Molecular Ecology (2009) 18, 1282–1293 doi: 10.1111/j.1365-294X.2009.04095.

Community composition, host range and genetic structure

Blackwell Publishing Ltd

of the fungal entomopathogen Beauveria in adjoining

agricultural and seminatural habitats
N I C O L A I V. M E Y L I N G ,* M E T T E L Ü B E C K ,† E L L E N P. B U C K L E Y ,‡ J Ø R G E N E I L E N B E R G * and
STEPHEN A. REHNER§
*Department of Agriculture and Ecology, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C, Denmark,
†Center for Biotechnology and Bioenergy, Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg
University, Lautrupvang 15, DK-2750 Ballerup, Denmark, ‡USDA-ARS, Office of National Programs, Natural Resources and
Sustainable Agriculture, Beltsville, MD 20705, USA, §Systematic Mycology and Microbiology Laboratory, USDA-ARS, Beltsville,
MD 20705, USA

Abstract
Although intensively investigated for biological control of insect pests, little is known about
the ecology of the fungal entomopathogenic genus Beauveria in natural or agricultural
habitats. In this study, we used molecular phylogenetic and genotypic information to infer
species diversity, reproductive potential and genetic structure of Beauveria occurring
within a single arable field and bordering hedgerow in Denmark. Isolates were sampled
from cultivated field and hedgerow soils, from insects harbouring latent fungal infections,
and from the phylloplanes of three plant species common in the hedgerow flora. A nuclear
phylogeny of this local Beauveria assemblage resolved seven phylogenetic species,
including (i) five phylogenetic species within Beauveria bassiana sensu stricto; (ii) Clade C,
a taxonomically uncharacterized species that is morphologically indistinguishable but
phylogenetically distant from B. bassiana s.s.; and (iii) Beauveria brongniartii. All seven
species were present throughout the hedgerow habitat, including as infections in insects.
Significantly, only B. bassiana s.s. phylogenetic species Eu_1 was isolated from tilled soils.
Mating type polymerase chain reaction assays demonstrated that all five B. bassiana s.s.
phylogenetic species possess bipolar outcrossing mating systems. Of these, only the Eu_1
population contained two mating types; however, a 31:2 skew in MAT1:MAT2 mating types
suggests a low frequency of sexual reproduction in this population. The four remaining
B. bassiana s.s. phylogenetic species were fixed for single mating types and these popula-
tions are evidently clonal. Multilocus microsatellite genotyping revealed polymorphism
in all five phylogenetic species of B. bassiana s.s.; however, all show evidence of clonal
genetic structure.
Keywords: agro-ecosystem, community, ecological host range, fungi, genetic diversity,
recombination

Received 6 October 2008; revision revised 2 December 2008; accepted 11 December 2008

the anamorphic genus Beauveria (Ascomycota: Hypocreales)

Introduction
Entomopathogenic fungi are natural enemies of diverse
terrestrial arthropods and are important regulators of host
populations in terrestrial ecosystems (Hajek 1997). Within
Correspondence: Nicolai V. Meyling, Fax: +45 35332670;
E-mail: nvm@life.ku.dk
are species with broad host ranges and the pan-global
Beauveria bassiana sensu lato morphospecies infects host
species in numerous orders of insects (Samson et al. 1988).
Conidia of B. bassiana s.l. can survive in the soil (Keller &
Zimmerman 1989) and these fungi also occur as epibionts
and endophytes of plants (Elliott et al. 2000; White et al.
2002). The ability of B. bassiana s.l. to infect insects has been

© 2009 Blackwell Publishing Ltd

 C O M M U N I T Y C O M P O S I T I O N O F B E A U V E R I A 1283
explored for the biological control of insect pests and
commercial products based on this fungus are developed
(Inglis et al. 2001).
Several molecular studies on B. bassiana s.l. have been
based on the implicit assumption that genetic groups have
co-evolved with particular host taxa (Couteaudier & Viaud
1997; Maurer et al. 1997; Urtz & Rice 1997; Berretta et al.
1998; Gaitan et al. 2002). However, limited evidence has
been produced to suggest that this is actually the case
(Glare 2004), and the general conclusion of more recent
studies is that B. bassiana s.l. contains generalist entomo-
pathogens without any particular phylogenetic association
with regard to host specificity or evolutionary codiver-
gence with their insect hosts (Bidochka et al. 2002; Coates
et al. 2002; Wang et al. 2003; Rehner & Buckley 2005). It has
been proposed that environmental factors apart from
host biology constitute the prime selective forces shaping
adaptive and neutral genotypic evolution in B. bassiana s.l.
(Bidochka et al. 2002).
Despite extensive research on the potential of B. bassiana
s.l. for insect biological control, basic knowledge of com-
munity diversity and ecology, population structure, and
epidemiology of these organisms in either natural or
agricultural habitats is surprisingly scant. A focus on local
assemblages of Beauveria species within an agro-ecosystem
may thus provide important insights into the ecology and
population biology of these generalist insect pathogens.
Such knowledge may also be useful for the selection and
management of these organisms for biological control
of insect pests. Previous polymerase chain reaction
(PCR)-based studies of genetic diversity in B. bassiana s.l.
have shown high levels of genotypic diversity, even within
a relatively limited geographical area (Castrillo et al. 1999;
Wang et al. 2004; McGuire et al. 2005). In these studies,
however, isolates were collected with a bias towards specific
insect hosts or particular isolation methods but without
regard to the position of isolates within the environments
sampled. Neither have any of these prior surveys explicitly
partitioned the underlying genetic diversity within com-
munities of Beauveria. Thus, no useful information presently
exists about community structure of Beauveria with regard
to the number of species, their distribution between
habitats, host range or their genetic structure within any
ecosystem. Such information is important to fundamentally
understand host–pathogen ecology involving insects and
fungi. Moreover, the application of commercial strains of
B. bassiana s.l. for biological control of pests in agricultural
systems will potentially interact with the indigenous
Beauveria community (Castrillo et al. 2003; Wang et al. 2003;
Wang et al. 2004; Reay et al. 2008) and nontarget insect
species. For this reason, knowledge of B. bassiana s.l.
community structure, host range and the reproductive
biology and life histories of fungal populations that occupy
contiguous agricultural landscape elements is essential to
© 2009 Blackwell Publishing Ltd
understand and possibly predict the environmental effects
of field applications of biocontrol strains.
Recent molecular phylogenies of Beauveria and B. bassiana
s.l. (Rehner & Buckley 2005; Rehner et al. 2006) provide new
tools for species recognition and identification. These
studies have shown that the globally distributed B. bassiana
s.l. morphospecies is nonmonophyletic and contains two
distantly related but morphologically indistinguishable
clades. The first clade, which we refer to as Beauveria bassiana
sensu stricto, corresponds to B. bassiana in the traditional
sense, represents a globally distributed complex of mor-
phologically cryptic phylogenetic species (Rehner et al. 2006).
The second clade is provisionally referred to as ‘Clade C’
and has not been formally described taxonomically (S.A.
Rehner, unpublished). In surveys of Beauveria from Asia,
Africa, North and South America and Europe, B. bassiana
s.s. is consistently predominant among environmental
isolates of the genus (S.A. Rehner, unpublished). Multiple
cryptic phylogenetic species of B. bassiana s.s. have been
inferred from all continents and regions sampled (Rehner
et al. 2006; S.A. Rehner, unpublished), and an ad hoc iden-
tification system has been established by which phyloge-
netic species are designated by continent and in the order
of their discovery (e.g. Eu_1 and Eu_2 for the first two
European phylogenetic species discovered) (Rehner et al.
2006). However, it has not been determined whether the
multispecies sympatry and broad host ranges observed at
continental and national scales are also realized locally
within a single agro-ecosystem. Similarly, the distributions
of phylogenetic species within habitat types have not yet
been investigated.
Beauveria bassiana s.s. reproduces asexually by mitosporic
conidia and, since its discovery nearly 200 years ago, it has
been presumed to be exclusively clonal. Recently, B. bassiana
s.s. has been linked developmentally and phylogenetically
to the Asian sexual species Cordyceps bassiana (Sung 1996;
Li et al. 2001; Huang et al. 2002; Rehner & Buckley 2005),
providing evidence that B. bassiana s.s. is facultatively
sexual. However, it remains to be determined whether all
members of this global complex are sexually competent.
Molecular markers to assess the mating system of B. bassiana
s.s. and to infer reproductive mode have only recently
become available. Yokoyama et al. (2006) developed a
degenerate PCR-based assay to mating type (MAT) genes
in clavicipitalean fungi, which includes Beauveria. MAT
genes are transcriptional regulatory genes that determine
sexual mating types in euascomycetes. The genomic
organization of MAT genes largely determines whether
ascomycete mating systems are outcrossing or selfing
(Kronstad & Staben 1997; Coppin et al. 1997; Debuchy &
Turgeon 2006). Yokoyama et al. (2006) demonstrated that
individual isolates of B. bassiana s.s. were either MAT1 or
MAT2 mating type. This mutually exclusive segregation
of mating types by haplotype indicates that the mating
1284 N . V. M E Y L I N G E T A L .
system in these Beauveria isolates is heterothallic and
outcrossing. However, it has not been determined whether
all phylogenetic species within the B. bassiana s.s. complex
also possess heterothallic mating systems. It also is not
known whether the predisposition for mitotic reproduction
expressed by B. bassiana s.s. is due to unequal distributions
of mating-type genes within populations or perhaps by
other factors that affect mating competence. Population
surveys for the presence and distribution of mating types
offer an initial approach to distinguish between these
alternative explanations for the strong bias in clonal repro-
duction by B. bassiana s.s. Assessment of population genetic
structure, which offers a second option for inferring repro-
ductive mode in B. bassiana s.s., have not been conducted
due to a lack of genetic markers. However, co-dominant
microsatellite markers are now available (Rehner & Buckley
2003).
In this study, we determined the endemic phylogenetic
diversity, environmental distribution and genetic structure
of the Beauveria community within a single agro-ecosystem
in Denmark, consisting of an arable field and associated
field margin, with specific emphasis on the B. bassiana s.l.
morphospecies. Since the soil environment is a well-known
reservoir of these fungi (Keller & Zimmerman 1989), we
partitioned this into cultivated arable field soil and uncul-
tivated soil from the neighbouring hedgerow to investigate
the effect of soil environment on community composition.
We also sampled isolates from above-ground in the
hedgerow to link these to below-ground populations. To
determine whether Beauveria circulates within the above-
ground environment, the seminatural habitat of the hedge-
row was divided into groups of plants characteristic of
hedgerows in Northern Europe, and we assessed selected
insect species specifically associated with these host plants
to survey for latent Beauveria infections. This spatial parti-
tioning of isolates should provide insights into how species
and their populations are distributed within the agro-
ecosystem, which niches they occupy and whether the
populations in the Beauveria community show potential for
recombination.
Materials and methods
Collection of isolates
Seventy-seven isolates of Beauveria (see Table S1, Supporting
information) were collected within a 27.5-ha agro-ecosystem
at the experimental organic farm, Bakkegården, located
at Taastrup, 20 km west of Copenhagen, Denmark (55°40′N,
12°18′E). A hedgerow with dimensions 10 × 350 m (0.35 ha)
consisting mainly of hawthorn (Crataegus monogyna) and
poplar (Populus sp.) with herbaceous vegetation dominated
by stinging nettles (Urtica dioica) and grasses, mostly
Dactylis glomerata and Elytrigia repens (Poaceae), bordered
the field to the southeast, and this seminatural habitat was
included in the area of investigation.
Isolates originated from selected compartments within
the locality: tilled field soil (n = 17), hedgerow soil (n = 11),
infected insects (n = 34) collected from grasses, nettles and
hawthorn in the hedgerow as well as from phylloplanes of
these plants (n = 15). Soil isolates from field and hedgerow
soils were obtained by the ‘Galleria bait method’ (Zimmer-
mann 1986) using larvae of Galleria mellonella (Lepidoptera:
Pyralidae), Tenebrio molitor (Coleoptera: Tenebrioidae) as
described in Meyling & Eilenberg (2006a) or by plating soil
suspensions on selective media, as described by Kessler
et al. (2003). Isolates from cultivated soil were selected to
maximize variation in spatial distribution within the site
and over time. This was carried out by selecting isolates
obtained from across the entire area of the field as well as
isolates from both spring 2001 and autumn 2002. Isolations
from phylloplanes of the three plant groups were conducted
as described by Meyling & Eilenberg (2006b).
Insects were collected with sweep nets from hedgerow
plants. Plant specific true bugs (Hemiptera) and weevils
(Coleoptera: Curculionidae) were collected. In addition,
flies (Diptera: Anthomyiidae) were sweep-netted along the
hedgerow and in the field. Ground beetles and rove beetles
(Coleoptera: Carabidae and Staphylinidae) were trapped
in pit falls in the hedgerow and in the middle of the field.
However, all insects carrying latent infections of Beauveria
originated from the hedgerow (Table S1).
All collected insects were confined singly in medicine
cups (30 mL) fitted with ventilated lids and provided with
appropriate food. The containers were incubated in a
climate cabinet at 20 °C, L16:D8, and were checked fre-
quently for mortality. Dead insects were transferred to
moist chambers for growth of any entomopathogenic
fungi. Emerging fungi were identified to genus and mor-
phospecies by light microscopy and isolated onto Sabouraud
dextrose agar (SDA).
All isolates of Beauveria were prepared as single conidial
isolates on SDA by arbitrarily selecting one colony forming
unit (CFU) from a cohort of conidia in dilution plating
series of suspensions made from the original isolation. Both
original and single conidial isolates were subsequently
stored in the strain collection at –80 °C at the Department
of Agriculture and Ecology, University of Copenhagen
(strain collection code KVL).
DNA extraction
Isolates were inoculated individually into sterile flasks
with liquid growth medium consisting of 2% peptone, 3%
sucrose and 0.2% yeast extract. Flasks were incubated for 3
days at room temperature on a shaker (170 r.p.m.) and the
resulting fungal cells were filtered and lyophilized. DNA
was extracted from fungus material using a Nucleon
© 2009 Blackwell Publishing Ltd
 C O M M U N I T Y C O M P O S I T I O N O F B E A U V E R I A 1285
Phytopure kit (Amersham Biosciences) according to the
guidelines of the manufacturer. Pellets of DNA were
resuspended in 1× TE buffer (pH 8.0).
PCR and sequencing
All isolates from the research site were amplified and
sequenced for Bloc, a nuclear intergenic marker developed
for phylogenetic investigation of Beauveria (Rehner et al.
2006). PCR and sequencing of Bloc was performed according
to Rehner et al. (2006). Partial Bloc sequences of approxi-
mately 700 bp were determined for all isolates with the
internal primers B22U and B822L (Rehner et al. 2006).
Complete Bloc and Elongation Factor 1-alpha (EF-1α)
sequences, each approximately 1500 bp in length, were
generated for 19 exemplar isolates that included 13
representative isolates from the seven lineages detected in
this study and six extralimital European reference isolates
according to methods in Rehner & Buckley (2005) and
Rehner et al. (2006). Procedures for editing sequence
data and constructing multiple sequence alignments are
described in Rehner & Buckley (2005) and Rehner et al.
(2006), respectively.
Phylogenetic analysis
Molecular phylogenies of Bloc and EF-1α were used to
infer the phylogenetic diversity and relationships among
Beauveria isolates collected at the Bakkegården research
site. Phylogenetic trees were inferred with maximum
parsimony (MP) using paup* (version 4b10; Swofford 2002).
All MP analyses were performed using the heuristic search
option with tree-bisection–reconnection (TBR) branch
swapping under equal character weighting, excluding
gapped and uninformative characters, and executing 1000
random-addition replicate analyses. Heuristic MP bootstrap
analyses were performed with 1000 pseudoreplicates (TBR
branch swapping) with 10 random-addition replicates
per pseudoreplicate. Phylogenetic analyses were rooted to
isolates of Clade C.
PCR diagnosis of mating type
The mating type for all Beauveria bassiana s.s. isolates was
determined by performing two single-plex PCR amplifica-
tions to internal segments of the MAT1 and MAT2 mating
type idiomorphs, respectively. Idiomorph-specific primers
were designed from sequences determined from genomic
clones of the MAT locus, the details of which are being
described in a separate publication (S.A. Rehner, unpub-
lished). The MAT1 specific primer pair, MAT112.F4 (5′-
CAGCTCTCCGTCTGCCGAGTT-3′) and MAT111.R5
(5′-TAGTGAGAAAGCCTGACGCGG-3′), amplify across
an intergenic region between the adjacent MAT 1–1-2 and
© 2009 Blackwell Publishing Ltd
MAT 1–1-1 genes, yielding a ~1550-bp fragment. The
MAT2 specific primers, MAT2.F4 (5′-RTCAGCGTCGG-
CATCAACCCATT-3′) and MAT2.R5 (5′-GAAAAYTCGCT-
GCCAGTCATRAT-3′), amplify a ~650-bp fragment internal
to the MAT 1–2-1 gene. PCR amplifications were conducted
separately for each MAT primer pair using a single thermal
cycling profile that consisted of a single cycle of 95 °C for
2 min followed by 40 cycles of 95 °C for 30 s, 56 °C for 30 s,
72 °C for 1 min and concluding with a single cycle of 72 °C
for 15 min. PCR products were resolved and scored on 1%
agarose gels.
Multilocus microsatellite genotyping
Multilocus microsatellite genotypes for all isolates of B.
bassiana s.s. were determined at 17 or 18 microsatellite loci
(Table 1). The microsatellite markers were developed as
described in Rehner & Buckley (2003) and amplicons
generated using a M13-tailed fluorescent labelling strategy
described by Schuelk (2000). PCR amplification reactions
were performed in 10-μL reaction volumes with 5–10 ng
genomic DNA and adjusted to 200 μm dNTPs, 5 pmol of an
M13-tailed locus specific primer, 5 pmol of a M13 primer
end-labelled with TAMRA, FAM or HEX fluorescent dye,
10 pmol reverse locus-specific primer, 0.175 U Taq DNA
polymerase (Promega) in 1× Promega reaction buffer at
1.5 mm Mg++. PCR cycling parameters included a 2-min
denaturation at 95 °C followed by 35 cycles of 95 °C for
30 s, 56 °C for 30 s, 72 °C for 45 s and ending with 30-min
incubation at 72 °C. Following amplification, 1.0 μL of the
reaction product was diluted in 50 μL sterile distilled water
and then 1 μL aliquots from three different loci from a
single individual, each labelled with a different fluorescent
tagged, was added to 10 μL formamide with 0.5 μL
GeneScan 400 HD ROX molecular size standards (PE
Biosystems), denatured for 1 min at 95 °C and the products
separated on a ABI 3100 Genetic Analyser. Electromorph
sizes were estimated using GeneScan software (Applied
Biosystems). Descriptive population statistics for the
microsatellite data were estimated with the program
Genetic Data Analysis (gda) (Lewis & Zaykin 2001).
Interspecific differentiation across microsatellite loci was
assessed using neighbour-joining on the untransformed
allelic data implemented in paup* (version 4b10; Swofford
2002).
Results
Phylogenetic diversity and distribution of Beauveria
within the Bakkegården site
Partial Bloc sequences, between internal primers B22U
and B822 L, were determined for all 77 Beauveria isolates
yielding an aligned matrix of 695 bp that included 121
1286 N . V. M E Y L I N G E T A L .

Table 1 Primer pairs for amplification of microsatellite loci in Beauveria bassiana s.s. Forward primers (F) include a 5′ forward M13 tail
sequence (5′-GTTTTCCCAGTCACGAC). Reverse (R) primers were unmodified

Locus Repeat motif Base repeat length (bp)* Primers (5′–3′)

Ba06 GTT 114 F: GCGATTGACGAAAAGCTAGA

R: ACTTGCTTTGCTGTTGCACA
Ba08 AAG 210 F: TGTTGCCGACACGAATTGT
R: GGCTCAAGCGCAAAGAGAAA
Ba12 CTT 231 F: GGGTCCATCATGTACGGC
R: AGGCGTATACAGGTCGTG
Ba13 AAG 161 F: CAGGCAACAACACGATTTCA
R: ATGCCATCTACGACTTTATGA
Ba14† AAG 192 F: TTGCTATCCCAATAACCAATA
R: GCAAGAGCTGGATGAGAC
Ba15† CTT 156 F: GTCCGGGAATGCCTGTGAT
R: TCCCCATCTCGCTCTTCAAT
Ba16† TGC 121 F: GCCACATTTCATCACTGTTG
R: TGTCGCCTTTGTGACCAAG
Ba17† AAG + AGG 169 F: ATGACTAGCAGGACTGCG
R: ATATTCATCTTTGCAGGTGGC
Ba18† GTT 120 F: TCGTCCAAGTGTGCTTTAC
R: CATGATTTTTACCTTGAGGAA
Ba20† AAG 182 F: GCATCGTATCCCTTTTCACA
R: GGAGGCGGTGGTGAAGG
Ba21† GTG + GTC 188 F: ACGAGTATTGGTGTTGGGTA
R: GCAACACAACGCCCCAAG
Ba22† AAG 152 F: GAAAAAGGCCCGCAGCAAC
R: CCTCGTGAATCTCGGTCAG
Ba23† AAG 153 F: CGTACGACGTTTCCTAAAGAA
R: TGGAAACTGTTTGGGATTGGA
Ba24† AAG 171 F: TCAACATGCAATATAGCTGGT
R: CCATCTTGCTCCAGTATCC
Ba25† AAG 216 F: GACGGGGGCAGGGAACG
R: CTCTGATTGACCGTTTTGGT
Ba26† AAG + AAG 119 F: AAGGGAAAGAGGAGGACGA
R: CCAAACGCACCACATAAAGT
Ba27 GTT 186 F: CATGAGACGGTGTGGGAAG
R2: AAACGCCGTTCTCCAAGACT
Ba28 AAG 155 F2: CTGCTGCTCGGAGAGGG
R: AGCACATCCTACACACGCA
Ba29 AAGC 152 F: GAAAAAGGCCCGCAGCAAC
R: CCTCGTGAATCTCGGTCAG

*Size of allele originally cloned from ARSEF 1564; †new in this study.

parsimony-informative nucleotide positions. MP analysis
of the aligned data, exclusive of gapped positions, produced
two most parsimonious trees of 181 steps with consistency
index = 0.7965, homoplasy index = 0.2035 and rescaled
consistency index = 0.7866 and resolved seven well-
supported terminal clades (trees not shown; phylogenetic
placement of isolates is listed in Table S1). Examinations
of isolate morphology and comparison to sequences in
published sequence phylogenies (Rehner & Buckley 2005)
place these isolates within one of the following three
groups: Beauveria bassiana s.s., Beauveria brongniartii and an
as yet undescribed taxon provisionally termed clade C. The
majority of isolates from Bakkegården (n = 69) were placed
within B. bassiana s.s. that were further partitioned into
five terminal clades with strong bootstrap support. The
biological and taxonomic status of these clades within
B. bassiana s.s. has not been resolved. However, we consider
them to represent discrete phylogenetic species and
henceforth refer to them as such. To distinguish the different
B. bassiana s.s. phylogenetic species from one another, they
are designated ‘Eu_X’, where ‘Eu’ refers to Europe and ‘X’
to the order of their discovery. Accordingly, the B. bassiana
s.s. phylogenetic species treated here, including affiliated
Agricultural Research Service Collection of Entomopa-
thogenic Fungi (ARSEF) reference isolates from other
European locations, are referred to as: Eu_1 (n = 33, ARSEF

© 2009 Blackwell Publishing Ltd

 C O M M U N I T Y C O M P O S I T I O N O F B E A U V E R I A 1287

Table 2 Spatial distribution of the seven phylogenetic species of Beauveria within the Bakkegården research site

Arable field Hedgerow

Soil Soil Hawthorn Nettle Grasses Insects

B. bassiana s.s.
Eu_1 17 2 — 2 — 13*
Eu_3 — — — — — 2
Eu_4 — 1 3 2 2 2
Eu_5 — 4 3 2 − 11
Eu_6 — — — — — 3
B. brongniartii — 2 — 1 — 1
Clade C — 2 — — — 2

*Including one isolate KVL 03-72, which is a basal outlier to Eu_1.

1628, Hungary); Eu_3 (n = 2, ARSEF 1185, France); Eu_4

(n = 10, ARSEF 1848, Belgium); Eu_5 (n = 20); and Eu_6
(n = 3, ARSEF 815, France). Eu_5 represents a newly
discovered phylogenetic species from the Bakkegården site
while Eu_2 was not found at the site. Four isolates grouped
with B. brongniartii reference isolate JE276 from Switzerland
and four isolates grouped with the reference Clade C
isolate, ARSEF 4933 from France. In total, we recognize seven
phylogenetic groups in this study, five within B. bassiana
s.s., and one within each of B. brongniartii and Clade C,
respectively. A single isolate, KVL 03–72, was closely
related to but distinct from Eu_1 and will be treated as a
basal outlier to this phylogenetic species.
Full-length Bloc and EF-1α sequences were determined
for 19 exemplar isolates. This set included 13 isolates from
the study site and included one or two exemplars from
each of the seven clades resolved in the initial Bloc phylo-
genetic analysis plus the six reference isolates. GenBank
Accession numbers for the exemplar EF-1α sequences
are AY531886, AY531904, AY531938, AY883696, DQ376244, Fig. 1 Maximum parsimony analysis of the combined Bloc and
EF193180, EF193181, EF193184–EF193193, FJ229490– EF-1α sequence data. Nodes that received ≥ 70% bootstrap
FJ229492 and for Bloc are AY883796, EF193165–EF193179, support values are indicated. The numbers of isolates and MAT
FJ228724 and FJ228725. Trees inferred from individual genotypes for each of the five Beauveria bassiana s.s. phylogenetic
MP and MP bootstrap analyses of Bloc and EF-1α were species are listed below the clade identifiers. KVL 03–72, a basal
topologically congruent (data not shown) and the data were outlier to Eu_1 was not included in this analysis.
combined into a single matrix with a combined length of
3215 bp. MP analysis of the combined data, excluding 51 from insects and hedgerow soil. The absence of these latter
gapped positions, yielded a single most parsimonious tree three phylogenetic species from particular partitions is
of 519 steps, consistency index = 0.7803 and a rescaled likely attributable to the small available sample sizes. Eu_1
consistency index = 0.6989, which is presented in Fig. 1. was the only phylogenetic species isolated from tilled
Distributions of Beauveria from all habitat compartments agricultural soils. All other soil isolates were from the
of the Bakkegården site are summarized in Table 2. Beauveria hedgerow and included Eu_1, Eu_4, Eu_5, Clade C and
bassiana s.s. phylogenetic species Eu_1, Eu_4, Eu_5 and B. B. brongniartii. Eu_1, Eu_4, Eu_5 and B. brongniartii were
brongniartii were present in all three hedgerow partitions isolated from leaf surfaces of hedgerow plants. Phylloplanes
(soil, phylloplanes and insects) sampled. Eu_3 and Eu_6 constituted the greatest number of isolations for Eu_4
were isolated from insects only and Clade C was isolated (n = 7/10).

© 2009 Blackwell Publishing Ltd

1288 N . V. M E Y L I N G E T A L .
Table 3 Codes for host species illustrated in Figure 2 including
their host plant (when applicable) in the hedgerow
Code Systematic name Host plant
1 Notostira elongata (Hemiptera: Miridae) Grasses
2 Stenodema laevigatum (Hemiptera: Miridae) Grasses
3 Leptopterna dolobrata (Hemiptera: Miridae) Grasses
4 Sitona lineata (Coleptera: Curculionidae) Grasses
5 Anthocoris nemoralis (Hemiptera: Anthocoridae) Hawthorn
6 Rhynchites aequatus (Coleoptera: Curculionidae) Hawthorn
7 Nebria brevicollis (Coleoptera: Carabidae) NA
8 Pegoplata aestiva (Diptera: Anthomyiidae) NA
9 Hylemya variata (Diptera: Anthomyiidae) NA
10 Anthocoris nemorum (Hemiptera: Anthocoridae) Nettle
11 Liocoris tripustulatus (Hemiptera: Miridae) Nettle
12 Scolopostetus affinis (Hemiptera: Lygidae) Nettle
All Beauveria phylogenetic species were recovered as
infections in insect hosts and are therefore true ento-
mopathogens. Figure 2 and Table 3 show their ecological
host range by depicting the trophic links between pathogen
species and host insects. It is evident that the most abundant
B. bassiana s.s. phylogenetic species, Eu_1 and Eu_5, infected
many host species in the insect community in the hedgerow.
Furthermore, the less common phylogenetic species, Eu_4
and Eu_6, infected two host species each. Eu_3 infected
only the predatory bug, Anthocoris nemorum (n = 2) while
B. brongniartii infected the carabid beetle Nebria brevicollis
(n = 1) and Clade C were found as infections of the mirid bug
Liocoris tripustulatus (n = 2).
Mating type diagnosis
PCR assays for mating type demonstrated that individual
isolates of B. bassiana s.s. were either MAT1 or MAT2 (Table
S1). Eu_1 was the only phylogenetic species in which both
mating types were detected although the ratio of mating
Fig. 2 Qualitative host-pathogen web linking
infections of the seven phylogenetic species
of Beauveria (B. bassiana s.s. phylogenetic
species are designated Eu_1, Eu_3, Eu_4,
Eu_5 and Eu_6, respectively; B. bro., B.
brongniartii) to specific insect hosts sampled
in the insect community of the hedgerow at
Bakkegården. Each lower box illustrates a
given host species. Codes for host species
names and their respective spatial location
within the hedgerow are given in Table 3.
*Eu_1 includes the isolate KVL 03–72 which
was found to be a basal outlier to Eu_1.
types was skewed, with a 31:2 ratio of MAT1 to MAT2
mating types. Within Eu_1, isolate KVL 03–94 from an
infection in Notostira elongata grass bug from the hedgerow
and isolate KVL 03–79 from agricultural field soil were
MAT2. Only a single mating type was detected in each of
the four remaining phylogenetic species. Both Eu_4 and
Eu_6 were MAT1, whereas Eu_3 and Eu_5 were MAT2.
The mating types of the extralimital European reference
isolates were identical to that of their affiliated group at
Bakkegården. Isolate KVL 03–72, the basal outlier to Eu_1,
was MAT1, the most prevalent mating type in Eu_1.
Multilocus microsatellite genotypes
Multilocus microsatellite genotypes were determined for
all B. bassiana s.s. isolates for 17 or 18 loci and these data are
summarized in Table 4. Persistent amplification failures
indicated possible null alleles at Ba27 in Eu_4 (6 of 10
isolates) and Eu_6 (all 3 isolates), at Ba20 in Eu_4 (all 10
isolates); and at Ba06 in Eu_4 (3 of 10 isolates). A total of 102
unique alleles were detected among the five B. bassiana s.s.
phylogenetic species and varied from 8 to 60 unique alleles
detected per population (Table 4). The average number of
alleles per locus varied from 1.06 to 3.47 per population.
The five populations were differentiated from one another
by multiple, fixed allelic differences at a majority of
microsatellite loci examined. A neighbour-joining analysis
of the microsatellite data concordantly supported the five
phylogenetic species resolved in the combined Bloc and
EF-1α phylogenetic analysis (Fig. 3). In addition to this,
isolate KVL 03–72, the outlier to Eu_1, had eight unique
microsatellite alleles not observed in Eu_1 or any other
B. bassiana s.s. phylogenetic species listed in Table 4. Eu_3,
Eu_4, Eu_5 and Eu_6 had low allelic variation with only
one, two, five, and two polymorphic loci, and a total of two,
seven, eight and three multilocus genotypes in these
population samples, respectively. In contrast, Eu_1 had the
greatest genotypic variability with 12 polymorphic loci
© 2009 Blackwell Publishing Ltd
 C O M M U N I T Y C O M P O S I T I O N O F B E A U V E R I A 1289

Table 4 Measures of allelic richness and gene diversity for five phylogenetic species of Beauveria bassiana s.s. co-occurring at the
Bakkegården site

Group: Eu_1* Eu_3 Eu_4 Eu_5 Eu_6

No. of isolates 33 2 10 20 3
No. of alleles 72 19 19 25 19
No. of unique alleles 60 11 10 13 8
No. of invariant loci 4 17 15 15 15
A 3.47 1.06 1.13 1.48 1.12
P 0.78 0.056 0.12 0.28 0.12
Ap 5.29 2 2 2.6 2
HT 0.24 0.039 0.041 0.076 0.063
MH 28 2 3 9 3

A, mean number of alleles per locus; P, percentage of polymorphic loci; Ap, mean number of alleles per polymorphic locus; HT, estimated
heterozygosity; MH, number of unique multilocus microsatellite haplotypes; *does not include data for outlier isolate KVL 03-72.

and 26 unique multilocus genotypes. Over-represented

multilocus genotypes were observed in three phylogenetic
species: Eu_1 had a single repeated genotype that included
eight individuals, Eu_4 had two multilocus genotypes
with two and three individuals and Eu_5 had three
repeated genotypes with four, five and six individuals
(Fig. 3). In addition, the majority of unique multilocus
genotypes in Eu_1 and all multilocus genotypes within
Eu_3, E_4, Eu_5, Eu_6 differ from their nearest related
multilocus genotype by single allelic differences. A close
inspection of the microsatellite data for each population
did not reveal any instances of character conflict among
polymorphic loci that could be attributed to recombination
(data not shown), hence allele association tests were not
conducted.

Fig. 3 Unrooted neighbour-joining tree of clone-corrected micro-
satellite data for five Beauveria bassiana s.s. phylogenetic species
and isolate KVL 03–72. Nodes receiving ≥ 70% bootstrap support
values are indicated. *Multilocus/microsatellite types are defined
as: Eu_1 MT.1: KVL 03–71, KVL 03–135, KVL 03–97, KVL 03–96,
KVL 03–82, KVL 03–105, KVL 03–124, KVL 03–79; Eu_4 MT.1: KVL
03–101, KVL 03–117; Eu_4 MT.2: KVL 03–113, KVL 03–114, KVL
03–116; Eu_5 MT.1: KVL 03–133, KVL 03–108, KVL 03–103, KVL
03–110, KVL 03–113; Eu_5 MT.2: KVL 03–142, KVL 03–87, KVL 03–115,
KVL 03–89; Eu_5 MT.3: KVL 04–32, KVL 03–88, KVL 03–104, KVL
03–111, KVL 03–102, KVL 03–21.
Discussion
The present study is unique in employing stratified
localized sampling of Beauveria isolates, the majority of
which were collected within a period of a few months. The
combined use of phylogenetic and co-dominant population
genetic markers developed for Beauveria enabled a highly
detailed account of their hierarchical genetic diversity
at the Bakkegården site. This study revealed that the
investigated field site (~28 ha) harbours a high local
phylogenetic diversity of Beauveria, including five of six
known European phylogenetic species of Beauveria bassiana
s.s. Within the site, the greatest phylogenetic and genotypic
diversity was obtained from the linear seminatural habitat
of the hedgerow, comprising just 10 × 350 m (0.35 ha).
Phylogenetic diversity and environmental distribution
of Beauveria
A molecular phylogeny of the Beauveria isolates from the
Bakkegården research site identified B. bassiana s.s., B.

© 2009 Blackwell Publishing Ltd

1290 N . V. M E Y L I N G E T A L .
brongniartii, and also Clade C, an undescribed monophyletic
group that is morphologically indistinguishable but
phylogenetically distinct from B. bassiana s.s. (Rehner &
Buckley 2005). Beauveria bassiana s.s. accounted for nearly
90% of all Beauveria isolations, a finding that is consistent
with results of isolate collections spanning larger spatial
scales (Reay et al. 2008; S.A. Rehner, unpublished). Beauveria
bassiana s.s. was partitioned into five phylogenetic species,
an interpretation reinforced by fixed allelic differences
at multiple microsatellite loci assayed. Additionally, the
isolate KVL 03–72, which was a basal a outlier to Eu_1 in
both the nuclear phylogeny and microsatellite neighbour-
joining analysis, had unique alleles at eight microsatellite
loci and thus may represent an additional phylogenetic
species in the B. bassiana s.s. complex. However, because
this divergent isolate is thus far unique to the research site,
additional isolates are needed to resolve its phylogenetic
and taxonomic status.
Beauveria diversity was highest in the seminatural
habitat of the hedgerow, which is likely due to the
greater abundance and diversity of insect hosts, increased
humidity, reduced ultraviolet and long-term environmental
stability as compared to the structurally simpler and more
exposed and disturbed agricultural field. Within the
hedgerow, all seven Beauveria phylogenetic species were
broadly distributed in both the below- and above-ground
habitat compartments. This simultaneous occurrence
of members, including some clones, of similar pathogen
populations below- and above-ground suggests that
the fungi freely circulate between the soil environment,
phylloplanes and infected insects within the hedgerow.
This life cycle for Beauveria was suggested by Meyling &
Eilenberg (2007) and contradicts the conventional view that
these fungi reside principally in the soil. Insect-mediated
dispersal of Beauveria from soil to phylloplanes and resulting
initiation of infections in insects on phylloplanes has been
demonstrated in laboratory settings (Meyling et al. 2006).
In the current study, we found no evidence to suggest that
the dominant Beauveria phylogenetic species specifically
target any particular host species, but instead they
apparently function simultaneously as generalist ento-
mopathogens towards a range of host species in the insect
community in the hedgerow. The rarer phylogenetic
species Eu_3 and Clade C are known to infect a diversity
of insect species outside the research site (S.A. Rehner,
unpublished); however, such observations were not made
in the present study because of limiting sample sizes. It
is therefore likely that Beauveria phylogenetic species
collectively contribute to the structuring of insect com-
munities by mediating apparent competition between
insect host species occupying separate host plants. Such an
indirect effect is known to be mediated by other groups
of natural enemies such as predators and parasitoids (van
Veen et al. 2006).
The Beauveria phylogenetic species in the hedgerow
appear to occupy overlapping niches in the ecosystem.
This sympatric co-existence raises some basic ecological
issues. Species of organisms that occupy similar niches
compete for resources and the most competitive should in
theory exclude the other (Hardin 1960). However, habitat
heterogeneity and spatially structured environments are
predicted to facilitate co-existence of potentially competing
species (Tilman 1994; Wang et al. 2000). Local extinction
and invasion events in patchy environments are predicted
to further promote co-existence of competitors in meta-
populations (Wilson 1992). However, conventional meta-
population theory has been based on organisms occupying
patches in continuous time while many fungi occupy
patches that occur in discrete events during the season
(Gourbiere & Gourbiere 2002). Gourbiere & Gourbiere
(2002) developed a discrete-time metapopulation model
for unit-restricted fungi inhabiting ephemeral units in the
environment, namely leaves and needles, to which the
fungi dispersed by infective spores. Co-existence, both in
the metapopulation of patches or units as well as locally
within units, was possible in this system even with no
trade-off between competitiveness and colonization ability
(Gourbiere & Gourbiere 2002). The model could in principle
be applicable to the present study since insect hosts are
units of resources for the entomopathogenic fungi and
their availability varies with the season. In the present
system, the seminatural habitat of the hedgerow can be
regarded as more structurally heterogeneous with more
available resource units or patches (hosts) than the highly
disturbed environment of the arable field. Spatio-temporal
variation in the availability of the ephemeral resources
would thus facilitate co-existence. However, entomopath-
ogenic fungi within Hypocreales also occur outside infected
hosts in the soil environment for prolonged periods of time
where numerous interactions may occur with other organ-
isms and where the fungi are affected by abiotic factors
(Hajek 1997; Meyling & Eilenberg 2007). Bidochka et al.
(2001, 2002) suggested that the nonpathogenic phase of
these fungi may constitute the most important part of the
life cycle for permanent establishment. Genetic groups of
B. bassiana s.l. isolates from Canadian soil were partitioned
between habitat types defined as agricultural fields and
forests (Bidochka et al. 2002). Furthermore, isolates from
agricultural soil had higher temperature preferences for
growth and were more resistant to ultraviolet-light radiation
than isolates from forest soils (Bidochka et al. 2002). These
observations were consistent with results of an earlier
study of habitat association in Canadian soil isolates of
Metarhizium anisopliae (Bidochka et al. 2001) and these
authors hypothesized that abiotic factors in the environ-
ment therefore select for genotypes that can survive the
specific conditions in the habitat of the fungus. Eu_1 was
the only phylogenetic species of B. bassiana s.s. isolated
© 2009 Blackwell Publishing Ltd
 C O M M U N I T Y C O M P O S I T I O N O F B E A U V E R I A 1291
from agricultural soil in the present study. Eu_1 clustered
with a representative (ARSEF 1628) of a large group of
isolates that are commonly isolated from agricultural
systems throughout Europe (S.A. Rehner, unpublished).
This suggests that the dominance of Eu_1 in habitats
affected by agricultural practices is likely facilitated by
certain factors not present in less-disturbed, naturally
vegetated habitats such as hedgerows, thus supporting the
hypothesis proposed by Bidochka et al. (2001, 2002). This
further indicates that some members of B. bassiana s.s. may
have as yet unidentified niche partitioning and warrants
further investigation.
Co-existence of cryptic phylogenetic species of fungi
with seemingly overlapping niches has been reported for
the plant pathogenic Fusarium oxysporum complex in two
neighbouring pea fields (Skovgaard et al. 2002) and for the
ectomycorrhizal fungus Cenococcum geophilum in individual
soil samples (Douhan & Rizzo 2005). Douhan & Rizzo
(2005) even found that one soil sample contained the same
diversity as detected across North America. As in the
present study, Douhan & Rizzo (2005) suggested that
C. geophilum phylogenetic species may co-exist through
differential occupation of niches. Based on theoretical
models, however, sympatric co-existence even in spatially
structured habitats is only possible if competitors differ
ecologically to some extent (Wang et al. 2005). Future studies
must elucidate if B. bassiana s.s. phylogenetic species
occupy separate ecological niches. This study highlights the
lack of basic knowledge of population structure of hypoc-
realean entomopathogenic fungi despite the long tradition
of research in biological control. Future work must be
dedicated towards the fundamental ecology of Beauveria
communities and the factors structuring these in agricultural
landscapes.
Hedgerows are recognized as important refuges for
farmland biodiversity (Benton et al. 2003). Furthermore,
hedgerow habitats offer structural diversity to organism
groups that cannot survive in the cultivated agricultural
fields (Maudsley 2000). Here we demonstrate that hedge-
rows additionally are reservoirs for multiple Beauveria
phylogenetic species as compared to the cultivated field.
Our findings underscore the possible importance of hedge-
rows as resources promoting biodiversity within agricultural
landscapes.
Mating potential, genetic diversity and reproductive mode
within phylogenetic species of B. bassiana s.s.
Mating types and multilocus microsatellite genotypes
were determined for the five B. bassiana s.s. phylogenetic
species co-occurring at the Bakkegården site to assess their
potential for sexual reproduction and to gain insight into
their genotypic diversity and genetic structure. At the MAT
locus, all isolates were either MAT1 or MAT2, a structural
© 2009 Blackwell Publishing Ltd
organization characteristic of bipolar heterothallic mating
systems of euascomycetes (Coppin et al. 1997; Kronstad &
Staben 1997; Debuchy & Turgeon 2006). Thus, if sexually
competent, all five phylogenetic species are obligately
outbreeding. Among the Bakkegården sample of isolates,
Eu_3, Eu_4, Eu_5 and Eu_6 each were fixed for a single
mating type although limited sample size and possible
strong underlying skew towards one mating type, as
observed in Eu_1, might have prevented the detection of
both mating types in some of the populations. However,
the repeated detection of single mating types in each of
these populations suggests that reproduction is constrained
to asexual modes due to lack of complementary mating
types in this locality. This interpretation is supported by the
low allelic and genotypic diversity and also the clonal
genetic structure in which repeated multilocus genotypes
and/or complexes of closely related genotypes predominated
in all four population samples. Further examination of
these phylogenetic species at progressively broader spatial
scales (e.g. landscape scale) is needed to determine the
geographical range of clonal genotypes. At the same time,
expanded geographical surveys will help to establish
whether or not these phylogenetic species possess the
normal complement of two mating types characteristic
of sexual species and to identify habitats where sexual
reproduction might be expected to occur.
Eu_1 was the only B. bassiana s.s. phylogenetic species in
which both mating types were detected and therefore
the only population with the demonstrated potential for
sexual reproduction at the study site. However, the observed
31:2 (MAT1:MAT2) ratio suggests that sexual reproduction
in this population is infrequent. However, one of the Eu_1
MAT2 isolates, KVL 03–94, carried unique alleles at five
microsatellite loci and thus is either a divergent clone or
possibly a migrant from a different population. On the
other hand, the multilocus genotype of the other Eu_1
MAT2 isolate, KVL 03–79, is fully consistent with the range
of variation among the MAT1 multilocus microsatellite
genotypes and thus is plausibly a member of this population.
The lack of recombinant genotypes could either be due to
sampling error or that sexual reproduction, when it occurs,
preferentially occurs between related individuals, which
could make recombination harder to detect when mates
share allelic states at marker loci. However, the consistent
imbalance in mating type frequencies observed in all five
B. bassiana s.s. populations suggests that a combination of
infrequent sex, perhaps due to reduced sexual competence,
in conjunction with founder effects, genetic drift or selec-
tion, promote skew in mating type frequencies in local
populations. This in turn leads to higher rates of asexual
reproduction and reduced rates of recombination. Fisher et al.
(2005), citing Penicillium marneffei, an asexual mammalian
pathogen endemic to Asia, hypothesized that facultatively
sexual species with low rates of recombination will show
1292 N . V. M E Y L I N G E T A L .
reduced ability to disperse and colonize heterogeneous
environments and hence will show spatial endemism. Such
a model may similarly apply to species of the B. bassiana s.s.
complex.
Conclusion
Multiple phylogenetic species of Beauveria were found to
co-exist in sympatry within the seminatural habitat of the
hedgerow at the Bakkegården field site. Hedgerows in
field margins thus appear to be significant reservoirs of
biodiversity of these entomopathogenic fungi in agricultural
landscapes. The high diversity and the possibility for
sexual recombination in this habitat make it intriguing
to study Beauveria communities in pristine ecosystems,
which harbour a greater diversity of potential niches than
seminatural habitats. Moreover, the striking reduction in
diversity in the adjoining tilled agricultural soils underscores
the need to investigate the ecological adaptations that
affect survival and success of Beauveria in different environ-
ments. This study has brought the understanding of
Beauveria ecology a significant step further and provides
fundamental data that can promote further work at local
scales. Only when we understand the composition and
dynamics locally can effects of biocontrol applications of
entomopathogenic fungi be thoroughly evaluated across a
broader range of spatial scales and ecological contexts.
Acknowledgements
We thank Christina Wolsted for valuable technical assistance in
the field and laboratory. Verner Michelsen kindly identified the
flies included in this study. N.V.M. was funded by a PhD grant
from Faculty of Life Sciences at the University of Copenhagen.
References
Benton TG, Vickery JA, Wilson JD (2003) Farmland biodiversity: is
habitat heterogeneity the key? Trends in Ecology & Evolution, 18,
182–188.
Berretta MF, Lecuona RE, Zandomeni RO, Grau O (1998) Gen-
otyping isolates of the entomopathogenic fungus Beauveria
bassiana by RAPD with fluorescent labels. Journal of Invertebrate
Pathology, 71, 145–150.
Bidochka MJ, Kamp AM, Lavender TM, Dekoning J, De Croos
JNA (2001) Habitat association in two genetic groups of the
insect-pathogenic fungus Metarhizium anisopliae: uncovering
cryptic species? Applied and Environmental Microbiology, 67,
1335 –1342.
Bidochka MJ, Menzies FV, Kamp AM (2002) Genetic groups of the
insect-pathogenic fungus Beauveria bassiana are associated with
habitat and thermal growth preferences. Archives of Microbiology,
178, 531–537.
Castrillo LA, Wiegmann BM, Brooks WM (1999) Genetic variation
in Beauveria bassiana populations associated with the darkling
beetle, Alphitobius diaperinus. Journal of Invertebrate Pathology, 73,
269 –275.
Castrillo LA, Vandenberg JD, Wraight SP (2003) Strain-specific
detection of introduced Beauveria bassiana in agricultural fields
by use of sequence-characterized amplified region markers.
Journal of Invertebrate Pathology, 82, 75–83.
Coates BS, Hellmich RL, Lewis LC (2002) Allelic variation of a
Beauveria bassiana (Ascomycota: Hypocreales) minisatellite
is independent of host range and geographic origin. Genome, 45,
125 –132.
Coppin E, Debuchy R, Arnaise S, Picard M (1997) Mating types and
sexual development in filamentous ascomycetes. Microbiology
and Molecular Biology Reviews, 61, 411–428.
Couteaudier Y, Viaud M (1997) New insights into population
structure of Beauveria bassiana with regard to vegetative
compatibility groups and telomeric restriction fragment length
polymorphisms. FEMS Microbiology Ecology, 22, 175 –182.
Debuchy R, Turgeon BG (2006) Mating-type structure, evolution,
and function in euascomycetes. In: The Mycota. I. Growth, Dif-
ferentiation, and Sexuality (eds Kües U, Fisher R), pp. 293 –323.
Springer-Verlag, Berlin, Germany.
Douhan GW, Rizzo DM (2005) Phylogenetic divergence in a local
population of the ectomycorrhizal fungus Cenococcum geophilum.
New Phytologist, 166, 263 –271.
Elliott SL, Sabelis MW, Janssen A, van der Geest LPS, Beerling
EAM, Fransen J (2000) Can plants use entomopathogens as
bodyguards? Ecology Letters, 3, 228–235.
Fisher MC, Hanage WP, Hoog S et al. (2005) Low effective dispersal
of asexual genotypes in heterogeneous landscapes by the
endemic pathogen Penicilium marneffei. PLoS Pathogens, 1, 2 (e20).
Gaitan A, Valderrama AM, Saldarriaga G, Velez P, Bustillo A
(2002) Genetic variability of Beauveria bassiana associated with
the Coffee Berry Borer Hypothenemus hampei and other insects.
Mycological Research, 106, 1307–1314.
Glare TR (2004) Molecular characterization in the entomopatho-
genic fungal genus Beauveria. Laimburg Journal, 1, 286–298.
Gourbiere S, Gourbiere F (2002) Competition between unit-
restricted fungi: a metapopulation model. Journal of Theoretical
Biology, 217, 351–368.
Hajek AE (1997) Ecology of terrestrial fungal entomopathogens.
Advances in Microbial Ecology, 15, 193 –249.
Hardin G (1960) The competitive exclusion principle. Science, 131,
1292–1297.
Huang B, Li CR, Fan MZ, Li ZZ (2002) Molecular identification of
the teleomorph of Beauveria bassiana. Mycotaxon, 81, 229–236.
Inglis GD, Goettel MS, Butt TM, Strasser H (2001) Use of
hyphomycetous fungi for managing insect pests. In: Fungi as
Biocontrol Agents. Progress, Problems and Potential (eds Butt TM,
Jackson C, Magan N), pp. 23–69. CABI Publishing, Wallingford,
UK.
Keller S, Zimmerman G (1989) Mycopathogens of soil insects.
In: Insect-Fungus Interactions (eds Wilding N, Collins NM,
Hammond PM, Webber JF), pp. 239–270. Academic Press,
London, UK.
Kessler P, Matzke H, Keller S (2003) The effect of application time
and soil factors on the occurrence of Beauveria brongniartii
applied as a biological control agent in soil. Journal of Invertebrate
Pathology, 84, 15 –23.
Kronstad JW, Staben C (1997) Mating type in filamentous fungi.
Annual Review of Genetics, 31, 245–276.
Lewis PO, Zaykin D (2001) Genetic Data Analysis: Computer Program
for the Analysis of Allelic Data. Version 1.0. (d16c). Available from
URL: http://lewis.eeb.uconn.edu/lewishome/software.html.
© 2009 Blackwell Publishing Ltd
 C O M M U N I T Y C O M P O S I T I O N O F B E A U V E R I A 1293
Li Z-Z, Li C-R, Huang B, Fan M-Z (2001) Discovery and demon-
stration of the teleomorph of Beauveria bassiana (Bals.) Vuill., an
important entomogenous fungus. Chinese Science Bulletin, 46,
751–753.
Maudsley MJ (2000) A review of the ecology and conservation of
hedgerow invertebrates in Britain. Journal of Environmental
Management, 60, 65–76.
Maurer P, Couteaudier Y, Girard PA, Bridge PD, Riba G (1997)
Genetic diversity of Beauveria bassiana and relatedness to host
insect range. Mycological Research, 101, 159 –164.
McGuire MR, Ulloa M, Park YH, Hudson N (2005) Biological and
molecular characterisation of Beauveria bassiana isolates from
California Lygus hesperus (Hemiptera: Miridae) populations.
Biological Control, 33, 307–314.
Meyling NV, Eilenberg J (2006a) Occurrence and distribution of
soil borne entomopathogenic fungi within a single organic
agro-ecosystem. Agriculture, Ecosystems and Environment, 113,
336–341.
Meyling NV, Eilenberg J (2006b) Isolation and characterisation of
Beauveria bassiana isolates from phylloplanes of hedgerow
vegetation. Mycological Research, 110, 188–195.
Meyling NV, Eilenberg J (2007) Ecology of the entomopathogenic
fungi Beauveria bassiana and Metarhizium anisopliae in temperate
agroecosystems: potential for conservation biological control.
Biological Control, 43, 145–155.
Meyling NV, Pell JK, Eilenberg J (2006) Dispersal of Beauveria
bassiana by the activity of nettle insects. Journal of Invertebrate
Pathology, 93, 121–126.
Reay SD, Brownbridge M, Cummings NJ et al. (2008) Isolation and
characterization of Beauveria spp. associated with exotic bark
beetles in New Zealand Pinus radiata plantation forests. Biological
Control, 46, 484–494.
Rehner SA, Buckley EP (2003) Isolation and characterization of
microsatellite loci from the entomopathogenic fungus Beauveria
bassiana (Ascomycota: Hypocreales). Molecular Ecology Notes, 3,
409– 411.
Rehner SA, Buckley EP (2005) A Beauveria phylogeny inferred
from nuclear ITS and EF1-alpha sequences: evidence for cryptic
diversification and links to Cordyceps teleomorphs. Mycologia,
97, 84 –98.
Rehner SA, Posada F, Buckley EP et al. (2006) Phylogenetic origins
of African and Neotropical Beauveria bassiana s.1. pathogens of
the coffee berry borer, Hypothenemus hampei. Journal of Invertebrate
Pathology, 93, 11–21.
Samson RA, Evans HC, Latgé JP (1988) Atlas of Entomopathogenic
Fungi. Springer Verlag, Berlin, Germany.
Schuelk M (2000) An economic method for the fluorescent labelling
of PCR fragments. Nature Biotechnology, 18, 233–234.
Skovgaard K, Bodker L, Rosendahl S (2002) Population structure
and pathogenicity of members of the Fusarium oxysporum
complex isolated from soil and root necrosis of pea (Pisum
sativum L.). FEMS Microbiology Ecology, 42, 367–374.
Sung JM (1996) The Insect-Borne Fungi of Korea in Color. Kyo-Hak
Publishing, Seoul, Korea.
Swofford DL (2002) PAUP*: Phylogenetic Analysis Using Parsimony
(*and other methods), Version 4b10. Sinauer & Associates, Sunder-
land, Massachusetts.
Tilman D (1994) Competition and biodiversity in spatially
structured habitats. Ecology, 75, 2–16.
Urtz BE, Rice WC (1997) RAPD-PCR characterization of Beauveria
© 2009 Blackwell Publishing Ltd
bassiana isolates from the rice water weevil Lissorhoptrus opyzo-
philus. Letters in Applied Microbiology, 25, 405– 409.
van Veen FJF, Morris RJ, Godfray HCJ (2006) Apparent competition,
quantitative food webs, and the structure of phytophagous
insect communities. Annual Review of Entomology, 51, 187–208.
Wang C, Fan M, Li Z, Butt TM (2004) Molecular monitoring and
evaluation of the application of the insect-pathogenic fungus
Beauveria bassiana in southeast China. Journal of Applied Micro-
biology, 96, 861–870.
Wang CS, Shah FA, Patel N, Li Z-Z, Butt TM (2003) Molecular
investigation on strain genetic relatedness and population structure
of Beauveria bassiana. Environmental Microbiology, 5, 908–915.
Wang ZL, Zhang JG, Liu XM (2000) Competition and coexistence
in spatially subdivided habitats. Journal of Theoretical Biology,
205, 631–639.
Wang ZL, Zhang DY, Wang G (2005) Does spatial structure facil-
itate coexistence of identical competitors? Ecological Modelling,
181, 17–23.
White JF, Belanger F, Meyer W et al. (2002) Clavicipitalean fungal
epibionts and endophytes- development of symbiotic interactions
with plants. Symbiosis, 33, 201–213.
Wilson DS (1992) Complex interactions in metacommunities,
with implications for biodiversity and higher levels of selection.
Ecology, 73, 1984–2000.
Yokoyama E, Arakawa M, Yamagishi K, Hara A (2006) Phylo-
genetic and structural analyses of the mating-type loci in
Clavicipitaceae. FEMS Microbiological Letters, 264, 182–191.
Zimmermann G (1986) The Galleria bait method for detection of
entomopathogenic fungi in soil. Journal of Applied Entomology-
Zeitschrift für Angewandte Entomologie, 102, 213 –215.
This study was part of the PhD research of Nicolai V. Meyling. His
research interests are ecology of insects and fungal pathogens of
insects, their interactions and identification of factors structuring
their communities. Mette Lübeck’s research focuses on genetic
diversity of fungi, cloning and evaluation of their hydrolytic
enzymes for biomass conversion. Jørgen Eilenberg’s research
focuses on insect pathogenic fungi and bacteria, their role in
regulation of host populations and application in biological control.
Stephen Rehner’s research focuses on the phylogenetic systematics,
biogeography and population genetics of insect-associated fungi,
particularly entomopathogenic species used in insect biological
control.
Supporting Information
Additional Supporting Information may be found in the online
version of this article:
Table S1 Complete list of isolates of Beauveria spp. used in this
study, including their assignment to phylogenetic species, mating
types for Beauveria bassiana s.s. and accession numbers in culture
collections
Please note: Wiley-Blackwell are not responsible for the content or
functionality of any supporting information supplied by the
authors. Any queries (other than missing material) should be
directed to the corresponding author for the article.