PDF

Solutions for all
Life Sciences
Grade 12
Learner’s Book
J de Fontaine J Dugard R Freedman L Marchant

I McKay R Simenson J Webb
Solutions for All Life Sciences Grade 12 Learner’s Book
© J de Fontaine, J Dugard, L Marchant, R Freedman, I McKay, R Simenson, J Webb, 2013
© Illustrations and design Macmillan South Africa (Pty) Ltd, 2013
All rights reserved. No part of this publication may be reproduced,

stored in a retrieval system, or transmitted in any form
or by any means, electronic, photocopying, recording,
or otherwise, without the prior written permission of the
copyright holder or in accordance with the provisions
of the Copyright Act, 1978 (as amended).
Any person who commits any unauthorised act in relation to this
publication may be liable for criminal prosecution and
civil claims for damages.
First published 2013
13 15 17 16 14
2 4 6 8 10 9 7 5 3 1
Published by
Macmillan South Africa (Pty) Ltd
Private Bag X19
Northlands
2116
Gauteng
South Africa
Typeset in Palatino LT Std 10.5pt on 12.5pt by Boss Repro & Design Studio
Cover image from Science Photo Library
Cover design by Deevine Design
Illustrations by: Greg Graney; Alan Kennedy; Brainwave India; Gareth Williams
Photographs by:
AAI Fotostock pp. 5 (fig 1.2); 8 (fig 1.7); 24 (fig 2.2, 2.4); 41 (fig 2.28); 43 (fig 2.30); 50 (fig 3.0); 57 (fig
3.13); 59 (fig 3.18); 78 (fig 4.24); 81 (fig 4.27a, b); 84 (fig 4.32); 85 (fig 4.35); 122 (fig 5.27); 166 (fig 6.11);
178 (fig 6.20b, d); 179 (fig 6.20f, h); 225 (fig 7.21b); 276 (fig 10.12); 283 (fig 10.17); 331 (fig 11.28);
Africa Media Online pp. 337 (fig 11.39); Afripics pp. 7 (fig 1.6); 8 (fig 1.8); 9 (fig 1.9); 54 (fig 3.5); 77
(fig 4.21b); 81 (fig 4.27c, d); 159 (fig 6.3b); 164 (fig 6.7); 178 (fig 6.20c); 179 (fig 6.20g); 180 (fig 6.20k);
201 (fig 6.38a); 203 (fig 6.39a, b); 246 (fig 9.0); 257 (fig 9.16); 258 (fig 9.19); 262 (fig 10.0); 289 (fig 10.25);
290 (fig 10.27a,b); 304 (fig 11.4b); 309 (fig 11.8a, b); 334 (fig 11.34); Biophoto Association pp. 30
(fig 2.12); 31 (fig 2.13, 2.14, 3.15); 32 (fig 2.16, 2.18); 33 (fig 2.19, 2.20); Brett Rubin pp. 90 (fig 5.0);
Fuse Gallo Images Getty Images pp. 354 (Fig 12.0); Gallo Images pp. 272 (fig 10.7); 361 (Fig 12.6);
Gallo HPH Image Library pp. 194 (fig 6.32a, b); Greatstock pp. 54 (fig 3.6); 224 (fig 7.20); 304
(fig 11.4c); 324 (fig 11.20a); Greatstock Barcroft Media pp. 313 (fig 11.11); Greatstock Corbis pp. 2
(fig 1.0); 18; 65 (fig 4.4); 66 (fig 4.7); 72 (fig 4.13); 73 (4.16); 85 (fig 4.34); 161 (fig 6.5); 209 (fig 7.1); 222
(fig 7.17); 224 (fig 7.19); 230 (fig 8.0); 242 (fig 8.15, 8.16); 252 (fig 9.9); 331 (fig 11.29); 343 (fig 11.47);
INPRA pp. 57 (fig 3.12); 101 (fig 5.8); 177 (fig 6.20a); 178 (fig 6.20e); 180 (fig 6.20i, j); 208 (fig 7.0); 273
(fig 10.9); 287 (fig 10.23a, b); 327 (fig 11.24a); Jane Dugard pp. 300 (fig 11.0); Maropeng Media Centre
pp. 339 (fig 11.42); Reinette Simenson pp. 189 (fig 6.25); Science Photo Library pp. 42 (fig 2.29); 43 (fig
2.31); 62 (fig 4.0); 91 (fig 5.1); 127 (fig 5.34); 131 (fig 5.35); 133 (fig 5.38); 154 (fig 6.0); 201 (fig 6.38b);
225 (fig 7.21a); 263 (fig 10.1); 277 (fig 10.15); pg 291 (fig 10.30); 293 (fig 10.31); 322 (fig 11.19); 324
(fig 11.20b); 325 (fig 11.21); 328 (fig 11.25a); 329 (fig 11.27a, b); 339 (fig 11.41a, b); 342 (fig 11.45); 360
(fig 12.5); 376 (fig 12.3d); University of the Witwatersrand – Dart Collection pp. 335 (fig 11.36, 11.37);
VMS Images pp. 22 (fig 2.0); 53 (fig 3.3); 55 (fig 3.7); 59 (fig 3.17); 68 (fig 4.9); 304 (fig 11.4a);
Wiki Commons pp. 336 (fig 11.38)
ISBN: 978-1-4310-1-4385 e-ISBN: 9781431024322

WIP: 4514M000
It is illegal to photocopy any page of this book

without written permission from the publishers.
The publishers have made every effort to trace the copyright holders.
If they have inadvertently overlooked any, they will be pleased to make the
necessary arrangements at the first opportunity.
Contents
Topic Topic LB Page
number numbers
Introduction v
How to use the Solutions for all, Life Sciences Grade 12 Learner’s Book
Strand: Life at molecular, cellular and tissue level
1 DNA: The code of life 2
Unit 1 Deoxyribonucleic acid (DNA) 4
Unit 2 Ribonucleic acid (RNA) 13
More questions on DNA: The code of life 19
Summary 21
2 Meiosis 22
Unit 1 Chromosomes 24
Unit 2 Meiosis: The process of reduction division 27
Unit 3 Comparison of mitosis and meiosis 44
More questions on meiosis 47
Summary 49
Strand: Life processes in plants and animals
3 Reproduction in vertebrates 50
Unit 1 Diversity of reproductive strategies 52
More questions on reproduction in vertebrates 61
Summary 61
4 Human reproduction 62
Unit 1 The male and female reproductive systems 64
Unit 2 Puberty 67
Unit 3 Gametogenesis 70
Unit 4 The hormones that control the menstrual cycle 74
Unit 5 Fertilisation and development of zygote to blastocyst 77
Unit 6 Development of the foetus and the role of the placenta 79
Unit 7 Contraceptive methods and devices 83
More questions on human reproduction 87
Summary 89
Strand: Life at molecular, cellular and tissue level
Strand: Diversity, change and continuity
5 Genetics and inheritance 90
Unit 1 Genetics and genes 92
Unit 2 Inheritance and variation 100
Unit 3 Sex chromosomes 120
Unit 4 Mutations 124
Unit 5 Genetic engineering 132
Unit 6 Using human DNA 143
More questions on genetics and inheritance 148
Summary 153
Strand: Life processes in plants and animals
6 Responding to the environment: The human nervous system 154
Unit 1 The nervous system 156
Unit 2 Disorders and injuries of the nervous system 171
Unit 3 Receptors 184
More questions on responding to the environment: The human 205
nervous system
Summary 207
7 Responding to the environment: The human endocrine system 208
Unit 1 The endocrine system 210
More questions on responding to the environment: The human 228
endocrine system
Summary 229
8 Homeostasis in humans 230
Unit 1 Homeostasis 232
More questions on homeostasis in humans 243
Summary 244
9 Responding to the environment: Plants 246
Unit 1 Plant hormones 248
Unit 2 Tropisms in plants 253
Unit 3 Plant defence mechanisms 257
More questions on responding to the environment: Plants 260
Summary 261
Strand: Diversity, change and continuity
10 Evolution by natural selection 262
Unit 1 Origin of ideas about the origins of species 265
Unit 2 Artificial and natural selection 275
Unit 3 Formation of new species 287
Unit 4 Evolution in present times 293
More questions on evolution by natural selection 296
Summary 298
11 Human evolution 300
Unit 1 Evidence of common ancestors for living hominids, including
humans 302
Unit 2 Out of Africa hypothesis 316
Unit 3 The importance of the Cradle of Humankind 331
Unit 4 Alternative views to evolution 347
More questions on human evolution 351
Summary 352
12 Revision 354
Glossary 386
Introduction
Life Sciences is the scientific study of living things. In your study of Life Sciences you will
be exploring living things at a molecular level as well as their interactions with one
another and the environment. The study of Life Sciences includes obtaining certain
knowledge.
In addition, you will be performing practical work in which you will practice the skills
necessary to study and investigate living things. Through the process of learning and
doing we hope you develop an interest and appreciation for living things on Earth – and
how to take care of our planet!
Life Sciences Grade 12 Learner’s Book has content knowledge and background information
to ensure that you acquire enough, and a bit more, knowledge than required by the
Curriculum and Assessment Policy Statement (CAPS).
Life Sciences Grade 12 Learner’s Book, includes enough practical tasks to ensure that you
develop the skills necessary to become a true scientist.
In the Further Education and Training band the Life Sciences content framework is
organised according to four knowledge strands. Knowledge strands are developed
progressively over the three years of FET. These knowledge strands are:
r Knowledge Strand 1: Life at the Molecular, Cellular and Tissue Level
r Knowledge Strand 2: Life Processes in Plants and Animals
r Knowledge Strand 3: Environmental Studies
r Knowledge Strand 4: Diversity, Change and Continuity.
As you progress in your studying of Life Sciences you will come to realise how
interlinked these strands are. Not all of these knowledge strands are covered in each year
of FET. In Grade 11, Knowledge Strand 1: Life at the Molecular, Cellular and Tissue Level
is not covered. Also note that Knowledge Strand 3: Environmental Studies is not covered
in Grade 12, but you will be examined in Grade 12 on the work done in Environmental
studies in Grade 11.
The three specific aims in Life Sciences are:

r Specific Aim 1, which relates to knowing the subject content facts
r Specific Aim 2, which relates to doing science or practical work and investigations
r Specific Aim 3, which relates to understanding the applications of Life Sciences in
everyday life, as well as understanding the history of scientific discoveries and the
relationship between indigenous knowledge and science.
You might be taking Life Sciences to obtain background knowledge for further studies in
one or more of the biological sub-disciplines. There are many different careers in the field
of Life Sciences. Each career requires special knowledge and skills. The table on the next
page shows a few of these careers.
Introduction t v
Career/job Brief description of job
Dentist Diagnoses, prevents and treats problems related to teeth and the
gums.
Doctor Diagnoses, treats and prevents diseases in humans.
Dietician Advises patients about suitable diets for their individual needs or
conditions.
Biokineticist Specialises in exercise therapy for sportsmen/women and injured
people.
Palaeontologist Studies the fossilised remains of plants, animals and humans, and
uses this information to provide a picture of the history of life on
Earth.
Forensic scientist Analyses physical evidence collected at crime scenes.
Geneticist Studies the inheritance of characteristics, particularly the
characteristics that lead to disorders or diseases in humans.
Animal scientist Conducts research in selecting, breeding, rearing and studying
diseases of domestic animals.
Aquaculturist Studies fish populations and ways of breeding fish for commercial
use.
Veterinarian Diagnoses, prevents and treats diseases in domestic and/or wild
animals.
Landscape architect Designs outdoor and public spaces to achieve environmental,
social and aesthetic outcomes. Includes urban design, urban or
town planning, environmental restoration, parks and recreation
planning and private residence planning.
Food scientist Studies the chemical, physical and biological aspects of different
kinds of food to ensure that it is prepared, preserved and
packaged correctly. Also that it is tasty and safe to eat.
Microbiologist Studies the biology of microscopic organisms such as viruses,
bacteria, fungi and protists. Investigates how these organisms
affect living organisms and the environment.
Ecotoxicologist Studies substances that are toxic to the environment and their
effect on animal life.
Environmental Provides specialist advice on environmental impacts. Conducts
consultant environmental impact assessments.
Environmental health Helps to ensure that public health standards are met in relation
officer to water, sanitation, air, land etc.
Conservationist Works to preserve biological diversity, especially in natural
environments.
vi
How to use Solutions for all Life Sciences Grade 12
Learner’s Book
The content knowledge in Life Sciences Grade 12 Learner’s Book is organised according
to Topics. Each topic is structured in the same way:
Topic opener page: The topic starts with a full colour photograph of something that is
related to the content of the topic. On the opener page is listed What you will learn about in
this topic, which links to what you should know after you have worked through the topic.
There is also a section called Let’s talk about ... This introduces the topic and includes
questions related to the photograph. The idea is for you to start thinking about new
things you will learn about in the topic.
What you know already: On the second page of a topic is What you know already and
Check myself. These two features make sure that you know what you need to know before
continuing with the new work. It is revision of a previous grade’s work.
Units and lessons: Each topic is divided into units that are broken up into lessons. The
lessons break the work up into little chunks of information. This helps you to make sure
you know and understand a certain section of the work before moving on to the next new
section of work. A lesson consists of content and then an Activity that could be a Learning
task or a Practical task. The Learning task might be done in class or given as homework. The
activities are also opportunities for formal and informal assessment. Your teacher will tell
you which activities will be assessed. One Practical task per term is a suggested formal
assessment task. You could be assessed on these tasks, so watch out for them. The
Learning tasks and Practical tasks can be done alone, in pairs or in groups. Your teacher will
tell you how to work.
Enrichment activities: The enrichment activities are additional activities. These are for
you to find out more about what was covered in the lesson.
More questions on ... : The topic ends with a variety of additional questions to give you
extra practice.
Summary: Each topic ends with a summary of the work covered in the topic. You could
use these summaries to go over the content.
Other features to look out for are:

Word boxes: In the margins on the pages there are boxes with certain words. An
explanation of the meaning of the word is given for you to understand the information
better. Also always keep a dictionary at hand. If you understand a word, your learning is
made much easier.
Cool fact, Something interesting and Hot topic: This is some interesting information.
Diagrams and illustrations: Scientifically accurate diagrams are included to help you
understand the written words. Make good use of the pictures when working through the
text. When you see something, you will remember it a lot better.
The publisher and authors wish you all the best in your study of Life Sciences Grade 12.
Good luck!
vii
Topic
1 DNA: The code of life
What you will learn about in this topic
r the location of DNA in the cell

r the structure of DNA
r the discovery of the structure of DNA
r DNA profiling
r the role of DNA in the genetic code
r the replication of DNA
r the structure of RNA
r the types of RNA and the location of RNA in the cell
r the transcription of RNA from DNA
r the translation of RNA into proteins
r the role of RNA in expressing the genetic code.
Let’s talk about this topic
DNA is so small that its structure cannot even be seen under the strongest
microscopes currently in use. It is for this reason that the photograph shows a model
of a double helix DNA molecule and not an actual DNA molecule.
What is DNA and why is it so important to life? How does DNA determine what
and who we are? In this topic you will find the answers to these questions.
2 t Topic 1: DNA: The code of life

Life at molecular, cellular and tissue level
What you know already

nucleic acid: an In Grade 10 you learnt about the cell – the basic unit of life – and its structure. The cell
organic
compound that contains many different types of organic compound, including proteins, lipids and
contains the carbohydrates. Proteins consist of chains of amino acids. Organic compounds called
elements nucleic acids are also found in cells. Nucleic acids are organic compounds that contain
carbon, the elements carbon, hydrogen, oxygen, nitrogen and phosphorus.
hydrogen,
oxygen,
nitrogen and There are two types of nucleic acid:
phosphorus. A r deoxyribonucleic acid (DNA)
polynucleotide r ribonucleic acid (RNA).
such as DNA
and RNA
You also learnt, in Grade 10, that cells divide by mitosis. During interphase of the cell
cycle, the DNA in the nucleus replicates itself exactly so that each daughter cell that is
formed, receives an identical copy of the DNA.
nucleus
lysosome nucleolus nucleoplasm

centriole
nuclear
membrane
mitochondrion Golgi apparatus
endoplasmic
cytoplasm
reticulum
ribosomes cell
membrane
Fig. 1.1 Diagram of an animal cell
Study Figure 1.1 and answer all the questions below:

k
Chec 1. What is the nucleus made up of?
lf
myse 2. What is the function of the nucleus?
3. How do substances get into and out of the nucleus?
4. Where in a cell will you find ribosomes?
5. What is the function of ribosomes?
6. What is the function of mitochondria?
7. In a plant cell there are chloroplasts. What is the function of
chloroplasts?
Topic 1: DNA: The code of life t 3

Unit 1 Deoxyribonucleic acid (DNA)
Location of DNA in the cell chromosome: a

threadlike
DNA is found in the form of chromosomes in the nucleus of eukaryotic cells. molecule of
Chromosomes carry the hereditary information in the form of genes. Unless a cell is DNA made up of
dividing, chromosomes appear as very long, tangled strings in the nucleus. This tangle of many genes
chromosomes is known as the chromatin network (see Figure 1.1). When a cell is eukaryotic cell: a
dividing, the chromosomes condense and spiral and become visible as individual cell that
chromosomes. DNA is also found inside the mitochondria and chloroplasts of eukaryotic possesses a
membrane-
cells. DNA that is found outside the nucleus is known as extranuclear DNA. bound nucleus
and membrane-
bound
Something interesting organelles
gene: a specific
The total length of DNA in a typical human cell is thought to be about two metres. part of a strand
This means that the total length of all the DNA in your body would be more than ten of DNA that
codes for a
billion kilometres! particular
characteristic,
for example eye
colour, or that
Activity 1.1 Practical task (prescribed) carries the
information to
Extract DNA from peas make a
particular
You will need: protein such as
haemoglobin
r two level teaspoons of split peas (soaked in water for 24 hours)
r bottle top chromatin
network: the
r metal nail form in which
r two 100 cm3 beakers chromosomes
r test tube and test tube rack are found in the
r glass rod nucleus of an
eukaryotic cell
r 50 cm3 or 100 cm3 measuring cylinder that is not
r water dividing. The
r teaspoon chromatin
r one level teaspoon of salt network consists
of a mass of
r watch or stopwatch long, tangled
r 5 cm3 syringe threads of DNA
r dish-washing liquid (the liquid type, not the gel type) extranuclear
r one level teaspoon of meat tenderiser DNA: DNA that
r 30 cm3 of cold methylated spirits is found outside
r piece of wire about 15 cm long the nucleus
r ruler
r marker pen.
Method
1. Place the soaked split peas into the bottle top and use the head of the nail to
grind or crush the peas.
2. Still using the head of the nail, scrape the ground-up peas into one of the beakers.
Add 30 cm3 of water to the beaker and stir the mixture with the glass rod.
3. Add one level teaspoon of salt to the beaker. Stir the mixture until you can see
that all the salt has dissolved.

4. Let the mixture stand for two minutes.

5. Pour the liquid part of the mixture into the test tube until the test tube is about a
third full.
6. Use the syringe to add 5 cm3 of dish-washing liquid to the mixture in the test tube.
7. Let the mixture in the test tube stand for ten minutes.
8. Add one level teaspoon of meat tenderiser to 10 cm3 of water in the second
beaker. Using the glass rod, stir the contents of the beaker until it is mixed
properly. Pour the mixture from the second beaker into the test tube and stir
gently for five seconds.
9. Let the mixture in the test tube stand for twenty minutes.
10. Use the ruler to measure the height of the liquid in the test tube. Use the marker pen
to make a mark on the side of the test tube, level with the top of the liquid. Since, in
the next step, you will add an equal volume of methylated spirits to the liquid, use
your ruler and pen to make a second mark on the side of the test tube to indicate the
level to which the liquid will rise when the methylated spririts is added.
11. Hold the test tube at an angle of approximately 45°. Very slowly and carefully,
pour the cold methylated spirits down the inside of the test tube so that it forms
a separate layer on top of the mixture. The two liquids must not mix.
12. After about ten minutes you will see fine, whitish threads appearing in the layer
of methylated spirits. These threads are DNA.
13. Bend the end of the piece of wire to form a loop and use this to remove the
Fig. 1.2 DNA threads DNA from the test tube.
extracted from peas 14. Examine the threads. Each thread is made of many DNA molecules. (10)
The structure of DNA

In Activity 1.1 you extracted DNA from peas. All you could see was a mass of white
strands. You know from work covered in Grade 10 that DNA is made up of carbon,
hydrogen, oxygen, nitrogen and phosphorus. Atoms of these elements are organised in a
very specific way to form DNA.
DNA is a double-stranded polynucleotide. A polynucleotide chain is a very long

molecule made up of a string of repeating, similar units called nucleotides. As shown in
Figure 1.3, each DNA nucleotide consists of three parts:
ra deoxyribose sugar molecule
base ra phosphate group
(pyrimidine)
ra nitrogen-containing base.
phosphate
group These three parts are attached to each other in a specific
way. The phosphate group is joined to the deoxyribose
base
sugar that is joined to the base. The bonds that connect
(purine) these three parts result in a nucleotide that is L-shaped, as
phosphate
group shown in Figure 1.3.
deoxyribose There are four possible bases that can form part of a DNA
sugar nucleotide:
radenine (A)
deoxyribose rthymine (T)
sugar
rguanine (G)
Fig. 1.3 DNA nucleotides rcytosine (C).

According to their structure, these bases are grouped into two types,
namely purines and pyrimidines. Purines are larger molecules because
thymine
they consist of a double ring, while pyrimidines are smaller molecules a nucleotide
because they consist of a single ring.
Adenine and guanine are purine bases. Thymine and cytosine are
pyrimidine bases. In Figure 1.4 each base is given a designated shape to cytosine
distinguish it from the other bases. a phosphate
a sugar
Nucleotides are joined to form a polynucleotide chain when the (deoxyribose)
deoxyribose sugar of one nucleotide joins to the phosphate group of the adenine
next nucleotide, as shown in Figure 1.4. This forms the sugar-phosphate
‘backbone’ of the polynucleotide chain.
Each DNA molecule consists of two polynucleotide chains (two parallel guanine
strands of nucleotides) that lie with the bases on each strand or chain
facing each other. Hydrogen bonds hold these two chains together to
form a ladder-like structure. The ‘upright legs’ of the ladder are formed
by the sugar-phosphate ‘backbones’ of the two polynucleotide chains.
Fig. 1.4
The ‘rungs’ of the ladder are formed by pairs of bases joined together
by hydrogen bonds. Polynucleotide
The bases are always paired up in a specific way, in other words with a specific
complementary
pyrimidine joined to a specific purine: bases: nucleotide
r adenine joins with thymine (joined by two hydrogen bonds) bases (adenine
r cytosine joins with guanine (joined by three hydrogen bonds). and thymine;
guanine and
As only certain pairings of bases are possible to make each ‘rung’, those bases that are cytosine) that
are able to be
able to pair in this way are said to be complementary bases. This means that only joined by
complementary bases can join together to form a complete ‘rung’, just like two pieces of a hydrogen bonds
puzzle that fit together. and therefore
hold the double-
The flat, ladder-like DNA molecule described so far is twisted around its own central axis stranded nucleic
acid together
to give a three-dimensional shape called a double helix. There are ten base pairs for every
complete twist of the helix. Each DNA molecule in a cell has many hundreds of double helix: the
structure that is
thousands of base pairs. (See Figure 1.5.) formed when
two strands are
a) b) c) twisted around a
hydrogen bond central axis, for
sugar
example the two
cytosine guanine phosphate
polynucleotide
backbone
strands in a DNA
base molecule
thymine adenine phosphate

group
deoxyribose
sugar
guanine cytosine
Complementary base pairs are joined by hydrogen Two polynucleotide strands Twisted into a
bonds lying side by side double helix
Fig. 1.5 Structure of DNA

The difference between different DNA molecules lies in the sequence of the base pairs.
The sequence of bases in a particular strand of DNA is very important because it carries
the genetic information of the organism. The sequence of bases acts as a code that we call
the genetic code. You will learn more about the genetic code in the section on genes and
non-coding DNA.
Genes and non-coding DNA

The portion of a DNA molecule that carries the code for making a specific protein is
non-coding DNA: called a gene. Each protein results in a particular characteristic, for example a person’s
DNA that does blood group. (In Topic 5 you will learn more about genes and how they are passed on
not code for the
production of
from one generation to the next.) A DNA molecule is therefore made up of many different
proteins genes. Not all the DNA in a chromosome codes for the production of proteins. Some
DNA sequencing: regions of DNA between the genes on chromosome are known as non-coding DNA since
the process that they do not code for the production of proteins.
is used to work
out the base Scientists use a technique called DNA sequencing to identify the sequence of bases in a
sequence of a
segment of DNA particular segment of a strand of DNA.
Activity 1.2 Learning task
1. Draw a diagram of a segment of DNA with this sequence of bases: GGCTAAC.

Use the sequence that you wrote down for the left-hand side of the DNA molecule,
starting from the top and working downwards. Fill in the complementary base
pairs on the right-hand side of the sequence of bases in the diagram. (10)
Activity 1.3 Practical task (enrichment)
Build a model of a DNA molecule

You will need:
r various items that can be used to construct a
model of a DNA molecule, for example
modelling clay, pipe cleaners, beads, paper
clips, toothpicks and jelly sweets
r glue
r card or paper (for your key). Fig. 1.6 DNA model made from
Method sweets
1. Use the resources that you have collected to build a model of a DNA molecule.
2. On the piece of card/paper, write what each item in your model represents in a
real DNA molecule.
3. Present your model to the rest of the class:
a) Explain what each part of the model represents.
b) Explain the problems you had while trying to build your model and what
you might do differently if you had to do it again.
c) Describe the limitations of your model, in other words explain why it is not
a perfect representation of a DNA molecule.
(20)

Discovery of the structure of DNA
By the middle of the 1900s, many scientists were trying to work out the structure of DNA.
Experimental evidence suggested that DNA did not consist of a single chain of
nucleotides as shown in Figure 1.4.
Rosalind Franklin was working on

X-ray diffraction patterns of DNA
at King’s College, London. You can
see what the X-ray diffraction
patterns of DNA looked like in the
photograph shown in Figure 1.7.
In 1953, James Watson, a

microbiologist, and Francis Crick, a
physicist, were both working at the
Cavendish Laboratory in
Cambridge. They used the evidence:
information that
unpublished photographs and is used to test
measurements taken by Dr Fig. 1.7 One of Rosalind Franklin’s X-ray diffraction whether
Rosalind Franklin (given to them patterns of DNA something
by Maurice Wilkins and Max might be true
Perutz, without her knowledge or DNA profiling:
permission) to work out the correct structure of DNA. The model they built is shown in the procedure
used to identify
Figure 1.8. individual
organisms based
In 1962, Watson, Crick and Wilkins were awarded a Nobel Prize. Rosalind Franklin on the unique
would have shared the prize instead of Wilkins but she had died in 1958, and Nobel sequence of
nucleotides in
Prizes are not awarded posthumously. She died without knowing that the two men were each person’s
able to build their model only because they had been shown her work. DNA
DNA profiling
Every human being, with the exception of identical twins, has a
unique sequence of bases in their DNA, in other words a unique
genetic code. This means that DNA can be used to identify an
individual person in the same way as a fingerprint can be used.
The procedure that is used to identify an individual’s unique
DNA pattern or profile is called DNA profiling, genetic profiling
or DNA fingerprinting. Producing a DNA profile involves a
complicated procedure and expensive scientific apparatus. You
do not have to know or understand the procedure, but you
should be able to interpret the outcome.
DNA profiling produces a pattern of dark bands that is unique to

a person. Because DNA is identical in each cell of an organism, it
does not matter what source is used to obtain the DNA profile.
The nuclei of cells from a hair follicle (or root), skin, blood or
semen, as well as cells from the lining of the cheeks that are found
Fig. 1.8 Model
in saliva, will all produce the same unique pattern of dark bands.
showing the
structure of DNA

Figure 1.9 shows a DNA profile for 12 DNA samples.

The profiles are numbered 1 to 12. Each profile consists
of a series of coloured bands. The bands are not
necessarily evenly spaced, and some are darker and/or
thicker than others. Look at the profile in Sample 4 as
an example. Using a ruler to guide you, move down
the column while looking at the spacing of the bands,
their thickness and their colour. You will see that the
second band is blue and that bands three and four are
closer together than bands four and five. When you
compare this with the profile in Sample 5, you will see
that the pattern of the two samples is totally different.
Two DNA samples that come from the same source
will have the same pattern of bands. Now examine
Sample 3 carefully and then find its identical match
from among the other profiles in the photograph. The
two identical DNA profiles came from the same
individual.
For some time now, DNA profiling has been used as

forensic evidence to help solve crimes. It has also been
used to clear people who had been wrongfully
convicted of a crime at a time before DNA evidence was
used in criminal investigations.
Fig. 1.9 Photograph of DNA profiles
Activity 1.4 Practical task

forensic: used in
a court of law
and/or with
Using DNA profiling to solve a crime
regard to solving Read the following case study and use the DNA forensic evidence to solve the
a crime crime.
CASE STUDY
Inspector Ndlovu and Sergeant There were three possible suspects
Botha were investigating the scene in the investigation, one of whom
of a violent crime. The victim was a was the boyfriend of the victim’s
70-year-old woman who had been daughter. All three suspects were
stabbed and left to die. They found required to give a blood sample. A
a few strands of hair in one of her sample was also taken from the
hands, which might have come victim. The DNA profiles of the four
from the murderer. They also found samples were compared with the
some skin under the woman’s DNA profiles obtained from the hair
fingernails, which might also have and skin samples taken from the
come from the murderer if the crime scene. The profiles are shown
victim had been able to scratch the in Figure 1.10. Use these DNA
murderer when she was attacked. profiles to help you answer the
questions on page 10.

Fig. 1.10 Forensic evidence
1. Does the DNA from the hair found in the victim’s hand and from the skin
found under her fingernails come from the same person? Use evidence from
the profiles to explain your answer. (2)
2. Based on the DNA profiles, which of the three suspects could have been
present at the crime scene? Use evidence from the profiles to explain your
answer. (3)
3. Compare the profile of the DNA found under the victim’s fingernails with
the DNA profile of the victim. What do you notice? (3)
4. Suspect 2 was the boyfriend of the victim’s daughter.
a) What forensic evidence links him to the crime scene? (1)
b) Suggest another possible explanation for the presence of this forensic
evidence at the crime scene. (1)
c) What further evidence do you think the detectives would have to
collect to enable a judge to convict him of the crime? (Any 2)
5. Do you think DNA evidence on its own is enough to convict a criminal?
Give reasons for your answer. (2)
6. Suggest two advantages and two disadvantages of using DNA profiling in
criminal investigations. (4)
7. Do you think it would be a good idea to collect DNA from every person in
the country to create a DNA profile database? Provide two arguments for
and two arguments against this idea. (4)

Replication of DNA
Why DNA is replicated
The DNA in any cell carries the genetic information of that cell. When a cell divides by
mitosis it must pass on the same genetic information to the daughter cells that are
formed. In order to do this, the DNA in the original cell has to produce an exact copy of
mitosis: the type itself. This process is called DNA replication.
of cell division
that occurs in a The process of DNA replication occurs during
cell that divides interphase of the cell cycle, before the cell cell
to produce two division cells
undergoes cell division. (See Figure 1.11.) increase
identical (mitosis)
in size
daughter cells It is important for a cell to produce an exact
DNA replication: cell cycle
copy of the nuclear DNA, for the following begins
the process continues
during which
reasons: to grow
DNA makes r The same amount of DNA (therefore and
identical copies the same number of chromosomes) prepares
of itself under to divide
occurs in the parent cell and the two
the control of
the enzyme DNA
daughter cells. All daughter cells will
polymerase therefore contain exactly the same
cell cycle: the genetic information (carried by the
series of events DNA) as the parent cell.
that occur in a r Identical cells will function to promote replication of DNA
cell from the the development and wellbeing of the
time it is Fig 1.11 The cell cycle
produced to the multicellular organisms of which they
time it has form a part. When cells are genetically different from one another (i.e. have different
divided into two DNA), they do not work together because they do not recognise each other as being
new identical part of the same organism.
cells (daughter
cells) r Genetic information of an organism of a particular species needs to be passed on
unchanged to the next generation of that species so that the species can continue to
enzyme: a
specialised exist. If the DNA that carries the information on how to make a human being were to
protein that change, the cells that carry the new information will most probably not grow into or
speeds up produce another human being.
chemical
reactions that
occur inside or Process of DNA replication
outside cells. How DNA replication takes place (See Figure 1.12):
Each type of
enzyme is r Within the nucleus, an enzyme, DNA polymerase, causes the DNA double-helix
specific to a molecule to unwind so that it is no longer a double helix but becomes a flat, double-
particular type of stranded polynucleotide chain (Step 1 in Figure 1.12).
reaction, for r The enzyme DNA polymerase also unzips the DNA molecule by causing the
example DNA
polymerase will hydrogen bonds between the complementary bases to break. The two single strands
speed up only of DNA separate (Step 2 in the figure).
the reaction that r Each single strand of DNA acts as a template or mould for the formation of a new
results in DNA DNA strand (Step 3 in the figure).
replication
r By means of hydrogen bonds, free nucleotides in the nucleus pair up with their
template: any complementary bases on the two exposed single strands of DNA (Step 4 in the figure).
molecule that
acts as a pattern r When the newly attached nucleotides are in this position, the sugar phosphate
for the making ‘backbone’ is formed when the sugar of one nucleotide joins to the phosphate of the
of a new next nucleotide creating a polynucleotide chain (Step 5 in the figure).
molecule r Since this happens on both DNA template strands, two new polynucleotide chains
are formed.

r Each newly formed DNA strand rewinds into a double helix.
semi-
r Two DNA molecules have been formed from one. As you can see in Figure 1.12, the conservative
two new DNA molecules are identical to each other, as well as to the original DNA replication: each
molecule. Because each new DNA molecule formed contains one polynucleotide new DNA
strand from the original molecule and one newly made polynucleotide strand, this is molecule formed
known as semi-conservative replication. contains one
polynucleotide
r The two newly formed DNA molecules separate from each other once DNA strand from the
replication has been completed. original
molecule and
one newly made
a DNA molecule
polynucleotide
strand
DNA polymerase
1. DNA molecule unwinds

free DNA nucleotide
2. DNA polymerase unzips
the DNA molecule by
3. Each single strand of causing the hydrogen
DNA acts as a template bonds to break
between the base pairs.
4. Free DNA nucleotides in This results in two
the nucleus pair up with separate base pairs.
complementary bases on the
DNA, forming new hydrogen
bonds. 5. When the free DNA
nucleotides are lined
up, they join together
to form a new
polynucleotide chain.
Two identical DNA molecules
Fig. 1.12 DNA replication
Answer the following questions:
1. Where does DNA replication occur in eukaryotic cells? (1)

2. What is the function of DNA polymerase? (2)
3. One polynucleotide strand of a DNA molecule contains the following
sequence of bases: TTCGGATGTAGCCAA.
Reading from left to right, use these accepted symbols for DNA bases to draw
the complete sections of the two DNA molecules that will be produced by the
replication of the DNA molecule that contains this polynucleotide strand. (4)

Unit 2 Ribonucleic acid

Structure and types of RNA and their location in the
cell
Structure of RNA
Each RNA molecule is a single-stranded polynucleotide. This means that it is made up of
a single chain of nucleotides. RNA molecules are much shorter than DNA molecules.
The nucleotides of RNA differ slightly from those of DNA. An RNA

nucleotide consists of:
uracil r a ribose sugar
r a phosphate group
ribose r one of four bases: uracil, cytosine, guanine or adenine.
sugar
Uracil is similar to thymine (one of the bases found in DNA) and is
cytosine complementary to adenine.
Uracil and cytosine are pyrimidine bases (single-ringed molecules).

Guanine and adenine are purine bases (double-ringed molecules).
phosphate
group adenine Types of RNA
There are three types of RNA:
r Messenger RNA (mRNA) is a straight polynucleotide strand.
It carries information about the amino acid sequence of a
guanine particular protein from the DNA in the nucleus, to the
ribosome where the protein will be made.
r Ribosomal RNA (rRNA) forms the ribosomes, which are
found free in the cytoplasm of the cell and are attached to the
outside of the endoplasmic reticulum. Ribosomes are the site of
Fig. 1.13 Structure of RNA protein synthesis.
r Transfer RNA (tRNA) is a short RNA molecule that is folded
back onto itself to form a clover-leaf shape. It picks up amino
acids in the cytoplasm and brings them to the ribosomes where
mRNA they are joined together to form a protein.
Location of RNA in the cell

rRNA RNA is found in the nucleus of the cell where it is made by DNA,
as well as in the cytoplasm (tRNA and mRNA). rRNA is found
forming the ribosomes in the chloroplasts of plant cells and in the
mitochondria of plant and animal cells.
tRNA
Fig. 1.14 The three types of RNA

Protein synthesis
Protein synthesis is the process by which proteins are made or manufactured. Protein
molecules are long chains of amino acids bonded together by peptide bonds. Twenty
different amino acids are used to make proteins. Proteins differ from one another in the
sequence, type and total number of amino acids they contain. The genetic code that
determines the nature of each protein is carried as the sequence of bases in the genes of
DNA molecules.
transcription: the
Plants absorb compounds that contain nitrogen from the soil through their roots. Plants production, in
the nucleus, of
use the nitrogen to make the amino acids they need. The amino acids are then joined mRNA using a
together in long chains to form proteins. gene (a specific
segment of
When animals (including humans) eat plants, they digest the plant proteins. When these DNA) as
template
proteins are digested they are broken down into amino acids. Animals then use these
amino acids to build the proteins they need. translation: the
process during
which the
The process of protein synthesis takes place in two stages: transcription and translation. genetic
information
encoded in
Transcription of mRNA from DNA mRNA is
translated into
During transcription, mRNA is made using a section of DNA as a template. When the cell the sequence of
requires a particular protein, the enzyme RNA polymerase breaks the hydrogen bonds amino acids in a
protein
between complementary bases in that section of the DNA, unzipping it so that the two
DNA strands move apart. The portion of a DNA molecule that carries the code for RNA polymerase:
the enzyme that
making a specific protein is called a gene. Each protein results in a particular is responsible for
characteristic, for example a person’s blood group. (You will learn more about genes and making mRNA
how they are handed down from one generation to the next in Topic 5 Genetics and from a DNA
inheritance.) A DNA molecule is therefore made up of many different genes. Not all the template
DNA in a chromosome codes for the production of proteins. There are regions of DNA non-coding DNA:
between the genes on a chromosome that are known as non-coding DNA because this DNA that does
not contain a
DNA does not code for the production of proteins. code for making
proteins
r RNA polymerase binds to the DNA at the start of the gene. The DNA molecule
unwinds for the length of the gene (seen as Stage 1 in Figure 1.15), and the enzyme
causes the hydrogen bonds between the complementary base pairs to break. The two
single strands of DNA move apart. (This is seen as Stage 2 in Figure 1.15.)
r Free RNA nucleotides in the nucleus are attracted to the exposed bases on the coding
strand of the DNA, which acts as a template. (This is shown as stages 3 and 4 in
Figure 1.15.) An RNA nucleotide with uracil pairs up with adenine on DNA since
thymine is not found in RNA. The RNA nucleotides bind together to form a single
strand of mRNA. The sequence of bases on the mRNA will be complementary to the
coding strand of the DNA.
r As the mRNA forms, it detaches from the DNA. Hydrogen bonds re-form between
the complementary bases of the two single strands of DNA. The DNA then rewinds
to form a double helix. (This is shown as Stage 5 in Figure 1.15.)
r The mRNA leaves the nucleus through a nuclear pore in the nuclear membrane, and
becomes attached to a ribosome in the cytoplasm.

a DNA molecule
3. The coding strand of the DNA acts as a free RNA nucleotide

template.
1. DNA molecule unwinds
4. Free RNA nucleotides in the nucleus pair

up with complementary bases in the 2. The enzyme RNA polymerase unzips the
coding strand of the DNA molecule. The DNA molecule by causing the hydrogen
free nucleotides join up to form a new bonds to break between the base pairs.
polynucleotide strand (mRNA) The two polypeptide chains separate.
RNA polymerase
5. The two polynucleotide chains of the DNA

molecule rejoin and rewind back into a
6. The completed mRNA molecule double helix.
separates from the DNA molecule
and passes out of the nucleus. an mRNA molecule
Fig. 1.15 Transcription from DNA
Translation of mRNA to form proteins

codon: a triplet
of bases on a The sequence of bases on the mRNA is complementary to the sequence of bases on the
piece of mRNA DNA coding strand. Each triplet or group of three bases on the mRNA is called a codon.
that codes for a
particular amino Each codon codes for a particular amino acid in the protein that is going to be made.
acid These amino acids in the cytoplasm are picked up and carried to an mRNA by a tRNA
molecule. There are 20 different amino acids.
The first codon on the mRNA is a START

codon and it means ‘start reading this amino acid
message’. The last codon is a STOP codon
and it means ‘stop reading this message/
the protein is complete’. Translation is the
tRNA
process during which the genetic code of
mRNA is used to determine the sequence of
amino acids during protein synthesis. The
code is read by the ribosome to which the
mRNA attaches after leaving the nucleus.
anticodon
Many of each of the 20 different types of
amino acid float around in the cytoplasm of Fig. 1.16 tRNA with an attached amino
cells. There are also many different tRNA acid
molecules.

r Each tRNA has one end that attaches to a particular amino acid, and a sequence of
three bases at the other end. This triplet of bases is called an anticodon. The sequence
of bases forming the anticodon determines which of the 20 different types of amino
acids the tRNA can become attached to, for example the tRNA with the anticodon
UCA will only be able to pick up serine on its other end. The anticodon UCA is made
up of three base pairs: uracil (U), cytosine (C) and adenine (A).
r While moving around in the cytoplasm, each tRNA molecule picks up its own type of
amino acid when it finds that amino acid.
r The tRNA with the complementary anticodon for the first mRNA codon (the START
codon) forms hydrogen bonds between the bases of its anticodon and the bases of the
codon. Then the tRNA with the complementary anticodon for the second mRNA anticodon: a
codon forms hydrogen bonds with this codon. The two amino acids carried by these triplet of bases
two tRNAs are now close to one another, and a peptide bond forms between them. on a tRNA that is
r The ribosome now moves along the mRNA, exposing the next codon, and the next capable of base
pairing with a
tRNA bonds in position. Meanwhile, the first tRNA breaks away from its amino acid,
triplet of
moves away from the ribosome and picks up another amino acid of the same type. complementary
r The ribosome continues to move along the mRNA, ‘reading’ each of the codons. The nucleotides
polypeptide chain that forms from the amino acids grows longer until the ribosome (codon) on an
reaches a STOP codon on the mRNA. No tRNA molecule is able to bond to the STOP mRNA
codon. peptide bond: a
bond that joins
r The completed polypeptide chain is released into the cytoplasm as a protein.
two amino acids
r The ribosome detaches from the mRNA.
polyribosome: a
group of
The mRNA codons that code for the position of a particular amino acid in a protein have ribosomes
been determined by scientists and can be read off an mRNA codon table (see Table 1.1). associated with a
There are sixty-four different ways in which the four bases of RNA can be combined in single mRNA
groups of three which means there are sixty-four different codons. While some amino during the
translation stage
acids are coded for by only one codon, for example tyrosine (abbreviated as ‘tyr’), others of protein
can have more codons, for example leucine (abbreviated as ‘leu’), which has six codons. synthesis
One of the codons functions as the START codon and also codes for methione (abbreviated
as ‘met’). Three codons are STOP codons only and do not code for an amino acid.
Peptide bond forms between two amino acids

Ser amino acid
Met His
tRNA
anticodon
large subunit of ribosome codon
mRNA
ribosome moves along the mRNA
small subunit of ribosome
Fig. 1.17 Translation of RNA to make proteins
As one ribosome moves along the mRNA, another can start reading it from the beginning.
It is quite common to see several ribosomes ‘reading’ the same mRNA at the same time,
forming many protein molecules of the same type. These are called polyribosomes.

ribosome
mRNA
dire polypeptide chains

cti
on
Fig. 1.18 Polyribosomes translating many
of
tra
identical protein molecules from an mRNA
ns
la
molecule at the same time
tio
n
The 64 different mRNA codons, together with the amino acids they code for, are shown in
Table 1.1.
Table 1.1 The mRNA codons and their corresponding amino acids or instructions
Read first Read Read third
letter here second Second base letter here
letter here
U C A G
U UUU Phe UCU Ser UAU Tyr UGU Cys U Key to amino acids
UUC Phe UCC Ser UAC Tyr UGC Cys C Ala = alanine
Cys = cystine
UUA Leu UCA Ser UAA STOP UGA STOP A His = histidine
UUG Leu UCG Ser UAG STOP UGG Try G Met = methionine
Thr = threonine
C CUU Leu CCU Pro CAU His CGU Arg U
Arg = arginine
CUC Leu CCC Pro CAC His CGC Arg C Gin = glutamine
CUA Leu CCA Pro CAA Gin CGA Arg A Iso = isoleucine
Third base
First base
CUG Leu CCG Pro CAG Gin CGG Arg G Phe = phenylalanine
Try = tryptophan
A AUU Iso ACU Thr AAU Asn AGU Ser U Asn = asparagines
AUC Iso ACC Thr AAC Asn AGC Ser C Glu = glutamic acid
AUA Iso ACA Thr AAA Lys AGA Arg A Leu = leucine
Pro = proline
AUG Met Start ACG Thr AAG Lys AGG Ser G Tyr = tyrosine
G GUU Val GCU Ala GAU Asp GGU Gly U Asp = aspartic acid
GUC Val GCC Ala GAC Asp GGC Gly C Gly = glycine
Lys = lysine
GUA Val GCA Ala GAA Glu GGA Gly A Ser = serine
GUG Val GCG Ala GAG Glu GGG Gly G Val = valine
Answer the following questions:

1. List three functions of proteins in cells (3)
2. Explain the role of DNA in protein synthesis. (5)
3. Explain the role of mRNA in protein synthesis. (5)
4. a) Work out the sequence of bases in the mRNA that would be transcribed
from the following coding strand of DNA (work from left to right):
TACGGGAAGCAACUATGT (2)
b) How many codons are there on this piece of mRNA? (1)

5. Explain the role of tRNA in protein synthesis. (5)
6. Copy the table below.
Use the knowledge that you have gained in this section, as well as the
information in Table 1.1 to complete the table below. Read the genetic code
from left to right. (15)
Table 1.2
Base sequence on coding strand T A C G G G A C A C G T G A A

Codons on mRNA
Anticodons on tRNA
Name of amino acid
Role of RNA in expressing the genetic code

In the section on protein synthesis, you learnt that the genetic code is the sequence of
bases in DNA that carries the information needed to make the types of protein needed by
a cell. DNA does this by functioning as a template to make specific mRNA needed by the
cell. You also learnt that the sequence of codons in an mRNA molecule carries this
information from the nucleus (where the mRNA was made using DNA as a template) to a
ribosome that translates the information into a protein. The production of a protein from
the genetic code is referred to as ‘expressing the genetic code’.
Hot topic
Scientists have found that some genes might never get translated (made into
proteins). The reason for this is that there are small, non-coding pieces of RNA
called miRNA (micro RNA) that help to physically block translation. Research may
well find a way to use these small non-coding pieces of RNA to treat diseases caused
by the production of abnormal proteins or to block protein production (and therefore
growth) of organisms that cause infectious diseases.
Something interesting
On 20 December 2002, Sydney Brenner received the

Nobel Prize for Physiology or Medicine.
Brenner was born in Germiston in 1927. His parents were

illiterate and there were no books in their house. As a
small boy, he used to visit a neighbour whose table was
covered with newspaper instead of a tablecloth. With her
assistance he learnt to read, and by the age of six he was
reading adult books borrowed from the Germiston
Public Library.

After matriculating at the age of 14, he studied Medicine at Wits University and
eventually completed a doctorate in physical chemistry from Oxford University.
He was one of the first scientists to see Watson and Crick’s model of DNA in 1953.
Working with other scientists, Brenner proposed that the genetic code consists of
three bases and called each triplet of bases a codon. He also proposed the existence
of tRNA, demonstrated that protein synthesis takes place in ribosomes and
confirmed the existence of mRNA.
In later years, Brenner studied how genes bring about development of an organism,
and it was for this work that he received his Nobel Prize.
More questions on DNA: the code of life
1. Give the correct word or term for the following:

a) the base that pairs with thymine
b) the building blocks of proteins
c) the bonds that hold the two polynucleotide strands of a DNA molecule
together
d) repeating units that form a nucleic acid
e) sugar that forms part of DNA
f) the shape of a DNA molecule. (6)
2. Copy and complete the following table that compares DNA and RNA. (5)
DNA RNA
A double-stranded polynucleotide
Sugar is deoxyribose
Bases are adenine, thymine, cytosine and

guanine
A very long molecule
Found in nuclei, mitochondria and

chloroplasts
3. What is the function of each of the following in relation to DNA and RNA?
a) hydrogen bonds
b) DNA polymerase
c) codon
d) ribosome
e) RNA polymerase. (5)
4. a) Write the sequence of letters representing the bases in the coding
strand of the piece of DNA that was used to make the following
mRNA molecule: (2)
AUGUUGCAUAAAAGCGGUCAU

b) How many amino acids does this piece of DNA code for? Explain your
answer. (2)
5. A coding strand of DNA has the following sequence of bases
(read the sequence from left to right): CGCTCAAGGCGA
a) Give the base sequence of the mRNA that will be produced by
transcription from this piece of DNA. (4)
b) Use Table 1.1 to work out which amino acids are coded for by this
piece of mRNA. Write these amino acids in the order in which they
will be joined together during translation. (4)
6. The diagram in Figure 1.19 is a summary of protein synthesis.
A
nuclear membrane
1
2 J
B
cytoplasm
D 4
H
I
3 8
6
C E
G
7
F 5
Fig. 1.19 Summary of protein synthesis
a) Identify each of the structures labelled A to I. (9)

b) Briefly describe what is happening at each stage of the process at
numbers 1 to 8. (8)
7. The diagram in Figure 1.20 shows
the DNA profiles taken at two
hair found on
hair found on
victim’s nails
crime scenes.
skin under
the floor
The first crime scene was a house

the safe
brother
victim’s
owner
victim
that had been broken into and

burgled. The second crime scene
was a flat where a man was found
murdered two weeks
later. At first, it appeared that
there was no connection between
the two crimes.
crime scene 1 crime scene 2
Fig. 1.20 DNA Profiles

Look carefully at the DNA profiles produced from forensic evidence found at the
two crime scenes.
a) Using the evidence provided, suggest who robbed the house.
Give a reason for your answer. (3)
b) Using the evidence provided, suggest who murdered the man in
the flat. Give a reason for your answer. (2)
c) What evidence shown in the DNA profiles in Figure 1.20 could have
been used by the police to work out that the two crimes were
connected? (2)
8. In a short essay, briefly explain the role of tRNA and mRNA in making
proteins in a cell.
Content (17)
Synthesis (3)
[20]
Summary
r DNA is found in the nucleus of eukaryotic cells in the form of chromosomes. It

is also found in mitochondria and chloroplasts.
r DNA is a long molecule made up of many similar units called nucleotides that
are bonded together in a chain.
r Each DNA nucleotide consists of a deoxyribose sugar, a phosphate and one of
four possible bases: adenine, thymine, cytosine or guanine.
r DNA molecules are formed from two polynucleotide chains that are held
together by hydrogen bonds. The hydrogen bonds connect pairs of bases.
Adenine is always bonded to thymine and cytosine is always bonded to guanine.
The DNA molecule is twisted into a shape called a double helix – ‘double’
because it consists of two polynucleotide chains and ‘helix’ because it is a spiral.
r The sequence of bases in a DNA molecule is unique for each person (except for
identical twins). We can therefore identify people using their DNA. This is called
DNA (genetic) profiling or DNA fingerprinting.
r Before new cells can be made, DNA has to be replicated (copied exactly). This
occurs during interphase of the cell cycle.
r DNA carries hereditary information in the form of genes. Each gene carries the
instruction to make a specific protein.
r Proteins are made of amino acids. The sequence of amino acids in a specific
protein is determined by the sequence of bases in a particular gene. This is called
the genetic code. Each amino acid is coded for by a group of three bases.
r RNA is found in the nucleus of eukaryotic cells, in the cytoplasm and in
ribosomes, mitochondria and chloroplasts.
r RNA is a polynucleotide chain/single strand of nucleotides. Each RNA
nucleotide consists of a ribose sugar, a phosphate and one of four possible bases:
adenine, uracil, cytosine or guanine.
r There are three types of RNA: mRNA, tRNA and rRNA.
r RNA plays an important role in protein synthesis. In transcription, an mRNA
molecule is made from the coding strand of a piece of DNA (a gene). During
translation, a tRNA molecule picks up a specific amino acid from the cytoplasm.
The mRNA is ‘read’ by a ribosome and amino acids are assembled in the correct
order to make a specific protein.

Topic
2 Meiosis
r the location, structure and arrangement of chromosomes and the difference

between haploid and diploid
r the purpose of reduction division
r the process of meiosis
r the importance of meiosis
r how meiosis introduces genetic variation to the gametes
r the consequences of abnormal meiosis
r the similarities and differences between mitosis and meiosis.
In the photograph you can see different human gametes. The larger female gamete is
an ovum (also called an egg cell; pl.: ova) that is surrounded by much smaller male
gametes or sperm cells. These gametes were formed by a process called meiosis.
As you work through this topic, you will be able to answer the following questions:
r What events happen during meiosis to form gametes?
r How does meiosis produce gametes that are genetically different?
r Why is meiosis important in the reproduction of living organisms?
22 t Topic 2: Meiosis
chromosome: In Grade 10 you learnt about chromosomes. You also learnt about the cell cycle. The cell
thread-like cycle is the sequence of events that takes place when a cell grows and then divides. The
structure
consisting of cell cycle can be divided into three phases:
DNA and r Interphase is when the cell grows and the chromosomes in the nucleus replicate
protein, and (make identical copies of themselves). Each chromosome consists of two identical
found in the chromatids joined at the centromere.
nuclei of plant
and animal cells r Mitosis is division of the nucleus. During mitosis, the nucleus of a cell divides to
cell cycle: the
produce two daughter nuclei. Each daughter nucleus has the same number and type
events that take of chromosomes as the parent nucleus.
place in a cell r Cytokinesis is the division of the cytoplasm into two identical daughter cells. The
leading to its daughter cells have exactly the same genetic information and the same number of
division
chromosomes as the parent cell.
interphase: the
phase of the cell
cycle when the Mitosis takes place when an organism needs to grow, replace damaged tissues or reproduce
nucleus and cell asexually. Although mitosis is a continuous process, it is divided into four stages. Look at
are not dividing Figure 2.1 to refresh your memory of what happens during each stage of mitosis.
chromatid: one
of the two chromatid
identical strands
formed when a centromere
chromosome is
replicated before PROPHASE
Two identical daughter t DISPNPTPNFTDPOUSBDU
the cell divides cells are produced centrioles
and become visible
centromere: the spindle t OVDMFVTEJTBQQFBST
constricted forms t TQJOEMFTUBSUTUPGPSN
region of a
chromosome at TELOPHASE METAPHASE
spindle
which the two t DISPNBUJET OPXDBMMFEEBVHIUFSDISPNPTPNFT
fibre t DISPNPTPNFTMJF
chromatids are arrive at the poles of the spindle on the equator of
held together t BOVDMFVTGPSNTJOFBDIIBMGPGUIFDFMM the spindle
t UIFDFMMEJWJEFTJOUPUXP DZUPLJOFTJT
cytokinesis: equator of the spindle

division of the ANAPHASE
t DISPNBUJETTFQBSBUFBOENPWF
cytoplasm of a daughter chromosomes
toward opposite poles of the spindle
cell after the
nucleus has Fig. 2.1 The different stages of mitosis
divided
Write down the correct word or number in brackets that completes the
k
Chec following sentences.
lf
myse 1. Replication of DNA occurs during (interphase/mitosis) and each
chromosome consists of two (identical/non-identical) chromatids.
2. The nuclear membrane breaks down during (prophase/metaphase/
anaphase/telophase).
3. The chromosomes become enclosed in separate nuclei during the final
stage of mitosis called (prophase/metaphase/anaphase/telophase).
4. The chromosomes attach at their centromeres to the widest part of the
spindle during (prophase/metaphase/anaphase/telophase).
5. One chromatid of each chromosome is pulled to each of the poles
during (prophase/metaphase/anaphase/telophase).
6. (Cytokinesis/Karyokinesis), the division of the cytoplasm and cell into
two, occurs after the nucleus has divided.
7. A human cell with 46 chromosomes will form (two/four) cells by
mitosis, each of which contains (23/46/92) chromosomes.
Topic 2: Meiosis t 23
Unit 1 Chromosomes
Overview of chromosomes
Before studying the process of meiosis in Unit 2, you need to have a basic
understanding of chromosomes.
Figure 2.2 shows what chromosomes look like in the nucleus of a human cell as Fig. 2.2 Scanning electron
the cell is about to divide. Before the cell divides, the DNA in the nucleus
micrograph of human
replicates so that each chromosome is made up of two identical DNA
chromosomes
molecules. The identical DNA molecules form the two identical chromatids
(sister chromatids) of the chromosome. The chromatids are held together at the
centromere.
Each chromosome consists of many

different genes. A gene is a part of the identical karyotype: an
chromatids ordered display
DNA that makes up the chromosome. A (sister
centromere of all the
gene carries information about a specific chromatids) chromosomes
hereditary characteristic of an organism, genes for different found in the
such as hair or eye colour. characteristics nucleus of a cell
autosome: a
Figure 2.4 shows a set of chromosomes chromosome that
from the nucleus of a human cell that is not a sex
Fig. 2.3 Simplified structure of a chromosome chromosome
were photographed and sorted into pairs
sex chromosomes:
according to features such as their size, shape and position of the centromere. This chromosomes
display of the set of chromosomes from a nucleus arranged in an ordered way is called a that determine
karyotype. the gender of an
organism
Chromosome pairs 1 to 22 are called autosomes. The 23rd pair consists of the sex homologous
chromosomes. The sex chromosomes in human males consist of one X chromosome and chromosomes: a
pair of
one Y chromosome. The X chromosome and the Y chromosome differ in shape and size. chromosomes,
The sex chromosomes in human one from each
females consist of two X parent, that are
chromosomes of the same shape similar in
structure and
and size. have the same
gene loci
The matching chromosomes in
each pair are called homologous
chromosomes. Each
chromosome of a homologous
pair comes from one of the
parents. All normal human
somatic cells (also known as
body cells) contain 46
chromosomes or two sets of
23 chromosomes. One set of
Fig. 2.4 Karyotype of a human male: the chromosomes 23 chromosomes comes from
in the cell have been stained with a special dye that the father and the other set of
causes a pattern of different bands on each 23 chromosomes comes from
chromosome. the mother.
The chromosomes are brought together at

23 fertilisation, when the nucleus of the male’s
sperm cell fuses with the nucleus of the
sperm female’s ovum to form a zygote. Therefore,
fertilisation 46
one chromosome in each of your
homologous chromosome pairs comes from
zygote
23 your father and is the paternal chromosome;
(fertilised egg)
the other chromosome of the homologous
egg pair comes from your mother and is the
maternal chromosome. Homologous
HAPLOID DIPLOID chromosomes are similar in structure and
Fig. 2.5 Your chromosomes are inherited from both of your carry genes for the same characteristics. You
parents. The figures refer to the number of chromosomes in will learn more about homologous
the cells. chromosomes in Topic 5.
A male or female gamete has only one set of chromosomes and is a haploid cell,
containing a haploid number (n) of chromosomes. Other body cells have two sets of
zygote: the cell chromosomes in their nuclei and are diploid cells, containing a diploid number (2n) of
that is formed
chromosomes.
when an ovum
and a sperm cell
join together The number of chromosomes in a somatic cell is constant for a particular type of
during organism. For example, every human somatic cell contains 46 chromosomes.
fertilisation
paternal
chromosome: a Activity 2.1 Learning task
chromosome
from the male
parent 1. What is the difference between:
a) a chromosome and a chromatid?
maternal
chromosome: a b) a haploid cell and a diploid cell?
chromosome c) an autosome and a sex chromosome? (6)
from the female 2. Study the information in Table 2.1 and answer the questions that follow.
parent
haploid: a cell in Table 2.1 The number of chromosomes in body cells of different species
which the
nucleus contains
Species Number of chromosomes
one full set of
chromosomes Cat 38
diploid: a cell in Cow 60
which the
nucleus contains Dog 78
two full sets of Fruit fly 8
chromosomes
Gorilla 48
Human 46
Pea plant 14
Potato plant 48
a) Do more complex organisms generally have more chromosomes in

their body cells? Explain your answer. (3)
b) Why are all the numbers in the table even numbers? (2)
c) Since potato plants and gorillas have the same number of chromosomes
in their cells, shouldn’t they look the same? Why are they different? (3)
Make a karyotype
You will need:

r pair of scissors r enlarged photocopy of Figure 2.6 a)
r glue r enlarged photocopy of Figure 2.6 b).
Method
1. Cut out the chromosomes in Figure 2.6 a). The X chromosome has been identified for you.
2. Sort the chromosomes into homologous pairs.
3. Arrange the chromosomes on the karyotype sheet, from the longest to the shortest. Place the sex
chromosomes after the smallest autosomes.
4. Once your sorting is complete, paste the chromosomes onto the sheet. (6)
Questions
1. Other than size, what helped you to identify the chromosomes in a homologous pair? (3)
2. Suggest why a scientist would want to look at chromosomes arranged in a karyotype. (2)
3. Is the karyotype that of a male or a female? (1)
a)
b)
_________ _________ _________ _________ _________

1 2 3 4 5
_________ _________ _________ _________ _________ _________ _________

6 7 8 9 10 11 12
_________ _________ _________ _________ _________ _________

13 14 15 16 17 18
_________ _________ _________ _________ _________ _________

19 20 21 22 X X/Y
Fig 2.6 a) Diagram of stained human chromosomes, showing banded patterns, at metaphase
of mitosis. b) Human karyotype sheet
Unit 2 Meiosis: The process of

reduction division
Purposes of reduction division

Before sexual reproduction can take place, an organism needs to make gametes. The
gametogenesis: production of gametes, the sperm and ovum, is called gametogenesis. In animals, gametes
the production form by a process called meiosis. During meiosis, the nucleus of a cell divides to produce
of gametes by a
four daughter nuclei. Each daughter nucleus has half the number of chromosomes of the
process that
involves meiosis parent nucleus.
meiosis: a type of Meiosis is referred to as a reduction division because it halves the number of
nuclear division
that produces chromosomes in the nucleus of a cell.
daughter nuclei
that have half Gametes that form by meiosis have half the normal number of chromosomes found in
the number of somatic cells. Somatic cells are diploid cells and gametes are haploid cells. For example,
chromosomes of in humans, gametes contain the haploid number of 23 chromosomes. When fertilisation
the parent
nucleus takes place, a sperm cell fuses with an ovum to form a zygote. The diploid number of 46
chromosomes is restored in the zygote. The zygote then divides by mitosis to eventually
form all the somatic cells, each of which has 46 chromosomes. Meiosis ensures that the
chromosome number in the body cells of an organism remains constant from the parents
to their offspring and from one generation to the next.
a) b)
fertilisation fertilisation
adult gametes zygote adult adult gametes zygote adult
Fig. 2.7 a) The number of chromosomes would double in each generation if the number of
chromosomes was not halved in the gametes. b) The number of chromosomes remains the
same in each generation because the number of chromosomes is halved in the gametes.
sporophyte
Gametes are formed in the reproductive structures of
animals and plants.
zygote In animals, meiosis occurs in the ovaries to produce

Diploid (2n) Sporophyte
Generation
haploid ova, and in the testes to produce haploid sperm
cells.
fertilisation meiosis
Not all gametes are formed by meiosis. Study Figures 2.8
Haploid (n) Gametophyte and 2.9. Figure 2.8 shows the life cycle of plants, such as
Generation spore mosses and ferns, that you studied in Grade 11.
female gamete
mitosis
male gamete gametophyte Fig. 2.8 Alternation of generations in the life cycle of
mitosis plants such as mosses and ferns
Even though the gametes are haploid, they are not formed by meiosis. The haploid
gametophyte produces haploid gametes by mitosis. In mosses and ferns, haploid spores
are produced by meiosis within the sporangia (spore-producing capsules) on the diploid
sporophyte. The haploid spores develop into the gametophyte that produces the gametes.
In flowering plants, haploid spores are formed by meiosis in the ovules within the ovary
and in the anthers of the flower.
}
a) sporangium b) spores (n) are
produces spores (n) produced by
by meiosis meiosis on the
sporophyte (2n) underside of the
leaves, in
structures called
}
sporangia
gametophyte (n)
produces gametes (n)
by mitosis
Fig. 2.9 a) A moss gametophyte with sporophyte attached

b) A fern plant (sporophyte)
Study the two life cycles shown in Figure 2.10 and then answer the questions below.
1. Why is it important for gametes of animals and plants to be haploid
and not diploid? (2)
2. Name the process (mitosis/meiosis/fertilisation) that occurs at
A, B, C, D, E, F, G and H. (8)
Gametes Haploid
multicellular
organism
(gametophyte)
Spores Gametes
Haploid
Diploid multicellular Diploid

organism Diploid multicellular
Zygote organism (sporophyte)
Zygote
Fig. 2.10 Life cycles of two different organisms
crossing over:
the exchange of The process of meiosis
genetic material
between the Meiosis occurs as two separate nuclear divisions. The first meiotic division (Meiosis I) is a
chromatids of reduction division, resulting in two daughter nuclei with half the number of chromosomes
homologous of the parent nucleus. In the second meiotic division (Meiosis II), each of the haploid
chromosomes daughter nuclei formed by Meiosis I divides again to form four haploid daughter nuclei.
chiasma: the
point at which
the chromatids
Look carefully at Figure 2.11. During the first meiotic division, chromosomes of each
of homologous homologous pair may exchange small parts of their chromatids, and therefore their
chromosomes genes, with one another. This is called crossing over. The point where crossing over
cross over each occurs is called a chiasma (pl.: chiasmata). There may be one or more chiasmata along the
other
length of the chromosome.
Figure 2.11 a) shows how a diploid cell forms four haploid cells by meiosis. To help you
understand the process, the parent cell is shown with only one pair of homologous
chromosomes.
a) Diploid parent cell
maternal chromosome
paternal chromosome
homologous chromosomes
Chromosomes replicate before meiosis
chiasma sister chromatids
First meiotic
division Homologous
chromosomes
separate into
different cells
Sister
chromatids
Second of each
meiotic chromosome
division separate
Daughter cells with only one
chromosome from the parent cell
b)
chiasma
Fig. 2.11 a) Formation of haploid cells

by meiosis b) Crossing over during
meiosis
Homologous Chromatids Chromosomes
chromosomes cross over and now have a
exchange new
genetic combination
information of genes
Use the diagrams in figures 2.11 a) and b) to help you answer the following questions.
1. Are the cells at the end of the first meiotic division the same or different to
each other? (1)
2. Are the cells at the end of the second meiotic division the same or different
to each other? (1)
3. Are the cells at the end of the first meiotic division haploid or diploid? (1)
4. Are the cells at the end of the second meiotic division haploid or diploid? (1)
5. Why is the second meiotic division necessary? (2)
6. During crossing over, are genes exchanged between:
a) sister chromatids or chromatids of different chromosomes? (1)
b) chromosomes in a homologous pair or chromosomes in different
homologous pairs? (1)
Stages of meiosis
Meiosis is a continuous process, but different stages can be identified by the behaviour of
the chromosomes and changes within the cell at each stage.
Study figures 2.12 to 2.20, which show diagrams of an animal cell (with 2n = 4) as it
undergoes the different stages of meiosis. Alongside each stage of meiosis is a sister chromatids:
photomicrograph of a cell in the testes of a locust. the two identical
chromatids
connected at the
During interphase, the chromosomes replicate. Each chromosome consists of two centromere that
genetically identical sister chromatids attached at their centromeres. In an animal cell, the make up a
centrioles also replicate. Once interphase is complete, Meiosis I takes place. chromosome
bivalent:
structure formed
during meiosis
centrioles
that consists of
replicate
two paired
chromosomes homologous
chromosomes
are long and chromosomes
in nucleus
threadlike
non-sister
nuclear chromatids:
membrane chromatids of
two different
Fig. 2.12 Interphase Source: Biophoto Association homologous
chromosomes
First meiotic division (Meiosis I)
r Prophase I
o Chromosomes condense and become visible. Each chromosome consists of two
identical chromatids (sister chromatids).
o Homologous chromosomes pair up. Each homologous chromosome pair is called
a bivalent because it consists of two chromosomes (bi- means two). One
chromosome of the pair comes from each parent.
o Crossing over occurs between non-sister chromatids of the homologous
chromosome pairs.
o A spindle forms. (In animal cells, the spindle forms between the centrioles that
move apart to opposite poles of the cell.)
o The nuclear membrane and nucleoli disappear.
spindle forms chiasma

centrioles
chromatids
chiasma } nuclear
membrane
bivalent disappears
Source: Biophoto Association
Fig. 2.13 Prophase I
r Metaphase I
o Homologous chromosome pairs (bivalents) line up on either side of the equator
of the spindle, attached to the spindle fibres at their centromeres.
centrioles
at pole bivalents line
up on equator
of spindle
spindle
}
centromere
fibre
equator of spindle

Fig. 2.14 Metaphase I
r Anaphase I
o The homologous chromosomes separate and move to opposite poles of the
spindle.
chromosome
moves
towards pole homologous
chromosomes
move to
opposite poles
homologous
chromosomes separate
Fig. 2.15 Anaphase I
r Telophase I
o Chromosomes reach the poles of the spindle. A haploid set of chromosomes
(n = 2) is at each pole, and each chromosome still has two chromatids.
o The spindle breaks down.
o A nuclear membrane forms around each set of chromosomes.
o Cytokinesis (division of the cytoplasm and cell into two) follows and two
daughter cells are formed.
Meiosis I is a reduction division since the nucleus of each daughter cell has half the
number of chromosomes of the parent nucleus.
cleavage furrow divides
the cell into two
two nuclei
form
nuclear membrane spindle breaks Source: Biophoto Association

reforms down
Fig. 2.16 Telophase I and cytokinesis
Second meiotic division (Meiosis II)

There is no replication of the genetic material before the second meiotic division. Each of
the haploid nuclei that resulted from Meiosis I divide again. The events of Meiosis II are
similar to those of mitosis.
r Prophase II
o The spindle reforms, at right angles to the spindle of Meiosis I.
o The nuclear membrane disappears.
o Each chromosome consists of two chromatids joined at the centromere.
chromatids nuclear membrane

disappears
centromere
spindle
reforms
Fig. 2.17 Prophase II
r Metaphase II
o Chromosomes, attached to spindle fibres, line up separately at the equator of the
spindle.
chromosomes
line up at the chromosomes
equator of the line up on
spindle equator
Fig. 2.18 Metaphase II

r Anaphase II
o The centromeres divide and the chromatids separate. The individual
chromosomes, called daughter chromosomes, move to opposite poles of the
spindle.
daughter
chromosomes
move to
opposite
poles daughter
chromosomes
at opposite
Fig. 2.19 Anaphase II poles
r Telophase II
o Chromosomes reach the poles of the spindle. Source: Biophoto Association
A haploid set of chromosomes (n = 2) is at each pole.

o The spindle breaks down.
o A nuclear membrane forms around each of the four sets of chromosomes.
o Cytokinesis follows and results in four haploid daughter cells that are genetically
different.
nuclear
membrane four nuclei
form
haploid,
genetically
different
daughter cells
Fig. 2.20 Telophase II and cytokinesis
The diagrams in Figure 2.21 summarise the events of meiosis. The parent cell is shown
with 2n = 4, and has one pair of long homologous chromosomes and one pair of short
homologous chromosomes.
Diploid parent cell (2n = 4)

Chromosomes replicate
First meiotic division

Homologous
Prophase I chromosomes
pair and crossing
over occurs
Homologous
chromosomes line
Metaphase I up on either side
of the equator of
the spindle
Homologous
chromosomes
Anaphase I
separate and
move towards
opposite poles
Early telophase I
Late telophase I
Second meiotic
division
Prophase II
Chromosomes
Metaphase II line up at the
equator of the
spindle
Chromatids
separate and
Anaphase II daughter
chromosomes
move to opposite
poles
Telophase II
and
Cytokinesis
Four different haploid daughter cells (n = 2)
Fig. 2.21 Behaviour of chromosomes during meiosis
1. Name the stage of meiosis in which each of the following

events occur:
a) Chromosomes in each bivalent separate and migrate toward opposite
poles.
b) Chromosomes line up on the equator as homologous pairs.
c) Crossing over occurs.
d) Two haploid nuclei are formed.
e) Sister chromatids move apart. (5)
2. Study the diagram in Figure 2.22 and then answer the questions
that follow.
a) How many of each of the following are there in the diploid nucleus
at the start of meiosis?
(i) chromatids
(ii) chromosomes
(iii) pairs of homologous chromosomes
(iv) molecules of DNA
(v) centromeres. (5)
b) Write down the number for each of the following in a gamete
formed from the cell in Fig 2.22 by meiosis:
(i) chromatids
(ii) chromosomes
(iii) pairs of homologous chromosomes. (3)
Fig. 2.22 Nucleus of a
diploid cell at the start
of meiosis
Activity 2.6 Practical task (prescribed)
Examine the stages of meiosis
You will need:

Microscope and prepared microscope slides of cells at different stages of meiosis or
micrographs or models of cells in different stages of meiosis.
1. Carefully observe the chromosomes at Prophase I in the micrograph

(Figure 2.13) on page 31.
a) Make a drawing of the chromosomes in the micrograph. Your drawing
must be clear and accurate. (5)
b) Give your drawing a heading. (1)
c) Label any two structures in your drawing. (2)
d) Describe what is happening to the chromosomes in your drawing
during this stage of meiosis. (2)
2. Refer to the resources (microscope slides, micrographs or models) with which
you are provided to examine cells in different stages of meiotic cell division.
a) For each stage, make a labelled biological drawing of the cells you
observe. (10)
b) Identify the stage of meiosis in your drawings. (1)
c) Write down which feature in each of your drawings helped you to
name that particular stage of meiosis. (1)
Importance of meiosis
Meiosis is important in the life cycle of organisms for the following reasons:
r Meiosis produces gametes. Gametes are involved in sexual reproduction.
r Meiosis reduces the chromosome number from diploid to haploid. Meiosis gives
rise to cells that have half the number of chromosomes of the parent cell. Gametes
need to have half the number of chromosomes of a somatic cell because when their
nuclei fuse during fertilisation, the zygote that is produced will then have the
correct diploid number of chromosomes for that particular organism. If meiosis did
not occur, the fusion of gametes would result in the doubling of chromosome
number in successive generations.
r Meiosis promotes genetic variation. Crossing over in Prophase I and random
segregation of the chromosomes in Meiosis I ensure that the gametes are genetically
different. The offspring produced by the fusion of gametes will therefore be
genetically different. Genetic variation is important in determining how evolution
takes place. (You will study evolution in Topic 10.)
How meiosis results in genetic variation of gametes

Two events take place during meiosis that result in the gametes produced being
genetically different from each other and from their parent cell. When the genetically
different gametes fuse randomly at fertilisation, even more variation is produced in the
offspring.
The two events of meiosis that result in genetic variation of the gametes are crossing
over and random segregation.
r Crossing over
In Prophase I, non-sister chromatids of homologous chromosomes exchange genetic
material inherited from both parents. Crossing over is shown in Figure 2.11 b) on
page 29. Crossing over produces new combinations of genes on the homologous
chromosomes and results in gametes that are genetically different from each other.
r Random segregation (also known as random assortment or independent

assortment)
In Metaphase I, the maternal and paternal chromosomes of the homologous
chromosome pairs are arranged at random (i.e. not in a specific order) on the
equator of the spindle. The maternal and paternal chromosomes may carry different
forms of the gene, for example genes for dark eyes and genes for blue eyes. When
these homologous chromosomes separate during Anaphase I, they do so
independently of all the other pairs of homologous chromosomes. It is left to chance
as to whether a gamete will get the maternal or paternal chromosome of a
homologous pair. The arrangement of maternal and paternal chromosomes in
Metaphase I determines which chromosomes will be distributed together into
which gametes. The first meiotic division therefore results in the random
segregation of maternal and paternal chromosomes into different gametes.
Figure 2.23 shows what may happen if you have two pairs of homologous
chromosomes. There are two possible arrangements of chromosomes at the equator
of the spindle in the first meiotic division. This results in four possible different
combinations of chromosomes in the gametes.
r Mutations, or sudden changes in the genetic material, may also produce gametes
that are different. You will study mutations in Topic 5 on Page 90.
First arrangement Second arrangement
Two possible Key:

arrangements at Maternal
Metaphase I of meiosis chromosomes
(crossing over is not
shown) Paternal
chromosomes
Metaphase II
of meiosis
Gametes
Combination 1 Combination 2 Combination 3 Combination 4
Fig. 2.23 Random segregation of chromosomes during meiosis
Cool fact
In human cells with 23 pairs of homologous chromosomes, there are more than eight
million possible combinations of maternal and paternal chromosomes in the
gametes.
A model to show random segregation of chromosomes
You will need:

r six pairs of socks of different colours – two short pairs of socks of the same
length but different colours, two long pairs of socks of the same length but of
different colours and two pairs of socks of the same medium length but of
different colours (no two pairs of socks must be the same colour)
r newspaper
r ball of wool or string
r pair of scissors
r piece of unlined paper
r coloured pencils.
Fig 2.24 Learners modelling
random segregation in
meiosis
1. Fill each sock with newspaper and place the two socks of each matching pair
together with their heels touching. Use string or wool to tie the two matching
socks of each of the six pairs of socks together. Each tied pair of socks represents
a chromosome in Prophase I of meiosis.
2. Place the pairs of socks of the same length together side-by-side. Arrange the
pairs of socks of different lengths under one another on a flat surface, as shown
in Figure 2.24. This represents the lining up of bivalents at the equator in
Metaphase I of meiosis. Surround the socks with a piece of wool or string tied in
a circular shape to represent the cell membrane. Use the coloured pencils to
draw the arrangement of socks in the ‘cell’.
3. Move the matched pairs of socks apart to form two groups of socks. Untie the
circular wool or string and cut it in half. Tie the pieces of wool or string into two
circular shapes and place them around each group of socks. This represents the
two daughter cells at the end of the first meiotic division. Use the coloured
pencils to draw the two groups of socks in each of the daughter ‘cells’.
4. Repeat Step 2. Place the matching pairs of socks under one another in other
possible arrangements. Then repeat Step 3 for every possible arrangement of the
socks.
Questions
1. What is represented by each of the following in your model?
a) one sock in a pair of socks
b) two pairs of socks of the same length
c) the piece of wool or string holding the socks together. (3)
2. Why did the two pairs of socks of the same length need to be of different
colours? (2)
3. With three homologous pairs of chromosomes:
a) how many different arrangements of chromosomes are possible at
Metaphase I of meiosis? (1)
b) how many different combinations of chromosomes are possible in the
daughter cells at the end of the first meiotic division? (1)
c) how many different combinations of chromosomes are possible in the
gametes? (1)
4. Do you think that this is a good model to show random segregation?
Give reasons for your answer. (3)
5. Suggest one improvement you could make to this model to show the
behaviour of the chromosomes in the first meiotic division more accurately. (1)
Consequences of abnormal meiosis

If meiosis does not take place normally, the gametes produced may have chromosomal
abnormalities such as a change in the number or the structure of the chromosomes.
non-disjunction:
the failure of
Chromosomal abnormalities may result in different genetic disorders, for example Down
chromosomes to syndrome in humans.
separate
correctly during Non-disjunction is a type of error that could happen during meiosis. Non-disjunction
the first or
second meiotic
occurs when homologous chromosomes do not separate at Anaphase I or the sister
division chromatids do not separate at Anaphase II. As a result of non-disjunction, the gametes
produced have too many or too few chromosomes.
Figure 2.25 shows what

one extra
chromosome
happens when non-disjunction
(n + 1) of one homologous
chromosome pair occurs during
one extra Anaphase I in meiosis. Both
chromosome chromosomes of the one
(n + 1)
homologous pair move to the
one less same pole, leaving one
Metaphase I non-disjunction chromosome daughter cell without that
at Anaphase I (n – 1) particular chromosome. The
one less cells continue to go through
chromosome Anaphase II of meiosis and
Metaphase II Anaphase II (n – 1) divide normally, producing
gametes four gametes. Two gametes
have one complete set of
Fig. 2.25 Non-disjunction during Anaphase I of meiosis chromosomes plus one extra
chromosome. The other two
gametes lack a chromosome.
If total non-disjunction occurs and the full set of chromosomes does not separate during
meiosis, the gametes produced will be diploid, in other words, each gamete will have two
full sets of chromosomes.
If the gametes formed by abnormal meiosis are fertilised by normal gametes, they will
form zygotes with an abnormal number of chromosomes. trisomy: an
abnormal
condition in
r If a gamete with an extra chromosome fuses with a normal haploid gamete, the which a diploid
resulting zygote has an extra (third) chromosome of one type. This chromosomal cell has three
abnormality is called trisomy. Most zygotes with an extra chromosome do not copies of a
survive. However, humans with three chromosomes number 21 (trisomy 21) in their particular
chromosome
cells do survive but are affected by a disorder called Down syndrome. Males with instead of the
three sex chromosomes (XXY) also survive, but have Klinefelter syndrome. (Both normal two
these syndromes will be discussed in more detail.) copies
r If a gamete with one less chromosome fuses with a normal haploid gamete, the syndrome: a
zygote that results has one chromosome missing. This chromosomal abnormality is group of signs
called monosomy. The cell has only one copy of a particular chromosome. In and symptoms
that indicate the
humans, most zygotes with a missing chromosome do not survive. However, human existence of a
females who are missing an X chromosome do survive, but are affected by a disorder disorder
called Turner syndrome, which will be discussed monosomy: an
in more detail later on. abnormal
r If a diploid gamete fuses with a normal haploid condition in
a) b) which a diploid
gamete, the zygote that results will be triploid,
cell has only one
which means that it will have three full sets of copy of a
chromosomes. This chromosomal abnormality is particular
called polyploidy. Organisms with three or more chromosome
instead of the
complete sets of chromosomes in their cells are
normal two
called polyploids. copies
Fig. 2.26 Polyploidy makes fruits
larger. a) The wild woodland triploid: a
Polyploidy is much more common in plants than in condition in
strawberry, Fragaria vesca, is
animals. Many plants are naturally polyploids, for which a cell
diploid (2n) with 14 chromosomes. contains three
example maize, potatoes and bananas.
Polyploid plants often have better characteristics than b) The commonly cultivated
full sets of
garden strawberry, Fragaria x chromosomes
their normal, diploid relatives. They may have
polyploidy: a
increased seed, flower and fruit size, better yields and Ananassa, is octoploid (8n) with condition in
stronger resistance to disease. 56 chromosomes. which a cell
contains more
than two full sets
Something interesting of chromosomes
Plant breeders are able to form polyploid plants by using chemicals such as
colchicine. This chemical prevents spindle fibres from forming. As a result,
chromosomes cannot separate during cell division and the cells that are formed
have twice the total number of chromosomes.
This technique of forming polyploid plants is used to produce improved
varieties of economically important crops such as tomatoes.
Human disorders caused by abnormal meiosis

A person with a chromosomal abnormality may have a specific syndrome that is
characteristic of the disorder. Scientists can predict the specific type of disorder by
looking at the person’s karyotype to see if there are any extra or missing chromosomes.
Down syndrome
Down syndrome is one of the most frequently occurring chromosomal abnormalities. The
syndrome is usually the result of an extra chromosome 21, so that each body cell has three
chromosomes 21 (Trisomy 21) and a total of 47 chromosomes. The extra chromosome 21
results from non-disjunction of chromosome 21 during gamete formation in one of the
parents. The sperm cell or ovum produced therefore has 24 instead of 23 chromosomes. If
the gamete with two chromosomes 21 fuses with a normal gamete with just one
chromosome 21, the zygote will have three copies of chromosome 21.
The 47 chromosomes are then copied in every cell that makes up the baby's body.
The following physical characteristics are typical of people with Down syndrome:
r a stocky body
r distinct facial features such as a flattened face with a small, broad nose, small skin
folds in the inner corner of the eyes that appear to slant upward, ears situated lower
down on the head and a large tongue
r broad hands with short fingers and a crease that runs across the palm
r a wide space between the first and second toes.
People with Down syndrome have an increased risk of developing medical problems
such as respiratory and ear infections and may have heart defects, as well as visual and
hearing problems. They may also be mentally challenged and develop slower.
Down syndrome is a naturally occurring biological phenomenon that affects people of

any race, gender and socio-economic status. Down syndrome occurs in all human
populations. A person with any disability, including Down syndrome, must be accepted
in society and treated with dignity and respect.
In South Africa, Down syndrome affects about one in every five hundred babies born.
The risk of having a child with Down syndrome increases with the age of the mother,
especially beyond the age of 35.
Certain tests allow doctors to detect Down syndrome in a foetus before it is born. You will
learn more about these tests in Topic 4. These tests are usually done on older mothers
whose babies have a greater chance of being born with Down syndrome.
Sperm with a normal number of Fertilised egg with

23 chromosomes (only one 47 chromosomes
chromosome number 21) (three chromosomes
number 21)
Egg with
24 chromosomes
(two chromosomes
number 21)
Fig. 2.27 Fertilisation of an ovum with an extra chromosome 21 by a normal sperm

cell results in Trisomy 21. Fig. 2.28 Distinct facial
features of Down
Syndrome
Cool fact
Down syndrome is named after British

doctor John Langdon Down, who
described this condition in 1866. The
cause of Down syndrome remained
unknown until the 1950s, when
researchers identified the extra
chromosome number 21. In most of
Trisomy 21 cases, the additional
chromosome comes from the mother's
egg rather than from the father's
sperm.
Fig. 2.29 Karyotype of a female with Down syndrome
Draw and interpret a graph about Down syndrome
The information in the table was obtained from four South African hospitals
situated in an urban area.
Table 2.2 The incidence of babies born with Down syndrome to mothers of increasing age in
South Africa
Age of mother Number of babies born with Down syndrome

(years) (per 1 000 births)
20 0,7
25 0,9
30 1,1
35 2,0
40 10,0
45 28,0
Draw a line graph using the data in the table. (10)
Questions
1. Describe the relationship between the age of the mother and the incidence
of Down syndrome. (2)
2. From what age are mothers at high risk of giving birth to a baby with
Down syndrome? (1)
3. Regardless of the mother’s age, the number of foetuses conceived with
Down syndrome is greater than the number of babies born with this
genetic disorder. Suggest a reason for this. (1)
4. How would you improve this study in order to obtain more accurate
information? (3)
Klinefelter syndrome
Klinefelter syndrome is an abnormality of the sex

chromosomes that affects male sexual development.
Because males with Klinefelter syndrome do not
produce enough of the hormone testosterone they
often have physical characteristics such as small
testes and less facial and body hair than normal
males. Most males with Klinefelter syndrome do not
produce enough sperm and may not be able to father
a child naturally. Men with Klinefelter syndrome
may develop more breast tissue than normal, grow
taller than normal or be more rounded with less
muscle mass.
Most males with Klinefelter syndrome have one

extra copy of the X chromosome in each cell (XXY)
Fig. 2.30 Klinefelter syndrome can be diagnosed using a
and a total of 47 chromosomes in their cells. The
karyotype. extra X chromosome results from non-disjunction of
the sex chromosomes during gamete formation in
one of the parents. When a gamete with two sex chromosomes (XX or XY) fuses with a
normal gamete with either a Y or an X chromosome, the zygote could end up with three
copies of the sex chromosomes (XXY) instead of the normal two (XY). The extra
chromosome is then copied in every somatic cell.
Turner syndrome
Turner syndrome arises because of a disorder of the sex chromosomes. Study the
karyotype in Figure 2.31. There are 45 instead of 46 chromosomes, and only one X
chromosome (monosomy X). The second X chromosome is missing. This happens when
an abnormal gamete, missing a sex chromosome, fuses with a normal gamete containing
an X chromosome. The sex chromosome is missing in the abnormal gamete as a result of
non-disjunction during
meiosis.
People who have Turner

syndrome develop as
females, but their growth
and sexual development is
affected. Typical symptoms
of Turner syndrome
include a short and stocky
body, a webbed neck with
extra skin folds, a low
hairline at the back of the
neck and swollen hands
and feet. Their ovaries do
not develop normally and
they are usually infertile.
Fig. 2.31 Karyotype of a girl with Turner syndrome
Unit 3 Comparison of mitosis and meiosis
Similarities and differences between mitosis and
meiosis
Mitosis and meiosis are different types of nuclear division that take place in the cells of
living organisms. DNA replication occurs during interphase before both mitosis and meiosis
begin. Daughter cells result from cytokinesis which occurs after the nucleus has divided.
Mitosis Meiosis
Prophase Parent cell MEIOSIS I

(before chromosome replication)
Prophase I
homologous
}
sister Chromosomes Chromosomes chromosomes
chromatids replicate replicate pair and crossing
over occurs
Metaphase Metaphase I
Chromosomes Homologous
line up singly chromosome
at the equator pairs line up at
of the spindle the equator of
the spindle
Anaphase Anaphase I
Sister
chromatids
separate and Homologous
move as chromosomes
daughter separate
chromosomes chromatids
to opposite
poles
Haploid Telophase I
daughter cells and
Telophase cytokinesis
and
cyto-
kinesis
Identical daughter cells

Sister MEIOSIS II
chromatids
separate in
Anaphase II
Haploid, non-identical daughter cells
Fig. 2.32 Differences between the events of mitosis and meiosis
Similarities between mitosis and meiosis

r Both processes involve division of the nucleus.
r Both processes can be divided into the following stages:
o prophase
o metaphase
o anaphase
o telophase.
Differences between mitosis and meiosis

Study Figure 2.32 and compare the behaviour of the chromosomes in mitosis and meiosis.
Then study Table 2.3, which describes how mitosis differs from meiosis.
Table 2.3 Differences between mitosis and meiosis
Mitosis Meiosis
Site where the t 4PNBUJDDFMMTPGBOJNBMT FHUIF t 0WBSJFTBOEUFTUFTPGBOJNBMT UP
process occurs epidermis of the skin form gametes)
t ;ZHPUF UPGPSNBOFNCSZPBOE t 4QPSBOHJBJOBOUIFSTBOEPWVMFTPG
adult organism) flowering plants (to form spores)
t .FSJTUFNBUJDUJTTVFPGQMBOUT t 4QPSBOHJBPGNPTTFTBOEGFSOT UP
t (BNFUPQIZUFPGQMBOUT UPGPSN form spores)
gametes)
Purpose of the t 1SPEVDUJPOPGEBVHIUFSDFMMTXJUI t 1SPEVDUJPOPGEBVHIUFSDFMMTXJUI
process the same chromosome number and half the chromosome number
type as the parent cell of the parent cell. This prevents
t 0DDVSTEVSJOH the chromosome number from
o growth of a zygote into a doubling from one generation to
multicellular organism the next
o growth and repair of tissues t 'PSNTIBQMPJEHBNFUFT TQFSN
o asexual reproduction and ova) in animals for sexual
o production of gametes in reproduction
plants such as mosses and ferns t 'PSNTIBQMPJETQPSFTJOþPXFSJOH
plants, mosses and ferns
t *OUSPEVDFTHFOFUJDWBSJBUJPOJOUIF
daughter cells
Daughter cells t 5XPEBVHIUFSDFMMTQSPEVDFEGSPN t 'PVSEBVHIUFSDFMMTQSPEVDFEGSPN
produced a parent cell a parent cell
t %BVHIUFSDFMMTJEFOUJDBMUPPOF t %BVHIUFSDFMMTEJGGFSGSPNPOF
another and to parent cell another and from the parent cell
t %BVHIUFSDFMMTIBWFUIFTBNF (as a result of crossing over and
number of chromosomes as the of random segregation of the
parent cell , e.g. (2nq2n or nqn) homologous chromosomes)
t %BVHIUFSDFMMTIBWFIBMGUIF
number of chromosomes of the
parent cell – meiosis is a reduction
division (2nqn)
Number of Completed after one division Completed after two divisions –
divisions Meiosis I and Meiosis II
Behaviour of Prophase Prophase I
chromosomes Homologous chromosomes do Homologous chromosomes pair up;
not pair up; no crossing over or crossing over and exchange of genetic
exchange of genetic material between material between chromosomes occur
chromosomes occurs
Metaphase I
Metaphase Chromosomes line up in their
Chromosomes line up singly at the homologous pairs on either side of the
equator of the spindle equator of the spindle
Anaphase Anaphase I
Centromere divides; identical Non-identical chromosomes of a
chromatids separate and move as homologous pair separate and move
daughter chromosomes to opposite to opposite poles; chromatids remain
poles together
Telophase Telophase I
Both homologous chromosomes are Only one of each pair of homologous
present in each of the two daughter chromosomes are present in each of
cells. the two daughter cells.
1. State whether each of the statements below refers to mitosis, to meiosis or to

both mitosis and meiosis. Write ‘mitosis’, ‘meiosis’ or ‘both’ next to the
appropriate letter.
a) At the start of nuclear division, each chromosome consists of two chromatids.
b) The number of chromosomes remains the same.
c) Chromosomes arrange themselves in pairs in the region of the equator.
d) Chromatids are pulled apart.
e) Crossing over may result in genetic variation.
f) Gametes are formed.
g) Two daughter cells form from a parent cell.
h) The process is a reduction division. (8)
2. The relative amounts of DNA were measured
in an anther cell of a plant during division of
the cell.
The results are shown in the graph alongside.
Study the graph and answer the questions DNA content/
that follow. nucleus
a) X on the graph represents interphase before
the cell divides. By referring to the graph,
describe what happens to the DNA content Time
of the cell at interphase. (2)
b) Explain the change in the amount of DNA at Y and Z on the graph. (2) Fig. 2.33 Graph of
c) Which type of nuclear division (mitosis or meiosis) is represented by the DNA content of a
the graph? (1) cell
d) Give a reason your answer in c). (2)
More questions on meiosis
1. Give the correct word or term for each of the following:

a) an organism with more than two haploid sets of chromosomes
b) the point at which chromatids exchange genetic material during
meiosis
c) division of the cytoplasm that takes place after the nucleus has
divided
d) the type of cell division that forms sex cells in diploid organisms
e) the reproductive organ in human females in which meiosis occurs
f) the complete number of chromosomes in the nucleus of a diploid cell
arranged in pairs according to their size and shape
g) a pair of chromosomes of the same size that originates from each of the
parents
h) the failure of chromosomes to separate during anaphase of Meiosis I
i) a disorder in humans also known as Trisomy 21
j) the region on a chromosome where the chromatids are held together. (10)
2. Study the diagrams in Fig. 2.34 that represent different stages of meiosis in
a cell with a diploid number of four.
Diagram 1 Diagram 2 Diagram 3 Diagram 4
Fig. 2.34 Different stages during meiotic division of the cell
a) Identify the stage of meiosis represented in:

(i) Diagram 1 (1)
(ii) Diagram 2. (1)
b) The diagrams are not in the correct sequence. Write down the numbers
of the diagrams to show the correct sequence in which the stages occur. (2)
c) Write down the number(s) of the diagram(s) of the stage(s) that take
place in the second meiotic division. (1)
d) Tabulate three differences between the events of the first and second
meiotic divisions. (7)
e) Name the process that is occurring at X in Diagram 2. (1)
f) Is the cell in Diagram 4 haploid or diploid? (1)
g) Give a reason for your answer to f). (2)
h) Explain two ways in which meiosis is biologically important. (4)
3. Study the diagrams in Figures 2.35 a) and b) and answer the a)
questions that follow. A
a) Would you see structures labelled A with the naked B C
eye or with a microscope? (1)
b) Give one way in which the chromosomes labelled A
are:
D
(i) similar
(ii) different. (2)
c) Give labels for parts B, C and D. (3)
d) How many chromosomes are shown in the diagram
in Figure 2.35 a)? (1) b)
e) How many chromosomes are there in each cell at the
end of meiosis? (1)
f) Which phase of meiosis is shown in Figure 2.35 a)? (1)
g) Give a reason for your answer in f). (2)
h) Figure 2.35 b) shows two of the cells that could form
from the animal cell at the end of meiosis. Draw the
remaining cells in a similar way. Do not include
labels. (4) Fig 2.35 a) Diagram
4. Meiosis is a process of nuclear division that forms gametes. Describe the representing a phase
mechanisms that introduce genetic variation into the gametes. Also of meiosis in an
describe how Down syndrome results from faulty meiosis. animal cell
Note: No marks will be awarded for answers in the form of flow charts or b) Diagram showing
diagrams. Content (17) two of the cells that
Synthesis (3) could result from the
[20] animal cell at the end
of meiosis
Summary
r Meiosis is a type of nuclear division that occurs in the production of haploid

gametes in animals or spores in mosses and ferns.
r Meiosis is a reduction division, as it halves the number of chromosomes in the
nucleus. This keeps the chromosome number constant from one generation to
the next in organisms that reproduce sexually.
r Meiosis consists of two divisions. Each division is divided into the stages:
prophase, metaphase, anaphase and telophase. In the first meiotic division, the
homologous chromosomes separate and go into different cells. In the second
meiotic division, the chromatids of each chromosome separate into different
cells.
r Division of the cytoplasm (cytokinesis) follows nuclear division (karyokinesis)
and results in four haploid daughter cells formed from a single diploid cell.
r The haploid cells produced by meiosis are genetically different from one another
and from the parent cell.
r Genetic variation of the gametes results from the exchange of genetic material
(crossing over) between the non-sister chromatids of homologous chromosomes
in Prophase I and the random segregation of the maternal and paternal
chromosomes of a homologous pair in the first meiotic division.
r Cells with an abnormal chromosome number may result from abnormal
meiosis. An abnormal chromosome number can arise when a normal gamete
fuses with a gamete that has either two copies of a chromosome or no copies of a
chromosome as a result of non-disjunction during meiosis. A person with cells
that have an abnormal chromosome number may have a genetic disorder, such
as Down syndrome (Trisomy 21), Klinefelter syndrome (XXY) or Turner
syndrome (XO).
r Polyploidy, a condition in which cells have more than two complete sets of
chromosomes, can arise as a result of complete non-disjunction of chromosomes
during gamete formation.
r Mitosis, another type of nuclear division, differs from meiosis in that it produces
identical daughter cells with the same chromosome number and type as the
parent cell. Mitosis is needed for growth, asexual reproduction and the
replacement of damaged or old cells.
Topic
3 Reproduction in vertebrates
r external and internal fertilisation

r ovipary, ovovivipary, vivipary
r amniotic eggs
r precocial and altricial development
r parental care.
The ability to reproduce is one of the seven characteristics of a living organism.

Vertebrate animals reproduce sexually. Sexual reproduction has the advantage of
maintaining genetic diversity. However, sexual reproduction is not without its
problems. Successful sexual reproduction needs a male and female, a liquid medium
and nourishment for the developing offspring. In this picture you see all three
requirements – a male frog and a female frog reproducing in water. The adult frogs
are surrounded by their eggs which have an outer layer of jelly to protect and
nourish the developing offspring.
For animals that reproduce sexually, the first obstacle is to find a way to bring the
egg and sperm together. Then the next generation needs a food source and
protection from the environment while they develop. How do animals achieve all of
this? In this topic, you will learn about the various ways and options that vertebrate
animals utilise to ensure they reproduce successfully.
50 t Topic 3: Reproduction in vertebrates

Life processes in plants and animals
In previous grades, you learnt about methods of reproduction in a variety of organisms.

Single-cell organisms reproduce asexually for the most part. They achieve this by
undergoing simple mitotic cell division. This process is called binary fission, which
means ‘to split in two’. Protista, such as the unicellular protozoan Amoeba, will reproduce
asexually by binary fission, but only when conditions for survival are favourable.
Asexual reproduction is quick and efficient, since no partners need to be found and no
courtship is necessary. The population numbers of organisms using binary fission can
increase very rapidly, enabling the organisms to make maximum use of the favourable
conditions. The shortcoming of asexual reproduction is that the offspring lack genetic
diversity.
When conditions for survival become unfavourable, organisms that usually reproduce
asexually will reproduce sexually instead. As a result of sexual reproduction, a resistant
zygospore is formed. Inside the zygospore, the embryo is well protected from adverse
environmental conditions. In addition, new genetic combinations will be formed.
Organisms that reproduce sexually under unfavourable conditions include bacteria,
Hydra, fungi and algae (algae are autotrophic Protista).
gametes: sex
cells, in other
words, ova (egg Sexual reproduction takes place when specialised sex cells called gametes (eggs and
cells) and sperm sperm) fuse to form a single cell called a zygote. It is from this zygote that the new
organism, with its own unique genetic combination, will develop.
1. What is the purpose of reproduction?

k
Chec 2. What is meant by sexual reproduction?
lf
myse 3. List three advantages that asexual reproduction has over sexual
reproduction.
4. What is the biggest disadvantage of asexual reproduction?
5. List three requirements for successful sexual reproduction.
6. What are gametes?
7. What type of cell division produces gametes in animals?
Topic 3: Reproduction in vertebrates t 51

Unit 1 Diversity of reproductive strategies
External or internal fertilisation

Vertebrate animals reproduce sexually. For vertebrate animals to reproduce successfully, fertilisation: the
fertilisation needs to take place. To achieve this, the ova and sperm of a female and a fusion of a
male have to be brought together. sperm cell
nucleus with
that of an ovum
One of the problems of bringing the sperm and the ovum together in terrestrial (egg cell) to
vertebrates is that sperm swim to reach the ovum. For this they need a liquid medium. form a zygote
Terrestrial vertebrates have to create their own liquid medium, and make sure that this terrestrial: living
liquid is not exposed to the drying effects of the outside environment. This has led to the on dry land
development of internal fertilisation.
In aquatic vertebrates that spend part of, or their whole life cycle in water, having
swimming sperm does not present a problem. The surrounding water provides the liquid
needed by the sperm and fertilisation can take place outside the animal’s body.
External fertilisation
Most vertebrates that live in water make use of external Male fish waits
fertilisation. Fish and amphibians are the two classes of to spread sperm
vertebrate that use this method of fertilisation. over eggs
External fertilisation takes place outside the body of the

animal. The male and female gametes are released into the
Female fish
water. The sperm cells either swim towards the eggs or are
lays eggs
carried by water currents towards the eggs. During external
fertilisation, physical contact between the male and female is
not necessary (see Figure 3.1). A male and a female fish swim
in circles around each other while releasing their eggs and
sperm. This behaviour is called spawning. The chances of
successful fertilisation increase when the male and female find
themselves in the same immediate area.
Fig. 3.1 Fish spawning
Some form of courtship is necessary to attract the sexes to one
another. Examples of such courtship include colour changes in
fish, mass external fertilisation occurring at full moon at a
particular time of the year and frogs croaking (see Figure 3.2). A
male frog calls to attract a female into his territory. When the
female arrives, he will climb onto her back and stay there while
she releases eggs and he releases sperm over the eggs.
The eggs are soft and not surrounded by a shell, so that the
sperm are able to penetrate the eggs easily. The eggs need to
stay in water or a moist environment, otherwise they will dry
out because they do not have a hard, protective shell. Many
eggs are laid in water and are surrounded by a slimy, jelly-like
substance. The jelly protects the developing embryo and allows
for the exchange of gases (such as oxygen) between the embryo
and the surrounding water. Fig. 3.2 A male frog croaking to attract a
female

External fertilisation can be a rather hit-or-miss affair. Many eggs end up not being
fertilised. To compensate for this and to improve the odds of successful fertilisation, vast
numbers of eggs and sperm are produced.
Internal fertilisation
Vertebrates living on land make use of internal fertilisation, in other
words, fertilisation that takes place inside the body of the female. The
swimming sperm cells are provided with a fluid medium, called
semen, in which they can swim towards the egg. The sperm have to
be introduced directly into the female’s body, to escape the drying
effect of the environment. Close physical contact is required between
the male and the female to achieve successful internal fertilisation.
Once again, this will involve some form of courtship behaviour. The
degree of courtship can range from very little, such as sniffing, to
elaborate displays. During copulation, the semen is placed into the
body of the female by an organ called the penis. In Figure 3.3 the
Fig. 3.3 Copulating elephants male elephant is using his penis to transfer semen into the female.
Internal fertilisation is a much more certain method of fertilisation. As a result, there are
far fewer eggs that need to be produced than in external fertilisation.
copulation:
sexual Activity 3.1 Learning task
intercourse or
mating
1. Name one disadvantage of external fertilisation. (1)
ovipary: eggs are 2. Name one advantage and one disadvantage of internal fertilisation. (2)
laid and
offspring hatch
3. Why do terrestrial vertebrates need a penis? (2)
once fully 4. Why do fish have to engage in courtship during external fertilisation? (3)
developed 5. How is the release of gametes coordinated in frogs? (3)
vivipary: giving 6. By what means are eggs laid in water usually protected? (1)
birth to live 7. What is semen, and how does it differ from sperm? (3)
offspring
ovovivipary: eggs
are formed, but
never laid. Ovipary, vivipary and ovovivipary
Instead, they
remain inside Once an egg cell has been successfully fertilised, a zygote is formed. The zygote develops
the female’s into an embryo. In terrestrial vertebrates the embryo needs some form of protection from
body and hatch
there. The the environment during its development, as well as a food source. There are three
young are then possible ways in which the needs of the developing embryo can be met, namely through
produced (born) ovipary, vivipary and ovovivipary.
live
Ovipary
Ovipary comes from the Latin words ovum (egg) and parus (to be born). Ovipary thus
refers to animals that lay eggs. Oviparous animals lay eggs after the ova (egg cells) have
been fertilised inside the female’s body. The embryo develops inside the egg and is
protected from the environment by the egg shell. The shell only forms after fertilisation
has taken place. In birds, the shell is hardened with calcium carbonate. In reptiles, the
shell is leathery. A female turtle lays eggs in a nest she has dug in the sand. The eggs drop
quite a distance into the hole but, because the shells are leathery, they do not break.

The eggs of aquatic animals are fertilised
outside of the females’ body and are usually placenta: a
suspended in and protected by a jelly-like temporary organ
that connects
substance. the developing
foetus to the
The eggs contain nutrient-rich yolks that provide uterine wall to
nourishment for the embryo during its allow nutrient
uptake, waste
development. When fully developed, the young elimination and
animals hatch from the egg. Most fish, gas exchange via
amphibians, reptiles and birds are oviparous. the mother’s
blood supply
Vivipary Fig. 3.4 Female turtle laying eggs

Vivipary comes from the Latin word vivi (to
live). The term viviparous describes animals
whose offspring are born alive once they are fully developed.
In these animals, the young develop inside the mother and are
protected by her body during their development. The mother also
provides nutrition to her unborn young by way of the placenta.
(You will learn more about the role of the placenta in sustaining
unborn young in Topic 4: Human reproduction.)
Vivipary is found almost exclusively in mammals (see Figure 3.5).

However, there are a few other viviparous vertebrates, for
example, scorpions and a species of skink (a smooth-bodied
lizard).
Ovovivipary Fig. 3.5 A wildebeest giving birth to a live

The word ovovivipary is a combination of ova and vivo. calf
Ovovivipary is what could be considered a combination of
ovipary and vivipary. In ovovivipary, eggs are produced and
fertilised, but stay inside the mother’s body. The developing
young get nourishment from the yolk inside the egg. The eggs
hatch inside the mother’s body and the young then emerge live
from the mother’s body (see Figure 3.6). This makes it appear as
if the young are born alive. Some snakes, lizards, sharks and fish
are ovoviviparous.
Ovovivipary enables the female to improve her eggs’ chance of

survival and offers them increased protection, especially against
predation. However, this method of reproduction is much more
taxing on the mother’s body.
Fig. 3.6 A snake ‘giving birth’ to her offspring
Cool fact
In sharks, the young (known as pups) will eat any unfertilised eggs – and even each
other – while still inside the mother. This reduces the number of offspring that
eventually survive.


amniotic egg: an
egg with a 1. Explain the difference between vivipary and ovovivipary. Give a suitable
water-
impermeable
example of each. (6)
amniotic 2. What possible advantage does ovovivipary have over ovipary? (3)
membrane 3. Crocodiles are oviparous. What type of shell do you expect their eggs to
surrounding a have? Give a reason for your answer. (2)
fluid-filled cavity
in which the
4. Vertebrates use one of three different methods of bringing the next generation
embryo into the world. Each of these methods has its advantages and its disadvantages.
develops Name and describe each of the three methods. Write an essay in which you
chalazae: thick, discuss the pros and cons of each method in full. Also give specific examples
twisted strands that illustrate each method. Facts (17)
of protein in the Synthesis (3)
albumin that
anchors the yolk [20]
in the thick egg
white
incubate: to sit
on eggs to keep
Amniotic eggs
them at a Oviparous vertebrates have an amniotic egg. Amniotic eggs contain several membranes
suitable
temperature for that surround the embryo. (The various membranes will be named and discussed in more
development detail below.) The one that encloses the embryo immediately is called the amnion. It
produces a fluid in which the embryo floats while developing. An amniotic egg is
surrounded by a shell to resist drying out. This is a great advantage for
terrestrial animals.
yolk
A newly laid, undeveloped egg contains the parts shown in figures 3.7
chalaza
and 3.8. The egg is protected on the outside by a shell. The shell may be
tough and leathery (e.g. in reptiles), or hard, owing to the presence of
albumen
calcium salts such as calcium carbonate (e.g. in birds). The shell, although
waterproof, is porous to gases such as oxygen and carbon dioxide. One
end of the egg is blunt, with an air space just beneath the shell. This air
Fig. 3.7 An undeveloped amniotic
space assists with the exchange of gases into and from the egg.
egg that has been removed from
its shell
The interior of the egg is filled with albumen, a soft,
runny substance rich in protein, which supplies water to
shell the embryo. Albumen is the white of the egg. In the
thin albumen albumen there is a large yellow yolk that serves as the
chalaza food supply for the developing embryo. The yolk is
thick albumen supported by thickened, twisted strands of albumen
called chalazae (sing.: chalaza). On the surface of the
germinal disc yolk is a small pale spot: the germinal disc. This is
yolk membrane where the embryo will develop. The purpose of the
yolk chalazae is to anchor the yolk in the thick egg white. It
chalaza fastens the egg yolk to the shell membrane and allows
inner shell membrane the yolk to rotate and to keep the germinal disk on the
outer shell membrane
air space top side of the yolk, close to the hen’s body. This is
important in birds’ eggs which are kept warm by the
Fig. 3.8 Diagram showing the structure of an parents. One or other of the parent birds will incubate
undeveloped amniotic egg the eggs. If the eggs get too cold, the embryo will not
survive.

After a period of development, the inside of the
egg looks somewhat different, as shown in embryo
amnion
Figure 3.9.
leathery shell
Membranes in amniotic eggs chorion
Inside the egg are a series of fluid-filled allantois
membranes. Each membrane plays a role in the
yolk sac
successful development of the embryo. The
membranes are:
r the amnion, which surrounds the embryo Fig. 3.9 A reptile egg containing a developing embryo
and is filled with amniotic fluid to cushion
the embryo
r the allantois, which stores excretory products from the embryo. This membrane
develops many blood vessels that enable it to provide transport for gases absorbed
from the air space
r the yolk sac, a fat-rich food source for the embryo
r the chorion, which surrounds all the other membranes.
Study Figure 3.10 and then answer the questions that X Y B

follow. 1
1. Name each of the membranes labelled 1, 2, 3 and 4. (4) 2
2. Which gases are represented by X and Y respectively? (2) 4 A
3. Give the name and letter of the part which is: E
a) rich in fat (2)
b) rich in protein. (2)
4. B is an embryo. Name the ways in which the egg
protects it. (7) 3
5. From which part of the yolk does the embryo develop? (1)
6. Describe the texture of the part labelled C, assuming C D
this is a bird’s egg. (2)
7. What would you expect to find in the region labelled E? (1) Fig.3.10 An amniotic
egg
Investigate an egg
Break open a raw egg and place it in a glass dish. Identify the various
structures. Make a simple labelled diagram to show what you think a
longitudinal section through the egg would look like. (10)

altricial: Precocial and altricial development

incapable of
moving around Once the next generation (offspring) of a species has survived the developmental stage
on its own after
and been either born or hatched, it faces the challenge of surviving to adulthood. The
birth or hatching
immediate concern is surviving when newly
precocial:
capable of
hatched or born. This is a time when organisms
moving and has are particularly vulnerable to predation. This
a degree of challenge can be met in different ways. There are
independence two types of development, namely altricial
straight after
being born or
development and precocial development, that
hatched influence the chances of survival of newly born
or hatched animals.
Altricial development
The word altricial means ‘needing nourishment’.
In animals that have altricial development, the Fig. 3.11 Newly hatched chicks
young are born helpless. They may lack hair or
feathers and are often born with their eyes still closed. Figure 3.11 shows a pair of newly
hatched altricial chicks with no feathers and poorly developed legs and beaks. They
require considerable parental care, including warmth, food and protection. The parents
are also responsible for moving the young when necessary. A period of development is
required before they can begin to move by themselves or feed themselves. All this makes
them incapable of surviving without parental care. Many birds and mammals are altricial.
Some animals are more altricial than others. Extreme examples are the Giant Panda
(Figure 3.12) and the kangaroo (Figure 3.13). Both these animals give birth to what can
only be described as little more than an embryo, which develops completely outside the
mother’s body. In the kangaroo, the ‘newborn’ (called a joey) lives in a pouch on its
mother’s abdomen for months.
Fig. 3.12 A giant panda with her newborn cub Fig. 3.13 A two-week-old kangaroo joey

Precocial development
In animals that show precocial
development, the young are born
with a high degree of
independence. They are able to
walk, run or swim shortly after
being born or hatching. This is
particularly important for animals
that need to avoid predators. Most
African antelopes are precocial
(Figure 3.14). Precocial
development is common among
prey species, as their survival
depends on it.
Fig. 3.14 A newborn impala calf already on its feet
Most birds produce altricial young,
especially birds of prey (Figure 3.15). However, a number of bird species, particularly
ducks, geese and game birds like guinea fowl, which spend most of the time on the
ground, have precocial young. The chicks of precocial birds have a good covering of
down when they hatch and can walk, swim and find food for themselves. Figure 3.16
shows that a newly hatched duckling with a good covering of down, is capable of
swimming on its own.
Fig. 3.15 Altricial chicks waiting for food Fig. 3.16 A precocial duckling capable of
from their parents swimming on its own
Both altricial and precocial development have certain advantages when it comes to the
survival of offspring.
Precocial offspring spend more time developing before birth and so are more alert and
physically further developed at birth. Altricial young spend less time developing before
being born, but tend to grow faster and develop further after birth. Altricial young tend
to be small bodied and have shorter life cycles. Precocial young, on the other hand, are
more likely to be large-bodied and breed less often. One notable exception is humans: we
are large bodied and slow breeding, but produce altricial young.

1. Draw a table in which you compare three characteristics of altricial and

precocial offspring. (7)
2. Why is it important for young antelope to be precocial? (3)
3. Group the following animals, depending on whether they are precocial or
altricial:
gorilla, buffalo, rat, giraffe, lion, Egyptian goose, elephant, ostrich, dog,
owl. (10)
Parental care
Parental care involves providing a nurturing and protected environment in which the
altruism: young can grow and develop. Because of the helplessness of their young, this behaviour is
behaviour by an better developed in altricial species. Parental care is considered to be a form of altruism.
organism that
may be harmful
to itself but Birds and mammals show a greater degree of parental care than other vertebrates. In fish,
favours the amphibians and reptiles, there is hardly any parental care. In fact, parental care among
survival of its these groups is the exception rather than the norm.
offspring that
carries its genes
Birds, whether they are altricial or precocial, show a high degree of parental care for their
young. One or both of the parents feed the chicks (Figure 3.17) and protect them from
danger as best they can. Feeding chicks takes a lot of time and energy, so birds that
produce altricial chicks tend to lay fewer eggs so that they can cope with caring for their
offspring. Parent birds will also protect chicks from the weather and keep them warm.
This is particularly important in species that breed in very cold environments like the
Antarctic. One such bird is the Emperor Penguin shown in Figure 3.18. The egg and later,
the newly hatched chick, of the Emperor Penguin must stay on the feet of the parent at all
times. If it does not, the egg may fail to develop because of coming into contact with the
ice. Without a high degree of parental care the chick would never survive. Each pair of
Emperor Penguins produce only one egg per season because so much parental care is
involved in looking after the egg and the chick.
Fig. 3.17 A cattle egret Fig. 3.18 An Emperor

feeds her young Penguin keeping a newly
hatched chick warm

Reproduction is a biologically very expensive, but necessary process. Parental care has
developed as a way to minimise the energy spent on reproduction. Without parental care, continuum: a
animals must produce thousands, if not millions of eggs to ensure that at least some will continuous series
of things or
survive through to adulthood. While parental care does not guarantee the survival of the events that
young, it greatly increases the chances of successful reproduction. This increased blend seamlessly
likelihood of success has allowed animals with parental care to reduce the number of into each other
offspring they produce. so that it is
impossible to tell
where one ends
A characteristic of female mammals is that they produce milk from their mammary and the next
glands and use this milk to feed (suckle) their young. Parental care is therefore a must begins
amongst mammals. This nurturing behaviour means
that mammals form a close bond with their young and
are very protective of them. Normally calm, easy-going
animals can become fiercely protective and aggressive
towards others when they have young to look after.
As with altricial and precocial development, parental

care is a continuum. This means that there are varying
degrees of parental care, ranging from some parental
care to extreme parental care. A crocodile, for example,
lays its eggs, guards the nest and assists the newly
hatched crocodiles into the water. After that, they have
to fend for themselves. Some fish stay with their young
once they have hatched and take them into the safety of
their mouths when danger threatens. This only lasts
while they are relatively young. At the other end of the
continuum are animals that stay with their young Fig. 3.19 A lioness cares for her cub by carrying it to
continually. Lions (Figure 3.19) are very social animals. safety.
The whole pride helps to look after the cubs, and the
female cubs even stay with the pride once they are
mature.
Elephants (Figure 3.20) are another good example of

extreme parental care. The herd is run by females. For
years, the young are protected by all the females in the
herd. The animal with the most extended period of
parental care is the human.
1. What is the relationship between parental

care and number of offspring? (2)
2. What is the relationship between parental
care and survival of offspring? (2) Fig. 3.20 A baby elephant suckles on its mother
3. Why do the parents of altricial young
show more parental care? (2)
4. Explain why parental care is considered
to be a form of altruism. (6)

More questions on reproduction of vertebrates

a) 1. Explain why external fertilisation is not possible for terrestrial animals. (2)
2. Why do animals that use external fertilisation still need to attract a mate? (2)
3. Figure 3.21 shows two chicks from different species. One is altricial and
the other is precocial. In table form, compare the visible features of the two
chicks. Say which a) or b) is altricial and which is precocial. (9)
4. Why is parental care so well developed in mammals? (2)
5. What is the first cell of a new generation called and how is it formed? (2)
6. What is the advantage of sexual reproduction over asexual reproduction? (1)
7. What is the function of the penis in internal fertilisation? (2)
b) 8. Birds incubate their eggs by sitting on them to keep them warm. They
occasionally turn the eggs so that the growing embryos do not stick to the
shells. What is the role of chalazae in birds’ eggs? (3)
9. Female lion cubs will stay with their pride when they mature sexually, but
male cubs are driven out. Say why you think this is good practice in terms
of the stability of the pride. (2)
10. How does altruism benefit a species? (1)
11. Eagles are altricial and produce only two or three eggs. Guinea fowl
Fig. 3.21
are precocial and produce considerably more eggs. Explain the survival
value of each of these methods as for these two types of bird. (4)
Summary
lay amniotic eggs

lay eggs with shells * reptiles – oviparous or
without shells ovoviviparous
* birds – oviparous
oviparous or mammals – viviparous
ovoviviparous
Reproductive
external fertilisation internal fertilisation
strategies in
vertebrates
aquatic medium
terrestrial animals
mostly fish & amphibians
if young are precocial:

* large number of offspring
* parental care uncommon
generally precocial: if young are altricial:

* produce large numbers of offspring * reduced number of offspring
* parental care absent or unusual * parental care fair to excellent

Topic
4 Human reproduction
r the structure of the male and female reproductive systems

r the changes that occur during puberty
r gametogenesis in the testes and ovaries
r hormonal control of the menstrual cycle
r fertilisation and development from zygote to blastocyst to
embryo to foetus during gestation
r the role of the placenta during gestation
r different contraceptive methods and devices.
The photograph shows a human foetus developing in its mother’s uterus. This
foetus developed from a single cell called a zygote. How is a zygote formed? Where
does a zygote develop into a foetus? How is the life of the foetus sustained in the
mother’s womb? In this topic, you will learn about human reproduction, fertilisation
and the development of the foetus.
62 t Topic 4: Human reproduction

In previous grades, you learnt about sexual reproduction in humans. Males and females
have specialised organs to ensure that reproduction can occur. Testes produce male
gametes called sperm and ovaries produce female gametes called ova. When males and
females go through puberty they become sexually mature. Males start to produce sperm
at puberty and females produce and release ova during the monthly menstrual cycle. A
female menstruates during her menstrual cycle. During sexual intercourse, sperm is
delivered to the female’s vagina. A sperm may join with an ovum to produce a zygote
during the process of fertilisation. The zygote develops into an embryo and then a foetus
inside the mother’s uterus (womb). Pregnancy in humans usually lasts 40 weeks.
Contraception is a way of preventing a pregnancy. There are many different contraceptive
methods and devices available for men and women.
k
Chec The diagrams in Figure 4.1 show the reproductive systems in humans.
lf
myse
System 1 System 2
Fig. 4.1 Reproductive systems in humans
1. Which is the female reproductive system?

2. Use the information in the diagrams to provide the letter that indicates
each of the following:
a) the place where female gametes are formed
b) the place where the foetus develops
c) the place where male gametes are formed
d) the structure that delivers semen to the female
e) the part that receives the penis during sexual intercourse.
3. Give the name of the:
a) female gamete
b) male gamete
c) process during which the male and female gametes fuse.
Topic 4: Human reproduction t 63

Unit 1 The male and female reproductive systems
Structure of the male reproductive system

For reproduction to occur, a sperm has to reach the ovum in the female. The male
reproductive system is specialised to produce sperm and deliver them to the female.
Figure 4.2 shows the structure of the male reproductive system.
Seminal vesicle: A pair of glands that secrete a Prostate gland: A gland that secretes an
thick sugary fluid containing fructose, which alkaline fluid which will neutralise any acidic
the sperm uses as a food source. urine or vaginal secretion during sexual
intercourse. It also helps sperm to move faster.
Urethra: A duct leading from the bladder

Cowper’s gland: A pair of glands that secrete
through the penis and opens to the outside at
mucus to lubricate the opening at the tip of the
its tip. This opening is called the urogenital
penis during ejaculation.
opening. The urethra transports urine and
semen out of the body at different times.
Vas deferens or sperm duct: A duct that carries
sperm from the epididymis to the penis.
Erectile tissue: Tissue with spaces that become
filled with blood during an erection.
Testis (pl.: testes): There are two oval-shaped

Scrotum: A double-layered pouch of skin testes, which hang outside the body in the
which covers and protects the testes. The scrotum. Each testis contains seminiferous
temperature in the scrotum is lower than tubules that produce the sperm. These tubules
in the body, which is necessary for open into a larger coiled tube, the epididymis,
producing sperm. lying outside at the back of each testis. As
sperm are produced they move from the testis
Penis: The penis consists of erectile tissue that to the epididymis to be stored. Between the
fills with blood to make the penis hard. The seminiferous tubules are masses of interstitial
tip of the penis is slightly enlarged and is Epididymis: This is a coiled cells that produce the hormone testosterone.
called the glans penis. The glans is covered by tube that lies at the back of Testosterone stimulates the production of
a loose skin called the foreskin. Sometimes it is the testis, where sperm are sperm, maintains the reproductive organs and
surgically removed in an operation called a temporarily stored until they causes the secondary sexual characteristics of
circumcision. are mature. men.
Fig. 4.2 Front view of the male reproductive system Physiology of erection
Cross-section of the penis in flaccid state testes: male sex
Sperm is produced in the testes and carried via the organs that
vas deferens to the penis. When the penis fills with produce male
blood, it becomes hard and erect (see Figure 4.3). gametes (sperm)
erectile
This is called an erection. An erect penis is tissue semen: thick,
essential to transfer semen into the female’s whitish liquid
urethra that contains
vagina. During ejaculation, sperm and secretions sperm and
from the seminal vesicles, Cowper’s gland and the spurts from the
prostate gland form a sticky fluid called semen. Cross-section of the penis in erect state penis during
ejaculation
ejaculation: the
process that
erectile
tissue
occurs in a male
mammal when
semen spurts
Fig. 4.3 Cross-section of a penis in a urethra from his penis
flaccid and an erect state

1. Give the function(s) of each of the following: testes, vas deferens,

epididymis. (3)
2. Draw a flow diagram to show the path of a sperm cell from the moment
that it is produced to the moment that it passes out of a man’s body. (4)
3. Semen is made up of secretions and sperm. Identify the glands that
produce the secretions. What is the function of the secretions? (6)
4. a) What is the advantage in having the testes held outside the body in
the scrotum? (2)
b) Explain how the temperature of the testes is maintained on a very
hot and very cold day. (2)
5. Name the organ that produces testosterone. Give two functions of
testosterone. (3)
Observing a microscope slide of a cross-section of a penis

You will need:
r microscope
r prepared microscope slide of a cross-section of a penis
Method:
1. Place the microscope slide on the stage of the microscope.
2. Compare what you see with the micrograph in Figure 4.4.
3. Make a labelled biological drawing of what you see in the microscope slide
or in the micrograph. Identify the urethra and the erectile tissue.
(10)
Fig. 4.4 Cross-section of a penis

Questions:
1. During an erection, what fills the erectile tissue? (1)
2. Describe how these blood spaces help in the process of intercourse. (3)
3. The glans is covered by loose skin called the foreskin. Sometimes the
foreskin is surgically removed. What is this procedure called? (1)

Structure of the female reproductive system
The female reproductive system is designed to produce female gametes and to house and embryo: an
organism in the
protect the growing embryo during pregnancy. early stages of its
Figure 4.5 shows the structure of the female reproductive system. Read each label and development
description to learn about the structure and function of each part.
Fallopian tube or oviduct: This is a narrow tube with

muscular walls that are lined with hair-like structures called Ovary: There are two ovaries
cilia. It is about 10 cm long. The ova from the ovaries are that lie in the abdominal cavity
moved along the Fallopian tube by the cilia and by of a female. Each ovary is made
contraction of the muscular walls. of connective tissue, blood
vessels and female germ cells.
Ovaries produce ova. The
hormone oestrogen is secreted
by the ovaries. Oestrogen
regulates the menstrual cycle,
Endometrium: The layer of tissue maintains a pregnancy and
that lines the inner wall of the uterus. causes the secondary sexual
characteristics of women.
Cervix: The lower part of the uterus

that connects the uterus with the
vagina. It contains glands that secrete
Uterus: Also known as the womb, is a
mucus into the vagina.
thick-walled muscular organ.
Vagina: The vagina is a muscular canal that runs from the cervix and opens to
the outside of the body. At the opening of the vagina are folds of skin called
the labia. Between the labia is a small, roundish structure called the clitoris.
Fig. 4.5 Front view of the female reproductive system

A
B
Study the diagram of the female reproductive system in Figure 4.6
C
and answer the questions that follow.
D
1. Identify the letter and name the place where:
a) the foetus develops (2)
b) the sperm is placed by the penis (2)
c) urine is passed. (2) Fig. 4.6 Side view of the female
2. Give the function(s) of: reproductive system
a) C
b) D. (2)
3. a) Name the structures where female gametes
are formed. (1)
b) Give one other function of these structures. (2)
4. Figure 4.7 shows the movement of the ovum though the
Fallopian tube.
a) Explain how an ovum is transported from the ovary
to the uterus. (2)
b) Give one structural adaptation of the Fallopian tubes
that enable them to transport the ovum to the uterus. (2) Fig. 4.7 Ovum moving along the
Fallopian tube

Unit 2 Puberty
Hormones that control puberty

Puberty is the period during which the body develops and becomes sexually mature. In
males, puberty usually starts between the ages of nine and 14; in females, it usually starts
between the ages of eight and 13 years. Girls usually start puberty at an earlier age than
boys and complete their sexual development sooner. This is why girls are often taller than
boys during puberty.
Hypothalamus
GnRH Pituitary gland
LH and FSH
Feedback hormones Feedback hormones
or
testes ovaries
sperm cells egg cell
testosterone oestrogen
voice deepens broadening of hips

growth of muscle tissue menstruation begins
enlargement of genitalia development of breasts
facial, pubic and axillary hair pubic and axillary hair
Fig. 4.8 Hormones and their functions during puberty
Figure 4.8 shows the different hormones that are responsible for the physical and
emotional changes experienced during puberty. Gonadotropin-releasing hormone (GnRH)
is secreted by a part of the brain called the hypothalamus. This hormone stimulates the
pituitary gland to secrete follicle-stimulating hormone (FSH) and luteinising hormone
(LH) into the blood, which carries the hormones to the reproductive organs.

FSH and LH stimulate the sex organs to produce oestrogen and testosterone. In girls, the oestrogen: the
ovaries start secreting oestrogen, which then causes puberty to start. In boys testosterone female sex
is secreted by the testes to start puberty. Oestrogen and testosterone are also known as the hormone that is
secreted by the
sex hormones. ovaries
testosterone: the
Changes in the body during puberty male sex
hormone that is
secreted by the
Oestrogen and testosterone bring about the development of secondary sexual testes
characteristics. As their levels increase during puberty, many such changes take place.
ovaries: female
Study Figure 4.9 and read each label to identify the changes that occur in males and sex organs that
females during puberty. produce female
gametes (eggs
or ova)
Hair starts to grow on
the face secondary sexual
characteristics:
Pimples develop physical and
The voice becomes behavioural
Pimples develop features that
deeper as the size of
the larynx (voice box) distinguish males
increases. from females.
Breasts start to develop These
Hair grows in the
armpits and body Hair grows in the armpits characteristics
odour becomes and body odour becomes start appearing
stronger stronger at puberty
Muscles develop Hips get wider
Pubic hair grows and the

Pubic hair grows. The
ovaries start to produce
penis and testes get
eggs. The monthly
larger. The testes start
menstrual cycle starts,
to produce sperm
which means that
pregnancy can occur if
you have sex.
Fig. 4.9 Puberty in males and females
1. During puberty, males and females develop secondary sexual characteristics.

Identify the characteristics that are similar in males and females, as well
as those that occur only in males or only in females. (6)
2. Study Table 4.1 and then answer the questions that follow.
a) Draw a line graph of the data in the table. Plot two lines on your graph,
one showing average height gain per year for girls and one showing
average height gain per year for boys. (14)
b) At what age do boys and girls respectively show the greatest height
increase? (2)
c) Girls start puberty before boys. Evaluate this statement and explain your
reasons using the graphs you drew in Question 2. a). (2)

Table 4.1 Growth patterns in boys and girls from eight to eighteen years old
Age Average height gain per year (cm)

(years) Boys Girls
8 5,1 5,5
9 5,0 5,0
10 4,8 5,5
11 5,0 6,0
12 5,0 8,0
13 5,0 7,0
14 10,0 3,5
15 8,5 1,0
16 3,5 0,5
17 1,5 0,0
18 0,0 0,0

Unit 3 Gametogenesis
Spermatogenesis spermatogenesis:
the production
Gametogenesis is the process during which the sex organs produce gametes. In males, the
of sperm in the
testes produce male gametes or sperm and the specific process is called spermatogenesis. testes by meiotic
Figure 4.10 a) shows a longitudinal section of a testis. Notice how the testis is divided into (reduction)
many compartments. Each compartment contains tiny curled tubes, called seminiferous division
tubules, in which the sperm are produced.
a) b)
sperm duct seminiferous tubule
germinal
epithelium
epididymis
testis sperm
seminiferous testosterone
tubules secreting
cells
(Leydig cells)
Sertoli cell lumen
Fig. 4.10 a) Structure of a testis

b) Cross section of a seminiferous tubule c)
germinal 2n
c) Different stages of spermatogenesis epithelial cell
Figure 4.10 b) shows a cross-section of a spermatogonia 2n 2n

seminiferous tubule. The wall of each tubule is
lined with diploid (2n) germinal epithelium or germ
cells. These germ cells divide constantly by mitosis
primary spermatocyte 2n
to produce many diploid (2n) sperm mother cells or
spermatogonia (sing.: spermatogonium).
Meiosis I
Figure 4.10 c) shows the different stages of secondary
spermatogenesis. Follow the stages to learn exactly spermatocytes n n
how a sperm cell is formed. Each spermatogonium
divides by mitosis to form a diploid (2n) primary Meiosis II
spermatocyte. The primary spermatocyte divides by
meiosis I to form haploid (n) secondary
spermatocytes. These then divide by meiosis II to spermatids n n n n
form haploid (n) spermatids. Each spermatid
matures and develops into haploid sperm cells (n).
sperm n n n n

The cells of Sertoli in the seminiferous tubules provide the developing sperm with
nutrients. When the sperm are mature, they move into the epididymis where they are
stored. Sperm production requires a temperature that is lower than normal body
temperature. To ensure that this lower temperature is maintained in the testes, the
scrotum hangs outside the body. The temperature in the scrotal sacs is at least 2 °C lower
than normal body temperature (37 °C). Men whose testes have not descended into the
scrotal sacs are infertile because sperm do not develop properly at normal body
temperature.
acrosome Structure of a sperm cell

cytoplasm
nucleus The function of a sperm is to move as fast as it can towards an egg and
mitochondria
fertilise it. The sperm’s structure is adapted for this function. Each
sperm cell has a head, neck, midpiece and tail. The head has a nucleus
head containing the father’s genetic material. At the tip of the head is the
neck mid- acrosome, which contains enzymes used to break down the ovum’s
piece
membrane. The midpiece contains many mitochondria that provide
energy for the tail to move.
tail
Diameter of head = 5 μm Because many sperm cells do not survive the journey from the vagina
to the egg, millions of sperm cells are produced in order to increase
Fig. 4.11 Structure of a sperm cell the chances that one will reach the egg.
1. Which organs produce sperm? (1)
{
2. Name two ways in which a
Connective tissue sperm’s structure is related
between adjacent Leydig cells to its function. (4)
seminiferous 3. The diagram in Figure 4.12
{
tubules spermatogonium represents a cross-sectional view
of a human seminiferous tubule
in which spermatogenesis is
taking place. Study the diagram
Part of and then answer the questions
seminiferous
tubule spermatids that follow:
a) Name the hormone
sperm produced by the cells
of Leydig. (1)
b) Name one function of the
Fig. 4.12 Cross- hormone named in
section of a question 3a). (1)
human seminiferous 4. How many chromosomes are in a:
tubule during a) spermatogonium? (1)
spermatogenesis b) spermatid? (1)
5. What kind of cell division occurs in the spermatogonium? (1)

Observing a microscope slide of a cross-section of a testis

You will need:
r microscope
r prepared microscope slide of a cross-section of a testis,
showing seminiferous tubules
Method:
1. Place the microscope slide on the stage of the microscope. Fig. 4.13
2. Compare what you see with the micrograph in Figure 4.13. Photomicrograph of
3. Make a labelled biological drawing of what you see seminiferous tubules in
in the microscope slide or in the micrograph. Label cross-section
the seminiferous tubules, germinal epithelium,
position of Leydig cells, and lumen. (10) a) primary follicle secondary follicle
Questions: follicle cells
1. What is the function of the Leydig cells? (1) fluid
2. What is the process of producing sperm called? (1)
secondary
oocyte
Oogenesis Graafian
follicle
Female gametes or ova are produced in the ovaries. The
process during which ova are produced, is called oogenesis.
corpus luteum
The ovaries lie in the abdominal cavity of a female. The
secondary oocyte (ovulation)
ovaries secrete the hormones oestrogen and progesterone,
which regulate the menstrual cycle and maintain a
pregnancy. You will learn more about these hormones in b) germinal
2n epithelial cell
Unit 4.
Oogenesis starts while a female foetus is developing in her

2n 2n oogonia
mother’s uterus. Figure 4.1 b) shows the process of
oogenesis. The diploid (2n) germinal epithelial cells in the
ovary divide by mitosis to produce diploid (2n) oogonia.
Oogonia grow into diploid (2n) primary oocytes. Each 2n primary oocyte
primary oocyte divides by Meiosis I and is then
surrounded by a layer of cells to form a diploid (2n) Meiosis I
secondary
primary follicle. When a baby girl is born, each of her n
oocyte
first
ovaries contains several hundred thousand primary polar body
follicles. Each primary follicle is capable of producing a
single ovum. Meiosis
II
n ootid
When a female reaches puberty, the pituitary gland secretes second
follicle, stimulating hormone (FSH) and luteinising hormone polar body
(LH). FSH stimulates the development of a primary follicle
in one ovary during the menstrual cycle. In the primary n ovum
follicle each diploid (2n) primary oocyte completes Meiosis I
to form a haploid (n) secondary oocyte and a polar body. The
polar body disintegrates. The follicle containing the Fig. 4.14 a) Structure of an ovary b) Oogenesis
secondary oocyte becomes a secondary follicle.

PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

PDF

Uploaded by

Copyright:

Available Formats

Solutions for all

J de Fontaine J Dugard R Freedman L Marchant

All rights reserved. No part of this publication may be reproduced,

First published 2013

ISBN: 978-1-4310-1-4385 e-ISBN: 9781431024322

It is illegal to photocopy any page of this book

The three specific aims in Life Sciences are:

Other features to look out for are:

What you will learn about in this topic

r the location of DNA in the cell

Let’s talk about this topic

2 t Topic 1: DNA: The code of life

What you know already

lysosome nucleolus nucleoplasm

mitochondrion Golgi apparatus

Fig. 1.1 Diagram of an animal cell

Study Figure 1.1 and answer all the questions below:

Topic 1: DNA: The code of life t 3

Location of DNA in the cell chromosome: a

4 t Topic 1: DNA: The code of life

4. Let the mixture stand for two minutes.

The structure of DNA

DNA is a double-stranded polynucleotide. A polynucleotide chain is a very long

Topic 1: DNA: The code of life t 5

distinguish it from the other bases. a phosphate

thymine adenine phosphate

Fig. 1.5 Structure of DNA

6 t Topic 1: DNA: The code of life

Genes and non-coding DNA

Activity 1.2 Learning task

1. Draw a diagram of a segment of DNA with this sequence of bases: GGCTAAC.

Activity 1.3 Practical task (enrichment)

Build a model of a DNA molecule

Topic 1: DNA: The code of life t 7

Rosalind Franklin was working on

In 1953, James Watson, a

DNA profiling produces a pattern of dark bands that is unique to

8 t Topic 1: DNA: The code of life

Figure 1.9 shows a DNA profile for 12 DNA samples.

For some time now, DNA profiling has been used as

Activity 1.4 Practical task

Topic 1: DNA: The code of life t 9

10 t Topic 1: DNA: The code of life

Topic 1: DNA: The code of life t 11

1. DNA molecule unwinds

Two identical DNA molecules

Fig. 1.12 DNA replication

Activity 1.5 Learning task

Answer the following questions:

1. Where does DNA replication occur in eukaryotic cells? (1)

12 t Topic 1: DNA: The code of life

Unit 2 Ribonucleic acid

The nucleotides of RNA differ slightly from those of DNA. An RNA

Uracil and cytosine are pyrimidine bases (single-ringed molecules).

Location of RNA in the cell

Fig. 1.14 The three types of RNA

Topic 1: DNA: The code of life t 13

14 t Topic 1: DNA: The code of life

3. The coding strand of the DNA acts as a free RNA nucleotide

4. Free RNA nucleotides in the nucleus pair

5. The two polynucleotide chains of the DNA

Fig. 1.15 Transcription from DNA

Translation of mRNA to form proteins

_____ _ _ _ _____

_____ _ _ _ _ _ _____

_____ _ _ _ _ _____

_____ _ _ _ _ _____