Microbial Pathogenesis 48 (2010) 245e250

Contents lists available at ScienceDirect

Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath

Regulation of hemagglutinin/protease expression by the

VarS/VarAeCsrA/B/C/D system in Vibrio cholerae
Jeyoun Jang 1, Kyung-Tae Jung 1, Cheon-Kwon Yoo, Gi-eun Rhie*
Division of High-risk Pathogen Research, Center for Infectious Diseases, National Institute of Health, 194 Tongil-Lo, Eunpyung-gu, Seoul 122-701, Republic of Korea

a r t i c l e i n f o a b s t r a c t

Article history: In this study, through the analysis of Vibrio cholerae 2740-80 mutant strains produced by the cholera toxin
Received 23 November 2009 subunit B gene containing Mariner-based transposon, we found that disruption of the varS gene, a member
Received in revised form of the recently reported sensory system VarS/VarAeCsrA/B/C/D, resulted in altered expression of
4 March 2010
hemagglutinin/protease A. To further investigate the connection between VarS and HapA, we generated an
Accepted 4 March 2010
additional varS mutant, V. cholerae 2740-80-VS, and examined the effect of this mutation on expression of
Available online 20 March 2010
HapA and of genes in the VarS/VarAeCsrA/B/C/D system. 2740-80-VS showed decreased expression of varS,
csrB/C, hapR, and hapA along with increased biofilm production. Interestingly, expression of the alternative
Keywords:
Hemagglutinin/protease A
sigma factor ss, which is important for adaptation to environmental stress, was also decreased in this
VarS mutant. These results indicate that the VarS/VarAeCsrA/B/C/D system is involved in the control of HapA
VarA expression and biofilm production in V. cholerae 2740-80 through HapR regulation, and also that VarS/VarA
ss controls expression of ss for HapA regulation.
Vibrio cholerae Ó 2010 Elsevier Ltd. All rights reserved.

1. Introduction
Cholera is an acutely dehydrating, diarrheal disease caused by
intestinal infection with the bacterium Vibrio cholerae [1]. Epidemic
cholera is caused by V. cholerae O1 serogroup strains of the classical
and El Tor biotypes and, more recently, by strains in the O139 group
[1]. V. cholerae secretes cholera toxin (Ctx), which plays a major role
in the pathogenesis of infection [1,2]. Ctx is composed of two
subunits: a single A subunit comprised of an ADP-ribosylating toxin,
and a pentamer of B subunits that bind the holotoxin to its intestinal
receptor [2]. In humans, secretion of Ctx from V. cholerae results in
elevated cAMP levels in intestinal epithelial cells and subsequent
secretory diarrhea [2,3]. The other major virulence factors include
hemagglutinin/protease A (HapA) [4] and the toxin-coregulated pili
(Tcp), which is required for intestinal colonization [5].
Among the virulence factors, HapA, a soluble Zn-dependent
metalloprotease, is important for overcoming the protective mucus
barrier covering the gastrointestinal epithelium for V. cholerae colo-
nization in the intestine [4]. HapA perturbs the para-cellular barrier
Abbreviations: Amp, ampicillin; Csr, carbon storage regulator; CtxB, cholera
toxin B subunit; HapA, hemagglutinin/protease A; RT-PCR, reverse-transcriptase
polymerase chain reaction; sRNA, small RNA; Strep, streptomycin; Var, virulence
associated regulator; Tn, transposon.
* Corresponding author. Tel.: þ82 2 380 2131; fax: þ82 2 380 1487.
E-mail address: gerhie@nih.go.kr (G.-e. Rhie).
1
These authors equally contributed to this work.
of cultured MDCK-1 cells and T84 intestinal epithelial cells [6e8]. It is
associated with detachment of vibrios from cultured intestinal cells
[9,10]. HapA proteolytically activates the Ctx A subunit, El Tor cyto-
lysin, and hemolysin [11,12], and hydrolyzes several physiologically
important proteins, such as mucin, fibronectin, and lactoferrin [13].
The expression of virulence factors (including HapA in V. cholerae)
has been reported to be regulated by the CAI-1eCqsS and
AI-2eLuxPQ quorum-sensing systems through LuxO and HapR
[14e16] (Fig. 1). The former system is composed of the CAI-1 auto-
inducer of unknown structure and CqsS, its two-component sensor.
The latter system is made up of AI-2, a furanosyl borate diester, the
periplasmic binding protein, LuxP, and the two-component sensor,
LuxQ. At low cell density, in the absence of autoinducers, the sensors
act as kinases and transfer phosphate via LuxU to LuxO, resulting
activation of LuxO [14,15] (Fig. 1). A third sensory system, the VarS/
VarAeCsrA/B/C/D system, was also recently reported to control the
LuxO response regulator (Fig. 1) [17,18]. Although the signal for the
pathway is not clear, it was proposed that at low cell density, the
VarS sensor kinase is inactive and does not phosphorylate
the response regulator VarA. Unphosphorylated VarA is also inactive
and therefore does not activate transcription of genes encoding the
CsrB/C/D small RNAs (sRNAs). As a consequence, CsrA, a post-tran-
scriptional regulator, is free to activate LuxO, which then destabilizes
the mRNA encoding HapR, the master-regulator of quorum sensing
in V. cholerae [17,18]. At high cell density, VarS phosphorylates VarA.
Phosphorylated VarA activates the genes encoding the CsrB/C/D
sRNAs. These sRNAs then bind CsrA, sequestering CsrA from its

0882-4010/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.micpath.2010.03.003
246 J. Jang et al. / Microbial Pathogenesis 48 (2010) 245e250

defective insertion mutants were selected on azocasein plates after

incubation for 16 h at 37  C. Approximately 5000 colonies were
screened and seven HapA-defective strains were isolated (Table 2).
The transposon insertion site in each mutant strain was determined
by arbitrary PCR analysis [21] and sequencing. For arbitrary PCR
amplification, the sequences flanking the Tn insertion site were
amplified using the primers 50 -CAGGGACACCAGGATTTAT-30 , 50 -
GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT-30 , and 50 -
GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC-3 . The resulting 0

PCR products were isolated and used as templates for secondary PCR
amplification using the primers 50 -CTTCCGTCACAGGTAGGCG-30 and
50 -GGCCACGCGTCGACTAGTAC-30 . Secondary PCR products were
sequenced to identify the insertion site. Interestingly, two out of
seven mutants isolated contained a Tn insertion in the varS gene
(VC2453; Table 2). Other insertions were found in genes encoding
either HapA or protein L of the general secretion pathway, resulting
in failure of expression or secretion of HapA (Table 2). These results
indicate that hapA expression in V. cholerae is involved in VarS
possibly through regulation of the VarS/VarA sensory circuit, as
previously proposed [17,18]. Unfortunately, none of these mutants
produced the CtxB (data not shown).

Fig. 1. Schematic representation of the quorum-sensing circuit in V. cholerae. The VarS/ 2.2. Construction of the varS mutant, 2740-80-VS
VarA system functions with the CAI-1eCqsS and AI-2eLuxPQ systems. The flow of
phosphate is indicated by the arrows and is illustrated for cells at low cell density. To further characterize the role of VarS in the regulation of HapA
Phosphate flow is reversed at high cell density. Dotted lines denote hypothetical
interactions.
expression in V. cholerae, we constructed a varS mutant of 2740-80
(2740-80-VS) using pCVD-VarS2. In 2740-80-VS, the middle 1.6-kb

targets. This leads to diminished LuxO activity, which in turn

enhances HapR expression [17,18]. High concentration of HapR Table 1
Strains, plasmids, and primers used in this study.
represses genes such as those encoding the virulence factors Ctx and
Tcp and those required for biofilm production, while enhancing Strain, plasmid Description Reference or source
expression of genes such as hapA [19,20]. or primer
Previously, we generated V. cholerae strains that overexpress the E. coli strains
CtxB using a ctxB gene containing Mariner-based transposon (Tn) DH5a/lpir l pir lysogen of DH5a Laboratory
collection
[21]. In the present study, to achieve higher expression of CtxB, we SM10/lpir thi thr leu tonA lacy supE recA:: Laboratory
subsequently attempted a similar approach in V. cholerae strain RP-4-Tc::Mu (l pir) R6K collection [34]
2740-80 [22], a nontoxigenic El Tor strain that produces a high TOP10 F-mrcA D(mrr-hsdRMS-mcrBC) Invitrogen
amount of HapA, which might indicate that the promoter activity of f801lacDM15 DlacX74 deoR recA1
araD139 D(ara-leu)7697 galU
hapA is strong. To place ctxB under the control of this hapA promoter,
galK rpsL (strR) endA1 nupG
the ctxBeTn [21] was randomly transpositioned to strain 2740-80
and HapA-negative strains were selected. Interestingly, among the V. cholerae strains
2740-80 Nontoxigenic, Strepr (E1 Tor, Laboratory
several HapA-defective mutants isolated, two mutants had the Tn Inaba, wild type) collection [22]
inserted in the varS gene, suggesting that varS plays a role in hapA 2740-80-VS 2740-80 DvarS This study
regulation. To confirm the role of the VarS/VarA sensory system in
the regulation of hapA expression in V. cholerae 2740-80, a varS- Plasmids
defective mutant of 2740-80 was constructed and expression of hapA pCVD442 Suicide vector (oriR6K, Laboratory
mobRP4, sacB, Ampr) collection [33]
and of genes involved in the VarS/VarAeCsrA/B/C/D pathway were
pCVD-VarS2 SacI-XbaI DvarS fragment from This study
analyzed. pCRII-VarS2 cloned in pCVD442

RT-PCR primer (Primer sequence 50 /30 ) Target gene in

2. Results and discussion
V. cholerae
RecA1061 CGCTTTACCTTGGCCGATTT recA
2.1. The varS gene is involved in regulation of HapA in V. cholerae RecA578 GTGCTGTGGATGTCATCGTTGTTG
strain 2740-80 VarS1977 AGCCGATAAGCTTCCGCTGT varS
VarS2435 GCTGGCGGTGATGAGGGT
VarA326 TGCCGCAGGTTATCTCACGAA varA
V. cholerae 2740-80 is a nontoxigenic strain of the El Tor Inaba VarA742 GTATACGCCGGGCTGGTTGGT
serotype that was isolated in 1980 [22]. This strain showed the HapA1278 CCATTCGAGTGGCGTGTTTA hapA
highest HapA activity among various V. cholerae strains examined by HapA1670 GACATACAGATCCGCATCGCC
azocasein assay in our lab (data not shown), suggesting that hapA HapR1100 GCCAACTTATACACTGCTTCT hapR
HapR589 CGCCTCAAAAACGCAAACTACAACT
might be driven by a highly active promoter in this strain. Previously,
16S520 AGAGTTTGATCCTGGCTCAG 16s rRNA
we constructed V. cholerae M7922 strains expressing the CtxB using 16S1492 ACGGCTACCTTGTTACGACTT
the ctxBeTn [21]. In the present study, we applied this approach to V. CsrB6058 GTCGGAAGGATACTGACACG csrB
cholerae strain 2740-80 in an attempt to create the ctxB gene was CsrB6477 AAAAAAGAAAACCCCGGG
driven by the promoter of hapA for more robust CtxB production. The CsrC495 GTCGAAGGAAATGACCTAGG csrC
CsrC909 AAAGCCCCGACACAGGTG
ctxBeTn [21] was randomly transpositioned into 2740-80 and HapA-
 J. Jang et al. / Microbial Pathogenesis 48 (2010) 245e250 247

Table 2
Tn insertion sites in V. cholerae 2740-80.

Strain Chromosomal Insertion sequenceb Disrupted gene; ORFc

locationa
1 7513 (þ) I GTCTCCTGCAACATTGTCCA VCA0865; Hemagglutinin/
protease
2 6995 (þ) II CGTGACTATTTCATTGTCCA VCA0865; Hemagglutinin/
protease
4 7412 (þ) I TAAAGCTGTACCATTGTCCA VC2453; Sensor histidine
kinase/response
regulator (VarS)
5 6183 () II GCCCAACCTTGCATTGTCCA VCA0865; Hemagglutinin/
protease
6 8961 () I CCCTACCTACTAATTGTCCA VC2453; Sensor histidine
kinase/response
regulator (VarS)
7 3674 (þ) I AGAGTGACGCCAATTGTCCA VC2725; General
secretion pathway
protein L
a
Location based on reported V. cholerae genomic sequence [32]. þ and  indicate
the orientation of the Tn insertion in the forward and reverse direction of the ORF,
respectively. I and II indicate chromosome I and II, respectively.
b
Sequence to the left of the bolded nucleotides represents the V. cholerae
genomic sequence; sequence to the right represents the end of the Tn.
c
Gene ID (JCVI annotation) and the corresponding ORF name.

of the 2.8-kb varS gene was deleted by AccI digestion and, as

a consequence, a TGA stop codon was generated just behind the
AccI site. The 1.6-kb varS deletion in 2740-80-VS was confirmed by
PCR amplification and sequencing (data not shown).

2.3. V. cholerae 2740-80-VS exhibits decreased HapA production

and increased biofilm formation

To confirm the HapA-defective phenotype in 2740-80-VS, wild
type 2740-80 and mutant 2740-80-VS cells were grown in LB, and
HapA activity was determined using milk plates and the azocasein
assay. As shown in Fig. 2A, 2740-80-VS had lower HapA activity both
in milk plates and azocasein assay (2.69-fold) than wild type cells.
VarS and VarA have been reported to be involved in biofilm
formation via VarS/VarAeCsrA/B/C/D-mediated regulation of HapR
Fig. 2. Comparison of HapA activity and biofilm formation in V. cholerae 2740-80 and
2740-80-VS. (A) Each strain was inoculated on milk plates (LA containing 1% milk
powder), incubated at 37  C for 16 h, photographed (inset). Data represent the average
HapA activity from three azocasein assays  standard deviation. (B) Overnight cultures
of each strain were diluted (1:100) into LB and incubated for 18 h at 22  C and then
subjected to the crystal violet biofilm assay. Samples were photographed (inset) and
crystal violet staining was quantified at OD570. Data represent the average biofilm
production from three experiments  standard deviation.

expression [17,18]. Given that HapR enhances HapA expression while

decreasing biofilm formation (Fig. 1), we expected that the decreased
HapA expression in 2740-80-VS (Fig. 2A) possibly through reduced
HapR expression would be accompanied by an increase in biofilm
formation. Crystal violet quantification of biofilms produced by
2740-80 and 2740-80-VS is shown in Fig. 2B. As expected, 2740-80-
VS had an enhanced ability to form biofilms, which were increased
by 4.1-fold compared to wild type.
2.4. Decreased hapR, hapA, rpoS, csrB, and csrC expression but not
varA expression in V. cholerae 2740-80-VS
To investigate the involvement of the VarS/VarAeCsrA/B/C/D
system in HapA regulation, expression of the quorum-sensing system
genes was determined in both wild type and mutant cells by reverse-
transcriptase polymerase chain reaction (RT-PCR) analysis using the
primers indicated in Table 1. Both strains were grown at 37  C in Luria
broth (LB) containing streptomycin (Strep) to an OD600 of w1.0 before
harvest and subsequent isolation of total RNA. RT-PCR analysis indi-
cated no significant difference in varA mRNA levels between 2740-80
and 2740-80-VS, whereas hapR and hapA mRNA levels were
decreased by 1.9- and 1.8-fold, respectively, in 2740-80-VS compared
to 2740-80 (Fig. 3). recA mRNA levels were measured as a control and
were not different between the two strains (data not shown).
In V. cholerae, the alternative sigma factor, ss, which is induced during
nutrient starvation or stationary phase and is encoded by rpoS, has
been reported to be involved in production or secretion of HapA [23].
Interestingly, in 2740-80-VS, the expression level of rpoS was 3.8-fold
lower than in 2740-80 (Fig. 3), suggesting a possible link between the
VarS/VarA and ss expression. In addition to RT-PCR analyses, we
performed whole-genome DNA microarray analysis using a Combi-
Matrix microarray chip (Digital Genomics, Korea) to compare the
transcription profiles of the two strains. In accordance with the
RT-PCR data, expression of hapA and rpoS was 14.7- and 4.7-fold
lower, respectively, in 2740-80-VS than in 2740-80 (data not shown).
To further confirm the involvement of the VarS/VarAeCsrA/B/
C/D system in hapA regulation, the levels of csrB and csrC sRNAs
were determined by northern blot analysis. Both 2740-80 and
2740-80-VS strains were grown at 37  C in LB with Strep to an
OD600 of w1.0 before harvest and subsequent RNA isolation for
northern blot analysis. As shown in Fig. 4, csrB and csrC sRNA
levels were 3.4- and 3.8-fold lower, respectively, in 2740-80-VS
than in wild type. These results agree with previous reports [17,18]
indicating that the VarS/VarA system activates the genes encoding
the CsrB/C/D sRNAs at a high cell density, because the varS mutant
strain 2740-80-VS, which mimics the low cell density state, would
be unable to phosphorylate VarA, which would in turn result in
decreased expression of CsrB/C/D sRNAs. As a consequence, free
CsrA activates LuxO and repression of hapR occurs, as demon-
strated in 2740-80-VS (Figs. 1 and 3). The reduction of HapR
expression results in low HapA production but high biofilm
248 J. Jang et al. / Microbial Pathogenesis 48 (2010) 245e250
Fig. 3. RT-PCR analysis of relative expression levels of the selected genes involved in HapA regulation. For each sample, total RNA (2 mg) was subjected to RT-PCR amplification using
the primers described in Table 1. The recA mRNA was used as reference. Amplification products were subjected to agarose gel electrophoresis, photographed (inset), and quantified.
Data represent the average of three RT-PCR reactions from 2740-80 (black) to 2740-80-VS (white)  standard deviation.
formation (Fig. 2A and B). In vivo, hapR mutant bacteria exhibit
restricted detachment from the intestinal epithelium compared to
wild type, which might result from decreased expression of HapA
and increased biofilm formation [19], likely prolonging coloniza-
tion and the duration of shedding of vibrios in the stools of cholera
patients.
VarS/VarA system homologs exist in a variety of Gram-negative
bacteria, including Escherichia coli (BarA/UvrY), Salmonella typhi-
murium (BarA/SirA), and Pseudomonas aeruginosa (GacS/GacA)
[24e27], and are involved in virulence. The gene gacA of P. aerugi-
nosa is required for full pathogenicity in both plant and animal
models of infection [25,26], and the sirA gene in S. typhimurium
encodes an essential transcriptional activator of invasion genes
[27]. Mutations in varA homologs from Pseudomonas species and
Salmonella result in pleiotropic defects in secretion of proteases and
other extracellular virulence factors [27,28]. In the case of V. chol-
erae, a varA mutant of the classical V. cholerae O395 strain has
defects in virulence protein expression, including reduced levels of
tcpA mRNA and TcpA protein, and lacks visible signs of autoag-
glutination [29]. The mutant also produces decreased levels of Ctx
Fig. 4. Northern blot analysis of total RNA from 2740-80 to the varS mutant 2740-80-
VS. Cultures were grown at 37  C to OD600 w1.0 and total RNA (10 mg per sample) was
subjected to northern blot analysis using the radiolabeled csrB and csrC sRNA probes
generated with the primers described in Table 1. Blots were photographed (inset) and
quantified. Data represent the average of three experiments from 2740-80 (black) to
2740-80-VS (white)  standard deviation.
and exhibits attenuated colonization in infant mice [29]. VarA has
been proposed to modulate Ctx and TcpA production, most likely by
regulating the expression of the transcriptional regulatory protein
ToxT, which positively controls the expression of virulence proteins
such as Ctx and Tcp in V. cholerae [29]. This suggests that the VarS/
VarA system is involved in the regulation of virulence factors other
than HapR.
In V. cholerae, the alternative sigma factor ss, encoded by the gene
rpoS, is induced during nutrient starvation or stationary phase [23].
Previously, V. cholerae mutants lacking rpoS have been reported to
have impaired survival under diverse environmental stresses,
including exposure to hydrogen peroxide, hyperosmolarity, and
carbon starvation [23]. In addition, rpoS mutants show reduced
production or secretion of HapA in V. cholerae, but rpoS is not critical
for survival in vivo as determined by an infant mouse intestinal
competition assay [23]. In our study, we demonstrated that rpoS
expression is regulated by the VarS/VarA pathway in V. cholerae
2740-80. This result suggests that the VarS/VarA pathway is impor-
tant not only for quorum sensing but also for adaptation to envi-
ronmental changes in V. cholerae. It remains unclear whether the
genes downstream of the VarS/VarA pathway (including sRNAs CsrB/
C/D, the regulator CsrA, LuxO, and HapR) are involved in the regu-
lation of rpoS. Another alternative sigma factor, s54, encoded by rpoN,
has been reported to work in concert with LuxO to activate the
expression of quorum regulatory RNAs [15,30]. Independent of LuxO,
s54 is involved in the regulation of motility and nitrogen metabolism
in Vibrio harveyi [30].
In summary, we have demonstrated that the VarS/VarAeCsrA/
B/C/D system is involved in the expression of HapA and in biofilm
production in V. cholerae strain 2740-80 through HapR regulation.
The VarS/VarA system also appears to be involved in the
expression of ss for the regulation of HapA. Further studies are
required to elucidate the precise interactions between the
components of these pathways, to determine the signal that
initiates the phosphorelay of VarS, and to identify the link
between the VarS/VarA and ss expression for HapA regulation in
V. cholerae.
3. Materials and methods
3.1. Bacterial strains and plasmids
All strains, plasmids, and primers used in this study are described
in Table 1. Strains were grown in LB or on L agar (LA), and stored at
80  C in LB containing 20% glycerol (v/v). Ampicillin (Amp) and
Strep were used at 100 mg/ml unless otherwise noted.
 J. Jang et al. / Microbial Pathogenesis 48 (2010) 245e250
3.2. Nucleic acid manipulations
All nucleic acid manipulations were carried out according to
standard protocols [31]. Cloning of PCR products was accomplished
using the TOPO TA Cloning kit (Invitrogen, Carlsbad, CA, USA) in
accordance with the manufacturer’s directions. PCR primers were
synthesized either by Qiagen (Hilden, Germany) or by Bioneer Co.
(Daejon, Korea). DNA sequencing was performed by the DNA
sequencing facility at the Korea National Institute of Health (Seoul,
Korea). PCR reactions (50 ml total) were typically performed using
exTaq polymerase under conditions specified by the manufacturer
(Takara, Shiga, Japan).
3.3. Construction of varS mutants of V. cholerae
For the construction of pCVD-VarS2, the coding region of varS
was amplified by PCR from V. cholerae genomic DNA using the
oligonucleotides 50 -CATATGACTCAAAGATATGGCTTGCGCGCC-30 ,
carrying the varS coding sequence from nucleotide 1 to 24 [32], and
50 -TCTAGATCAGTTCAGATAGTCGCGAGAGGC-30 , complementary to
nucleotides 2761 to 2784 of the varS coding sequence and con-
taining an XbaI site (underlined). The PCR product was cloned into
the pCRII-TOPO vector to produce pCRII-VarS1. pCRII-VarS1 was
digested with AccI to remove 1.6-kb of the varS coding region,
producing pCRII-VarS2. Then, pCRII-VarS2 was digested with SacI
and XbaI and the 1.2-kb fragment was inserted between the SacI
and XbaI sites of pCVD442 [33] to generate pCVD-VarS2.
To disrupt the varS gene in V. cholerae, pCVD-VarS2 was trans-
formed into E. coli SM10/l pirþ [34] and then transferred into
V. cholerae strains by conjugation. Recombinants were selected on
Amp- and Strep-containing plates. To select for a second recombi-
nation event, the recombinants were grown overnight on LA at 37  C
without selection and plated on LA (without NaCl) containing 6%
sucrose and Strep, thus selecting for sucrose-resistant, Amp-sensi-
tive colonies. The disruption of varS in V. cholerae was confirmed by
PCR amplification and sequencing.
3.4. Azocasein and biofilm assays
Azocasein assays were performed as previously described [35].
For biofilm assays, overnight cultures of V. cholerae were inocu-
lated at a 1:100 dilution into LB and incubated in borosilicate
tubes for 18 h at 22  C. Subsequently, the tubes were rinsed with
distilled water and then filled with crystal violet stain. After 5 min,
the tubes were rinsed. The biofilm-associated crystal violet was
resuspended in DMSO, and the OD570 of the resulting suspension
was measured.
3.5. Northern blotting and RT-PCR analysis
Total RNA was isolated from V. cholerae using the RNeasy mini kit
(Qiagen). The csrB and csrC DNA fragments used as probes for
northern blot analyses were generated by PCR amplification and
radiolabeled using the random hexanucleotide priming method
(Invitrogen). Primers used to generate the northern blot probes are
listed in Table 1. To confirm equal loading of RNA, the blots were
stripped and rehybridized with radiolabeled V. cholerae 16S rRNA
probe. The blots were exposed to X-ray film (Kodak XAR5; Eastman
Kodak, Rochester, NY, USA). Signal densities for each blot were
quantified using a densitometry program (Alpha Innotech Co., San
Leandro, USA) after normalizing to 16S rRNA.
Reverse transcription was performed using the Superscript III
first-stand synthesis system (Invitrogen) according to the manu-
facturer’s protocol. Briefly, 2 mg total RNA was used for the reverse
transcription reaction. The synthesized cDNA was subjected to
249
RT-PCR amplification using the premix-PCR kit (Bioneer Co.) and
then separated by agarose gel electrophoresis. The primers used for
RT-PCR amplification are listed in Table 1. The recA mRNA was
analyzed as a reference. Signal densities for amplification products
were quantified by densitometry (Alpha Innotech Co.) after
normalizing to the reference.
Acknowledgements
We thank Ms. H. Jung and M. Cho for their technical assistance.
This work was supported by a Korea National Institute of Health
Grant (2007-N00288-00 to G.R.).
References
[1] Faruque SM, Albert MJ, Mekalanos JJ. Epidemiology, genetics, and ecology of
toxigenic Vibrio cholerae. Microbiol Mol Biol Rev 1998;62:1301e14.
[2] Spangler BD. Structure and function of cholera toxin and the related Escher-
ichia coli heat-labile enterotoxin. Microbiol Rev 1992;56:622e47.
[3] Lencer WI, Tsai B. The intracellular voyage of cholera toxin: going retro.
Trends Biochem Sci 2003;28:639e45.
[4] Booth BA, Boesman-Finkelstein M, Finkelstein RA. Vibrio cholerae soluble
hemagglutinin/protease is a metalloenzyme. Infect Immun 1983;42:639e44.
[5] Reidl J, Klose KE. Vibrio cholerae and cholera: out of the water and into the
host. FEMS Microbiol Rev 2002;26:125e39.
[6] Wu Z, Milton D, Nybom P, Sjö A, Magnusson KE. Vibrio cholerae hemagglu-
tinin/protease (HA/protease) causes morphological changes in cultured
epithelial cells and perturbs their paracellular barrier function. Microb Pathog
1996;21:111e23.
[7] Wu Z, Nybom P, Magnusson KE. Distinct effects of Vibrio cholerae hemag-
glutinin/protease on the structure and localization of the tight junction-
associated proteins occludin and ZO-1. Cell Microbiol 2000;2:11e7.
[8] Mel SF, Fullner KJ, Wimer-Mackin S, Lencer WI, Mekalanos JJ. Association of
protease activity in Vibrio cholerae vaccine strains with decreases in trans-
cellular epithelial resistance of polarized T84 intestinal epithelial cells. Infect
Immun 2000;68:6487e92.
[9] Finkelstein RA, Boesman-Finkelstein M, Chang Y, Häse CC. Vibrio cholerae
hemagglutinin/protease, colonial variation, virulence, and detachment. Infect
Immun 1992;60:472e8.
[10] Häse CC, Finkelstein RA. Cloning and nucleotide sequence of the Vibrio chol-
erae hemagglutinin/protease(HA/protease) gene and construction of an HA/
protease-negative strain. J Bacteriol 1991;173:3311e7.
[11] Booth BA, Boesman-Finkelstein M, Finkelstein RA. Vibrio cholerae hemagglu-
tinin/protease nicks cholera enterotoxin. Infect Immun 1984;45:558e60.
[12] Nagamune K, Yamamoto K, Naka A, Matsuyama J, Miwatani T, Honda T. In
vitro proteolytic processing and activation of the recombinant precursor of El
Tor cytolysin/hemolysin (pro-HlyA) of Vibrio cholerae by soluble hemagglu-
tinin/protease of V. cholerae, trypsin, and other proteases. Infect Immun
1996;64:4655e8.
[13] Finkelstein RA, Boesman-Finkelstein M, Holt P. Vibrio cholerae hemagglutinin/
lectin/protease hydrolyzes fibronectin and ovomucin: F.M. Burnet revisited.
Proc Natl Acad Sci USA 1983;80:1092e5.
[14] Hammer BK, Bassler BL. Quorum sensing controls biofilm formation in Vibrio
cholerae. Mol Microbiol 2003;50:101e4.
[15] Lenz DH, Mok KC, Lilley BN, Kulkarni RV, Wingreen NS, Bassler BL. The small
RNA chaperone Hfq and multiple small RNAs control quorum sensing in Vibrio
harveyi and Vibrio cholerae. Cell 2004;118:69e82.
[16] Chen X, Schauder S, Potier N, Van Dorsselaer A, Pelczer I, Bassler BL, et al.
Structural identification of a bacterial quorum-sensing signal containing
boron. Nature 2002;415:545e9.
[17] Lenz DH, Miller MB, Zhu J, Kulkarni RV, Bassler BL. CsrA and three redundant
small RNAs regulate quorum sensing in Vibrio cholerae. Mol Microbiol
2005;58:1186e202.
[18] Lenz DH, Bassler BL. The small nucleoid protein Fis is involved in Vibrio
cholerae quorum sensing. Mol Microbiol 2007;63:859e71.
[19] Zhu J, Miller MB, Vance RE, Dziejman M, Bassler BL, Mekalanos JJ. Quorum-
sensing regulators control virulence gene expression in Vibrio cholerae. Proc
Natl Acad Sci USA 2002;99:3129e34.
[20] Jobling MG, Holmes RK. Characterization of hapR, a positive regulator of the
Vibrio cholerae HA/protease gene hap, and its identification as a functional
homologue of the Vibrio harveyi luxR gene. Mol Microbiol 1997;26:1023e34.
[21] Rhie G, Jung H, Park J, Kim B, Mekalanos JJ. Construction of cholera toxin B
subunit-producing Vibrio cholerae strains using the Mariner-FRT transposon
delivery system. FEMS Immun Med Microbiol 2008;52:23e8.
[22] Mohapatra SS, Ramachandran D, Mantri CK, Colwell RR, Singh DV. Determi-
nation of relationships among non-toxigenic Vibrio cholerae O1 biotype El Tor
strains from housekeeping gene sequences and ribotype patterns. Res
Microbiol 2009;160:57e62.
[23] Yildiz FH, Schoolnik GK. Role of rpoS in stress survival and virulence of Vibrio
cholerae. J Bacteriol 1998;180:773e84.
250 J. Jang et al. / Microbial Pathogenesis 48 (2010) 245e250
[24] Moolenaar GF, van Sluis CA, Backendorf C, van de Putte P. Regulation of the
Escherichia coli excision repair gene uvrC. Overlap between the uvrC structural
gene and the region coding for a 24 kD protein. Nucleic Acids Res 1987;15:
4273e89.
[25] Rahme LG, Tan MW, Le L, Wong SM, Tompkins RG, Calderwood SB, et al. Use
of model plant hosts to identify Pseudomonas aeruginosa virulence factors.
Proc Natl Acad Sci USA 1997;94:13245e50.
[26] Reimmann C, Beyeler M, Latifi A, Winteler H, Foglino M, Lazdunski A, et al. The
global activator GacA of Pseudomonas aeruginosa PAO positively controls
the production of the autoinducer N-butyryl-homoserine lactone and the
formation of the virulence factors pyocyanin, cyanide, and lipase. Mol
Microbiol 1997;24:309e19.
[27] Johnston C, Pegues DA, Hueck CJ, Lee A, Miller SI. Transcriptional activation of
Salmonella typhimurium invasion genes by a member of the phosphorylated
response-regulator superfamily. Mol Microbiol 1996;22:715e27.
[28] Sacherer P, Défago G, Haas D. Extracellular protease and phospholipase
C are controlled by the global regulatory gene gacA in the biocontrol
strain Pseudomonas fluorescens CHAO. FEMS Microbiol Lett 1994;116:
155e60.
[29] Wong SM, Carroll PA, Rahme LG, Ausubel FM, Calderwood SB. Modulation of
expression of the ToxR regulon in Vibrio cholerae by a member of the two-
component family of response regulators. Infect Immun 1998;66:5854e61.
[30] Lilley BN, Bassler BL. Regulation of quorum sensing in Vibrio harveyi by LuxO
and Sigma-54. Mol Microbiol 2000;36:940e54.
[31] Ausubel FM, Brent R, Kingston RE, Moore DE, Seidman JG, Smith JA, Struhl K,
editors. Current protocols in molecular biology. New York: Wiley; 1995.
[32] Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, Dodson RJ, et al.
DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae.
Nature 2000;406:477e83.
[33] Donnenberg MS, Kaper JB. Construction of an eae deletion mutant of
enteropathogenic Escherichia coli by using a positive-selection suicide vector.
Infect Immun 1991;59:4310e7.
[34] Simon R, Priefer U, Pühler A. A broad host range mobilization system for in
vivo genetic engineering: transposon mutagenesis in gram negative bacteria.
Nature Biotechnology 1983;1:784e91.
[35] Benitez JA, Silva AJ, Finkelstein RA. Environmental signals controlling
production of hemagglutinin/protease in Vibrio cholerae. Infect Immun 2001;
69:6549e53.