Professional Documents
Culture Documents
5 Lesson8 Worksheets WithAnswers
5 Lesson8 Worksheets WithAnswers
5 Lesson8 Worksheets WithAnswers
Pre-Lesson Reading:
1. What is cell?
a. Cells are the basic building blocks of all living things.
b. Human body is composed of trillions of cells.
c. Cells provide structure for a body, take in nutrients from food, convert
nutrients into energy, and carry out specialised functions.
2. What is DNA?
d. DNA (deoxyribonucleic acid) is found in nearly every cell in the body. One
significant exception is red blood cells (lack nuclei).
1
Figure 1 A representation of DNA model
g. The DNA backbone is exactly the same in all people. On the other hand,
the rungs are different in people.
h. Each rung is made up of two bases that link together. There are four bases -
adenine (A), thymine (T), guanine (G) and cytosine (C). Because of their
chemical nature, A will only link with T and G will only link with C (i.e. A-
T; G-C). No base can join with itself (i.e. No A-A / T-T / G-G / C-C).
i. The order of the bases of DNA determines the information available for
building and maintaining an organism. This order is referred to as genetic
code.
j. Human DNA consists of about 3 billion bases, and more than 99 % of the
base sequence in DNA is the same in all people. Less than 1 % is unique to
each individual (except identical twins).
2
Lesson 8 DNA Fingerprinting
3
Lesson 8 DNA Fingerprinting
Objective of experiment:
mortar x 1
pestle x 1
beaker x 1
test tube x 1
muslin cloth
funnel x 1
glass rod x 1
toothpick x 1
strawberry x 2
salt (1/2 teaspoon)
ice-cold alcohol (about 10mL)
washing-up liquid (about 10mL)
tap water (about 30mL)
ice
Procedures:
1. Grind strawberries with a pestle in the mortar.
2. Add about 10 mL washing-up liquid, 1/2 teaspoon salt and approximately 30 mL
tap water to the grinded strawberries. Stir the mixture gently for 1 minute.
3. Filter the mixture through a muslin cloth into a test tube, about 1/3 full, to
separate strawberries from the clear liquid.
4. Double up the volume of the mixture by adding alcohol slowly into the test tube.
5. Leave the mixture undisturbed for 2-3 minutes in an ice-bath until no emergence
of bubbles.
6. Swirl a toothpick around the interface of the two layers formed inside the test
tube. Long and stringy threads can be picked up.
4
Discussions:
1. Can we extract DNA from other plants, say, onion, kiwi fruit, broccoli, banana
(without skin) with the same method? Why?
All the above plants have cells, and DNA is found in the nucleus. Therefore, we
can extract DNA from the plants with the same method.
2. At a crime scene what forensic evidence can you collect for the extraction of
DNA?
Blood, saliva, skin scalp, hair and etc. Because DNA is found in nearly every
cell in the body. But one significant exception is red blood cells which lack
nuclei.
Questions:
1. What is the purpose of grinding the strawberries?
To break down the cell wall, cellular membranes and nuclear membranes.
5
Sample output
6
Lesson 8 DNA Fingerprinting
Guess (i) the possible locations of DNA on the collected evidence from a crime scene
and (ii) the possible sources of DNA.
semen
Dirty laundry Surface area Blood, sweat, semen
Used cigarette Cigarette butt Saliva
Bottle, can, glass Sides, mouthpiece Saliva, sweat
Blanket, pillow, sheet Surface area Sweat, hair, semen, urine,
saliva
Bite mark Person’s skin Saliva
Fingernail, partial fingernail Scrapings Blood, sweat, tissue
7
Lesson 8 DNA Fingerprinting
GTAAGAATTCTTTAGAATTCCGCCATTATCGAATTCAGGATCTTAC
CATTCTTAAGAAATCTTAAGGCGGTAATAGCTTAAGTCCTAGAATG
a. How many times does the specified base sequence GAATTC appear?
b. How many fragments would result from a restriction digestion of the DNA
sample with the enzyme EcoRI?
c. List all the fragments formed.
2. Different restriction enzymes cut at different sites, two examples are listed
below:
Enzyme Cutting Site
HaeIII GGCC GGCC
CCGG
Bam HI GGATCC GGATCC
CCTAAGG
Now, you are provided with the following DNA sample:
GTAGGATCCACGGAAGCT TGCAGGCCGCGAATTCAGGCCATA
CATCCTAGGTGCCT TCGAACGTCCGGCGCT TAAGTCCGGTAT
8
Answers:
1. a. The sequence GAATTC appears three times in the DNA strand.
As a result, the strand is cut into four pieces.
b. The fragments are as follows:
GTAAG AATTCTTTAG AATTCCGCCATTATCG AATTCAGGATCTTAC
CATTCTTAA GAAATCTTAA GGCGGTAATAGCTTAA GTCCTAGAATG
GGCC
CCGG
9
Lesson 8 DNA Fingerprinting
1. A child inherits one set of chromosomes from each parent. This is why children
carry characteristics from both of their parents. A child who has mom with
brown hair and blue eyes and dad with blond hair and brown eyes might end up
with brown hair from his mom and brown eyes from his dad.
The Chan’s family consists of mom, dad and four kids. The parents have one
daughter and one son together, the other daughter is from the mother’s previous
marriage, and the other son is adopted. Here are the DNA analysis results:
In all cases, make use of DNA profile to explain your answers briefly.
10
2. There was a murder case. A blood sample from a crime scene was collected.
DNA samples of the victim and the potential suspects (June, Scarlet and John)
were collected for DNA analysis. The DNA profile is shown below. Now, you
should be able to identify the potential murderer.
11
Answers:
1. You can distinguish the parents of the children by looking at the position of the
bands in the DNA profile.
Child 2 is the child from the mother’s previous marriage and Child 4 is adopted.
You can see that both Child 1’s and Child 3’s DNA fragments match with both
of the mom and dad, while Child 2’s DNA fragments match with the mom but
not the dad, and Child 4’s DNA fragments do not match with either parent.
2. a. All of the DNA fragments (5, 7, 10, 13) found in the victim are present in
the sample from the crime scene.
b. John’s DNA fragments (10 and 7) are of the same size as those DNA
fragments in the crime scene. However, his other fragments (6, 4 and 3) are
missing in the crime scene sample, allowing him to be ruled out as a suspect.
c. June’s DNA fragments (8 and 12) are of the same size as those DNA
fragments in the crime scene. However, her other fragments (1 and 19) are
missing in the crime scene, allowing her to be ruled out as a suspect, too.
d. All of the DNA fragments (18, 12, 8 and 2) of Scarlet can be found in the
crime scene sample, thus making her the most likely suspect.
Extended discussion:
1. June and Scarlet have the same DNA fragments (8 and 12). What are the
possible implications?
Ans: This pattern may arise if the two women are related or if this pattern
were common in the population.
2. Why DNA evidence must be combined with the traditional forms of evidence
such as eyewitness accounts?
Ans: Someone’s DNA is found at a crime scene does not mean that they
committed the crime because of the following reasons:
(i) The DNA sample may be contaminated by the environment.
(ii) The sample may be a mixture of more than one person’s DNA.
(iii) The DNA evidence may be degraded or broken down.
12
Lesson 8 DNA Fingerprinting
1. Do white blood cells give more accurate test result for paternity than cheek
cells?
2. What are the legal and ethical issues on the use of DNA fingerprinting in
society?
3. DNA fingerprinting can be used to convict someone of a crime. What would
be the difficulty in using this technique to identify criminals if the suspects
were father and son? Twin brothers?
4. Other than forensic science, list out the other uses of DNA analysis. Describe
each use briefly.
Suggested answers:
1. No. Cheek cells that are collected using a swab yield results that are as accurate
as those obtained from the white blood cells in blood samples. The DNA is the
same, regardless of whether it is collected from cheek cells or white blood cells,
and no sample is “more accurate” than another. Buccal swab DNA samples are
not affected by the presence of bacteria or food. Bacterial DNA does not affect
the testing, as bacteria do not contain the human DNA sequences that are being
selected and amplified by polymerase chain reaction for examination.
2. This is an open-ended question. Issues surrounding the ownership of a DNA
fingerprinting should be mentioned, such as who should have access to the
results of fingerprint typing, and whether the police or government should be
entitled to keep a reference bank of the profiles of all citizens.
3. Father and son: More restriction enzymes would be needed to cut the DNA into
different fragments to show the different DNA fingerprints.
Twins: DNA testing would be unable to solve the problem.
4. The use of the DNA analysis can be in various aspects such as medicine,
forensic, disaster, research, etc. In addition, DNA analysis can help solve crimes.
13
Lesson 8 DNA Fingerprinting
Follow-up Activity
1. Download the article (O. J. Simpson murder case ) from the following websites:
a. O. J. Simpson Trial Homepage,
http://www.law.umkc.edu/faculty/projects/ftrials/Simpson/simpson.htm
b. http://phobos.ramapo.edu/~jweiss/laws131/unit3/simpson.htm
a. “If you are the lawyer of the defendant, what type of questions you would
focus to challenge the DNA evidence provided by the prosecutor? Why?”
b. Is it possible for criminals to erase traces of DNA evidence? Explain your
answers.
c. May refer to O. J. Simpson murder case to ask students more questions on
the use of DNA evidence in court cases.
14