase in
leukocytes and dilatation of sinusoids when compared to the other
strains. Kupffer cells showed hypertrophy (Fig. 3DeF and Fig. 1B
supplementary material).
In the infected livers from C3H/HeJ mice the sinusoids were
less dilated when compared to the other two strains. In some
areas near of the central vein some sinusoids appear to be
interrupted or collapsed (not shown). In contrast to the obser-
vation in C3H/HePas and BALB/c, only few leukocytes and less
hypertrophic Kupffer cells were noted (Fig. 3GeI and Fig. 1C
supplementary material).
Infected lungs from BALB/c mice were characterized by thick-
ening of alveolar septae due to the increase of inflammatory cells
and edema. In addition, few leukocytes and red blood cells were
present into alveolar sacs (Fig. 4A,B).
No morphological alterations were detected in the parenchyma
of the infected lungs from C3H/HePas. However, the interalveolar
septae were moderately thickened (Fig. 4C,D).
Infected lungs from C3H/HeJ mice were characterized by intense
hemorrhage present inside the alveolar sacs. The interalveolar
septae was not evident and appeared to be fragmented. Leukocyte
infiltration was not prominent (Fig. 4E,F).
210 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216

Fig. 3. Photomicrographs of livers of BALB/c (AeC), C3H/HePas (DeF), and C3H/HeJ (GeI). Observe normal liver structures with well preserved liver plates and central vein (CV) of
non-infected BALB/c (A), C3H/HePas (D) and C3H/HeJ (G). (BeC) e Liver from infected BALB/c showing well preserved liver plates (arrow head) and, inflammatory infiltrate inside
sinusoidal capillaries (*). (EeF) e Liver from infected C3H/HePas showing inflammatory infiltrate (*) and dilated sinusoids (arrows). (HeI) e Liver from C3H/HeJ mice showing
dilated sinusoids almost free of leukocytes (arrows). Scale bars (C,F,I) 20 mm, (A,B,D,E,G,H) 50 mm.

3.3. Leptospira induces inflammatory CXCL2/MIP-2 chemokine in
organs of mice
Infection with 107 cells of L. interrogans serovar Copenhageni
induced CXCL2/MIP-2 transcription, increasing the mRNA content
in all tissues collected from the three mice strains since the 1st day
after inoculation. The amount of CXCL2/MIP-2 mRNA was similar
and elevated in kidney of infected C3H/HeJ and C3H/HePas mice,
achieving 80 folds at 7th day (Fig. 5A,B). In the kidney of C3H/HeJ
and C3H/HePas mice the profile of CXCL2/MIP-2 mRNA was
different from the profile of protein. While the levels of CXCL2/MIP-
2 mRNA increased until the 7th day after infection, the levels of
protein decreased at 7th day (Fig. 5A,B and Fig. 6A,B). It is inter-
esting to notice that in the kidney of BALB/c mice there was an
increase in CXCL2/MIP-2 mRNA until the 3rd day after infection,
and then, different from the other mice strains, a decay on mRNA
accumulation occurred (Fig. 5C). In kidney of BALB/c, CXCL2/MIP-2
protein (Fig. 6C) and mRNA were similar, with increase until the 3rd
day and the protein was sustained until the 7th day, while the
infection was being controlled.
The CXCL2/MIP-2 mRNA content in the liver of mice strains with
the same genetic background (C3H/HeJ and C3HePas) was similar,
except by a significant peak on days 3e5, with an increase of 10
folds measured in C3H/HeJ (Fig. 5D,E). In the liver of BALB/c an
increase of CXCL2/MIP-2 mRNA was detected, achieving around 20
folds at 3rd day after infection, decreasing in the subsequent days
(Fig. 5F). L. interrogans serovar Copenhageni is not lethal to C3H/
HePas and BALB/c at our experimental conditions and it is inter-
esting to notice that in the liver of both strains there was an
increase of CXCL2/MIP-2 protein (Fig. 6E,F), while in the susceptible
C3H/HeJ the CXCL2/MIP-2 protein remained constant throughout
the days of analyses (Fig. 6D).
In the lung, the highest level of CXCL2/MIP-2 mRNA was
detected around the 3rd day after infection in C3H/HePas and BALB/
c mice (Fig. 5H,I). In the lung of infected BALB/c, although the levels
of mRNA returned to that detected in the first day of infection
(Fig. 5I), the protein levels remained elevated (Fig. 6I).
In conclusion, although a considerable variation on the profiles
of CXCL2/MIP-2 mRNA has been observed in the organs of the mice
after leptospira infection, the data were sufficient to confirm the
induction of transcription. The profile of protein does not follow
strictly the levels of mRNA, possibly meaning an increase on protein
turnover to favor the chemotactic gradient for leukocytes. The level
of CXCL2/MIP-2 remained high in the lung of BALB/c strain, what
may correlate with its resistance to the disease.
3.4. Leptospira induces inflammatory TNF-a cytokine in organs of
mice
After infection with L. interrogans serovar Copenhageni, the
transcription of TNF-a mRNA was induced in kidney, liver and
lung of all three mice strains studied. In the kidney a peak of TNF-
a mRNA was detected at 3rd day after infection. The concentra-
tion of this mRNA was sustained in C3H/HeJ and C3H/HePas until
the 7th day, while clearly decreased in the resistant strain BALB/c
mice (Fig. 7AeC). In kidneys of the strains C3H/HeJ and C3H/
HePas it was observed a peak of TNF-a protein at 3rd day,
whereas in the resistant strain, BALB/c, the level of TNF-a protein
was a little lower, but remained throughout all the days of
analyses (Fig. 8AeC).
 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216 211

Fig. 4. Photomicrographs of lung of BALB/c (AeB), C3H/HePas (CeD) and C3H/HeJ (EeF); (A,C,E) e Structure of normal lungs. Note thin interalveolars septae (IS) and empty alveolar
sacs (AS); (B) e Lung from infected BALB/c showing thickening of alveolar septum (#). (D) e Lung from infected C3H/HePas showing thick alveolar septum (#) and inflammatory
cells (*). (F) Lung from C3H/HeJ mice showing severe alveolar hemorrhage (arrow head). Note the abundance of inflammatory cells (*). Scale bar: 20 mm.

In the liver of all three mice strain higher increase on the levels
of TNF-a mRNA occurred from 3rd to 5th days after infection
(Fig. 7DeF). The level of TNF-a protein in liver of C3H/HeJ mice did
not change, whereas in C3H/HePas a peak was observed at 3th day
and in BALB/c there was an increase and sustaining of the cytokine
from 1st to 7th days.
In the lung of three mice strains a very slight increase of TNF-
a mRNA was observed after leptospira inoculation (Fig. 7GeI). A
similar profile of TNF-a protein with constant basal level on the
three mice strains was observed, except for a low increase at the 5th
day in C3H/HeJ (Fig. 8GeI).
In the present study no TNF-a was detected by ELISA in any of
the samples of serum collected from the mice (data not shown).
4. Discussion
Although the immunity to Leptospira has been studied by
different groups, our understanding on the protective mecha-
nisms is still incomplete. In the present study, we evaluated the
transcripts and the presence of inflammatory chemokine CXCL2/
MIP-2 and TNF-a in organs of C3H/HeJ, C3H/HePas and BALB/c
mice after experimental infection with virulent L. interrogans
serovar Copenhageni, analyzing a possible correlation with the
severity of the disease and some pathological effects on different
organs.
It was showed that the presence of leptospira was higher on
organs from C3H strains in comparison with BALB/c. The higher
clearance capacity was suggested by the lower amplification of
leptospiral DNA using DNA templates from organs collected at 7th
day after infection. The amplification of leptospiral DNA was higher
using kidney samples when compared with liver samples, sug-
gesting the kidney as preferable organ for leptospira colonization.
Similar results were reported by Matsui et al. [15], who showed that
relative Leptospira burden progressively increased in hamster
tissues, an animal model susceptible to leptospirosis, whereas
a rapid clearance was observed in resistant mouse.
In this work we observed that CXC chemokine (CXCL2/MIP-2)
and TNF-a are produced in different organs with distinct intensity
and specific temporal patterns in the three strains of mice after
infection with L. interrogans. Recently, we reported that the
monocyte chemoattractant protein 1 (CCL2/MCP-1), a CC chemo-
kine, which is primarily a monocyte chemokine, and the CXCL1/KC,
a CXC chemokine and a functional homolog of the Interleukin-8
human, have increased production in mice infected by Leptospira
and that they may play a role in aggravating the pathological
process of leptospirosis in susceptible mice [7].
212 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216

Fig. 5. CXCL2/MIP-2 mRNA measured in kidney, liver and lung of C3H/HeJ, C3H/HePas and BALB/c mice infected with L. interrogans serovar Copenhageni. (AeC) Kidney, (DeF) Liver,
(GeI) Lung. Relative mRNA levels were quantified by real-time PCR. The results are representative of triplicate measurements in samples from 6 animals of each strain from two
independent experiments. The median of date are indicated by horizontal lines inside each box plot. ** indicates p values 0.1.

Fig. 6. CXCL2/MIP-2 protein measured in kidney, liver and lung from C3H/HeJ, C3H/HePas and BALB/c mice infected with L. interrogans serovar Copenhageni. (AeC) Kidney, (DeF)
Liver and (GeI) Lung. The results are representative of duplicate measurements by ELISA in samples of 5 animals of each strain. The median of date are indicated by horizontal lines
inside each box plot. * indicates p values 0.05 and **p values 0.1.
 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216 213

Fig. 7. TNF-alfa mRNA measured in kidney, liver and lung of C3H/HeJ, C3H/HePas and BALB/c mice infected with L. interrogans serovar Copenhageni. (AeC) Kidney, (DeF) Liver, (GeI)
Lung. Relative mRNA levels were quantified by real-time PCR. The results are representative of triplicate measurements in samples from 6 animals of each strain from two
independent experiments. The median of date are indicated by horizontal lines inside each box plot. * indicates p values 0.05 and **p values 0.1.

In a general view, the major histological alteration observed in of the three mice strains were compared could be related to the
kidneys of leptospirosis susceptible C3H/HeJ mice was an extensive differences in the progression of the disease occurring in each one
tubular epithelial cells necrosis in contrast to C3H/HePas and BALB/ of the mice strains. This hypothesis was evident when C3H/HeJ was
c strains. The morphological differences observed when the tissues compared to the parental C3H/HePas or BALB/c and the control (not

Fig. 8. TNF-alfa protein measured in kidney, liver and lung from C3H/HeJ, C3H/HePas and BALB/c mice infected with L. interrogans serovar Copenhageni. (AeC) Kidney, (DeF) Liver
and (GeI) Lung. The results are representative of duplicate measurements by ELISA in samples of 5 animals of each strain. The median of date are indicated by horizontal lines inside
each box plot. * indicates p values 0.05 and **p values 0.1.
214 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216
infected animals). In fact, infected C3H/HeJ mice died earlier,
perhaps due to the acute renal failure resulting from the extensive
tubular cell necrosis, possibly deriving of an immune deficiency to
control the infection.
The few inflammatory cells detected in kidney of BALB/c mice
seven days after infection by leptospira, is consistent with the
observation of increasing levels of CXCL2/MIP-2 and TNF-a mRNA and
proteins from the 1st to 3rd days after inoculation. This observation
may indicate that in this resistant strain the infection was controlled
as well as bacteria burden, possibly mediated by increased and sus-
tained production of these and other chemokines.
The kinetics of CXCL2/MIP-2 expression observed in the
different organs corroborate other studies [16], which had
described that KC and MIP-2, two functionally similar chemo-
attractants, are expressed with different profiles in time and
magnitude in inflammatory models. Previous reports showed that
CXC chemokines exhibit angiogenic activity and they suggest that
CXC chemokines and CXCR2 play a role in wound healing. In this
context, the increase on CXCL2/MIP-2 expression could be occur-
ring in response to the extensive tissue injuries observed in the
kidneys of the animals suffering leptospirosis.
The major alteration detected in the livers from BALB/c and
C3H/HePas was damaged cohesion between the liver plates and
a hypertrophic Kupffer cells. Despite of similarities between both
strains, it was a striking increase in inflammatory cells in the
sinusoidal capillaries in C3H/HePas. In addition, the CXCL2/MIP-2
and TNF-a proteins were increased in the liver of these strains.
The premature migration of inflammatory cells and production of
these mediators in BALB/c and C3H/HePas may have contributed
to control the infection. In previous studies we had observed early
production of chemokines CCL2/MCP-1 and CXCL1/KC in liver of
BALB/c mice and these events were correlated with the limitation
of the infection in the resistant mice strain [7]. On the other hand,
intense hepatic injury was observed in the livers of infected C3H/
HeJ mice. The majority of the bacteria that enter the blood stream
are taken up and eliminated in the liver. Thus, the liver is the chief
organ for clearance and prevention on septicemia and sepsis.
When sepsis occurs, the liver represents a major target for
development of multiple organ dysfunction syndromes. Indeed,
pro-inflammatory cytokine and chemokines produced by Kupffer
cells, activated by materials derived from the gut via the portal
vein, have been implicated in hepatocellular dysfunction [17]. In
the liver of susceptible C3H/HeJ, the levels of CXCL2/MIP-2 and
TNF-a proteins remained basically unchanged, whereas these
proteins were increased in C3H/HePas and BALB/c strains. CXCL2/
MIP-2 protein was transiently increased in the liver of both
strains, while TNF-a protein transiently increased in C3H/HePas,
and it was increased and sustained in BALB/c mice. The capability
of each one of these mice strain to produce specific chemokines is
possibly related to the specific ability to reduce the leptospira
infection in this organ.
In both BALB/c and C3H/HePas mice, the most important
structural alteration observed in the lungs was the thickening of
alveolar septae. In the C3H/HeJ mice, however, a profuse hemor-
rhage was present in the parenchyma of this organ. These intense
lung alteration may cause respiratory failure leading the infected
C3H/HeJ mice to die earlier compared to the other strains.
In contrast to the observed in lung of C3H/HeJ and C3H/HePas
mice, where CXCL2/MIP-2 concentration increased until 5th day
after infection and decreased at the 7th day, the protein increased
and remained sustained in lung of resistant BALB/c mice. In addition,
the amount of TNF-a protein was unchanged in the lungs of C3H/
HePas and BALB/c, strains that are not killed by leptospira, whereas
in the susceptible C3H/HeJ mice some induction of this cytokine was
observed, with significant amount in the 5th day after the infection.
Histological observations showed edema, congestion and
hemorrhages in organs of the susceptible mice, as previously re-
ported by other researchers in studies with different animal models
susceptible to leptospirosis, contrasting to the limited changes
observed in resistant mice [15,18,19].
Previous reports have shown that different cytokines/chemo-
kines, such as TNF-a, CXCL2/MIP-2, CCL2/MCP-1 and CXCL1/KC,
when excessively produced, induce systemic inflammatory
syndrome [20]. Although sepsis do not occur in leptospirosis and
high levels of these mediators were not detected in the blood of
infected mice, excessive and uncontrolled production of these
cytokines in specific tissues affected by leptospiras may increase
local damages.
It was shown that, in mouse, the two members of the C-X-C
family of chemokines, CXCL2/MIP-2 and CXCL1/KC, are potent
chemoattractants and activators of PMN. In fact, a direct correlation
of PMN influx into the tissues and the presence of these chemo-
kines were demonstrated in different in vivo inflammation models
[21]. The previous and the present data corroborate the hypothesis
that early and controlled production of these chemokines plays an
important role in the control of the leptospirosis [7].
Recruitment of leukocyte, including the influx of phagocytes
which will ingest and kill the invading microorganisms and infec-
ted cells, is an essential element to protect the body from invasion
by microorganisms. On the other hand the exacerbation of
inflammatory cells may also damage the tissues. For example,
granulocytes have been implicated in the genesis of many chronic
inflammatory conditions. In additions, hydrolytic enzymes secreted
by neutrophils and inactivated protease inhibitors have been
detected in fluids recovered from inflammatory sites. Activated
granulocytes generate reactive oxygen intermediates and release of
lytic enzymes that promote massive toxic and proteolytic tissue
damage. These processes may lead to premature death, when vital
organs have been affected [22].
The Toll like-receptor 4 dysfunction in C3H/HeJ strain probably
contributes to inefficiency of the mechanisms of innate immune
response, worsening the infection. The TLRs play a pivotal role
against a variety of exogenous and endogenous pathogens. The
stimulation of TLRs ligands binding to their receptors recruit
adapter molecules at the cytoplasmic TIR domain of the receptors
and trigger the downstream signaling cascade, including activation
of NF-kB and production of pro-inflammatory cytokines and che-
mokines that play important roles in the control of infections [23].
The present study showed that the production of chemokines/
cytokines is induced after leptospira infection. This result may be
correlated to previous observation that some leptospiral membrane
proteins induce the production of these chemokines/cytokines.
Such response to leptospira infection is important to the inflam-
matory response mediated by TLR2, contributing to the genesis of
the leptospiral tubulointerstitial nephrites [24e26] Similarly, it was
shown that in other gram-negative bacteria, outer membrane
proteins are linked to the microorganism’s ability to invade
mammalian cells [27].
Considering the progress of leptospirosis observed in C3H/HeJ
mice, TLR4 deficient strain, we may consider the possibility that the
delay on the CXCL2/MIP-2 expression contributes to worsen the
disease, resulting in premature death, in comparison to the other
strains of mice studied. It was shown previously that CXCL2/MIP-2
plays an important role in neutrophil recruitment during bacterial
infection. Furthermore it was showed that toll-4 is important to
regulate the production of this chemokine [4,23,28]. Elevated
production of CXC chemokines has been described in leptospirosis
patients [29]. Chassin et al. [6] demonstrate that B cells are crucial
in the clearance of Leptospira. During infection or inflammation,
these lymphocytes produce chemokines/cytokines, while the
 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216
receptors TLR2 and TLR4 are up-regulated on their surface [30].
Therefore, we may consider that the absence of TLR4 impairs C3H/
HeJ mice to react adequately against invading leptospira.
It has been suggested that chemokines are immobilized on the
surface of endothelial cells by heparan sulfate proteoglycans
(HSPGs) [31]. HSPGs consist in complex polysaccharide chains
negatively charged (heparan sulfate [HS]) conjugated to a protein
core. HSPGs are found attached to the plasmatic membrane of most
cell types as well as in the extracellular matrix (ECM). Chemokines
and a variety of positively charged proteins bind to HS chains
through covalent and/or electrostatic interactions. During inflam-
mation, endothelial HSPGs binds to L-selectin on leukocytes,
transport chemokines in a basolateral to apical direction across the
endothelium, as well as expose the chemokines at the luminal
surface of the endothelium to circulating cells [31]. Previous studies
had shown that diminished leukocytes recruitment and conse-
quent decrease of CXC and CC chemokines were due to the lack of
intact heparan sulfate in the cell membrane necessary for presen-
tation of chemokine and consequent leukocyte rolling and trans-
port across the endothelium [32].
Necrosis observed in renal tissue infected by leptospira, mainly
in C3H/HeJ mice, may disrupt specific ECM molecules at the cell
surface releasing chemokines and other pro-inflammatory mole-
cules, contributing to the tissues damage. Mechanisms reported in
proliferative and particularly crescentic glomerulonephritis (GN),
are associated with prominent glomerular accumulation of leuko-
cytes in the glomerulus in severe renal injury. Leukocyte accumu-
lation may have occured in early stages of the disease, around the
5th day after infection with Leptospira, favoring the increasing of
CXCL2/MIP-2 and TNF-a levels and maybe, tissue degeneration.
Autopsy data from leptospirosis patients showed significant
degeneration and necrosis of renal tubular epithelial cells in
affected kidney [33,34].
Although the presence of chemokine on the endothelium per
se is not enough to initiate leukocyte diapedesis, it is necessary to
start the migration, triggering the immune response. A chemo-
tactic gradient along the vessel wall and higher extravascular
concentration of chemokines would, however, be required.
During infection, a multitude of chemotactic factors are simulta-
neously present in the tissues microenvironment, so the ability of
leukocytes to prioritize among end-targets (bacterial peptides)
and intermediate chemotactic (eg, macrophage inflammatory
protein-2 MIP-2) cues is crucial for them to achieve the site of
infection [31].
The increase on mRNA confirms the request of the chemokine in
response to the infection. The difference observed in the content of
CXCL2/MIP-2 mRNA and protein, mainly in the liver and kidney of
C3H/HeJ mice, may be related to the different mechanisms of
expression control. The severe damage observed in kidney, liver
and lung of C3H/HeJ strain caused by leptospira infection may be
resulting in some incapability on protein translation or may be
reflecting a higher turnover of the chemokine.
The functionality of chemokines is controlled by their interac-
tions with several accessory molecules, which influence immobi-
lization, transport, clearance and degradation of such chemokines
and thereby determine the site and duration of their action [32].
Duffy antigen receptor for chemokines (DARC), a molecule
expressed by vascular endothelial cells, is also involved in the
regulation of chemokines. DARC binds a broad spectrum of
inflammatory CC and CXC chemokines, but these receptors inacti-
vates the conventional G-protein-mediated signaling cascades
[32,35]. In fact this receptor is involved in chemokine degradation.
The difference in the content of chemokine mRNA and protein
detected in the same tissue is possibly resulting from some of the
above described mechanisms.
215
Transcription of TNF-a mRNA was induced in the liver and
kidney of mice from the three strains after infection with leptospira,
elevating the levels of protein expression, therefore, a little lower
and more constant level of the protein was detected in these organs
of BALB/c. No statistically significant induction of TNF-a mRNA was
detected in the lung of infected animals, except by day 3 in C3H/HeJ
and no statistically significant increase of TNF-a protein was
detected except by day 5 in C3H/HeJ. In general the TNF-a protein
seems to be better controlled in the organs of BALB/c.
Lower production of TNF-a could impairs an early control of the
infection. On the other hand, elevated levels of TNF-a after infection
could be associated with the higher inflammation, tissue degen-
eration and higher mortality of the animals. Our results confirm
that this cytokine is induced by leptospira infection and that the
profile of induction in the C3H strains is different from that
observed in BALB/c.
TNF-a, an extensively studied cytokine, is produced by mono-
cytes, macrophages and by resident renal cells. It is considered
a pro-inflammatory or acute phase cytokine that plays important
role in vasodilatation, increasing the vascular permeability. TNF-
a up-regulates the expression of cellular adhesion molecules [23].
As the TNF-a gene contains NF-kB-binding sequence in its
promoter and this cytokine itself is able to stimulate NF-kB acti-
vation and synthesis, it works in an autocrine amplification
manner.
The increasing of TNF-a in organs of mice infected with Lep-
tospira corroborates the data from other researchers that observed
increasing of TNF-a mRNA in cultures of cells from medullary thick
ascending limb of loop of Henle stimulated with pathogenic Lep-
tospira [36]. Increasing of TNF-a was also observed in plasma of
patients with acute leptospirosis and has been associated with
severity of the disease and lethal outcome [11]. In addition, Li et al.
[37] have demonstrated that virulent L. interrogans can induce
macrophage apoptosis and cellular death via necrosis or apoptosis,
depending on the host cell types.
Although increasing levels of TNF-a were observed at the
beginning of leptospira infection, they were reduced in some
samples during the progression of the disease. Possible mechanism
of TNF-a regulation was proposed in recent studies showing that
long time of exposure to hypoxia/LPS reduced TNF-a protein while
keeping mRNA levels. The reduction on the cytokine content was
attributed to increased lysosomal degradation of TNF-a precursor
protein, suggesting a mechanism of negative pos-translation
regulation of TNF-a [38]. Other studies showed that TNF-a can be
regulated via instability of mRNA. Specifically, a mRNA-binding and
destabilizing proteins, such as tristetraprolin (TTP), binds to
a conserved adenosine/uridine rich element (ARE) in the untrans-
lated region (30 UTR) of TNF-a mRNA, inducing rapid degradation of
the messenger. This mechanism of TNF-a regulation was associated
to various inflammatory mediators, including macrophage inflam-
matory protein-2 (MIP-2) [39]. This mechanism may also be
present in the strains of mice here studied that show notable and
different profile in the content of mRNA and protein.
The present study provided evidence that virulent Leptospira
induces the expression of TNF-a and CXCL2/MIP-2 chemokine and
that the increasing is dependent on the organ and time of infection.
The increasing on the levels of CXCL2/MIP-2 and TNF-a mRNA in
early stages of infection possibly activates different pathways of the
innate immune response, favoring the control of bacterial load,
which may result in resistance to leptospirosis in BALB/c mice.
Appendix. Supplementary material
Supplementary material associated with this article can be
found, in the online version, at doi:10.1016/j.micpath.2012.01.002.
216 J.B. da Silva et al. / Microbial Pathogenesis 52 (2012) 206e216

References [22] Keller C, Hoffmann R, Lang R, Brandau S, Hermann C, Ehlers S. Genetically

determined susceptibility to tuberculosis in mice causally involves acceler-
ated and enhanced recruitment of granulocytes. Infect Immun 2006;74:
[1] Faine S, Adler B, Bolin C, Perolat P. Leptospira and leptospirosis. Melbourne:
4295e309.
MedScience; 1999.
[23] Balamayooran G, Batra S, Fessler MB, Happel KI, Jeyaseelan S. Mechanisms of
[2] Bharti AR, Nally JE, Ricald JN, Matthias MA, Diaz MM, Lovett MA, et al.
neutrophil accumulation in the lungs against bacteria. Am J Respir Cell Mol
Leptospirosis: a zoonotic disease of global importance. Lancet Infect Dis 2003;
Biol 2010;43:5e16.
12:757e71.
[24] Yang CW, Hung CC, Wu MS, Tian YC, Chang CT, Pan MJ, et al. Toll-like receptor
[3] Hung CC, Chang CT, Chen KH, Tian YC, Wu MS, Pan MJ, et al. Upregulation of
2 mediates early inflammation by leptospiral outer membrane proteins in
chemokine CXCL1/KC by leptospiral membrane lipoprotein preparation in
proximal tubule cells. Kidney Int 2006;69:815e22.
renal tubule epithelial cells. Kidney Int 2006;69:1814e22.
[25] Zhang Y, Bao L, Zhu H, Huang B, Zhang H. OmpA-like protein Loa22 from
[4] Viriyakosol S, Matthias AM, Swancutt AM, Kirkland NT, Vinetz MJ. Toll-like
Leptospira interrogans serovar Lai is cytotoxic to cultured rat renal cells and
receptor 4 protects against lethal Leptospira interrogans serovar icter-
promotes inflammatory responses. Acta Biochim Biophys Sin 2010;42:
ohaemorrhagiae infection and contributes to in vivo control of leptospiral
70e9.
burden. Infect Immun 2006;74:887e95.
[26] Diament D, Brunialti MK, Romero EC, Kallas EG, Salomao R. Peripheral blood
[5] Monahan AM, Miller IS, Nally JE. Leptospirosis: risks during recreational
mononuclear cell activation induced by Leptospira interrogans glyco-
activities. J Appl Microbiol 2009;107:707e16.
lipoprotein. Infect Immun 2002;70:1677e83.
[6] Chassin C, Picardeau M, Goujon JM, Bourhy P, Quellard N, Darche S, et al. TLR4-
[27] Jeannin P, Magistrelli G, Goetsch L, Haeuw JF, Thieblemont N, Bonnefoy JY,
and TLR2-mediated B cell responses control the clearance of the bacterial
et al. Outer membrane protein A (OmpA): a new pathogen-associated
pathogen, Leptospira interrogans. J Immunol 2009;183:2669e77.
molecular pattern that interacts with antigen presenting cells-impact on
[7] da Silva JB, Ramos TM, de Franco M, Paiva D, Ho PL, Martins EA, et al. Che-
vaccine strategies. Vaccine 2002;20(Suppl. 4):A23e7.
mokines expression during Leptospira interrogans serovar Copenhageni
[28] Netea MG, Kullberg BJ, Van der Meer JW. Circulating cytokines as mediators of
infection in resistant BALB/c and susceptible C3H/HeJ mice. Microb Pathog
fever. Clin Infect Dis 2000;31(Suppl. 5):S178e84.
2009;47:87e93.
[29] De Fost M, Chierakul W, Limpaiboon R, Dondorp A, White NJ, van Der Poll T.
[8] Graham KL, Zabel BA, Loghavi S, Zuniga LA, Ho PP, Sobel RA, et al. Chemokine-
Release of granzymes and chemokines in Thai patients with leptospirosis. Clin
like receptor-1 expression by central nervous system-infiltrating leukocytes
Microbiol Infect 2007;13:433e6.
and involvement in a model of autoimmune demyelinating disease. J Immunol
[30] Liang Y, Hasturk H, Elliot J, Noronha A, Liu X, Wetzler LM, et al. Toll-like
2009;183:6717e23.
receptor 2 induces mucosal homing receptor expression and IgA production
[9] Ma J, Zhang YG, Xia Y, Sun J. The inflammatory cytokine tumor necrosis factor
by human B cells. Clin Immunol 2011;138:33e40.
modulates the expression of Salmonella typhimurium effector proteins.
[31] Massena S, Christoffersson G, Hjertström E, Zcharia E, Vlodavsky I, Ausmees N,
J Inflamm (Lond) 2010;12:42.
et al. A chemotactic gradient sequestered on endothelial heparan sulfate
[10] Estavoyer JM, Racadot E, Couetdic G, Leroy J, Grosperrin L. Tumor necrosis
induces directional intraluminal crawling of neutrophils. Blood 2010;116:
factor in patients with leptospirosis. Rev Infect Dis 1991;13:1245e6.
1924e31.
[11] Tajiki H, Salomao R. Association of plasma levels of tumor necrosis factor
[32] Colditz IG, Schneider MA, Pruenster M, Rot A. Chemokines at large: in-vivo
alpha with severity of disease and mortality among patients with leptospi-
mechanisms of their transport, presentation and clearance. Thromb Hae-
rosis. Clin Infect Dis 1996;23:1177e8.
most 2007;97:688e93.
[12] Chierakul W, de Fost M, Suputtamongkol Y, Limpaiboon R, Dondorp A,
[33] Farr RW. Leptospirosis. Clin Infect Dis 1995;21:1e6.
White NJ, et al. Differential expression of interferon-gamma and interferon-
[34] De Brito T, Menezes LF, Lima DM, Lourenço S, Silva AM, Alves VA. Immuno-
gamma-inducing cytokines in Thai patients with scrub typhus or leptospi-
histochemical and in situ hybridization studies of the liver and kidney in
rosis. Clin Immunol 2004;113:140e4.
human leptospirosis. Virchows Arch 2006;448:576e83.
[13] Pereira MM, Andrade J, Marchevsky RS, Ribeiro dos Santos R. Morphological
[35] Graham GJ. D6 and the atypical chemokine receptor family: novel regulators
characterization of lung and kidney lesions in C3H/HeJ mice infected with
of immune and inflammatory processes. Eur J Immunol 2009;39:342e51.
Leptospira interrogans serovar icterohaemorrhagiae: defect of CD4þ and CD8þ
[36] Yang CW, Wu MS, Pan MJ, Hong JJ, Yu CC, Vandewalle A, et al. Leptospira outer
T-cells are prognosticators of the disease progression. Exp Toxicol Pathol
membrane protein activates NF-kappaB and downstream genes expressed in
1998;50:191e8.
medullary thick ascending limb cells. J Am Soc Nephrol 2000;11:2017e26.
[14] Nally JE, Fishbein MC, Blanco DR, Lovett MA. Lethal infection of C3H/HeJ and
[37] Li S, Ojcius DM, Liao S, Li L, Xue F, Dong H, et al. Replication or death: distinct
C3H/SCID mice with an isolate of Leptospira interrogans serovar Copenhageni.
fates of pathogenic Leptospira strain Lai within macrophages of human or
Infect Immun 2005;73:7014e7.
mouse origin. Innate Immun 2010;16:80e92.
[15] Matsui M, Rouleau V, Bruyère-Ostells L, Goarant C. Gene expression profiles of
[38] Lahat N, Rahat MA, Kinarty A, Weiss-Cerem L, Pinchevski S, Bitterman H.
immune mediators and histopathological findings in animal models of
Hypoxia enhances lysosomal TNF-alpha degradation in mouse peritoneal
leptospirosis: comparison between susceptible hamsters and resistant mice.
macrophages. Am J Physiol Cell Physiol 2008;295:C2e12.
Infect Immun 2011;79:4480e92.
[39] Werno C, Schmid T, Schnitzer SE, Peters K, Milke L, Brüne B. A combination of
[16] Endlich B, Armstrong D, Brodsky J, Novotny M, Hamilton TA. Distinct temporal
hypoxia and lipopolysaccharide activates tristetraprolin to destabilize proin-
patterns of macrophage-inflammatory protein-2 and KC chemokine gene
flammatory mRNAs such as tumor necrosis factor-alpha. Am J Pathol 2010;
expression in surgical injury. J Immunol 2002;168:3586e94.
177:1104e12.
[17] Holub M, Cheng CW, Mott S, Wintermeyer P, van Rooijen N, Gregory SH.
[40] Ellinghausen HC, McCullough WG. Albumin fatty acid broth for Leptospira,
Neutrophils sequestered in the liver suppress the proinflammatory response
modified by Johnson and Harris. J Bacteriol 1967;94:27e31.
of Kupffer cells to systemic bacterial infection. J Immunol 2009;183:3309e16.
[41] Gravekamp C, Van de Kemp H, Franzen M, Carrington D, Schoone GJ,
[18] Nally JE, Chantranuwat C, Wu XY, Fishbein MC, Pereira MM, Da Silva JJ, et al.
Van Eys GJ, et al. Detection of seven species of pathogenic leptospires by PCR
Alveolar septal deposition of immunoglobulin and complement parallels
using two sets of primers. J Gen Microbiol 1993;139:1691e700.
pulmonary hemorrhage in a guinea pig model of severe pulmonary lepto-
[42] da Silva JB, Carvalho E, Hartskeerl RA, Ho PL. Evaluation of the use of selective
spirosis. Am J Pathol 2004;164:1115e27.
PCR amplification of LPS biosynthesis genes for molecular typing of Leptospira
[19] Pereira MM, da Silva JJ, Pinto MA, Da Silva MF, Machado MP, Lenzi HL, et al.
at the serovar level. Curr Microbiol 2011;62:518e24.
Experimental leptospirosis in marmoset monkeys (Callithrix jacchus): a new
[43] Kawabata H, Dancel LA, Villanueva SY, Yanagihara Y, Koizumi N, Watanabe H.
model for studies of severe pulmonary leptospirosis. Am J Trop Med Hyg
flaB-polymerase chain reaction (flaB-PCR) and its restriction fragment length
2005;72:13e20.
polymorphism (RFLP) analysis are an efficient tool for detection and identi-
[20] Osuchowski MF, Welch K, Siddiqui J, Remick DG. Circulating cytokine/inhib-
fication of Leptospira spp. Microbiol Immunol 2001;45:491e6.
itor profiles reshape the understanding of the SIRS/CARS continuum in sepsis
[44] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-
and predict mortality. J Immunol 2006;177:1967e74.
time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:
[21] Hazlett LD. Pathogenic mechanisms of P. aeruginosa keratitis: a review of the role
402e8.
of T cells, Langerhans cells, PMN, and cytokines. DNA Cell Biol 2002;21:383e90.