Genetic Diversity

Prepared by: Karyl Marie Fabricante-Dagoc

 What should we study?

• Levels of genetic variety

• Population structure
• Importance of Genetic diversity
• Causes and Impacts of genetic loss
• Current genetic technologies
 What is Genetic diversity?
Variation of all living forms at the genetic level: genes, alleles,
or nucleic acids
What is a gene?
A gene is a stretch of DNA whose sequence determines the
structure and function of a specific functional molecule
(usually a protein)

…GAATTCTAATCTCCCTCTCAA …function
DNA CCCTACAGTCACCCATTTGGTA Computer program sf(){document.f.q
TATTAAAGATGTGTTGTCTACT .focus()}…
GTCTAGTATCC…

mRNA Working copy

Protein Specific function

 DNA Protein
(deoxyribonucleic acid)

mRNA
 How is Genetic diversity measured?

• Examining variation in phenotype

• Molecular sequencing of DNA

“Molcular/genetic techniques have been commonly available for

only about 20 years, little information is available for most
species”
 Two types of genetic variation:

• Within population – intrapopulational

- measured as amount of variation within ecologically and reproductively
interacting individuals (mountainside, island etc)
- within members of a species in the same area

• Between populations – interpopulational

- comparing two or more populations of a species
- geographic variation

“Genetic variation in an entire species is the sum of variation within and

variation between all populations that make up the species”
 Evolutionary Processes
• Natural Selection
• Gene Flow
• Genetic Drift
Natural Selection
• A major mechanism of evolution as proposed by Darwin
• A filter for genetic variation: the best adapted individuals
survive and reproduce in greater numbers over time
• Not a directed process!
• Changes in direction and intensity depend on conditions and
time span
Gene Flow
• The exchange of genetic material within a population, between populations of
a species, and even between species
• Gene flow among populations of a species maintains the integrity of the
species
• Lack of gene flow can lead to speciation
 What gives rise to diversity?

• Mutations – any alteration of a gene

• Creates variation within a gene pool
• Acted upon by natural selection
• Neutral mutations – do not affect an organism’s fitness
• DNA repair mechanisms mend changes before becoming
permanent mutations
 What gives rise to diversity?
• Recombination – DNA strands exchanged
•
 What gives rise to diversity?
• Genetic technologies / engineering

“creation of new and improved varieties

through insertion of new genes increases
diversity”
 Importance of Diversity

Assures possible adaptations to environmental

changes and potential survival of species!

At least some individuals have a better chance to inherit

genetic characteristics that are vital for their survival

Dr. Richard Lankau, “Diversity within a species is

necessary to maintain diversity among species.
If any one type is removed from the system, the
cycle can break down, and the community
becomes dominated by a single species
(National Science Foundation, 2007)
 Survival
of a
species

Genetic diversity plays a huge

role in survival and adaptability of
a species.
When a species’s environment
changes, slight gene variations
are necessary for it to adapt and
survive.
A species that has a large degree
of genetic diversity among its
population will have more
variations from which to choose
the most fit alleles.
Species that have very little
genetic variation are at a great
risk.
With very little gene variation
within the species, healthy
reproduction becomes
increasingly difficult.
 Source of
genes

Wild animals and

plants are sources of
genes for
hybridization and
genetic engineering
 The loss of genetic diversity is difficult to see or measure.

In contrast, the reduction and extinction of populations is far

easier to see.

Extinction is not only the loss of whole species, but is also

Source of preceded by a loss of genetic diversity within the species.

genes This loss reduces the species ability to perform its inherent
role in the whole ecosystem.

Furthermore, the loss of genetic diversity within a species can

result in the loss of useful and desirable traits (e.g.
Wild animals and resistance to parasites).
plants are sources of
genes for Reduced diversity may eliminate options to use untapped
hybridization and
resources for food production, industry and medicine.
genetic engineering
 Loss of Diversity
While some individuals might be able to tolerate an increased
load of pollutants in their environment, others, carrying
different genes, might suffer from infertility or even die
under the exact same environmental conditions.

Whilst the former will continue to live in the environment the

latter will either have to leave it or die.

This process is called natural selection and it leads to the loss

of genetic diversity in certain habitats. However, the
individuals that are no longer present might have carried
genes for faster growth or for the ability to cope better with
other stress factors.
 Loss of Diversity
• Monoculture, monocropping
Did you know that more than 7 000 varieties of
tomatoes existed in 1900 ?

Today, the European Union counts approximately 150

when 70 varieties are marketed but only 2 or 3 are found
on stall, a manner of standardizing our food to the
detriment of biodiversity.

The principal cause is the expansion of the commercial

agriculture which encourages monoculture. The new
varieties often used by commercial agriculture replaced
the traditional agricultural varieties and led to their
disappearance.

Up to 90 percent of the varieties of cabbage, corn and of

tomato, for example, disappeared relatively recently and
with them we lost essential knowledge on the production
of various varieties and races and on the soils where they
were growing.
 Loss of Diversity

• Habitat degradation
- direct loss of diversity

Any change in the environment - natural or human induced

causes a selection of events that only the fittest survive.
 Loss of Diversity
• Habitat degradation
- increases risk of inbreeding

Habitat fragmentation and destruction now produce and will continue to

produce small, isolated populations
Conservation Measures
A major goal is to preserve
natural patterns of genetic
diversity to the extent possible
to preserve options for future
evolutionary change.
The worst thing that can happen….is not energy depletion,
economic collapses, limited nuclear war, or conquest by a
totalitarian government.

As terrible as these catastrophes would be for us, they can

be repaired within a few generations.

The one process ongoing… that will take millions of years

to correct is the loss of genetic and species diversity by the
destruction of natural habitats.

This is the folly that our descendants are least likely to

forgive us for."

Edward O. Wilson, Harvard’s Pulitzer Prize-winning

Biologist
 What
lies ahead
for me?