Sayyed Jilani A02

Mutations causing Deletions may increase RFP Gene Expression

Abstract:
Site-Directed Mutagenesis (SDM) is a process that introduces a mutation in the DNA sequence
that leads to a change in the genetic material. This procedure can allow for the analysis of the structure
and biological activity associated with the gene by measuring the change in protein activity. A promoter
region (P1) and Red Fluorescent Protein (RFP) coding region were combined through ligation. SDM was
set up to mutate the P1 region so that a significant difference could be perceived between a mutated
product and a non-mutated one. Primer 268 introduced the mutation that caused a deletion in the spacer
region. Primer 278 caused a substitution in the coding region which changed the amino acid Methionine
to Isoleucine. Since a large portion of the spacer region was being deleted, it was hypothesized that there
would be a significant change in RFP expression since the distance between the -35 and the -10 sequence
was being decreased. It was hypothesized that the substitution on the other hand might affect the
wavelength of the light emitted by RFP due to a change in an amino acid. But from sequencing it was
deduced that only Primer 268 caused a mutation. It was determined that the fluorescence per cell
increased from the control when SDM was caused by Primer 268 while there was not a significant
difference in fluorescence per cell between the control and SDM in plasmid caused by Primer 278.
The change in gene expression depends on the success of the mutation resulting from SDM. It
can be inferred that primer design is crucial when it comes to the success of SDM. From the SDM that
worked, we saw an increase in RFP fluorescence when a deletion took place in the spacer region. To
deduce more effects of just deletion on gene expression different sites should be targeted. It is important
to understand what regions may lead to an increase and what regions may cause a decrease in expression.

Introduction:
Mutations can arise in processes like DNA replication when wrong nucleotides are added by the
DNA polymerase when replicating a DNA strand. The main goal of the experiment is to introduce a
mutation through SDM, which changes the DNA sequence of the P1-RFP recombinant gene. To
introduce the SDM, synthetic DNA fragments called primers were needed to be designed to introduce the
mutation by choice [1]. In an SDM that introduces substitution, one of the nucleotides in the forward
primer is exchanged for the nucleotide that would result in the required substitution. In the process of
completing the complementary strand guided by the primer, a substitution is created. In the process of
deletion, the forward and reverse primers are aligned in such a way that a deletion of nucleotides can
occur.
The reporter gene, RFP can allow to quantify the change in the protein expression as it provides
a physical result through absorbance and emission of light of certain wavelength and as such the mutation
introduced could be analyzed. The SDM mutation introduced allow us to vary the gene expression of RFP
and we expect a significant difference between mutated RFP and unmutated RFP protein. Using
Sequencing to verify the mutation in the DNA structures and measuring RFP emission.
Transcription factors are affected when the -10 and -35 regions are targeted. These sequences act
as a guide for the RNA polymerase which requires sigma factor that comes in direct contact with the two
coding sequences. SDM that caused the deletion within the spacer region would directly affect the two
regions. The SDM that causes substitution however alters a nucleotide within the coding region and might
lead to a change in the protein structure due to a change in amino acid.
Roger Tsien has been credited for the discovery of the Green Fluorescent Protein (GFP).
Different variants of the protein like the blue fluorescent protein were discovered by mutating amino
acids. Further mutations have shown to have shifted the emission wavelengths of the protein from the
wild type expression [3]. The mutations we introduced could lead to the development of different variants
of the RFP and be potentially used as biological markers.
Sub-experiments were carried out to determine the effect of primer concentration on Polymerase
chain reaction (PCR) and to find the optimal primer concentration required for the best yield [4]. To
understand the effect of primers, it is important to understand PCR which consists of three stages, the first
Sayyed Jilani A02

one being denaturing. In this stage, the hydrogen bonds of the double stranded DNA are broken, forming
a single strand. The second stage, annealing requires primers that bind to the single stranded DNA and act
as a guide for the DNA polymerase, Taq Polymerase is used as it can withstand high temperatures, in the
third stage of extension so that the complementary strand is completed. The three stages are repeated for
about thirty cycles, yielding multiple copies of the DNA template. It was hypothesized that an increase in
primer concentration would increase the amplification of the PCR product but only up to a certain
amount, after which the primers would be in excess and might lead to contamination through the
formation of primer dimers. The second sub-experiment tested the Ligation efficiency, which measures
the ability for a vector to take in an insert fragment. It was tested by varying the insert:vector ratio as well
as by varying the presence of stuffer, the fragment cut out from the P1 plasmid to make room for RFP,
which can religate back into P1. It was hypothesized that the 2:1 ratio of insert:vector with no stuffer
would yield the most efficient ligation. Having more insert than the vector itself means that the insert is
more likely to ligate with the vector, and the lack of stuffer means the fragment would not religate back
and thus would not block the RFP insert. The ligation reactions were used to transform, the ability of cells
to take in vector, competent DH5a cells and test our hypothesis.

Materials and Methods [1]:

The RFP and P1 plasmids were isolated from bacteria and grown overnight at 37°C in a liquid
culture with ampicillin. Using the QIAprep Alkaline Lysis MiniPrep kit, the plasmids were extracted and
purified (protein debris and RNA were removed). An agarose gel electrophoresis was run to confirm the
extraction and the purity of the plasmids and their concentrations were determined using a nanodrop.
The RFP gene and P1 region were amplified using PCR. The sub-experiment which measured the
effect of primer concentrations on PCR was carried out along with the amplification of the genes. The
recipe used for control PCR is as follows: 2X Go Taq mastermix, 0.2µM primers and 2ng/µL plasmid
DNA. The primers used for the PCR were diluted with deionized water to give a range of concentrations.
Four separate PCR reactions were set up: a positive control -0.2µM primer concentration, two varying
primer concentrations – 0.4µM and 0.8µM and a negative control - 0µM. The obtained PCR products
were run on an Agarose gel electrophoresis. The different bands of the PCR products from the gel
obtained were analyzed both qualitatively and by using image studio lite. The program allowed for the
quantification of PCR products by comparing them to a known standard (HindIII ladder).
After cleaning up the P1 and RFP DNA segments that were amplified from PCR, their ends were
digested by the addition of restriction enzymes (RE). P1 digestion made use of the RE Spe1 and Pst1
while RFP digestion made use Pst1 and Xba1. The digestion reactions were incubated for two hours at
37°C. To prep for the second sub-experiment, the contents from the P1 digestion was split at 1:2.5.
Stuffer was removed from the P1 plasmid that contained more P1. To check for the success of the
digestions, agarose gel electrophoresis was used.
The two sequences were ligated together to form a recombinant plasmid by using T4 DNA ligase.
This procedure led to the second sub-experiment that tested the ligation efficiency. Four ligation reactions
were set up: 1) RFP and P1 with stuffer with a 1:1 ratio was set, 2) RFP and P1 without stuffer with a 1:1
ratio, 2) RFP and P1 with stuffer with a 2:1 ratio was set, 3) RFP and P1 without stuffer with a 2:1 ratio
was set. Each of the ligation plasmids were introduced into competent DH5a cells. Each of the mixture
was plated on an agar plate containing ampicillin so that transformation could be quantified. Along with
the ligation reactions, a positive control which was made of a plasmid called pGEM and a negative
control, which only had water with the DH5a cells, were also plated. The transformations were analyzed,
and P1-RFP was extracted from a colony and set up in a liquid culture. The extracted plasmid was
purified using the QIAprep plasmid extraction protocol and the purity was recorded using a nanodrop.
NEB Q5 Site-Directed Mutagenesis Kit was used to design primers that would introduce the
SDM on the extracted P1-RFP. The extracted plasmid was used as a template in a PCR along with the
designed primers. Primer 268 had an annealing temperature of 56°C while Primer 278 had an annealing
temperature of 60°C.
Sayyed Jilani A02

Primer 268 - Forward = 5’ TATAATATGTGGATACTAGAGAAAG 3’

Reverse = 5’ TGTCAACTCTAGAAGCGG 3’

Primer 278 - Forward = 5’ cttatATGCGCTTCAAGGTGCGT 3’

Reverse = 5’ atcttCGCTGCTTGCCATTGAAAC 3’

The PCR products extracted were checked by using Agarose Gel Electrophoresis. A KLD
treatment which contains Kinase, Ligase and DpnI was set. Kinase phosphorylates the ends of the linear
DNA product and ligase allows the ends to ligate to form a circular DNA. DpnI digests the template DNA
as it is methylated. The products were plated on Agar plates for a transformation and a liquid culture that
isolated the transformed P1-RFP was set overnight. To confirm that the bacteria is carrying the desired
mutations, P1-RFP with primer 268, P1-RFP with primer 278 and P1-RFP from the liquid cultures were
streaked on a single agar plate. The plate was divided into thirds so that all the cultures could be streaked
on one plate. After the colonies grew on the plate, they were each isolated and extracted using the
QIAPrep Alkaline Lysis Miniprep protocol and were confirmed by being run on an Agarose Gel
Electrophoresis along with a NEB supercoiled plasmid ladder. The three samples were also run on a
nanodrop to check for their purity. 50ng/µl aliquots of each of the three plasmids were created and sent
out for sequencing. From the sequencing data, BLAST was used to determine if a mutation occurred in
the RFP region. Bacteria containing the plasmids were extracted and transferred into water. The resulting
mixtures were put in a 96 well plate and using a fluorometer, the fluorescence excitation emission and cell
densities were measured and analyzed to determine our hypothesis.

Results:
To determine the purity and concentrations of the initial P1 and RFP plasmids that were extracted from
the liquid culture, a nanodrop was used. From the RFP Plasmid a concentration of 70.0 ng/µL was
obtained while an A260/A280 value of 1.93 was obtained. Two replicates of P1 plasmids were obtained
with the first one’s concentration being 64.2 ng/µL and an A260/A280 value of 1.87. A concentration of
44.1 ng/µL and an A260/A28 value of 1.88 were obtained from the second replicate.

The sub-experiment determining the effect of Primer

concentration on PCR amplification was carried out. Figure 1
displays the Agarose Gel image obtained after the PCR reaction
varying the Primer concentration was carried out. Image Studio
Lite was used to obtain
Sayyed Jilani A02

Figure 2 displays the agarose gel obtained after

digestion reactions were set. The distance moved by
each band can be determined and compared to prove
the success of digestion.

The second sub-experiment determined which ligation condition would result in the greatest
transformation efficiency. To obtain a large sample size to make the results statistically viable, multiple
groups carried out the sub-experiment and inputted the data they obtained on a shared spreadsheet. Table
1 presents the averages calculated from each ligation condition.
Sayyed Jilani A02

Figure 3 displays the averages as a bar

graph for comparison. An ANOVA test
was used to determine if there was a
significant difference between the
Ligation conditions and the results are
displayed in Table 2. Table 3 displays a
Post Hoc test done on the different
ligation conditions, allowing for
comparison.

Our main experiment introduced an SDM in the

recombinant P1-RFP through primer design. Prior to
sending the recombinant plasmids and the control out
for sequencing after cleaning the samples, nanodrop
data was measured. The control, P1-RFP, had a
concentration of 102.8 ng/µL and an A260/280 value
of 1.87. For the recombinant plasmid that had an
SDM due to primer 268, a concentration of 50.6
ng/µL and an A260/280 value of 1.99. Plasmid
corresponding to primer 278 had a concentration of
75.5 ng/µL and an A260/280 value of 1.88.
Sayyed Jilani A02

In order to determine the success of the recombinant DNA extraction, an

Agarose Gel Electrophoresis was run. Figure 4 displays the gel. A NEB
supercoiled ladder was used as the three samples being compared were
supercoiled post KLD treatment.

Table 4 below displays primer name and the corresponding mutation it

theoretically would cause as determined by the primer design. Figure 5
below it displays the BLAST for the actual mutation the resulted from
Primer 268. The BLAST compares the sequence from the unmutated P1-
RFP to the mutated P1-RFP from Primer 268. A BLAST for Primer 278
was unobtainable.

The fluorescence per cell was calculated from the shared spreadsheet using the data from Fluorescence
and cell density. Data was shared as multiple groups were using our primers and all groups made use of a
control. An average was taken for each plasmid and plotted as a bar graph for comparison – Figure 6.
Sayyed Jilani A02

An ANOVA was carried out to determine if the data being used from the shared spreadsheet shows a
significant difference. The results for the ANOVA are displayed in Table 5. A Post Hoc test was carried
out to determine significance between the plasmids and the data is presented in Table 6. For both sets of
data, Fluorescence per cell was calculated for each data set and used in the two statistical tests.
Sayyed Jilani A02

Discussion
Our overall experiment focused on SDM but relied heavily on two major procedures – PCR and
ligation. This allowed us to set up two sub-experiments. Since we varied the primer concentration, it was
hypothesized that PCR amplification would increase with primer concentration but only up to a certain
point, after which the desired amplified product would decrease. Primers are a vital component in PCR as
they regulate amplification by acting as a guide for Taq Polymerase to act on. For this to occur, they must
first bind to a DNA single strand. When there is an excess amount of primers, a primer can bind onto
another primer to form a primer dimer. For Primer dimers to form, primers don’t necessarily have to bind
to each other completely. Even binding of a few nucleotides can lead to a primer dimer. If a primer dimer
were to be amplified, the desired DNA product would not be obtained as it is competing against the
primer dimer replication. Figure 1 from the results section displays the data obtained from the sub-
experiment. The figure shows an increase in PCR product as the primer concentration increased. Since
previous studies have shown that our hypothesis has some scientific merit [4], we can conclude that the
range of primer concentration used was too small. If a larger primer concentration was being tested, we
could’ve seen the effect that was hypothesized. Further testing of this sub-experiment should allow for the
determination of the optimal primer concentration required for the greatest PCR amplification.
The ligation reactions set tested the efficiency of ligation reactions. Ligation was the procedure
that introduced the RFP into the P1 plasmid to obtain the recombinant plasmid. The goal was to find the
optimal experimental configuration. Prior to the ligation, restriction enzymes were used to digest the P1
and the RFP plasmid on their respective multiple cloning sites (MCS). Complementary sticky ends were
formed so that the insert could ligate to P1 upon the addition of T4 ligase. Figure 2 displays the gel that
proves the success of the digestions. An undigested plasmid is supercoiled whereas a digested plasmid is
linear. When the two samples are run on a gel, we expect the supercoiled DNA to move further ahead
than a linear one due to its compactness. From the figure, we see that the undigested P1 moved further
down the digested one. The same result was seen when comparing digested RFP to undigested RFP. To
see the presence of a stuffer with the P1, we were expecting to see more than one band. But this was not
observed. It was hypothesized that the 2:1 insert to vector ratio with no stuffer would yield the greatest
ligation efficiency. By having more insert than the vector, the probability of the insert being introduced
into the vector would increase. The absence of stuffer fragment in the reaction mixture would mean, that
the stuffer would not religate back into the P1 plasmid when T4 DNA ligase is introduced.
Transformations were set so ligation efficiency could be quantified. Average transformation efficiency
was calculated from a larger pool of data obtained from a shared spreadsheet. Figure 3 presents that the
greatest ligation efficiency was obtained from 1:1, no stuffer configuration. The figure also presented that
the 2:1 with stuffer resulted in a greater ligation efficiency than with the 2:1 no stuffer configuration. The
data obtained disproves our hypothesis. But due to a large standard error between the different conditions,
the integrity of the data obtained comes into question. An ANOVA and a Post Hoc test were used to
determine if the data being used was significant and was not obtained due to chance. Since the p-values
obtained for both of the tests were greater than 0.05, as seen in Tables 2 and 3, we can conclude that the
data being used resulted by chance and no significant difference was seen between the ligation reactions.
The statistical results obtained makes our sub-experiment inconclusive. We can conclude that since the
data was obtained by a number of students, there is a possibility that resource limitation could have
influenced the data pool. To obtain conclusive results, it is important to do this experiment on a larger
scale. Having multiple replicates for the condition should increase the probability of success.
Using the procedures from the sub-experiments, SDM’s were introduced. The primers designed
influenced the coding region of the P1-RFP recombinant DNA by introducing deletions and a
substitution. The deletion, as introduced by Primer 268, was supposed to delete 17 nucleotides from the
spacer region. This would decrease the distance between -10 and -35 sites, that make up the promoter
region. It was predicted that a smaller distance between the two regions would result in tighter binding of
RNA polymerase due to the sigma factor recognition. The inducing of transcription factors would result
in a higher expression of RFP (greater fluorescence per cell). The substitution on the other hand, Primer
278, only substituted a single nucleotide and ended up changing a Methionine to an Isoleucine. Since the
Sayyed Jilani A02

coding region was being altered, and regions like RBS and -10 and -35 sites were being omitted, it was
deduced that there would not be a change in activity due to transcriptional and translational factors.
Instead it was hypothesized that the change in amino acid might lead to a change in protein structure –
contributing to a change in wavelength of absorbance and emission. As seen in Figure 5, only the
mutation due to primer 268 was successful. From Figure 6, it can be inferred that the deletion in the
spacer region due to Primer 268 did end up increasing the gene expression, whereas there was no
significant change between the fluorescence per cell from the control P1-RFP and the P1-RFP mutated by
Primer 278. The results obtained from the figure are in line with the previous findings. Statistical analysis
in the form of an ANOVA test and a Post Hoc test was carried out to determine if the data obtained was
due to chance and if there is a significant difference. The ANOVA test as well as the Post Hoc test, as
seen in Tables 5 and 6, presented that p > 0.05 and as such there wasn’t a significant difference between
the mutations and the control. This could signify that the data being used was obtained by chance.
Although some of the data obtained demonstrated that there was a significant change, Figure 6, the
statistical analysis prevented us from forming a conclusion.
It was hypothesized that a significant change would be seen in the recombinant plasmid that
underwent multiple deletions. This was proven to be correct from the BLAST data obtained. Since a
single nucleotide mutation was not observed, it can be concluded that SDM is more likely to be
successful when multiple nucleotides are being targeted. From the statistical analysis, it was seen that
there wasn’t a significant change in RFP emission for both primers. To further improve the data, it would
not be advised to carry out the experiment on a larger scale due to the limitations in resources and
complications that could arise from the analysis. Due to the higher success rate in mutation, limiting
resources on SDM’s that introduce deletions should be the next step. Testing deletion on different coding
regions should yield results that might demonstrate a significant change. Being able to statistically prove
the results should be the first step in developing different variants of RFP.

References:

[1] Butler, M. Mel, S. and McDonnell, L., BIMM 101 Recombinant DNA Lab Manual. Macmillan Learning
Curriculum Solutions, Plymouth, MI.
[2] Carter, P. “Site-directed mutagenesis.” Biochemical Journal 237.1 (1986): 1-7 Print.
[3] Heim, R. and Tsien, R., “Engineering Green Fluorescent Protein for Improved Brightness, Longer Wavelengths
and Fluorescence Resonance Energy Transfer.” Current Biology, vol. 6, no.2, 1 Feb. 1996. pp. 178-182.
[4] Markoulatos, P. Siafakas N. Moncany, M., “Multiplex Polymerase Chain Reaction: A Practical Approach.”
Journal of Clinical Laboratory Analysis, Vol. 16, No 1 Print.