Professional Documents
Culture Documents
Research Article
Research Article
Research Article
Microbiological Evaluation of the Effectiveness of Sewage Sludge
Sanitization with Solar Drying Technology
Copyright © 2012 Zbigniew Paluszak et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.
The aim of study was to estimate the sanitization effectiveness of the sludge solar drying process carried out on technical scale in
Poland based on the inactivation of bacteria and parasite eggs. Sewage sludge samples inoculated with Escherichia coli, Salmonella
Senftenberg W775 and enterococci and perlon bags containing Ascaris suum eggs were placed inside the carriers fixed in the dried
sludge pile and on the shovels and frame of the sludge turner. The number of reisolated microorganisms was determined with MPN
method and the percentage of invasive A. suum eggs—with the microscope counting. On the basis of regression equations, the
theoretical survivability and elimination rate of bacteria and parasite eggs were calculated. Experiment showed low hygienization
efficiency of solar drying method. The theoretical survival time was 46–104 days in summer and 90–98 days in winter for S.
Senftenberg W775 and, respectively 42–55 and 71–148 days for E. coli, depending on the carriers location. Enterococci were able to
survive for 52–168 days in summer and in winter its number increased. The decrease in the percentage of invasive A. suum eggs
was almost not observed. Results indicated that solar drying is a technology, which does not guarantee biosafety of product.
2.2. Material for the Study. The material for the study was
2.1. Description of the Examined Technology of Sludge Drying.
sewage sludge after mechanical dewatering to a dry matter
The solar drying plant is a system used commercially and it
content of 10% to 20%. The presence of native Salmonella,
works in full scale at the waste water treatment plant in Iława.
bacteria E. coli, and enterococci was examined in collected
This sewage sludge drying installation consists of drying
sludge samples. Also the proportion of dry matter and dry
halls similar to green houses with gable roof (Figure 1). The
organic matter, pH, and the content of basic macroelements
construction of the drying hall is made of zinc-coated steel
and heavy metals were determined in the sludge.
and covered with polycarbonate plates. The dimensions of
the drying hall are 120 m length, 12 m width, and 6 m height.
The described solar drying plant is a hybrid installation. 2.3. Experimental Design. The study was conducted in 2
The main principle of the drying operation is the solar cycles, summer and winter. In each cycle, 3 replications were
effect, but also the heating floor system (Figure 2) is exploited made for each location of the carrier.
for water evaporation from sewage sludge. The heating The experiment was carried out using carriers in the
floor additionally supports the drying process and the heat form of perforated cylinder with a threaded lock.
necessary for its functioning is made by a heating pump Samples of municipal sludge with a weight of 25 g were
which recovers energy from the treated sewage through the contaminated with 1 mL of the suspension of Escherichia
collector in secondary clarifier. coli, bacilli Salmonella Senftenberg W775 and enterococci and
The solar drying plant is located next to the building placed in the carriers. Also perlon bags containing live eggs of
of mechanical sludge dewatering station, from where dehy- Ascaris suum were placed inside the carriers. Then they were
drated sludge is transported into the hall by the transporter closed and fixed in selected points (in the pile of dried sludge
system. Inside the drying hall mechanically dewatered sludge at the end of the hall, as well as on shovels and frame of the
is spread with an even layer on the concrete floor and then sludge turner).
transported, aerated, granulated and moved to the end of From each location, 3 carriers were collected for the study
the hall by the nave turning sludge device (Figure 3). The after 7, 14, 21, and 28 days, respectively.
International Journal of Photoenergy 3
2.4. Monitoring of Climatic Conditions. During the experi- (incubation for 24 hours at 37◦ C). Final identification was
ment, the following parameters were monitored: humidity carried out using the PCR reaction for detecting the fragment
and temperature in the drying plant (with the use of the invA [12]. To 5 µL of isolated DNA 20 µL mastermix was
hygrothermometer), the temperature in the pile (with the added, composed of distilled water (8.85 µL), 10x PCR
use of the in-pile thermometer), the intensity of diffuse solar buffer (2.5 µL; Bioline, cat. no. BIO-37030), magnesium
radiation coming to the horizontal plane of the drying plant chloride (1.50 µL–25 mM; Bio-Rad, cat. no. 170-8872),
roof (with the use of pyranometer), and the outside micro- dNTP’s (5 µL–1 mM; Bio-Rad, cat. no. 170-8874), primer
climatic conditions (the climatic station data). Monitoring 139 (5 GTGAAATTATCGCCACGTTCGGGCAA 3 1 µL–
was conducted according the methods commonly applied in 10 µM), primer 141 (5 TCATCGCACCGTCAAAGGAACC
meteorology. 3 1 µL–10 µM), and Taq polymerase (0.15 µL–5 U/µL; Bio-
Rad, cat. no. 170-8870). The initial denaturation of DNA
2.5. Physicochemical Analyses. The physicochemical analysis was conducted at 95◦ C for 1 minute. Then 38 cycles were
of the dried sludge parameters was made at each sampling comprising of denaturation (30 seconds at 95◦ C), annealing
time. It involved the assessment of dry matter and organic (30 seconds at 64◦ C), and elongation (30 seconds at 72◦ C).
dry matter content, pH, the content of fertilizer components The last stage of the PCR reaction was the final elongation
(total and ammonium nitrogen, total phosphorus, calcium, carried out for 4 minutes at 72◦ C. Electrophoresis was
and magnesium), and heavy metals (lead, cadmium, mer- carried out in 1.8% agarose gel (Bio-Rad, cat. no. 151-0450)
cury, nickel, zinc, copper, and chromium). at the voltage 5 V × cm−1 for 60 minutes and dyed with
Physicochemical analyses of the sludge were carried out ethidium bromide (Bio-Rad, cat. no. 161-0433).
using the referential methods described in Appendix 5 to the To determine E. coli number, the MacConkey liquid
ordinance of the Ministry of the Environment of 13rd July medium was used (incubation for 24 at 43◦ C). Then the
2010 on municipal sewage sludge (Dz.U. 2010 nr 137 poz. material was sieved on the solid medium ENDO agar
924) [11]. The applied methods are presented in Table 1. (incubation for 24 hours at 43◦ C). The final identification
was carried out based on the set of biochemical tests API
2.6. Microbiological Analyses. For contamination of the ex- 20E.
perimental material, suspension of Salmonella Senftenberg Enterococci determination was carried out using broth
W775 , bacteria E. coli, and enterococci were used. with glucose and azide (incubation for 24 hours at 37◦ C) and
From 24-hour pure cultures of the tested microor- agar with kanamycin (incubation for 24 hours at 37◦ C). The
ganisms on nutrient agar, bacterial suspensions in 0.90% final identification was carried out based on the Phadebact
physiological salt solution with a density of 10 McF (∼3.0 × D—Strep Test.
109 cfu × cm−3 ) were prepared.
The number of microorganisms isolated from the car- 2.7. Parasitological Investigation. Ascaris suum eggs were
riers submitted to solar drying process at successive times obtained from uteruses of sexually mature females and
was determined based on the MPN method in the three-tube placed on Petri dishes filled with saline solution. Suspension
design. in volume of 1 mL with a density from 1.0 × 103 to 6.0 × 103
In the process of Salmonella isolation, 1% buffered pep- eggs × cm−3 was introduced to each perlon bag and used
tonic water was used for initial multiplication (incubation for experiment. The bags collected during the study were
for 24 hours at 37◦ C). Selective enrichment was conducted opened and placed on Petri dishes with tap water. Incubation
on the Rappaport medium (incubation for 24 hours at lasted for 28 days at 28◦ C. The percentage of invasive eggs was
43◦ C). BPLS agar was used as the solid growing medium determined with the microscope counting method.
4 International Journal of Photoenergy
35 90
70
25 60
50
20
40
15 30
20
10 1 3 5 7 9 11 13 15 17 19 21 23 25 27
1 3 5 7 9 11 13 15 17 19 21 23 25 27 Time (days)
Time (days)
Relative humidity in solar drying plant
Temperature in solar drying plant Outside relative humidity
Outside temperature
Temperature in pile Figure 6: The course of relative humidity during the summer cycle
(July).
Figure 4: The course of temperature during the summer cycle
(July).
10
700 8
Temperature (◦ C)
Solar radiation (W·m−2 )
600
6
500
4
400
2
300
200 0
100 −2
1 3 5 7 9 11 13 15 17 19 21 23 25 27
0 Time (days)
1 3 5 7 9 11 13 15 17 19 21 23 25 27
Time (days) Temperature in solar drying plant
Outside temperature
Figure 5: The course of insolation during the summer cycle (July). Temperature in pile
Drying time
Cycle Bacteria number [MPN × g−1 ] (days)
0 7 14 21 28
Sludge from carriers placed on the turner frame
Salmonella Senftenberg W775 4.5 × 107 3.83 × 106 9.97 × 107 4.83 × 105 2.8 × 105
Summer Escherichia coli 4.33 × 107 6.83 × 106 3.17×104 6.83 × 103 4.5 × 103
Enterococci 6.13 × 107 5.5 × 106 4.15 × 107 2.13 × 105 1.87 × 105
Salmonella Senftenberg W775 2.13 × 109 3.83 × 108 1.38 × 109 1.73 × 107 3.83 × 106
Winter Escherichia coli 3.83 × 107 3.83 × 107 1.51 × 108 6.17 × 104 1.83 × 105
Enterococci 9.0 × 107 1.82 × 109 1.25 × 109 1.07 × 109 3.25 × 108
Sludge from carriers placed on the turner shovels
Salmonella Senftenberg W775 4.5 × 107 6.5 × 106 2.86 × 105 4.9 × 103 4.67 × 102
Summer Escherichia coli 4.33 × 107 4.33 × 105 7.83 × 106 2.65 × 104 7.65 × 103
Enterococci 6.13 × 107 2.15 × 108 4.37 × 108 5.17 × 106 5.5 × 106
Salmonella Senftenberg W775 2.13 × 109 1.38 × 109 1.73 × 108 2.83 × 106 1.72 × 107
Winter Escherichia coli 3.83 × 107 7.17 × 107 9.67 × 105 9.33 × 104 1.55 × 105
Enterococci 9.0 × 107 6.17 × 108 2.38 × 108 3.17 × 108 1.07 × 109
Sudge from carriers placed in the sludge pile
Salmonella Senftenberg W775 4.5 × 107 3.17 × 106 1.77 × 106 6.17 × 105 3.17 × 105
Summer Escherichia coli 4.33 × 107 2.84 × 107 3.8 × 105 3.26 × 104 7.17 × 102
Enterococci 6.13 × 107 3.75 × 108 2.48 × 107 5.98 × 104 7.17 × 103
Salmonella Senftenberg W775 2.13 × 109 2.13 × 109 5.58 × 108 7.83 × 106 6.83 × 106
Winter Escherichia coli 3.83 × 107 2.5 × 107 7.83 × 105 1.2 × 106 3.17 × 106
Enterococci 9.0 × 107 9.17 × 108 1.67 × 108 1.13 × 109 1.67 × 109
5 log. The mean theoretical time of survival of Salmonella in the material from carriers placed in the pile to 168
Sanftenberg W775 in the summer cycle, calculated based days in samples from the turner shovels, at the elimination
on the regression equations, was 104 days in dried sludge rate ranging from 0.05 to 0.17 log MPN × day−1 (Table 5).
from the carriers placed on the frame of the turner and Highly statistically significant differences in the theoretical
in the pile. This time was highly statistically significantly survival rates of enterococci were found between the material
longer than that in the sludge from carriers on the shovels from the pile and the sludge from the other two locations,
of the turner (40 days) (Table 5). The elimination rate of and statistically significant differences between samples from
the bacteria on the shovels was highly significantly higher the turner frame and those from the pile (Table 5).
(0.19 log MPN × day−1 ) in relation to the other samples The available literature data shows that solar drying does
(0.08 and 0.07 log MPN × day−1 ) (Table 5). not provide the complete sanitization of sewage sludge even
At the same time, the number of E. coli isolated from in the summer cycles. The study by Bux et al. [16] conducted
carriers located on the frame and shovels of the turner on technical scale in sludge solar drying plants working with
decreased on average by about 4 log, whereas in the pile by charging method indicated that during the cycle lasting 21
about 5 log (Table 4). The mean theoretical times of survival days a reduction in the number of fecal coliform bacteria
ranged from 42 to 55 days (Table 5). by 3 log10 was obtained. Also in experiments conducted in
In the summer cycle, the highest average decrease in the Australia [20], despite more favorable climatic conditions,
number of enterococci, amounting to 4 log, was observed a considerable smaller decrease in the number of E. coli
in the sludge from carriers placed in the pile, whereas the was found in comparison with the present study, amounting
lowest, about 1 log, was observed in the material from to 1 log10 . Also in the pilot study conducted in Turkey by
carriers on the turner shovels (Table 4). In the sludge sub- Ögleni and Özdemir [21], the number of fecal coliform
jected to solar drying in the summer cycle, enterococci bacteria in sludge after 12 weeks of solar drying did not
were theoretically able to survive on average from 52 days fall below 1.0 × 103 MPN × g−1 D.M., just as during its
International Journal of Photoenergy 9
storage. Mathioudakis et al. [22], in spite of very high 100 96 97 96 95 95.67 95 95 94.67 95.67 95
Table 6: Values of parameters that determine the way of using sewage sludge [11].
Type of reuse
100 94
97 95
90.33 91.3389.33 91.67
94.6792.67
92 91 93.33 92.67 94 91.33 A similar phenomenon was observed by Cota et al. [17]
90 who proved that an increase in the proportion of waste dry
80 matter during solar drying up to 93.33% resulted in the
Invasive eggs (%)
drying can be used as a fertilizer. However, in the case of with municipal sewage sludges,” Environmental Geochemistry
occurrence of pathogenic bacteria and eggs of gastrointesti- and Health, vol. 28, no. 1-2, pp. 97–101, 2006.
nal parasites in the batch material, as it was in the described [10] R. Sobczyk, “Gospodarka komunalnymi osadami ściekowymi
experiment, the hygienization potential of solar drying plant teoria a praktyka,” in Proceedings of the 6th Konferencja Nauk-
is insufficient. In such situation, sludge after drying can owo-Techniczna Woda-Człowiek-Środowisko, Licheń, Poland,
2007.
be used for nonagricultural land reclamation, cultivation of
[11] “Rozporza̧dzenie Ministra Środowiska z dnia 13 lipca 2010 r.
plants destined for compost production and cultivation of
w sprawie komunalnych osadów ściekowych,” Dziennik Ustaw,
plants which are not destined for consumption and fodder no. 137, p. 924, 2010.
production, or constitute an energy substrate in the process [12] K. Rahn, S. A. De Grandis, R. C. Clarke et al., “Amplification
of burning or coburning. of an invA gene sequence of Salmonella typhimurium by
During the operation of sludge solar drying plant, con- polymerase chain reaction as a specific method of detection
stant microbiological and parasitological monitoring of both of Salmonella,” Molecular and Cellular Probes, vol. 6, no. 4, pp.
watered and dried sludge making its final product is of 271–279, 1992.
utmost importance. Only obtaining such results, it is possible [13] R. Sobczyk and P. Kabus, “Słoneczne suszarnie osadów,” in
to choose the optimal way of managing processed sludge. Forum Eksploatatora, no. 03, Wydawnictwo Seidel-Przywecki,
2006.
[14] http://www.neostar.com.pl/.
4. Conclusions [15] J. Szczygieł and P. Krawczyk, “Uwarunkowania słonecznego
suszenia osadów ściekowych,” Gaz, Woda I TechnIka SanI-
Based on the obtained results, it may be concluded that tarna, no. 3, pp. 30–44, 2006.
waste solar drying is a technology that does not guarantee [16] M. Bux, R. Baumann, W. Philipp, T. Conrad, and W.
obtaining of stable, biologically safe material for agricultural Mühlbauer, “Class—a by solar drying recent experiences in
purposes. The lack of explicit positive results of elimination Europe,” in Proceedings of the Water Environment Federation
of harmful microflora in both seasons of the year in drying (WEFTEC’01), pp. 309–317, Atlanta, Ga, USA, 2001, session
45.
plants located under various climatic conditions confirms
[17] A. D. Cota, C. Figueroa, E. Espinoza et al., “Active Solar
that solar drying technology cannot be regarded as an Drying of Wastewater Sludge: Physicochemical, Toxicologi-
effective technology of waste sanitization. In this respect, it cal, and Nutrimental Characterization,” México, http://www
is much less effective than other biological (e.g., composing), .uacj.mx/docentes/juflores/Documents/, 2007.
chemical (e.g., liming), and physical (e.g., pasteurization) [18] S. Nathan and B. Clarke, SolarMix—Innovation in Drying
methods of waste processing. To obtain sanitary clean wastes, Technology, CabWater Caboolture Shire Council, Arkwood
the vast majority of the authors report the need for additional Organic Recycling Pty, Mixwell Specialized Transport Pty,
sanitization treatments. Subjecting waste dried material to 2004.
pelletization may guarantee obtaining its proper sanitiza- [19] P. K. Hertwig, Seuchenhygienische Untersuchungen bei der
tion. Trocknung und Pelletierung von Klärschlamm. [Diplomarbait],
Universität Hohenheim, 2004.
[20] K. Barr, M. Bux, S. Horn, and J. McLellan, “Accelerated air-
References drying of sewage sludge using a climate-controlled solar
drying hall,” http://www.thermo-system.com/, 2002.
[1] J. A. Oleszkiewicz, Gospodarka osadami ściekowymi, Poradnik [21] N. Ögleni and S. Özdemir, “Pathogen reduction effects of solar
decydenta, LEM s.c., Kraków, Poland, 1998. drying and soil application in sewage sludge,” Turkish Journal
[2] F. O. Kocaer, U. Alkan, and H. S. Başkaya, “The effect of of Agriculture and Forestry, vol. 34, pp. 509–515, 2010.
alkaline-stabilized-sludge application on the microbiological [22] V. L. Mathioudakis, A. G. Kapagiannidis, E. Athanasoulia, V. I.
quality of soil and leachate,” Journal of Plant Nutrition and Soil Diamantis, P. Melidis, and A. Aivasidis, “Extended dewatering
Science, vol. 167, no. 6, pp. 704–712, 2004. of sewage sludge in solar drying plants,” Desalination, vol. 248,
[3] M. Michałkiewicz, “Podstawowe testy biologiczne stosowane no. 1–3, pp. 733–739, 2009.
w eksploatacji oczyszczalni ścieków,” in Proceedings of the [23] E. F. Shanahan, A. Roiko, N. W. Tindale, M. P. Thomas, R.
Eksploatatora Forum, no. 1, 2002. Walpole, and D. Ipek Kurtböke, “Evaluation of pathogen
[4] B. Nørrung and S. Buncic, “Microbial safety of meat in the removal in a solar sludge drying facility using microbial indi-
European Union,” Meat Science, vol. 78, no. 1-2, pp. 14–24, cators,” International Journal of Environmental Research and
2008. Public Health, vol. 7, no. 2, pp. 565–582, 2010.
[5] J. Zamorska, “Organizmy patogenne w osadach ściekowych,”
Zeszyty Naukowe PTIE i PTG Oddziału w Rzeszowie, vol. 9,
2007.
[6] J. Bień, Osady ŚcIekowe TeorIa I Praktyka, Wydawnictwo
Politechniki Czȩstochowskiej, Czȩstochowa, Poland, 2002.
[7] L. Sahlström, “A review of survival of pathogenic bacteria in
organic waste used in biogas plants,” Bioresource Technology,
vol. 87, no. 2, pp. 161–166, 2003.
[8] I. L. Pepper, J. P. Brooks, and C. P. Gerba, “Pathogens in
Biosolids,” Advances in Agronomy, vol. 90, pp. 1–41, 2006.
[9] Y. H. Sun, Y. M. Luo, L. H. Wu, Z. G. Li, J. Song, and P. Christie,
“Survival of faecal coliforms and hygiene risks in soils treated
Photoenergy
International Journal of
International Journal of Organic Chemistry International Journal of Advances in
Medicinal Chemistry
Hindawi Publishing Corporation
International
Hindawi Publishing Corporation Hindawi Publishing Corporation
Analytical Chemistry
Hindawi Publishing Corporation
Physical Chemistry
Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014
International Journal of
Carbohydrate Journal of
Chemistry
Hindawi Publishing Corporation
Quantum Chemistry
Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014
Journal of
The Scientific Analytical Methods
World Journal
Hindawi Publishing Corporation
in Chemistry
Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014