Plant Pathology (2003) 52, 3 – 12

REVIEW
Blackwell Science, Ltd

Black dot (Colletotrichum coccodes): an increasingly

important disease of potato

A. K. Leesa*† and A. J. Hiltonb

a
Programme of Host–Parasite Co-Evolution, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA; and
b
Agronomy Department, Scottish Agricultural College, Craibstone, Aberdeen AB21 9YA, UK

In recent years black dot (Colletotrichum coccodes) has become an economically important disease problem in potato
(Solanum tuberosum). It is characterized by silvery lesions on the tuber surface which result in a deterioration in skin
quality. In addition to causing tuber blemish symptoms, C. coccodes also causes symptoms on stems and foliage, resulting
in crop losses in some countries, and is implicated as a factor in the potato early dying disease complex. In the past, the
incidence and severity of black dot might have been underestimated, as tuber symptoms were often mistaken for silver
scurf (Helminthosporium solani ). Inoculum of C. coccodes can be both seed tuber- and soilborne, and disease control is
difficult as there are few chemical control methods and little resistance in commercial cultivars. Cultural control options
offer the only potential means to control this disease at present. Current developments in rapid and specific PCR-based
detection methods are being used to address epidemiological questions.

Keywords: disease detection and diagnosis, epidemiology, potato tuber disease, soilborne disease, tomato anthracnose

complexes of soilborne parasites including Verticillium dahliae

Introduction
Black dot is a tuber blemish and foliar disease of potato
caused by the fungus Colletotrichum coccodes (synonyms
C. atramentarium and C. phomoides). Early reports of the
disease in potato and tomato date back to the early 19th
century, and are described in detail by Dickson (1926). In
general, these reports did not regard black dot as a serious
problem in potato, and the pathogen was later described
by Chesters & Hornby (1965a) as common, but rarely of
economic importance on potato in the UK, and by Zitter
et al. (1989) as a weak pathogen of potato roots. However,
there have been increasing numbers of reports of dis-
ease incidence and crop damage caused by C. coccodes
(Thirumalachar, 1967; Mohan & Davis, 1987; Barkdoll
& Davis, 1992; Dillard, 1992; Johnson & Miliczky,
1993b; Johnson, 1994; Tsror (Lahkim) et al. 1994; Read
& Hide (1995a); Andrivon et al. (1997); Denner et al.
(1997); Tsror (Lahkim) et al., 1999b).
It has also been demonstrated that potato early dying (PED),
characterized by stunting, wilting, premature senescence and
reduced yields (Powelson & Rowe, 1993), is associated with
*To whom correspondence should be addressed.
†E-mail: alees@scri.sari.ac.uk
Accepted 22 August 2002
and C. coccodes [Tsror (Lahkim) & Hazanovsky, 2001].
The relative importance of black dot on potato has
increased, in part due to the growing market for fresh,
prepacked potatoes, which has resulted in an increase in
the demand for washed potatoes with a high-quality
appearance. As a consequence of this demand, skin
blemish diseases of potato such as black dot, silver scurf
(Helminthosporium solani) and black scurf (Rhizoctonia
solani), once considered to be of minor importance, are
now viewed as a serious problem. The British Potato
Council estimates that black dot and silver scurf cause up
to £5 million in losses to ware crops annually in the UK
(Anon, 1998), and there can be additional losses to the
seed industry, particularly to the export market. It is also
possible that until recently, black dot symptoms on tubers
were often mistaken for silver scurf symptoms, and
that the importance of the distribution of the disease has
therefore been underestimated. For a review of silver scurf
on potato see Errampalli et al. (2001b).
The disease
Symptoms
Colletotrichum coccodes can colonize all underground
parts (daughter tubers, stolons and roots), basal stems

© 2003 BSPP 3
4 A. K. Lees & A. J. Hilton
(Andrivon et al., 1997; Andrivon et al., 1998) and foliage
(Mohan et al., 1992; Johnson & Miliczky, 1993a;
Johnson, 1994) of the potato plant. Infection of potato
tubers by C. coccodes results in the development of silvery
lesions on the tuber surface, characterized by the pro-
duction of black microsclerotia (Dillard, 1992). Symptoms
are commonly observed at the heel end of the tuber and
the lesions can appear brown, with a poorly defined
margin. In contrast, silver scurf lesions are silver, with a
clearly defined margin. To confirm identification of these
two diseases requires examination of tubers with a hand
lens or microscope to observe the characteristic black
microsclerotia of black dot, or conidiophores of H. solani
(Errampalli et al., 2001a).
Microsclerotia of C. coccodes can also be seen on
roots, stems and stolons, and are commonly observed in
maincrop cultivars in the UK from late June onwards
(J. E. Danaher and A. J. H., unpublished data). Symptoms
of disease caused by C. coccodes on potato foliage are
usually associated with wounds caused by windblown soil,
particularly sand, and appear initially as water-soaked
lesions that subsequently turn dark brown to black.
Infected plants sometimes appear wilted, with the lower
and middle leaves becoming chlorotic (Mohan et al.,
1992; Johnson, 1994). Disease symptoms on potato
foliage have not been reported in the UK.
Effects of disease
Silvering of the tuber skin by C. coccodes causes a red-
uction in skin quality, which can result in crops being
rejected for the fresh prepack market. Infection by C.
coccodes can also cause limited yield reductions and weight
loss in storage. Hunger & McIntyre (1979) observed that
tubers with more than 60% infection lost an average of
10% of fresh weight after 18 weeks of storage, while
tubers with 0 –1% infection lost only 5%. These findings
were attributed to damage to the periderm which in-
creased skin permeability. In the UK, a series of artificially
and naturally infected field experiments showed that
although total crop yield was rarely affected by black dot
symptoms, the yield of marketable ware-sized tubers was
sometimes decreased and the number of small tubers in
the sample increased (Read & Hide, 1995a).
In contrast to the earlier reports of Chesters & Hornby
(1965a) and Zitter et al., 1989, who did not consider
C. coccodes to be an important disease of potato, artificial
inoculation of potato foliage with C. coccodes was shown
to cause significant yield losses in the state of Washington,
USA. In field experiments in 1991, 1992 and 1993, Johnson
(1994) noted a 7, 12 and 11% yield loss, respectively, in
the cultivar Russett Burbank, and in two glasshouse
experiments yield losses were 32 and 19%, respectively.
Tsror (Lahkim) et al. (1999b) observed significant yield
reductions of 22–30% in five cultivars planted in artifi-
cially inoculated soil.
Yield losses may also result from PED syndrome. Coin-
oculation of four cultivars varying in susceptibility to V.
dahliae and C. coccodes resulted in significant reductions
in plant weight and height compared with plants inocu-
lated individually and control plants [Tsror (Lahkim) &
Hazanovsky, 2001]. However, Sedegui et al. (2000) found
that in cultivar Superior, V. dahliae was the primary
pathogen causing early dying, and no increase in disease
severity or yield loss was observed when plants were
coinoculated with both pathogens.
Infection and symptom development
All underground parts of a potato plant are susceptible to
infection by C. coccodes (Ducomet, 1908; Schmiedeknecht,
1956; Andrivon et al., 1998). Early reports suggested that
roots, stolons, stems and daughter tubers were colonized
by internal growth of mycelial hyphae developing from
infected seed tubers or by contact of healthy plant parts
with infected debris (Ducomet, 1908). When infected
segments of seed were sown in pots in the glasshouse, initial
symptoms were observed on roots, stems and stolons 2, 8
and 8 weeks after planting, respectively (Andrivon et al.,
1998). This rapid development of symptoms on roots
has led to speculation that roots provide the initial site of
infection (Komm & Stevenson, 1978). Recent experi-
ments have shown that both the planting of clean seed
in infected soil, and infected seed in clean soil in the
glasshouse, result in rapid infection of all underground
plant parts (J. E. Danaher and A. J. H., unpublished data).
Stems, stolons and roots grown from infected seed were
infected with C. coccodes immediately after planting, and
it is speculated that this is due to systemic growth of the
fungus from infected seed. Visual symptoms of black dot
did not develop on stems and stolons until 6 and 8 weeks
after planting, respectively, and the severity of symptoms
on daughter tubers was dependent on the duration
between haulm senescence and harvesting (J. E. Danaher
and A. J. H., unpublished data).
The environmental conditions that favour disease
development are still unclear. However, the extensive
geographic distribution of this disease (Mordue, 1967)
suggests that infection in the field can occur under a wide
range of conditions. In in vitro tests, the optimum temper-
ature for conidial germination was shown to be 22°C, and
mycelial cultures grew most quickly between 25 and 31°C
(Dillard, 1988). Reports on environmental conditions
that favour black dot development in the field are limited.
However, in irrigation studies black dot was favoured by
wet soil conditions (Firman & Allen, 1993; Hide et al.,
1994).
Distribution and host range
Black dot is widely distributed throughout the potato-
growing regions of the world, including Africa, Asia, Aus-
tralasia and the Americas (Mordue, 1967). The majority
of reports of the disease come from North America (Raid
& Pennypacker, 1987), Europe (Andrivon et al., 1997),
Australia (Harrison, 1963), and South Africa, where the
disease is prevalent due to the susceptibility of local culti-
vars (Denner & Marais, 1989). In a survey of bacterial
© 2003 BSPP Plant Pathology (2003) 52, 3– 12
 Black dot disease of potato
and fungal seedborne diseases on imported and domestic
potatoes in Israel, up to 34% of batches imported from
Holland in 1998 were contaminated with black dot [Tsror
(Lahkim) et al., 1999a]. A survey undertaken in the UK in
1989–90 found that black dot, silver scurf and black scurf
occurred in 75, 86 and 85%, respectively, of potato crops
surveyed (Read et al., 1995).
Within the UK regional differences in the incidence of
the disease have been observed (Bradshaw et al., 2002). In
a crop survey in England and Wales in 1999 and 2000, the
relative incidence of black dot varied from 100 and 70%
in the south-east and midlands to 18% in the south-west
and 8% in the north. Observations by the authors in Scot-
land suggest that incidence of black dot is low compared
with that in the south-east of England.
Apart from black dot on potato, C. coccodes also causes
anthracnose in tomato crops, characterized by sunken,
water-soaked, circular lesions (Dillard, 1989), and is
able to infect at least 35 additional hosts from 13 families
including the Cucurbitaceae, Fabaceae and Solanaceae
(Chesters & Hornby, 1965b). Raid & Pennypacker
(1987) identified 15 weed species that acted as altern-
ative hosts for C. coccodes when root and foliar inocula-
tions were carried out in tomato fields in Pennsylvania,
USA. However, more than 50% of the infected plants
were symptomless and when symptoms did occur,
they generally appeared as inconspicuous chlorotic or
necrotic flecks. This is in agreement with the work of
Bremer (1954). Further research is necessary to deter-
mine the role of weeds as hosts and inoculum sources
in nature.
The pathogen
Taxonomy and variability
Colletotrichum coccodes is an imperfect fungus belonging
to the Melanconiales. Colonies of C. coccodes grown on
media are dominated by white, sparse aerial mycelium
and by abundant, black sclerotia that are distributed
evenly over the agar surface (Davis & Johnson, 2002).
Acervuli produced in culture, and on stems, roots, tomato
fruit and potato tubers, normally in association with
sclerotia, are round to elongate, approximately 200 –300
µm in diameter, and produce septate and branched
conidiophores (McIntyre & Rusanowski, 1975). Conidia
are formed in honey, orange to salmon-coloured masses and
are 16–24 µm long by 3 – 4 µm wide, straight, fusiform
and abruptly tapered to each end (Sutton, 1992).
Knowledge of the variability among isolates of C. coc-
codes has focused on studies of culture morphology and
pathogenicity. Kendrick & Walker (1948) found that
147 isolates of C. coccodes obtained from tomato fruits
showed a considerable range of growth characteristics
when cultured, varying in colour, the presence of prostrate
or aerial mycelia, and in the size and number of sclerotia
formed. Similarly, Tu & Poysa (1997) found at least 15
distinct biotypes of C. coccodes that varied in several
phenotypic characteristics (e.g. pathogenicity, cultural
© 2003 BSPP Plant Pathology (2003) 52, 3 –12
5
morphology) from 435 isolates obtained from diseased
tomato fruit and leaves.
Isolates of C. coccodes from potato were found to
be morphologically indistinguishable from those from
tomato, and were also capable of causing anthracnose on
tomato (Illman et al., 1959). In in vitro tests, similar levels
of variation were observed in isolates of C. coccodes
obtained from tomato roots, tomato anthracnose and
black dot of potato (Chesters & Hornby, 1965a). Temper-
ature optima for the germination of conidia were
described by Dillard (1988): germination of conidia was
greatest at 22°C, no conidia germinated at 7°C, and fewer
than 70% germinated at 10 or 31°C. The growth rate of
cultures was greatest at 25–31°C, and optimum at 28°C
and a pH of 6.
Variation in pathogenicity was examined by Barkdoll
& Davis (1992), who assessed nine isolates of C. coccodes
for their ability to cause disease symptoms on the foli-
age of potato cultivar Russett Burbank. These workers
induced wounding on the potato plants before inoculating
with a conidial suspension of the individual isolates.
Disease was subsequently measured, and differences in
the pathogenicity of the nine isolates were observed on
the foliage. There is also limited evidence to suggest that
physiological races exist among isolates of C. coccodes,
e.g. Andrivon et al. (1998) inoculated hemispherical eye
cores of the potato cultivars Spunta, Bintje and Desirée
with five isolates of C. coccodes using a 5 mm mycelial
plug cut from the margin of an actively growing colony.
Plants were then grown in a glasshouse before being har-
vested and assessed for the presence of disease. Symptoms
on stolons and tubers showed significant isolate by culti-
var interactions. In recent studies, Nitzan et al. (2002)
showed that four multimember vegetative compatibility
groups (VCGs) could be defined from 110 isolates of
C. coccodes originating from Israel, the Netherlands and
France, and that VCG diversity might be associated with
pathogenic characteristics of isolates. Further work is
needed to improve understanding of the extent of patho-
genic variation in C. coccodes.
In addition to phenotypic characterization, the use of
biochemical techniques has allowed great advances to be
made in understanding inter- and intraspecific variation in
Colletotrichum. For example, isoenzyme analysis showed
that isolates of C. coccodes could be distinguished from
other species of Colletotrichum pathogenic to strawber-
ries, but no intraspecific isozyme variation was evident
within C. coccodes (Bonde et al., 1991). Several molecu-
lar studies have used random fragment length polymor-
phism (RFLP), ribosomal coding nuclear DNA (rDNA)
sequence analysis, and random amplified polymorphic
DNA (RAPD) assays to investigate the systematics of
Colletotrichum. Fingerprints generated using RAPD ana-
lysis with four primers permitted reliable differentiation
between isolates of 10 species of Colletotrichum (Freeman
et al., 1993). New species groupings in the genus were
proposed based on rDNA sequence analysis, and a clear
relationship between morphological and molecular data
was demonstrated by Sherriff et al. (1994). Molecular
6 A. K. Lees & A. J. Hilton
characterization of Colletotrichum species has been per-
formed, including C. acutatum, C. gloeosporioides and C.
fragariae from strawberry plants (Buddie et al., 1999) and
C. graminicola from turfgrass (Backman et al., 1999).
Amplified fragment length polymorphism (AFLP) is a
powerful technique because it generates numerous DNA
fragments from small quantities of initial template DNA;
can determine the genetic and molecular basis of biologi-
cal phenomena in phytopathogenic fungi; and is repro-
ducible (O’Neill et al., 1997). AFLP has been used for the
genetic characterization of Colletotrichum pathogens of
alfalfa (O’Neill et al., 1997). This study showed that the
diversity detected within Colletotrichum species by AFLP
was consistent with previously published taxonomy based
on morphology, rDNA sequence and RAPD analysis. A
similar study of C. coccodes from potato would reveal
whether isolates from different geographical regions differ
or are clonal. Preliminary evidence from AFLP studies
suggests there is little variation between isolates of C. coc-
codes obtained from potato (A. K. L. and A. J. H., unpub-
lished data).
Isolation, detection and identification
Detection of C. coccodes in plant and soil samples has so
far been based on conventional isolation techniques
followed by identification of the fungus on the basis of
morphology and host specialization (Sutton, 1992). A
selective medium was developed by Farley (1972) for the
isolation and enumeration of C. coccodes from soils, and
could be used to recover the pathogen from artificially and
naturally infested soil and from overwintered tomato
skins. Later work by Platt & Bollen (1995) described the
use of selective media for the isolation of Verticillium and
C. coccodes from potato stems, and demonstrated that
recovery of the pathogens was dependent on the selective
media used. Isolation of fungi by the use of selective media
still requires identification of the species isolated, does not
provide a truly quantitative measure of pathogen inci-
dence, and is time-consuming. Similarly, a bioassay for the
detection of C. coccodes in soils was recently described by
Carnegie et al. (2003), who showed that determining
plant infestation based on the occurrence of infected bait
plant roots was a sensitive method for the detection and
quantification of inoculum, especially in naturally infested
soils with a low level of infestation. However, this test
requires a 9 –12-week baiting period before results are
obtained. A significant improvement in identification
and classification of fungi has come from RFLP, poly-
merase chain reaction (PCR), RAPD and rDNA sequence
analysis.
PCR is a diagnostic method widely used for the detec-
tion of plant pathogenic fungi (Miller, 1996), including
a range of seed and soilborne potato pathogens such
as Helminthosporium solani (McKay & Cooke, 1997;
Olivier & Loria, 1998; Cullen et al., 2001: Errampalli
et al., 2001a), Spongospora subterrranea (Bulman &
Marshall, 1998; Bell et al., 1999), and Rhizoctonia solani
(Lees et al. 2002).
Epidemiological studies are reliant on methods to quan-
tify pathogens, and real-time PCR is a quantitative detec-
tion method based on a modified PCR technique. The
assay uses two primers and an additional dual-labelled
fluorogenic probe to allow the continuous monitoring of
amplicon synthesis during thermocycling, and requires
no post-PCR sample handling for target quantification
(Orlando et al., 1998).
PCR and real-time PCR tests have been developed
recently for the sensitive, specific and quantitative detec-
tion of C. coccodes from potato tissue and soil (Cullen
et al., 2002). Two sets of primers were designed to
sequences within the ITS1/ITS2 regions of C. coccodes
isolates described by Sreenivasaprasad et al. (1996).
Outer primers Cc1F1 (ACCTAACTGTTGCTTCGGCG)
and Cc2R1 (AAATTTGGGGGTTTTACGGC), and
nested primers (which allow increased sensitivity of
detection in a second round of PCR amplification)
Cc1NF1 (TGCCGCCTGCGGACCCCCCT) and Cc2NR1
(GGCTCCGAGAGGGTCCGCCA), were shown to be
specific to C. coccodes when tested against a wide range
of other fungal and bacterial plant pathogens including
eight other Colletotrichum species (C. acutatum, C.
capsici, C. dematium, C. fragariae, C. gloeosporioides, C.
graminicola, C. linicola and C. trifolii) representing the
six phylogenetic groups of the genus. The sensitivity of
this assay using the nested PCR approach was the equiv-
alent of 0·12 sclerotia g−1 soil.
Real-time PCR primers CcTqF1 (TCTATAACCCTTT-
GTGAACATACCTAACTG) and CCTqR1 (CACTCA-
GAAGAAACGTCGTTAAAATAGAG) and a probe
CcTqP1 (CGCAGGCGGCACCCCCT) were also shown
to be specific to C. coccodes. The real-time assay was able
to detect DNA of C. coccodes to femtogram levels in soil
samples. Low levels of inoculum in fields can hinder
sensitive detection, but the C. coccodes diagnostic test
has been shown to be efficient in detecting C. coccodes in
naturally infested soils and is being used as a tool to study
the epidemiology of the disease.
Ecology and its epidemiological consequences
The potential of seed tubers infected by C. coccodes to
cause disease was first shown in Canada (Dickson, 1926).
When infected seed tubers were planted in the field, plants
grew poorly while stems and daughter (progeny) tubers
displayed disease symptoms. Similarly, when tubers of
once-grown stocks of cvs Desirée and Pentland Crown
were selected according to the severity of black dot and then
sown in the field, the daughter tubers from severely infected
seed showed significantly more disease than on those
plants from black dot-free tubers (Read & Hide, 1995a).
Dashwood et al. (1992) found that the overall frequency
of infection by C. coccodes in roots of plants grown from
seed tubers was twice as high as that found in the roots
of micropropagated plants, indicating that tuber-borne
inoculum contributed significantly to the infection level.
Evidence of the scale of seed tuber-borne inoculum as a
source of infection can be obtained from disease surveys
© 2003 BSPP Plant Pathology (2003) 52, 3– 12
 Black dot disease of potato
of tubers for planting: C. coccodes was readily isolated
from two stocks of certified seed tubers of cultivar Sup-
erior in Indiana, USA, when sections of tuber were plated
onto the selective medium potato–dextrose–tergitol agar
(Komm & Stevenson, 1978). A larger survey of the inci-
dence of C. coccodes on potato seed tubers was conducted
in Washington State, USA ( Johnson et al., 1997). In this
study, 1 cm slices of periderm and medulla of tubers were
plated onto a potato extract medium and the incidence of
C. coccodes isolation following 2 weeks incubation at
23°C was measured. The incidence of C. coccodes in lots
of certified seed originating from nine states in the USA
and two provinces in Canada ranged from 0 to 90% in
1994, and from 0–53% in 1995.
It is believed that potato seed tubers are an important
factor in the introduction of the pathogen to noninfested
fields. Once soil is infested, it can then act as an effective
source of inoculum. Colonization of tubers by C. coccodes
was highly correlated with the number of colony-forming
units found in the soil, and four isolates of C. coccodes
obtained from soil all caused symptoms on leaves of
potato following artificial inoculation, suggesting a signif-
icant role of soilborne infection on disease (Barkdoll &
Davis, 1992). A soil and tuber survey conducted in Idaho,
USA showed that C. coccodes was isolated from all the
potato fields surveyed in 1988, but was not found in areas
of native vegetation (Barkdoll & Davis, 1992). Other
work has shown that when clean seed was sown in a field
artificially inoculated with C. coccodes, daughter tubers
had significantly more disease than control plants grown
in uninoculated soil (Read & Hide, 1988).
Colletotrichum coccodes survives long-term in the field
in the form of sclerotia on seed tubers and crop debris,
and in soil. Fifty-three per cent of sclerotia of C. coccodes
buried at a depth of 2·5 cm in a loam soil in seed trays and
maintained in a moist state for 83 weeks in a glasshouse
remained viable (Blakeman & Hornby, 1966). In con-
trast, no conidia survived for more than 3 weeks when a
spore suspension was applied to an adhesive mesh and
buried in garden soil. More recently, a field study in New
York, USA investigated the effect of placing sclerotia of C.
coccodes obtained from tomato on the surface of the soil,
or buried to depths of 10 and 20 cm below the soil surface.
After 8 years, 55, 91 and 92% of sclerotia (surface, 10 cm,
20 cm, respectively) were found to be viable (Dillard &
Cobb, 1998). Recent results (Cullen et al., 2002) using a
PCR-based detection technique showed that C. coccodes
was detectable in naturally infested field soils collected
from three different UK sites that had not been planted
with potatoes for 5, 8 and 13 years. The viability of the
inoculum from all three sites was confirmed using baiting
tests. This evidence suggests that once soil is infested,
soilborne inoculum becomes the predominant source of
infection.
In semiarid regions, frequent wind storms early in the
growing season have the potential to distribute C. coc-
codes widely (Johnson, 1994). Other reports [Mohan
et al., 1992; Johnson & Miliczky, 1993a; Tsror (Lahkim)
et al., 1999b] suggest that C. coccodes should also be
© 2003 BSPP Plant Pathology (2003) 52, 3 –12
7
classified as an airborne pathogen. Other potential
sources of inoculum include crop debris and alternative
host plants. When disease-free seed tubers were sown in
the field, and dried stem pieces infected with C. coccodes
were applied to growing plants, premature death of the
plants occurred and sclerotia developed on the stems
(Dickson, 1926). Although this experiment showed the
potential for sclerotia surviving on crop debris to cause
disease, it is unclear how long this inoculum can survive
on plant material and whether it would represent a sign-
ificant source of inoculum in a crop rotation.
Some alternative hosts have been identified that may
provide a source of inoculum of C. coccodes (Raid &
Pennypacker, 1987; Eberlein et al., 1991). Four C. coccodes
isolates that produced lesions on potato foliage also colon-
ized eastern black and hairy nightshade, although some
caused no symptoms (Eberlein et al., 1991), thus indicat-
ing that these plants may serve as sources of primary inoc-
ulum for isolates that are pathogenic to potato. However,
the complete host range of C. coccodes is as yet unknown.
In view of its ability to infect alternative hosts, con-
siderable work has been carried out (Wymore et al., 1988;
Yu et al., 1997) to examine the possibilities of using C.
coccodes as selective postemergence bioherbicide to
control velvetleaf (Abutilon theophrasti), a major annual
weed of wheat and soybeans in North America.
Controlling black dot
Cultural control
Crop rotation can be used to reduce levels of inoculum
of a number of soilborne pathogens (Honeycutt et al.,
1996). However, when potatoes were grown in two-,
four- and six-course rotations with spring barley between
1982 and 1988, previous cropping was found not to affect
the incidence of black dot (Hide & Read, 1991). Reducing
the level of potential inoculum can also be achieved by
controlling other hosts of C. coccodes. Raid & Pennypacker
(1987) identified 15 weed species in Pennsylvania, USA
that could be infected when plants were inoculated at
the seedling, vegetative or senescent stages. Further
research is necessary to determine the role of weeds as
hosts and inoculum sources in nature before control
strategies can be made.
Crop rotation and other measures designed to reduce
soilborne inoculum of C. coccodes may be of limited value
because of reintroduction of the pathogen on potato seed
stocks (Komm & Stevenson, 1978). Pre-plant solarization
and mouldboard ploughing were shown to be effective in
the control of C. coccodes, with crops showing a 45%
reduction in disease incidence when solarization/tarping
was carried out for 8 weeks and temperatures reached
56°C in the top 5 cm of the soil. Mouldboard ploughing
to a depth of 30 cm reduced black dot by 34%, and was
twice as effective as ploughing to 60 cm (Denner et al.,
2000).
As development of black dot symptoms coincides with
haulm senescence, it is speculated that the method of
8 A. K. Lees & A. J. Hilton
haulm destruction may play a role in disease reduction. In
field experiments, the supplementation of chemical haulm
destruction with root cutting resulted in a lower incidence
of black scurf (Dijst et al., 1986). Early harvesting of
crops also reduces the severity of tuber diseases (Hide
& Boorer, 1991; Hide et al., 1994). As infection of dau-
ghter tubers by C. coccodes occurs early in the season
( J. E. Danaher and A. J. H., unpublished data), early harvest-
ing of the crop can reduce the length of time the tubers are
in contact with the infested soil.
Chemical control
As no specific fungicides have been developed to control
black dot in potatoes, studies have focused on the poten-
tial of seed treatments used for other seedborne patho-
gens, such as R. solani and H. solani. At present, chemical
control of black dot is best described as ineffective. In the
past, mercurial fungicides gave effective postharvest con-
trol of black dot ( Jellis & Taylor, 1974), but these chemi-
cals are no longer acceptable in modern agriculture. More
recently, in South Africa, naturally infected seed tubers of
cv. Vanderplank were dipped in the fungicides prochloraz,
thiabendazole, captofal, chloramizol sulphate and com-
binations of each, before being planted in the field (Marais,
1990). Although a mixture of chloramizol sulphate and
prochloraz significantly reduced the severity of black dot
on daughter tubers compared with the control, none of
the other treatments showed any effect. In the UK, Read
& Hide (1995b) assessed the efficacy of eight fungicides
including pencycuron, which is effective at controlling
black scurf (Adams & Malcolm, 1988), and thiabenda-
zole, which is effective at controlling silver scurf (Hide
et al., 1980). To ensure that only the effect of seedborne
inoculum was assessed, tubers infected with C. coccodes
were immersed in fungicide before being planted in a field
where potatoes had not been grown for 17 years. Fenpi-
clonil significantly decreased the amount of black dot
compared with the control, but the other fungicides tested
had no effect. However, these workers found that
when four isolates of C. coccodes were grown on media
amended with fenpiclonil (> 5 mg L−1), insensitive sectors
were formed. Similarly, Uribe & Loria (1994) found
resistant sectors growing from inhibited colonies of C.
coccodes when grown on media amended with fenpiclonil,
and suggested this was due to spontaneous mutation.
Soil fumigants can also be used to control fungal soil-
borne inoculum in the field. In a field experiment in South
Africa, the soil fumigant methyl bromide applied at
126 g m−2 reduced the incidence of black dot from 41% in
unfumigated soils to 1% in fumigated soil (Denner et al.,
1998). However, the use of soil fumigants on a large scale
is unlikely to be economically acceptable.
Cultivar resistance
At present, little information is available on the levels of
naturally occurring resistance to black dot in commercial
potato cultivars. In field surveys, early cultivars are
generally more susceptible to the disease than later-
maturing genotypes (Read, 1991; Andrivon et al., 1997).
A more detailed study found that the symptoms of black
dot that developed on the roots, stems and tubers of
cultivar Bintje (second early) were more severe than those
on the maincrop cultivar Roseval (Andrivon et al., 1998).
These authors speculated that the more vigorous growth
of Roseval enabled the stems and stolons of infected
plants to grow away more rapidly from the inoculum
source, and suggested that protocols based on root
investigation may be useful for investigating cultivar
response to black dot and pathogenicity of C. coccodes
isolates.
In a survey conducted in the USA, black dot symptoms
were more common on tubers of thin-skinned than thick-
skinned (Russett-type) cultivars (Hunger & McIntyre,
1979). However, as Russett-type cultivars are not popular
for table consumption in Europe, use of these cultivars is
unlikely to provide a suitable control option. Read (1991)
believed that skin discoloration caused by black dot was
more noticeable on white-skinned rather than red-skinned
cultivars. This is in contrast to observations by Jellis &
Taylor (1974), who suggested that the disease was more
noticeable on coloured tubers.
In field experiments in the UK, significant differences
between black dot disease symptom severity on daughter
tubers of 12 (1987) and 15 (1988) commercial potato
cultivars was observed when disease-free seed was sown
in naturally and artificially infected soils (Read, 1991).
The cultivars Desirée, Maris Piper, Maris Peer and Record
were among those cultivars severely affected by disease,
whereas Cara, Pentland Crown and Romano were the
least affected. Tsror (Lahkim) et al. (1999b) found that
cultivars Cara and Nicola were less susceptible to tuber
infection than Alpha, Desirée and Agria.
In future, understanding the mechanisms behind
resistance should provide information that will assist in
producing cultivars with improved disease resistance.
Standard methods have been developed to identify resist-
ance to black dot under controlled environmental con-
ditions (Gans et al., 2002; A. J. H. and A. K. L., unpublished
data). These tests will allow the genetic basis of resistance
to be studied, and therefore cultivars with improved levels
of resistance to black dot to be produced.
Storage conditions
Following harvest, potato tubers may be stored for up to
9 months before use. The first stage of storage in the UK
is dry curing, which involves blowing air at 15°C through
boxes for 10 –14 days, and is important to reduce the
excess moisture that can encourage the development of
silver scurf (Hardy et al., 1997) and contamination with
Erwinia spp. (Pringle & Robson, 1996). Drying potatoes
for 2 weeks after harvest reduced black dot symptoms in
store compared with potatoes that were placed in a damp
plastic bag, but reducing humidity in store from 95 to
75% had no effect on reducing black dot development
(Hide & Boorer, 1991). This suggests that condensation
© 2003 BSPP Plant Pathology (2003) 52, 3– 12
 Black dot disease of potato
on the surface of the tubers rather than relative humidity
encourages symptom development. Dry curing has been
shown to be particularly effective in reducing the disease
in store when tubers are harvested in wet conditions and
come into the store covered in mud. It is thought that
drying reduces the development of disease from recent
infections, and also the number of new infections initiated
from inoculum in the soil (Hide et al., 1994). Work carried
out to assess the effects of storage conditions on disease
incidence (Mawson, 1999) found that prevention of con-
densation during storage decreased levels of silver scurf,
but increased levels of black dot on tubers. The author
speculated that as both pathogens were present at high
levels, competition between the pathogens might have
resulted in an increase in black dot. This is supported by
the work of Hide & Hall (1993), who found that black dot
increased when silver scurf was constrained by imazalil
treatment.
Summary and future developments
The increasing importance of black dot can largely be
attributed to changes in consumer practices. In the past,
potatoes were bought predominantly from traditional
greengrocers where produce tends to be sold loose and
unwashed. In supermarkets, however, potatoes are sold
freshly washed in packs, making appearance critical. As
an increasing number of people shop in supermarkets and
are willing to pay the additional cost for washed potatoes,
growers will have to continue to produce potatoes with
high skin quality in order to attract premium prices.
Unless supermarket demand for blemish-free potatoes
changes, the pressure to control diseases such as black dot
and silver scurf will continue. In addition, underestima-
tion of the amount of disease caused by black dot, and the
growing use of fungicides to control silver scurf, may
also have contributed to the increasing importance of the
disease.
Twenty years ago it was thought that planting clean
seed could reduce the severity of blemish diseases on
daughter tubers, but because soils were likely to become
increasingly contaminated with inoculum of these patho-
gens, other methods of control would have to be found in
the future (Hide & Adams, 1980). The realization of this
prediction may be reflected in the increasing reports of
disease problems caused by C. coccodes, and it is now
thought that soilborne inoculum is the main source of the
disease problem in the UK.
Despite the common occurrence of tuber-blemishing
diseases caused by C. coccodes and H. solani, limited
information is available on the control of these diseases.
In order to develop improved disease control strategies,
there are several areas of disease epidemiology that
require further investigation, including the relationship
between seedborne and soilborne inoculum of C. coc-
codes, and the quantitative contribution of these sources.
Using PCR and real-time PCR tests to quantify levels of C.
coccodes on seed tubers and in soil will provide answers
to these questions (Cullen et al., 2002). In the future these
© 2003 BSPP Plant Pathology (2003) 52, 3 –12
9
methods could also be used to provide growers with a
measure of C. coccodes levels on seed stocks and in the
field, and therefore to make decisions regarding disease
prevention or control strategies such as avoiding planting
susceptible cultivars in fields with a high risk of disease
caused by soilborne C. coccodes.
At present, no chemical is available to control seed or
soilborne inoculum of C. coccodes effectively (Marais,
1990). The identification of such a chemical would offer
a short-term solution to disease control, whereas growing
cultivars with resistance would be more environmentally
acceptable. Present-day cultivars possess only limited
resistance to black dot, and new sources of resistance
would have to be identified, possibly among wild Sola-
num species. As it can take 8–10 years for new cultivars
of potato to be developed, growing crops with improved
host resistance would be a long-term prospect. Until other
methods are found, cultural practices that reduce sym-
ptom development must be utilized. Many growers and
packers are now more aware of controlling storage
temperature in order to maintain potato quality and, as a
result, refrigerated potato stores that reduce the risk of
condensation are now being used widely. Other options
include early harvesting of crops at risk of black dot to
avoid symptom development; and, in areas where soils are
contaminated, increasing the length of time between
potato crops in order to reduce levels of inoculum. When
new chemical products and cultivars are developed, these
should be used not in isolation, but as part of an inte-
grated approach incorporating risk assessment through
diagnostics, cultural control methods in the field, and the
use of appropriate potato storage conditions.
Acknowledgements
A. K. Lees is funded by the Scottish Executive Environment
and Rural Affairs Department (SEERAD). A. J. Hilton
conducted research on potato skin blemish diseases
funded by the British Potato Council while at the Scottish
Crop Research Institute.
References
Adams NM, Malcolm AJ, 1988. Control of Rhizoctonia solani
in potatoes in the UK with pencycuron. Proceedings of the
Brighton Crop Protection Conference, Pests and Diseases.
Farnham, Surrey, UK: BCPC, 959–64.
Andrivon D, Ramage K, Guérin C, Lucan M, Jouan B, 1997.
Distribution and fungicide sensitivity of Colletotrichum
coccodes in French potato-producing areas. Plant Pathology
46, 722–8.
Andrivon D, Lucas JM, Guérin C, Jouan B, 1998. Colonization
of roots, stolons, tubers and stems of various potato (Solanum
tuberosum) cultivars by the black dot fungus Colletotrichum
coccodes. Plant Pathology 47, 440 –5.
Anonymous, 1998. Quality. Eyewitness 1, 13.
Backman PA, Landschoot PJ, Huff DR, 1999. Variation in
pathogenicity, morphology, and RAPD marker profiles in
Colletotrichum graminicola from turfgrasses. Crop Science
39, 1129 –35.
10 A. K. Lees & A. J. Hilton
Barkdoll AW, Davis JR, 1992. Distribution of Colletotrichum
coccodes in Idaho and variation in pathogenicity on potato.
Plant Disease 76, 131–5.
Bell KS, Roberts J, Verrall S, Cullen DW, Williams NA,
Harrison JG, Toth IK, Cooke DEL, Duncan JM, Claxton JR,
1999. Detection and quantification of Spongospora
subterranea f. sp. subterranea in soils and on tubers using
specific PCR primers. European Journal of Plant Pathology
105, 905–15.
Blakeman JP, Hornby D, 1966. The persistence of
Colletotrichum coccodes and Mycosphaerella ligulicola in
soil, with special reference to sclerotia and conidia.
Transactions of the British Mycological Society 49, 227 –40.
Bonde MR, Peterson GL, Maas JL, 1991. Isozyme comparisons
for identification of Colletotrichum species pathogenic to
strawberry. Phytopathology 81, 1523– 8.
Bradshaw NJ, Turner JA, Elcock SJ, 2002. Potatoes, A Survey of
Diseases, 2000. ADAS/CSL Research and Development
Publication. London: Department for the Environment, Food
and Rural Affairs.
Bremer H, 1954. Beobachtungen zur Würzelfäule im
Trockenklima. Zeitschrift für Pflanzenkrankeiten und
Pflanzenschutz 61, 575– 87.
Buddie AG, Martinez-Culebras P, Bridge PD, Garcia MD,
Querol A, Cannon PF, Monte E, 1999. Molecular
characterization of Colletotrichum strains derived from
strawberry. Mycological Research 103, 385– 94.
Bulman SR, Marshall JW, 1998. Detection of Spongospora
subterranea in potato tuber lesions using the polymerase
chain reaction (PCR). Plant Pathology 47, 759–66.
Carnegie SJ, Choiseul JW, Roberts AMI, 2003. Detection of
Colletotrichum coccodes and Helminthosporium solani in
soils by bio-assay. Plant Pathology 52, 13–21.
Chesters CGC, Hornby D, 1965a. Studies on Colletotrichum
coccodes 1. The taxonomic significance of variation in isolates
from tomato roots. Transactions of the British Mycological
Society 48, 573– 81.
Chesters CGC, Hornby D, 1965b. Studies on Colletotrichum
coccodes 2. Alternative host tests and tomato fruit
inoculations using a typical tomato root isolate. Transactions
of the British Mycological Society 48, 583– 94.
Cullen DW, Lees AK, Toth IK, Duncan JM, 2001. Conventional
PCR and real-time quantitative PCR detection of
Helminthosporium solani in soil and on potato tubers.
European Journal of Plant Pathology 107, 387–98.
Cullen DW, Lees AK, Toth IK, Duncan JM, 2002. Detection of
Colletotrichum coccodes from soil and potato tubers by
conventional PCR and real-time quantitative PCR. Plant
Pathology 51, 281– 92.
Dashwood EP, Fox RA, Perry DA, 1992. Effect of inoculum
source on root and tuber infection by potato blemish disease
fungi. Plant Pathology 41, 215–23.
Davis JR, Johnson DA, 2002. Diseases caused by fungi – black
dot. In: Stevenson WR, Loria R, Franc GD, Weingartner DP,
eds. Compendium of Potato Diseases. St Paul, MN, USA: APS
Press, 16–8.
Denner FDN, Marais L, 1989. Silver scurf and anthracnose on
potatoes. South African Journal of Science 85, 673.
Denner FDN, Millard CP, Geldenhuys A, Wehner FC, 1997.
Treatment of seed potatoes with prochloraz for simultaneous
control of silver scurf and black dot on daughter tubers.
Potato Research 40, 221–7.
Denner FDN, Millard CP, Wehner FC, 1998. The effect of seed-
and soil-borne inoculum of Colletotrichum coccodes on the
incidence of black dot on potatoes. Potato Research 41, 51– 6.
Denner FDN, Millard CP, Wehner FC, 2000. Effect of soil
solarization and mouldboard ploughing on black dot of
potato, caused by Colletotrichum coccodes. Potato Research
43, 195 –201.
Dickson BT, 1926. The black dot disease of potato.
Phytopathology 16, 23 –40.
Dijst G, Bouman A, Mulder A, Roosjen J, 1986. Effect of haulm
destruction supplemented by cutting off roots on the
incidence of black scurf and skin damage, flexibility of harvest
period and yield of seed potatoes in field experiments.
Netherlands Journal of Plant Pathology 92, 287 –303.
Dillard HR, 1988. Influence of temperature, pH, osmotic
potential, and fungicide sensitivity on germination of conidia
and growth from sclerotia of Colletotrichum coccodes in
vitro. Phytopathology 78, 1357 –61.
Dillard HR, 1989. Effect of temperature, wetness duration and
inoculum density on infection and lesion development of
Colletotrichum coccodes on tomato fruit. Phytopathology 79,
1063 –6.
Dillard HR, 1992. Colletotrichum coccodes: the pathogen and
its hosts. In: Bailey JA, Jeger MJ, eds. Colletotrichum: Biology,
Pathology and Control. Wallingford, UK: CAB International,
225 –36.
Dillard HR, Cobb AC, 1998. Survival of Colletotrichum
coccodes in infected tomato tissue and in soil. Plant Disease
82, 235 –8.
Ducomet V, 1908. Une nouvelle maladie de la pomme de terrre:
la ‘dartose’. Annales de l’Ecole Nationale d’Agriculture de
Rennes 2, 24 –47.
Eberlein CV, Barkdoll AW, Davis JR, 1991. Pathogenicity of
Colletotrichum coccodes isolates to potato (Solanum
tuberosum) and two nightshade (Solanum spp.) species. Weed
Technology 5, 570 –4.
Errampalli D, Saunders J, Cullen DW, 2001a. A PCR-based
method for detection of potato pathogen, Helminthosporium
solani, in silver scurf infected tuber tissue and soils. Journal of
Microbiological Methods 44, 59 –68.
Errampalli D, Saunders JM, Holley JD, 2001b. Emergence of
silver scurf (Helminthosporium solani ) as an economically
important disease of potato. Plant Pathology 50, 141–53.
Farley JD, 1972. A selective medium for assay of Colletotrichum
coccodes in soil. Phytopathology 62, 1288 –93.
Firman DM, Allen EJ, 1993. Effects of windrowing, irrigation
and defoliation of potatoes on silver scurf (Helminthosporium
solani) disease. Journal of Agricultural Science 121, 47 – 53.
Freeman S, Pham M, Rodriguez RJ, 1993. Molecular
genotyping of Colletotrichum based on arbitrarily primed
PCR, A+T rich DNA and nuclear DNA analyses.
Experimental Mycology 17, 309 –22.
Gans PT, Vaughan JE, Thomas JE, 2002. The evaluation of
potato cultivar resistance to fungal diseases causing tuber
blemishes. In: Crop Protection in Northern Britain. Farnham,
Surrey, UK: British Crop Protection Council, 263 –8.
Hardy CE, Burgess PJ, Pringle RT, 1997. The effect of
condensation on sporulation of Helminthosporium solani on
potato tubers infected with silver scurf and held in simulated
store conditions. Potato Research 40, 169 –80.
Harrison DE, 1963. Black dot disease of potato. Journal of
Agriculture Victoria 61, 573 –6.
© 2003 BSPP Plant Pathology (2003) 52, 3– 12
 Black dot disease of potato
Hide GA, Adams MJ, 1980. Relationships between disease
levels on seed tubers, on crops during growth and in stored
potatoes. 3. Silver scurf. Potato Research 23, 229– 40.
Hide GA, Boorer KJ, 1991. Effects of drying potatoes (Solanum
tuberosum L.) after harvest on the incidence of disease after
storage. Potato Research 34, 133–7.
Hide GA, Hall SM, 1993. Development of resistance to
thiabendazole in Helminthosporium solani (silver scurf ) as a
result of potato seed tuber treatment. Plant Pathology 42,
707–14.
Hide GA, Read PJ, 1991. Effects of rotation length, fungicide
treatment of seed tubers and nematicide on diseases and the
quality of potato tubers. Annals of Applied Biology 119,
77 –87.
Hide GA, Cayley GR, Read PJ, Fraser JH, 1980. Treatment of
seed and ware potato tubers with thiabendazole for control of
storage diseases. Annals of Applied Biology 96, 119– 31.
Hide GA, Boorer KJ, Hall SM, 1994. Effects of watering potato
plants before harvest and of curing conditions on
development of tuber diseases during storage. Potato
Research 37, 169 –72.
Honeycutt CW, Clapham WM, Leach SS, 1996. Crop rotation
and N fertilization effects on growth, yield, and disease
incidence in potato. American Potato Journ 73, 45– 61.
Hunger RM, McIntyre GA, 1979. Occurrence, development,
and losses associated with silver scurf and black dot on
Colorado potatoes. American Potato Journal 56, 289– 306.
Illman WI, Ludwig RA, Farmer J, 1959. Anthracnose of canning
tomatoes in Ontario. Canadian Journal of Botany 37,
1237 –46.
Jellis GJ, Taylor GS, 1974. The relative importance of silver
scurf and black dot: two disfiguring diseases of potato tubers.
ADAS Quarterly Review 14, 53– 61.
Johnson DA, 1994. Effect of foliar infection caused by
Colletotrichum coccodes on yield of Russett Burbank potato.
Plant Disease 78, 1075– 8.
Johnson DA, Miliczky ER, 1993a. Effects of wounding and
wetting duration on infection of potato foliage by
Colletotrichum coccodes. Plant Disease 77, 13–7.
Johnson DA, Miliczky ER, 1993b. Distribution and
development of black dot, verticillium wilt and powdery scab
on Russet Burbank potatoes in Washington state. Plant
Disease 77, 74 –9.
Johnson DA, Rowe RC, Cummings TF, 1997. Incidence of
Colletotrichum coccodes in certified potato seed tubers
planted in Washington State. Plant Disease 81, 1199– 202.
Kendrick JB Jr, Walker JC, 1948. Anthracnose of tomato.
Phytopathology 38, 247– 60.
Komm DA, Stevenson WR, 1978. Tuber-borne infection of
Solanum tuberosum ‘Superior’ by Colletotrichum coccodes.
Plant Disease Reporter 62, 682–7.
Lees AK, Cullen DW, Sullivan L, Nicolson MJ, 2002.
Development of conventional and quantitative real-time PCR
assays for the detection and identification of Rhizoctonia
solani AG-3 in potato and soil. Plant Pathology 51, 293–302.
Marais L, 1990. Efficacy of fungicides against Colletotrichum
coccodes on potato tubers. Potato Research 33, 275– 81.
Mawson K, 1999. Drying for Disease Control in Store. Interim
Project Report for the British Potato Council. Oxford, UK:
British Potato Council, 1–17.
McIntyre GA, Rusanowski C, 1975. Scanning electron
microscope observations of the development of sporophores
© 2003 BSPP Plant Pathology (2003) 52, 3 –12
11
of Colletotrichum atrementarium on infected potato
periderm. American Potato Journal 52, 269 –75.
McKay GJ, Cooke LR, 1997. A PCR-based method to
characterise and identify benzimidazole resistance in
Helminthosporium solani. FEMS Microbiology Letters 152,
371–8.
Miller SA, 1996. Detecting propagules of plant pathogenic
fungi. Advances in Botanical Research Incorporating
Advances in Plant Pathology 23, 73 –102.
Mohan SK, Davis JR, 1987. Pathogenic potential of
Colletotrichum coccodes on potato: some new evidence.
American Potato Journal 64, 449.
Mohan SK, Davis JR, Sorensen LH, Schneider AT, 1992.
Infection of aerial parts of potato plants by Colletotrichum
coccodes and its effects on premature vine death and yield.
American Potato Journal 69, 547 –59.
Mordue JEM, 1967. Colletotrichum coccodes. CMI
Descriptions of Pathogenic Fungi and Bacteria, no. 131. Kew,
UK: Commonwealth Agricultural Bureau.
Nitzan N, Hazanovsky M, Tal M, Tsror (Lahkim) L, 2002.
Vegetative compatability groups in Colletotrichum coccodes,
the causal agent of black dot on potato. Phytopathology 92,
827 –32.
O’Neill NR, van Berkum P, Lin JJ, Kuo J, Ude GN, Kenworthy
W, Saunders JA, 1997. Application of amplified restriction
length polymorphism for genetic characterization of
Colletotrichum pathogens of alfalfa. Phytopathology 87,
745 –50.
Olivier C, Loria R, 1998. Detection of Helminthosporium solani
from soil and plant tissue with species-specific PCR primers.
FEMS Microbiology Letters 168, 235 –41.
Orlando C, Pinzani P, Pazzagli M, 1998. Developments in
quantitative PCR. Clinical Chemistry and Laboratory
Medicine 36, 255 –69.
Platt HW, Bollen GJ, 1995. The influence of isolation procedure
on recovery of Verticillium species and Colletotrichum
coccodes from colonized potato stems. Mycological Research
99, 942 –4.
Powelson ML, Rowe RC, 1993. Biology and management of
early dying of potatoes. Annual Review of Phytopathology
31, 111–26.
Pringle RT, Robson K, 1996. Storage of seed potatoes in
pallet boxes. 1. The role of tuber surface moisture on the
population of Erwinia bacteria. Potato Research 39,
205 –22.
Raid RN, Pennypacker SP, 1987. Weeds as hosts for
Colletotrichum coccodes. Plant Disease 71, 643 –6.
Read PJ, 1991. The susceptibility of tubers of potato cultivars to
black dot [Colletotrichum coccodes (Wallr.) Hughes]. Annals
of Applied Biology 119, 475 –82.
Read PJ, Hide GA, 1988. Effects of inoculum source and
irrigation on black dot disease of potatoes [Colletotrichum
coccodes (Wallr.) Hughes] and its development during
storage. Potato Research 31, 493 –500.
Read PJ, Hide GA, 1995a. Development of black dot disease
[Colletotrichum coccodes (Wallr.) Hughes] and its effects on
the growth and yield of potato plants. Annals of Applied
Biology 127, 57 –72.
Read PJ, Hide GA, 1995b. Effects of fungicides on the growth
and conidial germination of Colletotrichum coccodes and on
the development of black dot disease of potatoes. Annals of
Applied Biology 126, 437 –47.
12 A. K. Lees & A. J. Hilton
Read PJ, Storey RMJ, Hudson DR, 1995a. A survey of black dot
and other fungal tuber blemishing diseases in British potato
crops at harvest. Annals of Applied Biology 126, 249 –58.
Schmiedeknecht M, 1956. Untersuchungen des Parasitismus
von Colletotrichum atrementarium (B. et Br.) Taub an
Kartoffelstauden (Solanum tuberosum L.).
Phytopathologische Zeitschrift 26, 1–30.
Sedegui M, Carroll RB, Morehart AL, Whittington DP, 2000.
Etiology of potato early dying in Delaware. American Journal
of Potato Research 77, 289– 94.
Sherriff C, Whelan MJ, Arnold GM, Lafay JF, BrygooY,
Bailey JA, 1994. Ribosomal DNA-sequence analysis reveals
new species groupings in the genus Colletotrichum.
Experimental Mycology 18, 121– 38.
Sreenivasaprasad S, Mills PR, Meehan BM, Brown AE, 1996.
Phylogeny and systematics of 18 Colletotrichum species based
on ribosomal DNA spacer sequences. Genome 39, 499 –512.
Sutton BC, 1992. The genus Glomerella and its anamorph
Colletotrichum. In: Bailey JA, Jeger MJ, eds. Colletotrichum:
Biology, Pathology and Control. Wallingford, UK: CAB
International, 1– 26.
Thirumalachar MJ, 1967. Pathogenicity of Colletotrichum
atramentarium on some potato varieties. American Potato
Journal 44, 241– 4.
Tsror (Lahkim) L, Hazanovsky M, 2001. Effect of coinoculation
by Verticillium dahliae and Colletotrichum coccodes on
disease symptoms and fungal colonization in four potato
cultivars. Plant Pathology 50, 483– 8.
Tsror (Lahkim) L, Erlich O, Hazanowsky M, Peretz I, 1994.
Colletotrichum on potato in Israel, is it a new disease?
Phytoparasitica 22, 88.
Tsror (Lahkim) L, Aharon M, Erlich O, 1999a. Survey of
bacterial and fungal seedborne diseases in imported and
domestic potato seed tubers. Phytoparasitica 27, 215 –26.
Tsror (Lahkim) L, Erlich O, Hazanovsky M, 1999b. Effect of
Colletotrichum coccodes on potato yield, tuber quality, and
stem colonization during spring and autumn. Plant Disease
83, 561 –5.
Tu JC, Poysa V, 1997. The diversity and overwintering of
Colletotrichum coccodes in tomato fields in southwestern
Ontario. Microbios 91, 368 –9.
Uribe E, Loria R, 1994. Response of Colletotrichum
coccodes to fungicides in vitro. American Potato Journal
71, 455 –65.
Wymore LA, Poirier C, Watson AK, Gotlieb AR, 1988.
Colletotrichum coccodes, a potential bioherbicide for
control of Velvetleaf (Abutilon theophrasti). Plant Disease
72, 534 –8.
Yu X, Hallett SG, Sheppard J, Watson AK, 1997. Application of
the Plackett–Burman experimental design to evaluate
nutritional requirements for the production of Colletotrichum
coccodes spores. Applied Microbiology and Biotechnology
47, 301–5.
Zitter TA, Hsu L, Halseth DE, 1989. Black Dot Disease of
Potato. Vegetable Crops Fact Sheet 725. Ithaca, NY, USA:
Cornell Cooperative Extension.
© 2003 BSPP Plant Pathology (2003) 52, 3– 12