Professional Documents
Culture Documents
Human Proton Oligopeptide Transporter POT Genes
Human Proton Oligopeptide Transporter POT Genes
org/)
Submitted February 25, 2000; accepted May 11, 2000; published June 7, 2000
Christopher W. Botka, Thomas W. Wittig, Richard C. Graul, Carsten Uhd Nielsen, Wolfgang Sadée
Departments of Biopharmaceutical Sciences and Pharmaceutical Chemistry, University of California San Francisco, San
Francisco, California, USA
ABSTRACT Purpose: The proton-dependent in spleen, placenta, lung, leukocytes, and heart. These
oligopeptide transporters (POT) gene family results suggest considerable complexity of the human
currently consists of ~70 cloned cDNAs derived from POT gene family, with relevance to the absorption
diverse organisms. In mammals, two genes encoding and distribution of cephalosporins and other peptoid
peptide transporters, PepT1 and PepT2 have been drugs.
cloned in several species including humans, in
addition to a rat histidine/peptide transporter INTRODUCTION
(rPHT1). Because the Candida elegans genome
contains five putative POT genes, we searched the Small peptides and peptidelike drugs are often too
available protein and nucleic acid databases for polar to cross lipid bilayers by simple diffusion.
additional mammalian/human POT genes, using Therefore, translocation across membranes depends
iterative BLAST runs and the human expressed on transport by a suitable carrier, and orally
sequence tags (EST) database. The apparent human administered peptoid drugs would be poorly absorbed
orthologue of rPHT1 (expression largely confined to unless transported (1). The main intestinal
rat brain and retina) was represented by numerous H+/dipeptide transporter protein, PepT1, is thought to
ESTs originating from many tissues. Assembly of play a critical role in oral bioavailability of
these ESTs resulted in a contiguous sequence peptidelike drugs (2-7). hPepT1 is a member of a
covering ~95% of the suspected coding region. The well defined small gene family, the proton-dependent
contig sequences and analyses revealed the presence oligopeptide transporters (POT, also referred to as
of several possible splice variants of hPHT1. A PTR), with ancestral roots that can be traced to
second closely related human EST-contig displayed bacterial, fungal, and plant peptide transporters (8-
high identity to a recently cloned mouse cDNA 11). This class of secondary active transporters has
encoding cyclic adenosine monophosphate (cAMP)- broad selectivity for di- and tripeptides, whereas
inducible 1 protein (gi:4580995). This contig served ability to transport longer peptides decreases
to identify a PAC clone containing deduced exons drastically with increasing length. Most of the POT
and introns of the likely human orthologue (termed members share a common structural architecture with
hPHT2). Northern analyses with EST clones ~12 predicted transmembrane domains (TMDs), but
indicated that hPHT1 is primarily expressed in among the dipeptide transporters in distant phyla,
skeletal muscle and spleen, whereas hPHT2 is found variations on this theme do occur. We have
confirmed the transmembrane topology of at least a
portion of the main intestinal transporter, hPepT1,
using an epitope tagging approach (12).
Corresponding author: Wolfgang Sadee, Department of
Biopharmaceutical Sciences and Pharmaceutical
Until recently, only two POT genes had been
Chemistry, University of California San Francisco, San
identified in mammalian species, PepT1 and PepT2,
Francisco, California, USA. 94143-0446.
the main renal peptide transporters (6,13). cDNA’s of
sadee@cgl.ucsf.edu
1
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
the respective human orthologues have been cloned Whereas rPHT1 is mainly expressed in rat brain and
(orthologue refers to the same gene in different retina, the identity and tissue distribution of its
species) (13,14). These transporters display human orthologue remain unknown. We have found
overlapping, broad substrate selectivity and interact numerous human ESTs that on the basis of high
with numerous drugs, some with chemical structures sequence identity among them appear to represent the
quite distinct from peptides. Substrates include human orthologue of the rat transporter gene rPHT1.
important drug classes, such as β-lactam and Many of these ESTs were isolated from tissues other
cephalosporin antibiotics, renin inhibitors, ACE than brain, eg, human colon carcinoma, suggesting
inhibitors, and 5'-nucleoside esters of amino acids, that the tissue distribution of this gene product in
such as valcyclovir (15). humans might differ from that in rat. This finding
cautions against assuming that only one H+/dipeptide
With a few exceptions, single amino acids are not transporter is expressed in a tissue of interest.
substrates. In 1997, a third cDNA was cloned, Nakanishi et al (1997) have postulated the presence
encoding the rat peptide-histidine transporter, rPHT1 of a distinct peptide carrier in a human fibrosarcoma
(16), with use of sequence alignments of POT cell line (17). To understand peptide transport, all
members with the expressed sequence tags (EST) relevant genes need to be identified and
database. Currently cloned mammalian POT cDNAs characterized.
and deduced proteins are summarized in Table 1.
Comprehensive sequence analysis reveals the we show results obtained from a bioinformatics
presence of at least five possible members of the POT analysis of the available databases, supplemented by
family in C elegans (this report). Therefore, one assays of gene expression in human tissues.
would expect several POT genes to exist in the
human genome, in addition to hPepT1 and hPepT2. To find all members of a gene family, we have
Because the POT family shares limited sequence developed a Java-based program, which iteratively
similarity with other transporter families, any newly searches sequence databases for homologous genes
identified sequences with significant similarity to using BLAST. Called INCA (iterative neighborhood
POT proteins are likely to be members of the POT cluster analysis;
family. Therefore, our overall objective was to http://itsa.ucsf.edu/~gram/home/inca/), this program
identify all human homologues of the POT family identifies a complete cluster of sequence neighbors in
and determine their tissue distribution. In this study, the database (18). By applying INCA to search the
2
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
nonredundant protein sequence database and the lowest E value (highest similarity). Thus, a first
subsequently the human EST database for novel pass with multiple iterative BLASTs identifies all
dipeptide transporters, we have identified two new known protein sequences belonging to the POT
human genes as possible members of POT and family, regardless of the starter sequence. In a second
several ESTs representing candidate genes of pass, we used this entire neighborhood cluster,
additional human peptide transporters of the POT performing BLAST with each sequence, to scan the
family. A greater repertoire of the dipeptide human EST database (BLAST, database: ‘human
transporter gene family in humans must be ests’). EST clones represent individual mRNA
considered in the interpretation of pharmacological species extracted from target tissues and converted to
studies with peptoid drugs and could also serve for cDNAs that are then subcloned and partially
targeting drugs to specific tissues. Moreover, sequenced. Upon completion of the second INCA
sequence variations in these transporters could pass, the program tabulates the results with each EST
account for interindividual genetic differences in the assigned to the protein sequence giving the lowest E
disposition of peptoid drugs. value. Thereby, INCA provides a simple and
exhaustive means of finding all relevant ESTs and
METHODS assigning them to their most closely related protein
sequence in the core cluster of POT sequences. This
Iterative Neighborhood Cluster Analysis (INCA) facilitates the search for new genes that might be
using BLAST represented by ESTs in the accessible databases.
3
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
4
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
Table 2. Iterative BLAST analysis using INCA (18). The protein sequence of hPepT1 served as the starter sequence for
pass 1 searching the nr protein databases, and two iterations were done. The core cluster contains all sequences
scoring with Expect values E < 10-6. These are numbered 1-63, or with a second number to indicate the ranking order
of a newly added sequence in iteration 2 (eg, 42.41). Underlining indicates human core sequences; bold-face indicates
multi-drug efflux transporter in POT core cluster; bold-face with italics indicates putative C elegans transporters. In
pass 2, each of the 68 members of the core cluster was run against the human EST database, and the results tabulated
such that the identified ESTs were listed with the core sequence providing the highest score. Note the inclusion of a
bacterial drug-resistance transporter in the protein core cluster (bold-face); this sequence would have identified more
members of the core cluster in a third iteration (not done here). These include bacterial drug resistance transporters
which are currently listed outside the core cluster. Putative POT members from C elegans are shown in bold-face with
italics. Further, note that the human ESTs mainly cluster with sequences 11 (hPepT2), 50 (rPHT), and 51 (mouse cAMP-
inducible 1 protein).
INCA parameters: pass = 1, iterations 2, similar = 0.0, significant = 1.0E-6, minimum = 0.0, maximum = 10.0. PROGRAM
= blastp, DATALIB = nr; ran BLAST 64 times, found 596 total neighbors, 68 inside cluster. Scores include the No. bits and
the E value (see http://www.ncbi.nlm.nih.gov/BLAST/)
5
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
6
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
7
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
Pass = 2, iteration = 1, similar = 0.0, significant = 1.0E-6, minimum = 0.0, maximum = 10.0. PROGRAM = tblastn,
IPROGRAM = tblastx, DATALIB = est_human. Ran BLAST 68 times, found 125 total neighbors, 73 inside cluster, 52
outside cluster.
Relationship of POT Family to Other Transporters However, continued deposition of new sequences has
enlarged the POT family and general databases
Earlier INCA runs had yielded similar results but considerably. This could result in the discovery of
with fewer sequences in the core cluster. The same links to other transporter families possibly related to
analysis performed a year earlier revealed only 46 POT in evolution. Indeed, the recent INCA run
core sequences and converged after two iterations; shown in Table 2 identified a distinct sequence with
that is, further iterations did not reveal any new E < 10-6 belonging to the family of bacterial drug
sequences scoring with E < 10-6. This had suggested resistance transporters, a multidrug-efflux transporter
that the POT family shows rather unique sequence of Campylobacter (Table 2, core cluster; bold-face
characteristics, with no sequence from other type). To avoid including numerous multidrug-efflux
transporter families scoring with E = 10-6 or lower. transporters with the POT core family in a third
9
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
iteration of BLAST, Table 2 contains only two The core cluster of POT sequences contains one
iterations. A number of these drug-resistance additional human sequence, namely, erythroid
transporters of the major facilitator type transporter differentiation-related factor 2 (sequence 42.41,
family appear in the list of neighbor sequences Table 2). The E value (4 × 10-9) suggests probable
outside the core cluster (Table 2). Several distinct homology to a putative POT transporter of Bacillus
types of transporters reach E values of ~10-5 (eg, the subtilis (sequence 42; 13 predicted TMDs). However,
bile acid transporter gi/1381596 [sequence 48.52, this sequence is rather short (107 residues), showing
Table 2], and the hexuronate transporter Af015825 good sequence similarity with TMD11 and adjacent
[sequence 63.49] reported earlier (24)). These results loop of the B subtilis transporter. More studies are
support the supposition that the peptide transporter needed to discover the biological relevance of this
family POT is indeed related in evolution to other finding.
transporter families. We will pursue these
relationships to better understand the structure and In summary, the INCA analysis of the protein
evolution of the peptide transporter family. sequence databases revealed the presence of 4
mammalian sequences as probable members of POT:
Search for New POT Members PepT1, PepT2, PHT1, and cAMP-inducible 1 protein
(the latter two termed PHT1 and PHT2 in our
The core cluster contains 5 putative POT genes from nomenclature).
the completely sequenced genome of C elegans
(Table 2, bold-face and italics). Each of these Second Pass INCA: Scanning the Human EST
deduced proteins has high similarity to hPepT1. This Database
finding suggests that the human genome may also
contain more POT members than are currently All 68 sequences in the core cluster (Table 2) served
cloned. in a second INCA pass to search the human EST
database. The resultant list of core ESTs (E < 10-6),
Table 2 includes a number of deposited sequences sorted by highest similarity to one of the 68 core
encoding the main intestinal and renal transporters, protein sequences, is also included with Table 2.
hPepT1 (sequences 1-3) and hPepT2 (sequence 12), Curiously, no EST scored best with PepT1, presumed
and their orthologues in other mammalian species. to be the main intestinal transporter in rodents and,
The pH sensing regulatory factor of peptide by inference, in humans (intestinal ESTs may be
transporter (sequence 20) (25) appears to represent a underrepresented in the available EST databases).
possible truncated splice isoform of hPepT1. Also Further, seven ESTs assorted with the cloned human
shown in the core cluster of Table 2, the rat hPepT2; however, it remains to be seen whether all
peptide/histidine transporter (rPHT1) (sequence 50; E seven are indeed representatives of hPepT2. With E
= 5 × 10-50 against hPepT1) is adjacent to a new scores exceeding 10-10, it is possible that these ESTs
sequence with high similarity to it, namely the mouse with moderate similarity could represent distinct
cAMP-inducible protein 1 (sequence 51). The latter genes or splice variants (not analyzed further).
was recently cloned from a lymphoid cell line and Numerous human ESTs scored best with the rat
had not been suspected to belong to the POT family peptide histidine transporter, rPHT (sequence 50),
(26). We will demonstrate below that both rPHT1 and with mouse cAMP-inducible 1 protein (sequence
and mouse cAMP-inducible 1 protein have apparent 51). We therefore assembled these ESTs into
human orthologues, which we will term hPHT1 and contiguous sequences to identify the respective
hPHT2, respectively. This suggests that rPHT1 and human orthologous gene products, termed hPHT1
mouse cAMP-inducible 1 protein represent two and hPHT2.
distinct but closely related genes belonging to the
POT family. In the human EST core cluster (Table 2), two single
ESTs scored best with putative peptide transporters
from bacteria (sequences 42 and 48 of the core
10
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
proteins of POT). Additional analysis will be presumed human orthologue of rPHT1 (hPHT1) and
required to ascertain whether the respective human of cAMP-inducible 1 protein (termed here hPHT2)
genes suggested by these two ESTs could represent (cutoff E value ~10-20). For comparison, Table 3 also
yet additional members of the human POT gene displays the ESTs assigned to hPepT2, whereas no
family. ESTs appeared to represent hPepT1. The tissue
source of the numerous ESTs representing hPHT1 is
hPHT1 and hPHT2 Sequences Assembled from of considerable interest because in the rat, rPHT
Human ESTs expression is largely confined to the brain and retina.
Yet, the hPHT1-related ESTs derive from many body
Scanning the human EST database, we have tissues, including colon carcinoma. This raises the
identified numerous ESTs that appear to represent the possibility that hPHT1 is broadly expressed in many
human orthologues of rPHT and cAMP-inducible 1 human tissues.
protein. Table 3 lists the ESTs firmly assigned to the
Table 3. ESTs from BLAST (blastn) assigned to hPepT2, hPHT1, and hPHT2. Criteria of inclusion for alignments are
>90% identity in sequences longer than 60 bps.
11
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
Approximately 50 ESTs served to assemble a contig sequencing errors, but in a few cases a variation
DNA sequence of the presumed hPHT1 nucleotide occurs more than once at the same location. These
sequence Figure 1A and Figure 1B; Table 4). A variations increase the probability that a genetic
schematics of the hPHT1 contig assembly Figure 1A variant might be involved. The contig sequence is
contains the minimum number of EST’s spanning the closely related to that of rPHT1; however, the first
length of the deduced hPHT1 sequence. To view the ~50 5'-terminal base pairs are missing. (It appears
EST coverage of each segment, click on the that there is a rare NotI site at the 5'-end, which could
EST/region of interest. This will reveal segments have caused truncation during preparation for EST
with numerous overlapping ESTs. Because multiple sequence analysis.) Thus, the EST contig is likely to
ESTs cover the same regions of hPHT1, one can represent >95% of the coding region of hPHT1. The
deduce possible sequence variations in the human deduced hPHT1 amino acid sequence is shown in
population where EST sequences are not identical. Table 4.
Clearly, many of these variations may be due to
12
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
Table 4. Deduced amino acid and nucleotide sequences of hPHT1 and hPHT2
13
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
14
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
GTCATTGTGGCAGTCCTGGAGATGGAGCGCTTACACTACATCCACCACAACGAGACCGTG
TCCCAGCAGATTGGGGAGGTCCTGTACAACGCGGCACCACTGTCCATCTGGTGGCAGATC
CCTCAGTACCTGCTCATTGGGATCAGTGAGATCTTTGCCAGCATCCCACTGGAGTTTGCC
TACTCAGAGGCCCCGCGCTCCATGCAGGGCGCCATCATGGGCATCTTCTTCTGCCTGTCG
GGGGTGGGCTCACTGTTGGGCTCCAGCCTAGTGGCACTGCTGTCCTTGCCCGGGGGCTGG
CTGCACTGCCCCAAGGACTTTGGGAACATCAACAATTGCCGGATGGACCTCTACTTCTTC
CTGCTGGCTGGCATTCAGGCCGTCACGGCTCTCCTATTTGTCTGGATCGCTGGACGCTAT
GAGAGGGCGTCCCAGGGCCCAGCCTCCCACAGCCGTTTCAGCAGGGACAGGGGC
15
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
the middle of hPHT1 Figure 1B, Variant B; for RT- GT is called the splice donor and AT is called the
PCR results see Figure 5A). Some of the putative splice acceptor.
hPHT1 splice variants may introduce a frame shift
and would not be expected to result in a functionally
active transporter. These variants need to be cloned
individually and tested experimentally. The
information presented here is therefore important for
guiding cloning efforts to produce functional hPHT1
protein.
Genomic hPHT2 Sequence. Figure 2. Predicted hPHT2 gene structure (A). Click on
the introns and exons to view genomic sequence
The human EST contig sequence corresponding to rat
cAMP-inducible 1 protein served to scan the human The deduced cDNA coding sequence and protein
nr nucleotide databases. This revealed a PAC clone sequence are shown in Table 4. Table 5 lists the
(P1-derived artificial chromosome) containing human identities and similarities among the protein
genomic sequences closely related to the mouse sequences of the main mammalian members of the
cDNA-encoding cAMP-inducible 1 protein. Using POT family. While hPepT1 and hPEPT2 represent
the cDNA sequence of cAMP-inducible 1 protein, we one branch of this family, hPHT1, hPHT2, rPHT, and
were able to identify the likely introns and exons mouse cAMP-inducible 1 protein are closely related
representing the presumed hPHT2 gene Figure 2; and form a second branch. hPHT1 has 89% identity
click on the introns and exons to display DNA to rPHT1, while hPHT2 is 81% identical to mouse
sequence). Each of the intron-exon boundaries are cAMP-inducible 1 protein. Multiple sequence
flanked by GT. . . AG in the intron sequence. Thus, alignments are provided in Figure 3, including either
the intron structure follows the GT-AG rule, where the PHT branch only (3A), or both branches (3B).
Hydropathy analysis corroborates the close similarity After completion of this work, a cDNA sequence
within the PHT and PepT1 branches of the POT nearly identical to hPHT2 was deposited by K.
family Figure 4A. These hydropathy profiles predict Ishiabshi and M. Imai: AB020598, Homo sapiens
the presence of 11-12 transmembrane domains, as mRNA for peptide transporter 3, complete cds, 2113
reported earlier. Topological predictions are shown in bps in length. This defines the 3' and 5' ends of
Figure 4B for hPHT1 and hPHT2. hPHT1 as having a coding sequence of 1740 bps. The
16
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
deduced putative cDNA coding sequence is the repeat fragment. The remainder of the cDNA
identical length of the coding sequence suggested by sequence was identical to that of hPHT2, except for
our genomic hPHT2 sequence, and it is identical to an insertion of three nucleotides each in three
hPHT2 over a large portion of the presumed coding different locations of hPHT2 (at positions 837, 1271,
region. However, there are also several remarkable and 1428 of hPHT2). These sequence variations
differences. First, a fragment of 50 bps in the hPHT2 would indicate the presence of three additional amino
coding region from position 61-110 is replaced in the acids at these respective positions, without disturbing
cloned cDNA by a 50-bp fragment of low complexity the overall reading frame. It remains to be seen how
(cg-rich), which is excluded from BLAST analysis by these changes from our deduced coding sequence
a low complexity filter. This 50-bp cDNA fragment came about and whether they are of functional
did not recognize any sequence in the PAC clone significance. In any case, comparing the cDNA and
containing the hPHT2 genomic sequence, but it did genomic sequences reveals many details of the
recognize fragments in a number of unrelated genes, possible protein structure not available otherwise.
therefore, possibly representing a low complexity
repeat fragment. The remainder of the cDNA RT-PCR and Northern Blot Analysis of hPHT1 and
sequence was identical to that of hPHT2, except for hPHT2 mRNA From Human Tissues
an insertion of three nucleotides each in three
different locations of hPHT2 (at positions 837, 1271, The presence of numerous ESTs from many tissues
and 1428 of hPHT2). These sequence variations representing the presumed hPHT1 in the databases
would indicate the presence of three additional amino suggested that hPHT1 might be expressed in many
acids at these respective positions, without disturbing human tissues. RT-PCR analysis had revealed
the overall reading frame. It remains to be seen how detectable expression of hPHT1 in each of three
these changes from our deduced coding sequence tissues tested: intestines, skeletal muscle, and
came about and whether they are of functional pancreas (for intestines, see Figure 5A). In each of
significance. In any case, comparing the cDNA and these tissues, the presence of a shorter band
genomic sequences reveals many details of the suggested a possible splice isoform. The
possible protein structure not available otherwise. experimentally determined sequence Figure 1B
shows a deletion of 169 bases.
After completion of this work, a cDNA sequence
nearly identical to hPHT2 was deposited by K. For Northern analysis we used two ESTs representing
Ishiabshi and M. Imai: AB020598, Homo sapiens hPHT1 and 2, which were labeled to detect the
mRNA for peptide transporter 3, complete cds, 2113 presence of mRNA in 12 human tissues Figure 5B.
bps in length. This defines the 3' and 5' ends of hPHT1 was mainly expressed in skeletal muscle,
hPHT1 as having a coding sequence of 1740 bps. The followed by kidney, heart, and liver, with relatively
deduced putative cDNA coding sequence is the little expression in colon and brain. mRNA bands
identical length of the coding sequence suggested by were detected at apparent molecular weight 2.8 kb
our genomic hPHT2 sequence, and it is identical to and 5.1 kb, indicating the presence of possible
hPHT2 over a large portion of the presumed coding mRNA variants.
region. However, there are also several remarkable
differences. First, a fragment of 50 bps in the hPHT2 The mRNA tissue distribution of hPHT2 differed
coding region from position 61-110 is replaced in the significantly from that of hPHT1 Figure 5B. A single
cloned cDNA by a 50-bp fragment of low complexity major band appeared at 2.4 kb, with highest
(cg-rich), which is excluded from BLAST analysis by expression in spleen, placenta, lung, and leukocytes,
a low complexity filter. This 50-bp cDNA fragment followed by heart, kidney, and liver.
did not recognize any sequence in the PAC clone
containing the hPHT2 genomic sequence, but it did
recognize fragments in a number of unrelated genes,
therefore, possibly representing a low complexity
17
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
Figure 3. Multiple protein sequence alignments. PHT Figure 4: Hydropathy plots for hPepT1, hPepT2, rPHT,
branch only (A), plus PepT branch (B). Blue: 50% or cAMP-inducible 1 protein, hPHT1, and hPHT2 (A), and
higher identity; red, green: conservative and similar predicted topological representation (B) of hPHT1 and
substitutions. hPHT2
18
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
and single nucleotide variants occur only Our comprehensive INCA search uncovered several
sporadically, multiple overlapping ESTs could additional ESTs with sequences similar to members
nevertheless assist in finding single nucleotide of the POT family. Using BLAST analyses with these
polymorphisms (SNPs). There are several such ESTs as the query suggested the possibility of
candidate SNPs in the EST alignments: future work additional human POT genes. Further work is needed
will determine whether these do, indeed, represent to complete the human POT family. Also, we cannot
human sequence variations. However, the presence of preclude that the proposed hPHT 1 and 2 genes,
possible splice variants of hPHT1 was clearly although highly similar to genes encoding rPHT1 and
indicated by an insert or gap in two regions of the cyclic AMP-inducible 1 protein, are not the
hPHT1 coding region. These were detected either by immediate orthologues, but that there are as yet
EST alignemnts or experimentally by RT-PCR additional closely related human genes not
Figure 1B and Figure 5A. It will be of interest to represented in the EST database.
determine the tissue expression and function of the
splice variants. The insert into the loop between The strong representation of hPHT1 in the EST
TMDs 11 and 12 introduces an additional 100 database suggests that the presumed hPHT1 is widely
residue-sequence fragment into hPHT1. This region expressed in human tissues, largely in the CNS, in
contains no homology to any other known protein. contrast to its restricted expression in rats. One of
these ESTs stems from a human colon carcinoma, an
A possible splice variant has previously been indication that hPHT1 may also be expressed in
detected for hPepT1. Inue and colleagues (25) have human intestines. We have corroborated this
cloned a cDNA from human duodenum with 1704 supposition with the use of RT-PCR; however,
bp, encoding a predicted protein of only 208 residues Northern blot analysis has revealed that hPHT1 and
(hPepT1-RF). Of these, residues 18-195 are identical hPHT2 are not highly expressed in intestines relative
to an equivalent region of hPepT1. This truncated to other tissues. Protein expression and functional
hPepT1 protein appears to lack ability to transport studies are required to determine whether these
peptides; however, cotransfection of hPepT1-RF with transporters, in addition to hPepT1, could play a role
hPepT1 affected the pH sensitivity of peptide in intestinal peptoid drug absorption. This could be of
transport by hPepT1, suggesting a regulatory function considerable pharmacological interest, as previous
for hPepT1-RF of yet unknown mechanism. The studies have suggested that PepT1 was the sole
functions of splice variants of hPHT1 remain to be peptide transporter in rodent intestines, whereas no
determined. definitive experimental evidence has been reported
on the responsible transporter subtype in humans.
Assembly of ESTs into a second contig sequence Bioavailability studies demonstrate that peptoid
revealed high identity to the mouse cAMP-inducible drugs, such as certain antibiotics, largely depend on
1 protein, which was isolated from lymphocytes as intestinal absorption by peptide transporters to enter
one of the upregulated mRNAs after stimulating with the systemic circulation. For example,
cAMP (26). Close similarity to PHT1 suggests that coadministration of a dipeptide reduced the oral
this gene also encodes a peptide transporter. Using bioavailability of amoxicillin by 80% in human
this human contig sequence, we have identified a subjects providing strong evidence that a saturable
full-length genomic sequence in a PAC clone from dipeptide transport process is involved (27). Whether
which introns and exons can be predicted for the hPHT1 or 2 could play a role in oral antibiotic
presumed hPHT2 gene. High identity to the entire bioavailability remains to be seen.
mouse cAMP-inducible 1 protein suggests that
hPHT2 is the human orthologue, closely related to Our Northern blot analysis revealed strong
the PHT-like branch of the POT family. This will expression for hPHT1 in skeletal muscle and kidney
facilitate the cloning and testing of this putative new while hPHT2 was highly expressed in leukocytes,
member of the human POT family. lung placenta, and spleen. Detectable expression of
both genes in organs, such as the heart, may be of
20
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
21
AAPS Pharmsci 2000; 2(2) article 16 (http://www.pharmsci.org/)
22