Author’s Accepted Manuscript

Antidiabetic effect of Achillea millefollium through

multitarget interactions: α-glucosidases inhibition,
insulin sensitization and insulin secretagogue
activities

Fabiola Chávez-Silva, Litzia Cerón-Romero, Luis

Arias-Durán, Gabriel Navarrete-Vázquez, Julio
Almanza-Pérez, Rubén Román-Ramos, Guillermo www.elsevier.com/locate/jep

Ramírez-Ávila, Irene Perea-Arango, Rafael

Villalobos-Molina, Samuel Estrada-Soto

PII: S0378-8741(17)31467-8
DOI: https://doi.org/10.1016/j.jep.2017.10.005
Reference: JEP11059
To appear in: Journal of Ethnopharmacology
Received date: 12 April 2017
Revised date: 7 October 2017
Accepted date: 7 October 2017
Cite this article as: Fabiola Chávez-Silva, Litzia Cerón-Romero, Luis Arias-
Durán, Gabriel Navarrete-Vázquez, Julio Almanza-Pérez, Rubén Román-Ramos,
Guillermo Ramírez-Ávila, Irene Perea-Arango, Rafael Villalobos-Molina and
Samuel Estrada-Soto, Antidiabetic effect of Achillea millefollium through
multitarget interactions: α-glucosidases inhibition, insulin sensitization and insulin
secretagogue activities, Journal of Ethnopharmacology,
https://doi.org/10.1016/j.jep.2017.10.005
This is a PDF file of an unedited manuscript that has been accepted for
publication. As a service to our customers we are providing this early version of
the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting galley proof before it is published in its final citable form.
Please note that during the production process errors may be discovered which
could affect the content, and all legal disclaimers that apply to the journal pertain.
Antidiabetic effect of Achillea millefollium through multitarget interactions:

-glucosidases inhibition, insulin sensitization and insulin secretagogue

activities

Fabiola Chávez-Silva,a, Litzia Cerón-Romero,a Luis Arias-Durán,a Gabriel

Navarrete-Vázquez,a Julio Almanza-Pérez,b Rubén Román-Ramos,b Guillermo

Ramírez-Ávila,c Irene Perea-Arango,d Rafael Villalobos-Molina,e Samuel Estrada-

Soto.a,*

a
Facultad de Farmacia, Universidad Autónoma del Estado de Morelos,

Cuernavaca, Morelos 62209, México.

b
Laboratorio de Farmacología, Depto. Ciencias de la Salud, D.C.B.S.,

Universidad Autónoma Metropolitana- Iztapalapa, Ciudad de México 09340,

México.
c
Centro de Investigación Biomédica del Sur (IMSS), Xochitepec, Morelos 62790,

México.
d
Centro de Investigación en Biotecnología, Universidad Autónoma del Estado de

Morelos, Cuernavaca, Morelos 62209, México.

e
Unidad de Biomedicina, Facultad de Estudios Superiores Iztacala, Universidad

Nacional Autónoma de México, Tlalnepantla, Estado de México 54090, México.


Taken in part from the PhD Thesis of Fabiola Chávez-Silva
*Corresponding author: Tel/Fax +52 777 329 7089. E-mail address:
enoch@uaem.mx (S. Estrada-Soto).
ABSTRACT

Ethnopharmacological importance: Achillea millefolium L. (Asteraceae) is a

perennial herb used in Mexican folk medicine for treatment of several

pathologies, including inflammatory and spasmodic gastrointestinal disorders,

hepatobiliary complaints, overactive cardiovascular, respiratory ailments and

diabetes.

Aim of the study: To evaluate the potential antidiabetic effect in vivo and to

establish the potential mode of action through in vitro approaches of Achillea

millefolium.

Materials and methods: The antidiabetic effect of hydroalcoholic extract of

Achillea millefolium (HAEAm) was evaluated on the oral glucose tolerance tests,

in normoglycemic and experimental Type 2 diabetic mice models. In addition, we

evaluated the possible mode of action in in vitro assays to determine -

glucosidases inhibition, the insulin secretion and calcium mobilization in RINm5F

cells and PPAR and GLUT4 expression in 3T3-L1 cells.

Results: HAEAm showed significant glucose diminution on oral glucose tolerance

test and in acute experimental Type 2 diabetic assay with respect to the control

(p<0.05). In addition, HAEAm promoted the -glucosidases inhibition by 55% at

1 mg/ml respect to control. On the other hand, HAEAm increased the PPAR

(five-times) and GLUT4 (two-fold) relative expression than control (p<0.05).

Finally, HAEAm significantly increased the insulin secretion and [Ca2+]i

compared with control.

Conclusion: The HAEAm possesses in vivo antidiabetic effect, having such effect

through multitarget modes of action that involve antihyperglycemic (-

glucosidases inhibition), hypoglycemic (insulin secretion) and potential insulin

sensitizer (PPARGLUT4 overexpression) actions.

Keywords: Achillea millefollium; antidiabetic; calcium mobilization; insulin

secretion; insulin sensitization; PPAR.

 1. Introduction

The type 2 diabetes mellitus (T2DM) is a non-transmissible chronic metabolic

disorder of multiple etiologies, characterized by sustained hyperglycemia, and is

the result of inadequate insulin secretion or its defective action, or a combination

of both (Trisha, 2013; Rydén et al., 2007). Recently, the International Diabetes

Federation (IDF) estimated that this disease impacts 415 million people in the

world, and there are 318 millions of adults with impaired glucose tolerance (IDF,

2015), which put them at high risk of developing the disease in the future. In fact,

one of two adults with diabetes is undiagnosed; furthermore, persons with T2DM

suffer a progression of the disease by a combination of several grades of insulin

resistance and relative insulin deficiency. Insulin resistance is caused by

impaired β-cell functioning, which is usually associated with abnormal insulin

secretion or defective action (Shroff, 2016). The classical symptoms of T2DM are

polyuria, polydipsia, polyphagia and lethargy, among others; also T2DM is

associated to some complications such as neuropathy, cardiovascular disease,

nephropathy or retinopathy, and doubled the risk of death compared with healthy

people (Shroff, 2016).

The T2DM´s treatment consists in several drug groups that show different

mechanisms of action, because they act on different therapeutic targets;

however, all of these are focused to reduce and control the glycemia levels and

therefore its complications. These drugs are classified according to their

biological effect as: insulin secretagogue (sulfonylureas, meglitidines, inhibitor

DPP-4, incretinomimetic), insulin sensitizer (biguanides, thiazolidinediones),

antihiperglycemic (acarbose), and inhibitor of glucose recapture (glifozine)

(Chaudhury, 2017). However, despite this diversity of drugs available for

treatment in advanced stages or in uncontrolled diabetic patients, some have to

draw on a combination of two or more drugs with different mechanisms of action

in order to control glucose levels (Nathan et al., 2009). Nevertheless, currently a

lot of people are turning to use at least one type of alternative therapy (one for

every three). In this context, it has been reported that more than 400 herbal

remedies are available for use by diabetics worldwide. Researchers have

suggested that a lot of herbal therapies may have a role in the treatment of

diabetes (Al-Rowais, 2002).

The Achillea millefolium L. (Asteraceae), known as yarrow (milenrrama), is

commonly used in folk medicine for the treatment of inflammatory and spasmodic

gastrointestinal disorders, hepatobiliary complaints, and overactive

cardiovascular and respiratory ailments (Dall’Acqua et al., 2011; Li et al., 2011).

In Mexico, and in different parts of the world, A. millefollium is also used for the

treatment of diabetes and related diseases (Ramírez et al., 2012; Petlevski et al.,

2001; Akram, 2013). Many pharmacological effects reported A. millefolium as

antioxidant (Baggio et al, 2016; Chou et al., 2013), antimicrobial (Candan et al.,

2003), anti-inflammatory (Benedek et al., 2007b), estrogenic (Innocenti et al.,

2007), vasoprotective and bronchodilatory (Dall’Acqua et al., 2011; Koushyar et

al., 2013), gastroprotective (Potrich et al., 2010; Cavalcanti et al., 2006),

hepatoprotective, antispasmodic, calcium antagonist (Yaeesh et al., 2006),

diuretic (de Souza et al., 2013), anxiolytic (Baretta et al., 2012), and glucosidase
and lipase inhibitor (Ramirez et al., 2012). Several A. millefolium constituents

have been reported that include monoterpenes, sesquiterpenes, flavonoids and

phenolic acid derivatives, being the sesquiterpene lactones the chemotaxonomic

marker of this species (Dall’Acqua et al., 2011; Koushyar et al., 2013; Li et al.,

2012).

Thus, current work was designed in order to evaluate the potential in vivo

antihyperglycemic and antidiabetic effects and to establish the in vitro mode(s) of

action of hydroethanolic extract of Achillea millefolium.

2. Materials and Methods

2.1. Chemicals and drugs

Glucose, sucrose, nicotinamide, streptozotocin, pioglitazone and

glibenclamide were acquired from Sigma-Aldrich Co. (St. Louis, MO, USA).

Acarbose and others reagents were purchased from local distributors.

2.2. Plant material collection

Achillea millefolium L. (Asteraceae) was collected in June 2014 in Tres

Marias, Huitzilac, in the State of Morelos, Mexico. The plant material was

collected by Dr. Guillermo Ramirez and identified by Dr. Irene Perea-Arango

(CEIB, UAEM), and was deposited at the CIBIS Herbarium (HUMO Herbarium,

UAEM). The voucher number assigned was 34332.

2.3. Preparation of the Extracts

Plant material (aerial parts) was dried in the shade at room temperature for 20

days. The dry material was ground in mechanical grinder in order to increase the

area of contact with the solvent. Achillea millefolium (500 g) were exhaustively

extracted by maceration for 72 h (three times) with aqueous-ethanol solution

(70%). Later, the maceration was filtered and the liquid extract was obtained,

then solvent was removed on a rotary evaporator until dry extract to obtain

18.6% of yield.

2.4. In vivo studies

2.4.1. Animals

Male CD1 mice (20-25 g) were provided by Facultad de Medicina animal

facilities, from Universidad Autónoma del Estado de Morelos. Animals were

housed in groups of six (n= 6) under laboratory conditions (12 h light/dark cycle,

25±2 ºC and 45–65% of humidity). Before acute experimentation, all animals

were fasted for 16 h with water ad libitum. All animal procedures were conducted

in accordance with the Official Mexican Rules for Animal Experimentation and

Care (SAGARPA, NOM-062-ZOO-1999), ratified by the Institutional Animal Care

and Use Committee of the Universidad Autónoma Metropolitana (Supporting

information), based on US National Institutes of Health Publication #85-23,

revised 1985.
2.4.2. Oral Glucose Tolerance Tests

The normoglycemic mice were randomly divided into three groups (n=6),

Group 1: vehicle (isotonic saline solution), Group 2: hydroalcoholic extract of A.

millefollium (HAEAm, 100 mg/kg), and Group 3: positive control (glibenclamide, 3

mg/kg or acarbose, 3 mg/kg). 30 min after administration of test samples, a dose

of 2 g/kg of substrate (glucose or sucrose) solution was administered to each

mouse. Then, blood samples were collected from the caudal vein at time 0

(before oral administration), 0.5, 1, 1.5, 2 and 3 h after vehicle, positive control

and extract administrations. Blood glucose concentration was estimated using a

commercial glucometer (Accu-Chek, Performa; Roche). The percentage variation

of glycemia for each group was calculated in relation to the initial (0 h) level,

according to the formula: %Variation of glycemia = [(Gx-G0)/G0] x100, where G0

were initial glycemia values, and Gx were the glycemia values at each time,

respectively (Ortiz-Andrade et al., 2008).

2.4.3. Induction of diabetes

Experimental type 2 diabetic mice model was induced as described (Hayashi

et al., 2006). The fasted mice were treated with a single intraperitoneal (i.p.)

injection with freshly prepared streptozotocin (120 mg/kg) dissolved in citrate

buffer (pH 4.5), 15 min after an injection of nicotinamide (20 mg/kg) dissolved in

distilled water. Hyperglycemia was confirmed by the elevated glycemia in

plasma, determined at 72 h. Animals with blood glucose (GLU) concentrations

more than 150 mg/dl were used for the study.

2.4.4. Acute antidiabetic assay

The diabetic mice were randomly divided into five groups (n=6), Group 1:

vehicle (isotonic saline solution), Groups 2, 3 and 4: treatment (HAEAm, 33, 100

and 330 mg/kg, respectively), and Group 5: positive control (glibenclamide, 3

mg/kg). Blood samples were collected from the caudal vein; time 0 was

measured before treatments. Later, blood samples were obtained at 1, 3, 5, and

7 h after vehicle, test samples and positive control administration. Blood glucose

concentration was estimated as mentioned above (Ortiz-Andrade et al., 2008).

2.5. In vitro Assays

2.5.1. -glucosidases Inhibition

This assay was performed according to Ramirez et al. (2012). In the reaction

tube (quadruplicate) were added starch (12.5 mg/ml), the enzymes derived from

a homogenate of Sprague Dawley rats’ intestinal brush border, and 1 mg/ml of

the HAEAm or the hidroalcoholic extract from Camellia sinensis (HAECs), which

was described (positive control) as an -glucosidases inhibitor (Ramirez et al.,

2012), at 37 ºC and incubated for 10 min. Released glucose was quantified by a

glucose oxidase-based clinical reagent (SPINREACT, Girona, Spain), following

manufacturer’s instructions.

2.5.2. RNAm expression of PPAR and GLUT4

In vitro assay was developed in the 3T3-L1 cellular line as reported by

Hidalgo-Figueroa et al. (2013). The fibroblasts were grown in 6-well culture

plates culture using Dulbecco’s modified Eagle’s medium (DMEM),

supplemented with 25 mM glucose, 10% fetal bovine serum, 1 mM sodium

pyruvate, 2 mM glutamine, nonessential amino acids, and 1 mM gentamicin, in a

5% CO2 humidified atmosphere, at 37 °C. After 2 days of incubation (~80%

confluence) the fibroblasts were differentiated to the adipocyte phenotype with

0.5 μM 3-isobutyl-1-methylxanthine, 0.25 μM dexamethasone acetate, and 0.8

μM insulin for 48 h, followed by insulin for 48 h more. The culture medium without

insulin was changed every 2 days during 8 days of differentiation.

To determine the effect of HAEAm on PPAR and GLUT4 expression, the

cells were treated for 24 h with the HAEAm (100 μg/ml). The RNA was isolated

using a TriPure isolation reagent (Invitrogen, Paisley, UK). Total RNA were

analyzed using the ImProm II reverse transcription system (Promega, Madison,

WI, USA), i.e., the reaction was incubated in a thermocycler Select Cycler

(BioProducts, West Palm Beach, FL, USA), following the cycle program:

incubation at 25 °C for 5 min, extension at 42 °C for 55 min. The enzyme was

inactivated at 70 °C, for 15 min, and finally, samples were cooled at 4 °C, for 5
min. Then 1/10 volume of each RT reaction was amplified with SYBR Green

master mix (Roche Molecular Biochemicals, Mannheim, Germany), containing

0.5 μM of customized primers for 36B4 (F- AAGCGCGTCCTGGCATTGTCT; R-

CCGCAGGGGCAGCAGTGGT; Gene Bank Gene Bank NM_007475.2), PPAR

(F-CCAGAGTCTGCTGATCTGCG; R-GCCACCTCTTTGCTCTGCTC; Gene

Bank NM_011146.1), and GLUT4 (F- GATTCTGCTGCCCTTCTGTC; R-

ATTGGACGCTCTCTCTCCAA; Gene Bank NM_009204.2). PCR was

conducted using the following cycling conditions: pre-incubation and denaturation

at 95 °C/10 min. Amplification with 35 or 40 cycles that included: denaturation at

95 °C /10 s with a thermal ramp rate at 20 °C/s; annealing at 61 °C/7 s with a

thermal ramp rate at 20 °C/s; amplification at 72 °C/10 s with a thermal ramp rate

at 20 °C/s. The threshold cycles (Ct) were measured in separate tubes and in

quadruplicate. The melting curve was analyzed at the end of amplification

following SYBER Green kit conditions, as indicated by the company (Roche

Molecular Biochemicals).

Relative changes in the expression level of one specific gene (ΔΔCt) were

calculated as ΔCt of the test group minus ΔCt of the control group, and then

presented as 2_ΔΔCt.

2.5.3. Calcium measurement

RINm5F cells were grown in monolayer culture using RPMI 1640 medium

(glucose 11.1 mM) (GIBCO™), supplemented with 10% fetal bovine serum
(ATCC), 2 mM L-glutamine, 1 mM sodium pyruvate and 2 mg/ml gentamycin

(Invitrogen, CA, US). The cells were grown at 37 °C in disposable plastic bottles

(Nunc™) under a humidified atmosphere of 5% CO2 /95% air. The medium was

replaced twice a week (Miranda-Perez et al., 2016).

After 24 h of culture, the cells were loaded for 30 min with 1 μM of the [Ca2+]i

indicator Fluo-4AM (Molecular Probes, OR, US) in HBSS supplemented with

gentamycin at 10 μg/ml and BSA at 0.1%, later the cells were washed with the

same medium (2 volumes) and allowed to equilibrate. The fluorescence was

measured at 488 nm excitation and 535 nm emission using a confocal

microscope (Zeiss Zen-Sp1, Oberkochen, Germany) with laser scanning. The

images were acquired every second with an exposure time of 20 ms for 10 min at

23 °C. HAEAm (200 μg/ml) were applied before taking 5 images in each

sequence. The sequence files were analyzed using the image analyzer software

ImageJ from the NIH, USA (http://rsb. info.nih. gov/ij). The relative fluorescence

changes (ΔF/Fo) were plotted as a function of time and integrated to determine

the area under the curve. In order to determine the intracellular Ca2+ content, the

method of Bellomo et al. (1982) was used, which is based on the

spectrophotometric measurement of the complex formed by arsenazo III (2,2′-

(1,8-Dihydroxy-3,6-disulfonaphthylene-2,7-bisazo)bisbenzenearsonic acid) and

intracellular free Ca2+. Five μl of cytosolic fraction was taken and 1 ml of the

arsenazo III indicator (30 μl) prepared in 5.0 mM HEPES at pH 7.4 was added.

The complex formed by Arsenazo III-Ca2+ was read at a wavelength of 675 and
685 nm. The intracellular Ca2+ concentration was determined using the following

equation: C = ΔAbs/(ε - ε') 1

Where: C is the intracellular Ca2+ concentration, ΔAbs is 675-685, ε is the

molar extinction coefficient (2.80x104 /cmM) of the Arsenazo III-Ca2+ complex, ε'

is the molar extinction coefficient (0.19x10-4/CmM) of the calcium-free arzenazo

III and 1 is the thickness of the cell. The results are expressed as intracellular

free calcium mole/mg protein.

2.5.4. Measurement of secreted insulin

RINm5F cells were grown to 70–80% confluence in Lab-Tek II eight-well

glass slides and then pre-incubated for 2 h at 37 °C with Krebs-Ringer

bicarbonate HEPES buffer (KRBH, NaCl 135 mM, KCl 3.6 mM, NaHCO 3 5 mM,

NaH2PO4 0.5 mM, MgCl2 0.5 mM, CaCl2 1.5 mM, and HEPES 10 mM, pH 7.4,

and 10% bovine serum albumin, glucose 5.5 mM). The cells were then

stimulated with HAEAm (200 μg/ml) or the positive control glibenclamide (400

μM). Insulin levels were measured with an insulin ELISA kit (ALPCO, Mexico

City, Mexico) and normalized against the total insulin of the islets (Miranda-Pérez

et al., 2016).
2.6. Results presentation and statistical analysis

All values are expressed as the mean ± S.E.M. for in vivo (six mice per group)

or in vitro (by quadruplicate or sixtuplicate in cells or enzymes) studies. Analysis

of variance (ANOVA) was used to analyze changes in the percentage variation of

glycemia, followed by Bonferroni posttests or for in vitro assays was used

ANOVA followed by Dunnett´s multiple comparison test; p<0.05 was considered

statistically significant. SPSS software was used for data analysis.

3. Results and discussion.

In current study, it was determined the potential antidiabetic effect of the

hydroalcoholic extract from Achillea millefollium, a millennial medicinal plant,

which is used in Mexico for the treatment of several diseases, including diabetes

(Ramírez et al., 2012; Petlevski et al., 2001; Akram, 2013). Thus, there are only

some pharmacological studies described for A. millefollium as a potential

antidiabetic agent. To our knowledge, it was reported the antidiabetic effect of

ethanolic extract of A. millefollium on NOD mice (Petlevski et al., 2001), and the

-glucosidase inhibition (Ramírez et al., 2012), and some others; however,

nobody described the potential mode(s) of action of the antidiabetic activity of the

plant. In this context, we decided to determine the antihyperglycemic and

antidiabetic activities of HAEAm on oral glucose tolerance test (OGTT) and

experimental type 2 diabetic mice model.

3.1. In vivo studies

3.1.1. Antihyperglycemic action

First, we performed the oral glucose tolerance test with the purpose to

observe the sugar metabolism after a single oral ingestion of glucose (2 g/kg),

and to obtain evidence of possible mode of action involved in the antidiabetic

effect. In Fig. 1A, it is observed that the HAEAm (100 mg/kg) decreased the

percentage variation of glycemia (p<0.05) at 0.5, 1 and 2 h with respect to the

control. Also, at 3 h the glycemia decreased below basal values. Result suggests

that this effect, along the entire study in normoglycemic mice, could be related

with extrapancreatic and/or pancreatic actions such as insulin sensitizing through

PPAR activation, and/or any other sensitizer mechanism (Torres-Piedra et al.,

2010); or due to inhibition of glucose transporters located in the small intestine

(i.e., SGLT-1 or GLUT2) (Kellett et al., 2008). On the other hand, decreasing

glycemia below vehicle value observed at 3 h (hypoglycemic effect) suggests the

role of pancreas augmenting insulin secretion (Guillausseau et al., 2008).

Second, we performed the oral sucrose tolerance test to determine a possible

reducing postprandial hyperglycemia, after a single load of sucrose (2 g/kg). In

Fig. 1B, it was observed that the HAEAm induces a significant decrease in the

percentage variation of glycemia starting at 0.5 h, and the effect was sustained

throughout the 3 h of experimentation compared with control group (p<0.05). The

decrease of the percentage variation of glycemia is similar to that shown by

acarbose (positive control, 3 mg/kg). This result indicates that the HAEAm

involves an extrapancreatic mode of action, linked to glucose uptake from

intestinal lumen due to inhibition of intestinal -glucosidases complex affecting

carbohydrate digestion, and later absorption and retardation of postprandial

glycemia (Ortiz-Andrade et al., 2008), in addition to the possible synergism with

the effect described in the glucose tolerance test. Furthermore, we observed

again that the extract diminished glycemia below the basal values in

normoglycemic mice, which indicates that the extract could induce hypoglycemia

by increased insulin secretion.

3.1.2. Antidiabetic action

On the other hand, we determined the acute antidiabetic effect of HAEAm in a

STZ-induced diabetic mice model; as observed in Fig. 2, the HAEAm (33, 100

and 330 mg/kg) decreased the glucose levels in diabetic mice (p<0.05), starting

at 30 min and this decrement is sustained throughout the assay (7 h) compared

to control. The effect is dose-dependent; however, it was not statistically

significant (Fig. 2); moreover, the effect shown is similar to that of glibenclamide

(3 mg/kg), the positive control. These results correlate with those observed in the

oral glucose tolerance tests, suggesting that the hypoglycemic effect is possible

due to insulin secretion. In previous work, Zolghadri et al. (2014) established that

ethanolic extract of A. millefolium can decrease the levels of the IL-1 and iNOS,

against the cytotoxic effect induced by STZ on pancreatic β cells, and those

increase insulinemia. Furthermore, since the effect was persistent during all

experiments in OGTT and in the diabetic model, it suggests other mode of action
that is participating as an extrapancreatic contribution, which could induce insulin

sensitization (Ortiz-Andrade et al., 2008; García-Díaz et al., 2016).

3.2. In vitro assays

The results obtained from in vivo assays suggest that the antidiabetic effect of

the extract is related with different modes of action. Then, in order to obtain

evidence of such modes of action, in vitro tests were explored on the potential

antihyperglycemic (α-glucosidases inhibition), hypoglycemic (insulin secretion

and [Ca2+]i mobilization), and insulin sensitizer (expression of PPAR and

GLUT4) actions.

3.2.1. α-glucosidases Inhibition

The α-glucosidases are a complex of enzymes localized in the small intestine

and they hydrolyze (14) chemical bonds of the disaccharides, such as

sucrose and maltose, to generate the monosaccharides glucose and fructose,

which are the only carbohydrates that can be transported into the bloodstream

(Nurul, 2013; Ortíz-Andrade et al., 2007). The inhibition of these enzymes is a

therapeutic target for the treatment of T2DM, since such inhibition delays or

decreases the absorption of carbohydrates lowering the hyperglycemic peak

(Ramirez, 2012; Jiakai, 2014). In current study, we found that HAEAm inhibited

the α-glucosidases activity by 55% at 1 mg/kg with respect to the control, and this
result is similar to that reported by Ramirez et al. (2012). Also, Venditti et al.

(2015) described that the hydroalcoholic extract of A. tenorii, another member of

the Achillea genus, inhibits the α-glucosidases activity of Saccharomyces

cerevisiae (IC50 32.072.2 µg/ml), and authors attribute this activity to the high

content of flavonoids such as luteolin, which is an α-glucosidase noncompetitive

inhibitor (Yan et al., 2014). Later results suggest that luteolin is one of the

compounds responsible of the inhibitory activity showed by HAEAm, in addition

to some other flavonoids existing in A. millefolium (Benedek et al., 2007).

Nonetheless, based on the weak inhibitory activity showed by HAEAm, this mode

of action is not the most important for the extract to induce its antidiabetic action;

even though it can contribute to the control of hyperglycemia diminishing glucose

and fructose blood levels after food consumption.

3.2.2. Expression PPAR and GLUT4

In vivo studies showed that on OGTT HAEAm significantly diminished the

hyperglycemic peak, and then plasma glucose levels were efficiently decreased.

Also, basal values were reached at 2.0 h and 2.5 h, respectively (Fig. 1).

Moreover, in the antidiabetic activity on diabetic mice, the extract showed

significant effect at 0.5 h after treatment which was maintained up to 7 h (Fig. 2).

Both results suggest a mode of action probably linked with insulin sensitizing,

which could be related to PTP1B inhibition (Ramírez-Espinosa et al., 2011),

11HSD1 inhibition (Torres-Piedra et al., 2010), PPAR activation (Hidalgo-

Figueroa et al., 2013), among others. Thus, we decided to explore the possible

PPAR/GLUT4 overexpression as a putative mode of action of the antidiabetic

activity showed by HAEAm. PPAR is a member of the subfamily of nuclear

receptors and is predominantly expressed in adipose tissue (Wang, 2010; Larsen

et al., 2003), such that this activation induces expression of liable genes for fatty

acid transportation, storage and adipogenesis, besides it regulates the

production of adiponectin, resistin and tumor necrosis factor α (TNF-α) (Wang,

2010). In addition, increase of PPAR in adipose tissue augments GLUT4

(Fernyhough et al., 2007; Anandharajan et al., 2005), which is an insulin-

responsive glucose transporter located in muscle cells and adipocytes (insulin-

sensitive tissues) (Fernyhough et al., 2007). This nuclear receptor is an important

target in the treatment of T2DM, being and insulin sensitizer. In this sense,

pretreatment with HAEAm (24 h) increases (p<0.05) PPAR RNAm relative

expression (five-times) compared with control, which is even greater than the

expression induced by pioglitazone (Fig. 4A) in 3T3-L1 adipocytes. In accord,

there is correlation with overexpression of GLUT4 (about two-fold) with respect to

control, resembling that of pioglitazone (Fig. 4B). These findings suggest that

HAEAm probably induces its antidiabetic action through PPAR/GLUT4 pathway

enhancing insulin sensitivity, promoting the expression of genes of glucose

metabolism, such as GLUT4, allowing glucose transportation into the cell

resulting in its decrease in blood. On the other hand, Zolghadri et al. (2014)

reported that the ethanolic extract of A. millefolium significantly decreased IL-1β

and iNOS genes expression in STZ-induced diabetic rats. Those findings could
be related with PPAR activation, of which evidence exist that it decreases

inflammatory cytokines (IL-6, TNF-α, IL-1β, IL-10, IL-12 and gelatinase B), and

decrease expression of iNOs and scavenger receptor A genes (Clark, 2002).

3.2.5. Insulin secretion and calcium measurement

Finally, as observed in oral sucrose/glucose tolerance tests, HAEAm lowered

plasma glucose below baseline values (about 20-30%), which suggest a possible

hypoglycemic action. Thus, we decided to explore the insulin secretion and

changes in the free cytosolic [Ca2+]i, as another mode of action involved in the

extract’s antidiabetic action, taking into account that insulin is synthesized and

secreted in response to various stimuli (aminoacids, neurotransmitters,

hormones and glucose) (Joshi et al., 2007). In this context, glucose is

physiologically the most important stimulus that triggers a series of events

involving closure of ATP-sensitive K+ channels, following by increase in cytosolic

[Ca2+]i fundamental for insulin secretion (Martínez, 2000; Miranda-Perez et al.,

2016; Guillausseau et al., 2008). As observed in Fig. 5A, the cells treated with

HAEAm (200 μg/ml) significantly increased insulin secretion (5.3 ng/ml) than

control (4.4 ng/ml), similar to that of glibenclamide. Moreover, in Fig. 5B it is

described that the cells treated with HAEAm significantly promoted [Ca2+]i rise

(about 4.9-times) compared to control, and it was similar to glibenclamide. In this

context, several reports shown that polar extracts (methanolic, hydroalcoholic

and aqueous) of A. millefolium protects against the destructive effects of alloxan

and STZ in the β-cell (Zolghadri et al., 2014; Mustafa et al., 2012), and Zolghadri

et al. (2014) associated said effect with higher insulin level and lower glucose

level in STZ-diabetic rats. Other investigations have shown that A. santolina

decreases the oxidative damage to pancreatic tissue, and restores plasma

insulin levels (Yazdanparast et al., 2007). These results allowed us to observe

the correlation existing between insulin secretion, change in the free cytosolic

[Ca2+]i, and hypoglycemic effect observed in the in vivo assays, and also suggest

that insulin secretion is one of the modes of action involved in the antidiabetic

effect of HAEAm. However, further experiments are necessary to clarify the

change in the free cytosolic [Ca2+]i and the mode of action responsible for the

insulin secretion.

4. Conclusion

The HAEAm possesses in vivo antidiabetic effect, having such effect

through multitarget modes of action that involve antihyperglycemic (-

glucosidases inhibition), hypoglycemic (insulin secretion) and potential insulin

sensitizer (PPARGLUT4 overexpression) actions (Fig. 6). Further molecular

experiments are necessary to corroborate these findings.

Conflict of Interest

The authors have no conflict of interest to declare. Author contributions to the

paper were as follows: study design, coordination and in vivo studies: S. Estrada-

Soto and G. Navarrete-Vázquez; in vitro insulin and intracellular calcium

determination: F. Chávez-Silva and L. Cerón-Romero; preparation of the extracts

and in vivo studies F. Chávez-Silva and L. Arias-Durán; RT-PCR from in vitro

3T3-L1 cells studies F. Chávez-Silva, J.C. Almanza-Pérez and R. Román-

Ramos; plant material collection and identification and -glucosidases inhibition

determination: R. Villalobos-Molina, G. Ramírez-Ávila, F. Chávez-Silva and I.

Perea-Arango; preparation and writing of the manuscript F. Chávez-Silva, S.

Estrada-Soto, G. Navarrete-Vázquez and R. Villalobos-Molina; Finally, all

authors contributed to the writing and revised the manuscript.

Acknowledgements

We are grateful to M.C. Roberto Lazzarini Lechuga, María Elizabeth

Miranda-Pérez and Molecular Biology Divisional Laboratory (UAM-Iztapalapa) for

their technical assistance. This work was supported by SEP-CONACYT

(Proyecto de Ciencia Básica CB-2011-01 No. 167044). F. Chávez-Silva

acknowledges the fellowship awarded by CONACyT (378047) to carry out

graduate studies, and acknowledges the fellowship awarded by FOMIX (2013-

1#224038) for the short research stay at UAM-Iztapalapa.

References

Al-Awwadi, N.A.J., 2013. Antidiabetics effect of Achillea santolina aqueous

leaves extract. Int. J. Med. Plants. Res. 4, 151-156.

Al-Rowais, N.A., 2002. Herbal medicine in the treatment of diabetes mellitus.

Saudi. Med. J. 23, 1327-1331.

Anandharajan, R., Jaiganesh, S., Shankernarayanan, N.P., Viswakarma, R.A.,

Balakrishnan, A., 2005. In vitro glucose uptake activity of Aegles marmelos

and Syzygium cumini by activation of GLUT4, PI3 kinase and PPAR in L6

myotubes. Phytomedicine. 13, 434–441.

Akram, M. 2013. Minireview on Achillea millefolium Linn. J Membrane Biol 246,

661-663.

Baggio, C., Otofuji, G.M., Freitas, C.S., Mayer, B., Marques, M.C., Mesia-Vela,

S., 2016. Modulation of antioxidant systems by subchronic exposure to the

aqueous extract of leaves from Achillea millefolium L. in rats. Nat. Prod. Res.

30, 613-615.

Baretta, I.,P., Felizardo, R., A.,Bimbato, V., F., dos Santos, M., G., Kassuya, C:,

A., Gasparotto Junior, A, da Silva C., R., de Oliveira, S:, M., Ferreira, J,

Andreatini, R., 2012. Anxiolytic-like effects of acute and chronic treatment

with Achillea millefolium L. extract. J. Ethnopharmacol. 140, 46– 54.

Bellomo, G., Jewell, S.A., Thor, H., Orrenius, S., 1982. Regulation of intracellular

calcium compartmentation: studies with isolated hepatocytes and t-butyl

hydroperoxide. Proc. Natl. Acad. Sci. 79, 6842-6846.

Benedek, B., Gjoncaj, N., Saukel, J., Kopp, B., 2007a. Distribution of Phenolic

Compounds in Middleeuropean Taxa of the Achillea millefolium L.

Aggregate. Chem. biodivers. 4.

Benedek, B., Kopp, B., Melzig, M.F., 2007b. Achillea millefolium L. s.l. – Is the

anti-inflammatory activity mediated by protease inhibition?. J.

Ethnopharmacol. 113, 312–317.

Candan, F., Unlu M., Tepe, B., Daferera, D., Polissiou, M., Sökmen, A., Akpulat,

H., 2003. Antioxidant and antimicrobial activity of the essential oil and

methanol extracts of Achillea millefolium subsp. Millefolium Afan.

(Asteraceae). J. Ethnopharmacol. 87, 215–220.

Cavalcanti, A. M., Baggio, C.H., Freitas, C. S., Rieck, L., de Sousa, R. S., Da

Silva-Santos, J.E., Mesia-Vela, S., Marques, M.C., 2006. Safety and

antiulcer efficacy studies of Achillea millefolium L. after chronic treatment in

Wistar rats. J. Ethnopharmacol. 107, 277-84.

Chaudhury, A., Duvoor, C., Dendi, V.S., Kraleti, S., Chada, A., Ravilla, R., Marco,

A., Shekhawat, N.S., Montales, M.T., Kuriakose, K., Sasapu, A., Beebe, A.,

Patil, N., Musham, C.K., Lohani, G.P., Mirza, W., 2017. Clinical Review of
 Antidiabetic Drugs: Implications for Type 2 Diabetes Mellitus Management.

Front. Endocrinol. 8, 1-12.

Clark, R.B., 2002. The role of PPARs in inflammation and immunity. J. Leukoc.

Biol. 71, 388-400.

Chou, S.T., Peng, H.Y., Hsu, J.C., Lin, C.C., Shih, Y., 2013. Achillea millefolium

L. essential oil inhibits lps-induced oxidative stress and nitric oxide

production in RAW 264.7 macrophages. Int. J. Mol. Sci. 14, 12978-12993.

Dall’Acqua, S., Bolego, C., Cignarella, A., Gaion, R. M., Innocenti, G., 2011.

Vasoprotective activity of standardized Achillea millefolium extract.

Phytomedicine. 18, 1031–1036.

de Souza, P., Crestani, S., Vilhena da Silva R. de C., Gasparotto, F., Leite

Kassuya, C. A, da Silva-Santos, J. E., Arquimedes Gasparotto, J., 2013.

Involvement of bradykinin and prostaglandins in the diuretic effects of

Achillea millefolium L. (Asteraceae). J. Ethnopharmacol. 149, 157–161.

Fernyhough, M.E., Okine, E., Hausmanc, G., Vierck, J.L., Dodsona, M.V., 2007.

PPAR and GLUT4 expression as developmental regulators/markers for

preadipocyte differentiation into an adipocyte. Domest. Anim. Endocrinol. 33,

367–378.

García-Díaz, J.A., Navarrete-Vázquez, G., García-Jiménez, S., Hidalgo-

Figueroa, S., Almanza-Pérez, J.C., Alarcón-Aguilar, F.J., Gómez-Zamudio,

J., Cruz, M., Ibarra-Barajas, M., Estrada-Soto, S., 2016. Antidiabetic,

 antihyperlipidemic and anti-inflammatory effects of tilianin in streptozotocin-

nicotinamide diabetic rats. Biomed. Pharmacother. 83, 667–675.

Guillausseau, P.J., Meas, T., Virally, M., Laloi-Michelin, M., Medeau, V.,

Kevorkian, J-P., 2008. Abnormalities in insulin secretion in type 2 diabetes

mellitus. Diabetes. Metab. 34, S43-S48.

Hayashi, K., Kojima, R., Ito, M., 2006. Strain differences in

the diabetogenic activity of streptozotocin in mice. Biol. Pharm. Bull. 29,

1110-1119.

Hidalgo-Figueroa, S., Ramírez-Espinosa, J.J., Estrada-Soto, S., Almanza-Pérez,

J.C., Román-Ramos, R., Alarcón-Aguilar, F.J., Hernández-Rosado, J.V.,

Moreno-Díaz, H., Díaz-Coutiño, D., Navarrete-Vázquez G., 2013. Discovery

of thiazolidine-2,4-dione/biphenylcarbonitrile hybrid as dual PPAR 

modulator with Antidiabetic Effect: In vitro, In Silico and In Vivo approaches.

Chem. Biol. Drug. Des. 81, 474–483.

IDF Diabetes Atlas, 2015, seventh edition. http://www.diabetesatlas.org/

(accessed 03.04.17)

Innocenti, L.G., Vegeto, E., Dall’Acqua, S., Ciana, P., Giorgetti, M., Agradi, E.,

Sozzi, A., Fico, G., Tome, F., 2007. In vitro estrogenic activity of Achillea

millefolium. Phytomedicine. 14, 147–152.

Joshi, S.R., Parikh, R.M., Das, A.K., 2007. Insulin History, Biochemistry,

Physiology and Pharmacology. J. Assoc. Physicians. India. 55, 19-25.

Kellett, G.L., Brot-Laroche, E., Mace, O.J., Leturque, A., 2008. Sugar Absorption

in the Intestine: The Role of GLUT2. Annu. Rev. Nutr. 28, 35–54.

Koushyar, H., Koushyar, M.M., ByramI, G., Feizpour, A., Golamnezhad, Z.,

Boskabady, M.H., 2013. The effect of hydroethanol extract of Achillea

millefolium on β‑adrenoceptors of guinea pig tracheal smooth muscle.

Indian. J. Pharm. Sci. 400-405.

Larsen, T.M., Toubro, S., Astrup, A., 2003. PPARgamma agonists in the

treatment of type II diabetes: is increased fatness commensurate with long-

term efficacy?. Int. J Obes. Relat. Metab. Disord. 27, 147-161.

Li, Y., Zhang, M. L., Cong, B., Wang, S. M., Dong, M., Sauriol, F., Huo, C.H., Shi,

Q.W., Gu, Y.C., Kiyota, H., 2011. Achillinin A, a cytotoxic guaianolide from

the flower of Yarrow, Achillea millefolium. Biosci. biotechnol. Biochem. 75,

1554-1556.

Li, Y., Zhu, M.C., Zhang, M.L., Wang, Y.F., Dong, M., Shi, Q.W., Huo, C.H.,

Sauriol, F., Kiyota, H., Gu, Y.C., Cong, B., 2012. Achillinin B and C, new

sesquiterpene dimers isolated from Achillea millefolium. Tetrahedron. Lett.

53, 2601-2603.

Martínez, S. M., 2000. Mecanismos moleculares que intervienen en la regulación

de la síntesis de insulina por glucosa. Revista del Hospital General Dr.

Manuel Gea González. 3,118-120. In Spanish

Miranda-Perez, M. E., Ortega-Camarillo, C., Escobar-Villanueva, M. C., Blancas-

Flores, G., Alarcon-Aguilar, F. J., 2016. Cucurbita ficifolia Bouché increases

insulin secretion in RINm5F cells through an influx of Ca2+ from the

endoplasmic reticulum. J. Ethnopharmacol. 188,159–166.

Mustafa, K.G., Ganai, B.A., Akbar, S., Dar, M.Y., Masood, A., 2012. -Cell

protective efficacy, hypoglycemic and hypolipidemic effects of extracts of

Achillea millifolium in diabetic rats. Chin. J. Nat. Med. 10, 185-189.

Nathan, D.M., Buse, J.B., Davidson, M.B., Ferrannini, E., Holman, R.R., Sherwin,

R., Zinman, B., 2009. Medical management of hyperglycemia in type 2

diabetes: a consensus algorithm for the initiation and adjustment of therapy.

Diabetes. Care. 32, 193-203.

Nurul, I., Hyun, A.J., Hee, S.S., Hye, M.K., Jae, S.C., 2013. Potent -glucosidase

and protein tyrosine phosphatase 1B inhibitors from Artemisia capillaris.

Arch. Pharm. Res. 36, 542–552.

Ortiz-Andrade, R. R., Sánchez-Salgado, J. C., Navarrete-Vázquez, G., Webster,

S. P., Binnie, M., García-Jiménez S., León-Rivera, I., Cigarroa-Vázquez P.,

Villalobos-Molina, R., Estrada-Soto, S., 2008. Antidiabetic and toxicological

evaluations of naringenin in normoglycaemic and NIDDM rats. Diabetes.

Obes. Metab. 10, 1097–1104.

Ortiz-Andrade, R.R., García-Jiménez, S., Castillo-España P., Ramírez-Ávila G.,

Villalobos-Molina, R., Estrada-Soto, S., 2007. -Glucosidase inhibitory

 activity of the methanolic extract from Tournefortia hartwegiana: An anti-

hyperglycemic agent. J. Ethnopharmacol. 109, 48–53.

Petlevski, R., Hadzija, M., Slijepcevic, M., Juretic, D., 2001. Effect of 'antidiabetis'

herbal preparation on serum glucose and fructosamine in NOD mice. J.

Ethnopharmacol. 75,181-184.

Potrich F.B., Allemand, A., da Silva, L.M., Dos Santos, A.C., Baggio, C.H.,

Freitas, C.S., Mendes, D.A., Andre E., Werner, M.F., Marques, M.C., 2010.

Antiulcerogenic activity of hydroalcoholic extract of Achillea millefolium L.:

Involvement of the antioxidant system. J. Ethnopharmacol. 130, 85–92.

Ramírez, G., Zavala, M. Pérez, J., Zamilpa, A., 2012. In vitro screening of

medicinal plants used in México as antidiabetics with glucosidase and lipase

inhibitory activities. Evid. Based. Complement. Alternat. Med., 1-6.

Ramírez-Espinosa, J.J., Rios, M.Y., López-Martínez, S., López-Vallejo, F.,

Medina-Franco, J.L., Paoli, P., Gamici, G., Navarrete-Vázquez, G., Ortiz-

Andrade, R., Estrada-Soto, S., 2011. Antidiabetic activity of some pentacyclic

acid triterpenoids, role of PTP-1B: in vitro, in silico and in vivo approaches.

Eur. J. Med. Chem. 46, 2243-2251.

Rydén, L., Standl, E., Bartnik, M., Van den Berghe, G., Betteridge, J., de Boer,

M.J., Cosentino, F., Jönsson, B., Laakso, M., Malmberg, K., Priori, S.,

Ostergren, J., Tuomilehto, J., Thrainsdottir, I., Vanhorebeek, I., Stramba-

Badiale, M., Lindgren, P., Qiao, Q., Priori, S.G., Blanc, J.J., Budaj, A.,
 Camm, J., Dean, V., Deckers, J., Dickstein, K., Lekakis, J., McGregor, K.,

Metra, M., Morais, J., Osterspey, A., Tamargo, J., Zamorano, J.L., Deckers,

J.W., Bertrand, M., Charbonnel, B., Erdmann, E., Ferrannini, E.,Flyvbjerg, A.,

Gohlke, H., Juanatey, J.R., Graham, I., Monteiro, P.F., Parhofer, K., Pyörälä,

K., Raz, I., Schernthaner, G., Volpe, M., Wood, D., 2007. Guidelines on

diabetes, pre-diabetes, and cardiovascular diseases: executive

summary. Eur. Heart. J. 28, 88–136.

Shroff, G., 2016. Therapeutic potential of human embryonic stem cells in type 2

diabetes mellitus. World. J. Stem. Cells. 8, 223.

Trisha, Dunning, AM., 2013. Brief Overview of diabetes the disease. Diabetes

Education: Art, Science and Evidence.

Torres-Piedra, M., Ortiz-Andrade, R., Villalobos-Molina, R., Singh, N., Medina-

Franco, J.L., Webster, S.P., Binnie, M., Navarrete-Vázquez, G., Estrada-

Soto, S. 2010. Comparative study of flavonoid analogues on streptozotocine

nicotinamide induced diabetic rats: Quercetin as a potential antidiabetic

agent acting via 11–Hydroxysteroid dehydrogenase type 1 inhibition. Eur. J.

Med. Chem. 45, 2606-2612.

Venditti, A., Maggi, F. Vittori, S., Papa, F., Serrilli, A.M., Di Cecco, M., Ciaschetti,

G., Mandrone, M., Poli, F., Bianco, A., 2015. Antioxidant and -glucosidase

inhibitory activities of Achillea tenorii. Pharm. Biol. 53, 1505–1510.

Wang, Y.X., 2010. PPARs: diverse regulators in energy metabolism and

metabolic diseases. Cell. Res. 20, 124-137.

Yaeesh S, Jamal Q, Khan AU, Gilani AH., 2006. Studies on hepatoprotective,

antispasmodic and calcium antagonist activities of the aqueous-methanol

extract of Achillea millefolium. Phytother. Res. 20, 546–551.

Yan, J., Zhang, G., Pan, J., Wang, Y., 2014. -Glucosidase inhibition by luteolin:

Kinetics, interaction and molecular docking. Int. J. Biol. Macromol. 64, 213–

223. Yazdanparast, R., Ardestani, A., Jamshidi, S., 2007. Experimental

diabetes treated with Achillea santolina: Effect on pancreatic oxidative

parameters. J. Ethnopharmacol. 112, 13–18.

Zolghadri, Y., Fazeli, M., Kooshki, M., Shomali, T., Karimaghayee, N., Dehghani

M., 2014. Achillea Millefolium L. Hydro- Alcoholic Extract Protects Pancreatic

Cells by Down Regulating IL- 1 and iNOS Gene Expression in Diabetic

Rats. Int. J. Mol. Cell. Med. Autumn. 3, 255-262.

List of Figures.

Fig. 1. Effect of hydroalcoholic extract of Achillea millefolium (HAEAm) on blood

glucose levels after a single oral load of 2 g/kg of glucose (A), and after a single

oral administration of 2 g/kg of sucrose (B) in male normoglycemic CD1 mice.

Each plot represents the meansS.E.M. for six independent experiments. *p <

0.05 compared with control.

Fig. 2. Effect of multiples doses (33, 100, 330 mg/kg) of hydroalcoholic extract of

Achillea millefolium (HAEAm) on blood glucose levels in streptozotocin-

nicotinamide-induced diabetes mice model. Each plot represents the

meansS.E.M. for six independent experiments. *,&,#p < 0.05 compared with

control.

Fig. 3. Effect of the hydroalcoholic extracts from Achillea millefolium in the in vitro

α-glucosidases inhibition model. The results represent the meansS.E.M. for four

independent experiments. *p < 0.05 compared with control.

Fig. 4. Effect of hydroalcoholic extract of Achillea millefolium (HAEAm) on mRNA

expression of (A) PPAR and (B) GLUT4 in differentiated 3T3L-1 adipocytes,

measured by RT-PCR and normalized to 36B4 from control. The results

represent the meansS.E.M. for six independent experiments. *p < 0.05

compared with control.

Fig. 5. Effect of hydroalcoholic extract from Achillea millefolium (HAEAm) on

insulin secretion (A) and [Ca2+]i in RINm5F cells (B). The results represent the

meansS.E.M. for four independent experiments. *p < 0.05 compared with

control.

Fig. 6. Graphic diagram that outlines the different modes of action of the

hydroalcoholic extract of A. millefollium (HAEAm) to support the conclusion

developed.

Figure 1.
Figure 2.
Figure 3.
Figure 4.
Figure 5.
Figure 6.

HAEAm

Graphical Abstract