RESEARCH ARTICLE

Distribution of b-glucosidase and b-glucuronidase activity and of

b-glucuronidase gene gus in human colonic bacteria
Marta Dabek, Sheila I. McCrae, Valerie J. Stevens, Sylvia H. Duncan & Petra Louis
Microbial Ecology Group, Gut Health Division, Rowett Research Institute, Bucksburn, Aberdeen, UK

Correspondence: Petra Louis, Microbial Abstract

Ecology Group, Gut Health Division, Rowett
Research Institute, Greenburn Road,
Bucksburn, Aberdeen AB21 9SB, UK. Tel.:
144 1224 712 751; fax: 144 1224 716 687;
e-mail: p.louis@rowett.ac.uk
Present address: Marta Dabek, INRA,
Neuro-Gastroenterology and Nutrition Unit,
31931 Toulouse, France.
Received 17 December 2007; revised 10 April
2008; accepted 15 April 2008.
First published online 5 June 2008.
DOI:10.1111/j.1574-6941.2008.00520.x
Editor: Julian Marchesi
Keywords
microbiota; colon; b-glucosidase;
b-glucuronidase; enzyme activity;
degenerate PCR.
b-Glycosidase activities present in the human colonic microbiota act on glycosidic
plant secondary compounds and xenobiotics entering the colon, with potential
health implications for the human host. Information on b-glycosidases is currently
limited to relatively few species of bacteria from the human colonic ecosystem. We
therefore screened 40 different bacterial strains that are representative of dominant
bacterial groups from human faeces for b-glucosidase and b-glucuronidase
activity. More than half of the low G1C% Gram-positive firmicutes harboured
b-glucosidase activity, while b-glucuronidase activity was only found in some
firmicutes within clostridial clusters XIVa and IV. Most of the Bifidobacterium spp.
and Bacteroides thetaiotaomicron carried b-glucosidase activity. A b-glucuronidase
gene belonging to family 2 glycosyl hydrolases was detected in 10 of the 40 isolates
based on degenerate PCR. These included all nine isolates that gave positive assays
for b-glucuronidase activity, suggesting that the degenerate PCR could provide a
useful assay for the capacity to produce b-glucuronidase in the gut community.
b-Glucuronidase activity was induced by growth on D-glucuronic acid, or by
addition of 4-nitrophenol-glucuronide, in Roseburia hominis A2-183, while
b-glucosidase activity was induced by 4-nitrophenol-glucopyranoside. Inducibility
varied between strains.

2004). Some plant glucosides are also subject to deconjuga-

Introduction
Members of the gut microbiota in the human large intestine
exhibit a variety of enzymatic activities with potential
impact on human health through biotransformation of
secondary plant products and xenobiotic compounds
(McBain & Macfarlane, 1998; Heavey & Rowland, 2004;
Blaut & Clavel, 2007). b-Glucuronidases liberate toxins and
mutagens that have been glucuronated in the liver and
excreted into the gut with the bile. This can lead to high
local concentrations of carcinogenic compounds within the
gut, thus increasing the risk of carcinogenesis (Gill &
Rowland, 2002). Furthermore, reuptake of the deconjugated
compound from the gut and reglucuronidation in the
liver leads to an enterohepatic circulation of xenobiotic
compounds, which increases their retention time in the
body. b-Glucosidases can exert either beneficial or harmful
effects, as they form aglycones from a range of different
plant glucosides, which might exhibit either toxic/muta-
genic or health-promoting effects (Hill, 1995; Manach et al.,
tion by host b-glucosidases in the upper gut and may
subsequently be glucuronated by the host, making them a
substrate for bacterial b-glucuronidases when they reach the
colon with the bile (Manach et al., 2004). The resulting
aglycones of plant polyphenols may be subject to further
degradation and biotransformation by the gut microbiota
(Blaut et al., 2003; Atkinson et al., 2005).
Several studies have investigated bulk enzyme activities in
faecal samples. A high interindividual variation in enzyme
activities has been demonstrated in human faeces (McBain
& Macfarlane, 1998), which might be due to differences in
the composition of the gut microbiota or other influencing
factors, such as diet. Increased b-glucosidase activity upon
soy consumption has been shown in human volunteers
(Wiseman et al., 2004). Faecal b-glucuronidase activity
increased in rodents after consumption of a high-protein/
high-fat diet (Eriyamremu et al., 1995) and decreased after
consumption of diets high in carbohydrates (Shiau &
Chang, 1983; Gestel et al., 1994). It has also been reported

FEMS Microbiol Ecol 66 (2008) 487–495

c2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
488
that cancer patients exhibit higher b-glucuronidase activities
than healthy controls (Kim & Jin, 2001).
Relatively little information is available on the distribu-
tion of these enzyme activities between different gut bacter-
ia, especially with regard to the low G1C% Gram-positive
firmicutes, which are a dominant bacterial group within the
human large intestine (Flint et al., 2007). Two groups in
particular, bacteria related to Roseburia spp. and Eubacter-
ium rectale within clostridial cluster XIVa (Collins et al.,
1994) and Faecalibacterium prausnitzii within clostridial
cluster IV, have been estimated by FISH to comprise c. 7%
and 10% of the total microbiota in healthy human adults
(Aminov et al., 2006; Mueller et al., 2006). Bacterial
b-glucosidases seem to be more widespread among the
colonic microbiota than b-glucuronidases (McBain & Mac-
farlane, 1998). Nakamura et al. (2002) examined various
enzyme activities in fresh human faecal isolates and refer-
ence strains and found the highest b-glucuronidase and
b-glucosidase activities in some of the isolates related to
Clostridium spp. Most of the Bacteroides spp. examined also
carried high b-glucosidase activity. McBain & Macfarlane
(1998) examined 20 strains from various genera and detected
b-glucosidase activity in most of the strains tested, with
particularly high activity in Bacteroides ovatus. b-Glucuroni-
dase activity was low or absent in Clostridium spp., but
generally present in Bacteroides spp. and most Bifidobacterium
spp. Some studies have compared enzyme activities in in vitro
culture with faecal activities in gnotobiotic animals and found
that activities tended to be higher in vivo (Cole et al., 1985;
Gadelle et al., 1985), showing that environmental conditions
are important in determining those activities.
The aim of this study was to examine a range of human
gut bacteria for the presence of b-glucuronidase and b-
glucosidase activities, with an emphasis on the understudied
but predominant bacterial group of low G1C% Gram-
positive bacteria. A selection of bacterial strains was exam-
ined in more detail to gain an insight into whether growth
conditions affect these enzyme activities.
Materials and methods
Bacterial strains and culture conditions
All bacterial strains used in the current study except
Clostridum clostridioforme JCM 1291 were isolated from
human faeces. Strains A-, L- and T-, originated from a study
with two adult volunteers and a baby (Barcenilla, 1999;
Barcenilla et al., 2000), and other strains from several adult
volunteers (except for Eubacterium siraeum 70/3 and Rumi-
nococcus sp. 80/3) were described by Louis et al. (2004).
Clostridial cluster IV strains E. siraeum 70/3 and Rumino-
coccus sp. 80/3 were isolated from a faecal sample from an
adult female consuming a western diet. The volunteer had


c 2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
M. Dabek et al.
not received antibiotics or any other product likely to
influence the composition of the faecal microbiota in the
previous 6 months. A faecal slurry (10%) was prepared in
anaerobic phosphate buffer (pH 6.8). One aliquot of the
slurry was heated to 70 1C and one to 80 1C in water baths
for 10 min, and then quickly cooled to room temperature.
Following preparation of 10-fold serial dilutions in M2
medium under anaerobic conditions, these dilutions were
used to inoculate M2GSC roll tubes (Miyazaki et al., 1997)
and incubated at 37 1C for 48 h. Single colony isolates were
grown in M2GSC medium and repurified following a
second passage through roll tubes as described. Strains 70/3
and 80/3 were isolated from the samples heated at 70 and
80 1C, respectively. The 16S rRNA gene of both strains was
cloned and sequenced as described previously (Louis et al.,
2004). The GenBank accession numbers are EU266550 and
EU266551, respectively.
Bifidobacterium spp. and Bacteroides spp. were obtained
from the German Collection of Microorganisms and Cell
Cultures (DSMZ), except for Bifidobacterium adolescentis
L2-32, which was isolated at the Rowett Research Institute
(Barcenilla, 1999), and B. ovatus V975, which was obtained
from Terry Whitehead at the US Department of Agriculture,
Illinois, USA. Clostridum clostridioforme JCM 1291 was
obtained from the National Collections of Industrial and
Marine Bacteria (NCIMB).
For the initial screening of b-glucosidase and b-glucur-
onidase activity, all bacteria were grown on M2GSC medium
for 24 h. All further experiments were performed in YCFA
(yeast extract, casitone, fatty acid) medium (Duncan et al.,
2002) containing 0.1% casitone and 0.2% glucose, or other
carbohydrates and supplements as indicated in the results,
except for strains F. prausnitzii L2-6 and M21/2, which were
grown in M2GSC, as they exhibited poor growth in YCFA
medium. 4-Nitrophenyl-b-D-glucopyranoside or 4-nitro-
phenyl-b-D-glucuronide were added to cultures from
10-fold concentrated stocks in 100 mM sodium phosphate
buffer (pH 6.5) to achieve the final concentrations as
indicated in the results.
To investigate whether glycosides might lead to induction,
the 4-nitrophenyl-substrates utilized for the enzyme assays
were added to cultures of Roseburia hominis A2-183 in the
presence of glucose, and enzyme activities were determined in
the stationary phase. Substrates were added at 0.2 and 1 mM
and the enzymatic product 4-nitrophenol was included to the
control for any effects it might elicit from the cells.
Preparation of bacterial cell extracts
Bacterial culture (7.5 mL) was centrifuged (3800 g, 10 min,
4 1C). The cell pellet was washed two times in 3 mL chilled
100 mM sodium phosphate buffer, resuspended in 1.25 mL
buffer and kept on ice until cell disruption. For the initial
FEMS Microbiol Ecol 66 (2008) 487–495
b-Glycosidase activity in human gut bacteria
screen of all strains examined, the phosphate buffer was
adjusted to pH 6.0, based on a study reporting the highest
enzyme activities at this pH in human faeces (Mallett et al.,
1989). Subsequent analysis of strains R. hominis A2-183 and
F. prausnitzii A2-165 revealed that pH 6.5 was a better
compromise for measuring both activities under the same
conditions (data not shown); therefore the pH was adjusted
to 6.5 throughout all further experiments to enable a direct
comparison of the results.
For cell disruption, 1 mL of cell suspension was added to
250 mL of glass beads (106 mm, washed several times in
deionized water and autoclaved) in a 2-mL threaded tube
and beaten in a mini bead beater (Stratech Scientific) at
5000 r.p.m. two times for 30 s each, with a 30-s incubation
on ice in between. The tube was centrifuged (16 000 g,
10 min, 4 1C) and the supernatant, representing the cell
extract, was removed and stored on ice.
To determine enzyme activities in the insoluble fraction,
the pellet was washed three times with 0.95 mL sodium
phosphate buffer and finally resuspended in 0.95 mL buffer.
Enzyme activity determined in the washes was regarded as
belonging to the soluble fraction and added to the values
obtained for the cell extract in order to determine the
relative proportions of enzyme activity recovered from the
soluble fraction and insoluble fraction, respectively.
Determination of b-glucosidase and
b-glucuronidase activity
The substrates 4-nitrophenyl-b-D-glucopyranoside or 4-
nitrophenyl-b-D-glucuronide were prepared as 10 mM solu-
tions in 100 mM sodium phosphate buffer of the same pH as
was used for preparing cell extracts and prewarmed to 37 1C.
Bacterial extracts, cell debris or culture supernatants were
prewarmed to 37 1C before adding 75 mL of sample in
duplicate to wells of a microtitre plate. Seventy-five micro-
litres of substrate solution was added and the development
of 4-nitrophenol was recorded over 30 min in a plate reader
(Tecan) at 37 1C at 405 nm. The 4-nitrophenol concentra-
tion was determined from a standard curve of 4-nitrophenol
in sodium phosphate buffer of the same pH as was used for
preparing cell extracts. Protein concentrations were deter-
mined with a bicinchoninic acid kit (Pierce). All data are
mean and SD of at least three repeats.
Degenerate PCR, cloning, sequencing and
sequence analysis
Degenerate PCR and primer design were performed with
bacterial cells as template, as described previously (Louis
et al., 2004). Degenerate primer GNfor (TAT TTA AAA GGI
TTY GGI MRI CAY GAR GA) was designed from an
alignment of deduced protein sequences from Ruminococcus
gnavus (AY307023), Lactobacillus gasseri (AF305888), Sta-
FEMS Microbiol Ecol 66 (2008) 487–495
489
phylococcus sp. (AF354044) and Escherichia coli (S69414).
Degenerate primer GNP2mod (CC TTC TGT TGT IKB
RAA RTC IGC RAA RTT CCA) is a modification of primer
P2 from Beaud et al. (2005). Both primers contain 5 0 -tags
based on the sequence of the R. gnavus gene (AY307023).
Amplification was performed with BIOTAQ DNA Polymer-
ase (Bioline) according to the manufacturer’s instructions
with a ramped annealing approach (Skantar & Carta, 2000)
using the following conditions: initial denaturation (3 min
at 94 1C), then 35 cycles of denaturation (30 s at 94 1C),
ramped annealing (20 s at 55 1C, 5 s at 50 1C, 5 s at 45 1C and
5 s at 40 1C), and elongation (1 min at 72 1C) and a final
extension (10 min at 72 1C). PCR products obtained with
Roseburia intestinalis L1-82 and B. ovatus V975 as template
were cloned into pGEM-T-Easy (Promega) according to the
manufacturer’s instructions. Sequencing with vector pri-
mers M13F and M13R (Promega) and internal primers
(L1-82bglucF, ATCCGTGAACACCATGAACAG and L1-
82bglucR, GGAATGCCAGTACTCGTATGC; V975gusF,
TAATGCACGGTTGGCAGTG and V975gusR, CACCCCA-
GATAGTAAGACTG) was performed on a Beckman capil-
lary sequencer. BLASTP analysis (Altschul et al., 1990) was
performed with the deduced protein sequence to identify
the closest match in the GenBank database. The accession
numbers for the gene fragment of R. intestinalis L1-82 and
B. ovatus V975 are EU331462 and EU541480, respectively.
The phylogenetic tree was constructed using the program
MEGA4 (Tamura et al., 2007), using the neighbour-joining
method, 1000 times bootstrap and distance model Kimura.
Results
Presence of b-glucosidase and b-glucuronidase
activity in human colonic bacteria
A range of human colonic bacteria were screened for b-
glucosidase and b-glucuronidase activity after growth in
M2GSC medium to facilitate growth of all bacteria under
the same conditions. Two low G1C% Gram-positive strains
of clostridial cluster IV and all cluster XIVa strains related to
the Roseburia/E. rectale group exhibited b-glucosidase activ-
ity, but only few of the cluster XIVa strains outside that
bacterial group displayed the activity (Table 1, Fig. 1). The
highest b-glucosidase activity was found in cell extracts of
some of the Bifidobacterium species examined, while among
the Bacteroides strains tested, only Bacteroides thetaiotaomi-
cron displayed activity (Table 1).
b-Glucuronidase activity was only found in few of
the bacteria examined, namely, in strains belonging to
R. hominis and R. intestinalis within cluster XIVa, and two
F. prausnitzii-related isolates from cluster IV (Fig. 1).
Faecalibacterium prausnitzii A2-165 exhibited by far the
highest activity of all strains examined (Table 1).


c 2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
490 M. Dabek et al.

Table 1. b-Glucosidase and b-glucuronidase activity in human colonic bacteria and degenerate PCR screen for b-glucuronidase gene gus
Enzyme activity [U (mg protein)1]
gus degenerate
Phylogenetic group Bacterial strain b-Glucosidase b-Glucuronidase PCR productw
Clostridial cluster XIVa
Anaerostipes caccae L1-92 (DSM 14662T) ND ND 
Butyrivibrio fibrisolvens 16/4 0.048  0.028 ND 
Coprococcus comes A2-232 ND ND 
Coprococcus comes SL7/1 ND ND 
Coprococcus eutactus ART55/1 0.032  0.001 ND 
Coprococcus sp. L2-50 0.022  0.024 ND 
Eubacterium hallii L2-7 (DSM 17630) ND ND 
Eubacterium hallii SM6/1 ND ND 
Eubacterium rectale A1-86 0.119  0.091 ND 
Eubacterium rectale M104/1 0.022  0.006 ND 
Eubacterium rectale T1-815 0.058  0.016 ND 
Roseburia faecis M72/1 (DSM 16840T) 0.094  0.018 ND 
Roseburia hominis A2-181 0.072  0.023 0.070  0.013 1
Roseburia hominis A2-183 (DSM 16839T) 0.089  0.010 0.059  0.014 1
Roseburia intestinalis L1-8151 0.225  0.018 0.038  0.045 1
Roseburia intestinalis L1-82 (DSM 14610T) 0.155  0.079 0.008  0.002 1
Roseburia intestinalis L1-952 0.157  0.035 0.010  0.002 1
Roseburia intestinalis M50/1 0.186  0.038 0.007  0.002 1
Roseburia inulinivorans A2-194 (DSM 16841T) 0.168  0.016 ND 
Ruminococcus obeum A2-162 0.084  0.009 ND 
Isolate M62/1 ND ND 
Isolate SSC/2 ND ND 
Clostridial cluster IV
Eubacterium siraeum 70/3 0.037  0.002 ND 
Faecalibacterium prausnitzii A2-165 (DSM 17677) ND 0.505  0.013 1
Faecalibacterium prausnitzii L2-6 ND 0.020  0.006 1
Faecalibacterium prausnitzii M21/2 ND NDz 1
Ruminococcus bromii L2-63 ND ND 
Ruminococcus sp. 80/3 0.069  0.019 ND 
Clostridial cluster XVI
Eubacterium cylindroides SM7/11 ND ND 
Eubacterium cylindroides T2-87 ND ND 
Bifidobacterium spp.
Bifidobacterium adolescentis DSM 20083T 2.046  0.612 ND 
Bifidobacterium adolescentis L2-32 0.535  0.083 ND 
Bifidobacterium angulatum DSM 20098T 0.859  0.140 ND 
Bifidobacterium bifidum DSM 20456T ND ND 
Bifidobacterium breve DSM 20213T 0.275  0.103 ND 
Bifidobacterium longum DSM 20219T ND ND 
Bifidobacterium pseudocatenulatum DSM 20438T 0.312  0.134 ND 
Bacteroides spp.
Bacteroides ovatus V975 ND ND 1
Bacteroides thetaiotaomicron DSM 2079T 0.082  0.033 ND 
Bacteroides vulgatus DSM 1447T ND ND 
ND: enzyme activity o 0.005 U mg1.
w
 : presence/absence of a PCR product of the expected size after amplification with primers GNfor and GNP2mod.
z
Note that low level b-glucuronidase activity was detected for Faecalibacterium prausnitzii M21/2 in subsequent experiments, see main text for details.

Growth phase-dependence and localization of
enzyme activity in R. hominis A2-183 and
F. prausnitzii A2-165
Two strains were selected to examine the two glycosidase
activities in more detail. Roseburia hominis A2-183 was
chosen as it harbours both activities and F. prausnitzii A2-165
because it exhibited the highest b-glucuronidase activity.
Further experiments were performed with the more
defined YCFA medium, containing glucose or other
carbon sources where indicated. The b-glucosidase activities
of R. hominis A2-183 remained very similar, regardless of

c 2008 Federation of European Microbiological Societies FEMS Microbiol Ecol 66 (2008) 487–495
Published by Blackwell Publishing Ltd. All rights reserved
b-Glycosidase activity in human gut bacteria 491

GS GN
R. intestinalis L1-952 (AJ270479) + +
R. intestinalis L1-8151 (AJ31 2386) + +
R. intestinalis L1-82 (AJ 312385) + +
R. intestinalis M50/1 (AY305308) + +
R. hominis A2-183 (AJ27 0482) + +
R. hominis A2-181 (AY80414 8) + +
R. faecis M72/1 (AY305310) + –
E. rectale T1-815 (AJ270 476) + –
E. rectale A1-86 (AJ2704 75) + –
E. rectale M104/1 (AY305 311) + –
B. fibrisolvens 16/4 (AJ2 50365) + –
XIVa
R. inulinivorans A2-194 (AJ27 0473) + –
C. comes SL7/1 (AY305312) – –
C. comes A2-232 (AY305305) – –
R. obeum A2-162 (DQ986224) + –
isolate M62/1 (AY305 309) – –
Coprococcus sp. L2-50 (AJ27 0491) + –
C. eutactus ART55/1 (AY350746) + –
A. caccae L1-92 (AJ2704 87) – –
Fig. 1. Phylogenetic tree of human faecal low isolate SSC/2 (AY305 320) – –
G1C% firmicutes based on 16S rRNA gene E. hallii L2-7 (AJ270490) – –
sequences (accession numbers given in parenth- E. hallii SM6/1 (AY305 318) – –
eses) corresponding to positions 44 to 1474 of F. prausnitzii A2-165 (AJ 270469) – +
F. prausnitzii M21/2 (AY305307) – (+)
the Escherichia coli numbering system (Brosius
F. prausnitzii L2-6 (AJ27 0470) – +
et al., 1978). Clostridial clusters are indicated by IV
R. bromii L2-63 (EU266549) – –
roman numbers. GS, b-glucosidase activity; GN,
E. siraeum 70/3 (EU266550) + –
b-glucuronidase activity; 1, positive and  , Ruminococcus sp. 80/3 (EU266551) + –
negative for respective enzyme activity; (1), E. cylindroides T2-87 (AY305306) – –
Strain did display activity in subsequent experi- XVI
E. cylindroides SM7/11 (AY3053 13) – –
ments; see main text for details.

whether cells were harvested in exponential [0.058 
0.004 U (mg protein)1] or stationary growth phase [0.062 
0.002 U (mg protein)1]. b-Glucuronidase activity, on the other
hand, increased in stationary phase in both bacteria [R. hominis
A2-183 exponential phase: 0.049  0.002 U (mg protein)1,
stationary phase: 0.146  0.00 U (mg protein)1; F. prausnitzii
A2-165 exponential phase: 0.43  0.02 U (mg protein)1,
stationary phase: 0.77  0.09 U (mg protein)1].
The localization of the enzyme activities was examined by
separating culture supernatants, the soluble fraction of cell
extracts and cell debris as described in Materials and
methods.
The bulk of the activity (between 72% and 100%) was
found in the soluble fraction of the cells in both the
exponential and the stationary phase cells for both strains
and both activities, with a slight increase in the insoluble
fraction in stationary phase (data not shown). The activity
found in the culture supernatant was negligible. Based on
these results, all subsequent measurements were performed
on the soluble extracts only.
Effect of alternative carbon sources on enzyme
activities
Enzyme activities were determined after growth of
R. hominis A2-183 on four alternative carbon sources,
glucose, cellobiose, xylose and D-glucuronic acid. Cells were
passaged once through the respective medium, and activities
were determined in stationary cells of the second passage.
Activities for both enzymes were only marginally affected by
growth on cellobiose and xylose in comparison to glucose;
however, b-glucuronidase activity increased approximately
ninefold in the presence of D-glucuronic acid (Fig. 2). An
increase of b-glucuronidase activity to similar levels was
also seen in exponentially growing cells in the presence of
D-glucuronic acid (data not shown). When 0.02% of
D-glucuronic acid was added to glucose-containing med-
ium, the b-glucuronidase activity of R. hominis A2-183
remained low during exponential phase but rose to 0.282 
0.002 U (mg protein)1 compared with 0.095  0.005 U
(mg protein)1 in the glucose only control in stationary
phase, indicating that the presence of glucose prevents the
effect of D-glucuronic acid (data not shown).
In contrast, the b-glucuronidase activity of R. intestinalis
L1-82 was similar for glucose and D-glucuronic acid-grown
cultures [0.0093  0.0003 and 0.010  0.0003 U (mg
protein)1, respectively]. Roseburia inulinivorans A2-194,
Roseburia faecis M72/1 and E. rectale A1-86 showed no
detectable b-glucuronidase activity when grown on
M2GSC medium (Table 1), and failed to grow on D-
glucuronic acid as the sole carbon source in YCFA medium.
When grown in the presence of 0.02% D-glucuronic acid in

FEMS Microbiol Ecol 66 (2008) 487–495

c 2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
492 M. Dabek et al.

Enzyme activity [U (mg protein) ] 0.4 ****

Enzyme activity [U (mg protein) ]

1.8
**** ****
1.6
1.4 0.3

/10
1.2
**** **
1.0 0.2
or OD

or OD
0.8 * *
0.6 0.1
0.4 * *
**
0.2 * * * 0.0
0.0 Buffer 4-np 4-np GS GS GN GN
Glucose Cellobiose Xylose Glucuronic acid 0.2 mM 1 mM 0.2 mM 1 mM 0.2 mM 1 mM

Fig. 2. Enzyme activities and final OD of stationary phase cells of Fig. 3. Enzyme activities and final OD of stationary phase cells of
Roseburia hominis A2-183 after growth in YCFA medium with different Roseburia hominis A2-183 after growth in YCFA medium with glucose
carbon sources at 0.2%. Grey bars, b-glucosidase activity; black bars, b- and 4-nitrophenol compounds. Grey bars, b-glucosidase activity; black
glucuronidase activity; hatched bars, OD. Significance level compared bars, b-glucuronidase activity; hatched bars, OD. 4-np, 4-nitrophenol;
with glucose-grown cultures: P o 0.05; P o 0.0001. GS, 4-nitrophenyl-b-D-glucopyranoside; GN, 4-nitrophenyl-b-D-glucuro-
nide. Significance level compared with buffer: P o 0.05; P o 0.01;
P o 0.0001.
addition to glucose, these strains did not show detectable
b-glucuronidase activities. Table 2. Effect of glucuronide and glucoside substrates on glycosidase
Faecalibacterium prausnitzii A2-165 did not exhibit activites
an altered activity after growth in the presence of 0.2% Enzyme activity [U (mg protein)1]/fold
D-glucuronic acid compared with growth on glucose change
Treat-
[0.72  0.05 and 0.77  0.09 U (mg protein)1, respectively].
Bacterial strain ment b-Glucosidase b-Glucuronidase
The other two F. prausnitzii strains, L2-6 and M21/2,
R. hominis Buffer 0.054  0.005 0.119  0.008
exhibited very poor growth in YCFA medium and experi-
A2-183 GSw 0.383  0.007z/7.1 0.146  0.006‰/1.2
ments were therefore performed in M2GSC with either 0.2% GNz 0.041  0.004‰/0.8 0.336  0.017z/2.8
glucose or D-glucuronic acid added. We found very low R. intestinalis Buffer 0.085  0.010 0.014  0.002
b-glucuronidase activity in the strain M21/2, which was very LI-82 GS 0.104  0.023‰/1.2 0.014  0.001/1.0
slightly increased in the presence of D-glucuronic acid GN 0.088  0.017/1.0 0.014  0.002/1.0
[0.0025  0.0003 U (mg protein)1 compared with 0.0019 R. inulinivorans Buffer 0.086  0.001 ND
 0.0001 U (mg protein)1 on glucose, P = 0.028]. This low A2-194 GS 0.090  0.010/1.1 ND
R. faecis M72/1 Buffer 0.118  0.007 ND
level of activity was probably not picked up in the initial
GS 0.102  0.009/0.9 ND
screen as a higher assay pH was used (see Materials and E. rectale A1-86 Buffer 0.017  0.004 ND
methods), which increases the absorbance of the assay GS 0.218  0.020z/12.6 ND
product 4-nitrophenol and thus is slightly more sensitive. F. prausnitzii Buffer ND 0.740  0.146
Strain L2-6 exhibited 0.025 U (mg protein)1 regardless of A2-165 GN ND 0.917  0.328/1.2
the carbon source present. F. prausnitzii Buffer ND 0.002  0.000
M21/2 GN ND 0.002  0.000/0.9
F. prausnitzii Buffer ND 0.016  0.001
Effect of glucuronide and glucoside substrates L2-6 GN ND 0.073  0.003z/4.5
on glycosidase activites Compared with buffer control.
w
An increase of each enzyme activity was seen with its respective GS: 1 mM 4-nitrophenyl-b-D-glucopyranoside.
z
Significance compared with buffer control P o 0.0001.
substrate in stationary phase cells of R. hominis A2-183. ‰
Significance compared with buffer control P o 0.05.
4-Nitrophenol alone had an inhibitory effect on growth, but z
GN: 1 mM 4-nitrophenyl-b-D-glucuronide.
did not result in induction (Fig. 3). This effect of the substrates ND, not determined.
was also found in exponentially growing cells (tested for 1 mM
substrate concentration only, data not shown). increase in b-glucuronidase activity (Table 2). Inducibility
An examination of other bacteria of the Roseburia/E. therefore differed markedly between strains and species.
rectale group and F. prausnitzii strains revealed that the
enzyme activities of most strains were not affected by the
Degenerate PCR of b-glucuronidase gene gus
presence of 1 mM glycoside substrate (Table 2). Eubacterium
rectale A1-86, however, exhibited a 12.6-fold increase in As some of the strains examined here possessed very low
b-glucosidase activity and F. prausnitzii L2-6 a 4.5-fold b-glucuronidase activities, it was questionable whether

c 2008 Federation of European Microbiological Societies FEMS Microbiol Ecol 66 (2008) 487–495
Published by Blackwell Publishing Ltd. All rights reserved
b-Glycosidase activity in human gut bacteria
strains exhibiting no activity in our initial screen did indeed
lack a b-glucuronidase gene or were not expressing the
respective enzyme. We therefore performed degenerate
PCR against a b-glucuronidase gene belonging to family 2
glycosyl hydrolases (Carbohydrate Active Enzymes database,
http://www.cazy.org/; Coutinho & Henrissat, 1999) that has
been described in other bacteria (Beaud et al., 2005; Russell
& Klaenhammer, 2001), with the 40 bacterial strains exam-
ined in the enzyme activity screen. For isolates belonging to
Firmicutes, a product of the expected size was only found for
the two R. hominis strains, four R. intestinalis strains and
three F. prausnitzii strains, in accordance with the enzymo-
logical results (Table 1). Of the Bifidobacterium and Bacter-
oides strains tested, only B. ovatus V975 exhibited a faint
band of the expected size, despite not showing detectable
enzyme activity.
We cloned and sequenced the degenerate PCR product of
R. intestinalis L2-82 and B. ovatus V975. BLASTP analysis of
the R. intestinalis L2-82 sequence revealed the highest
similarity to an ORF of the draft genome sequence of
F. prausnitzii M21/2 (ZP_02090669, 71% identity) and
matches to other b-glucuronidase genes (closest match to
C. cellulolyticum H10 ZP_01574828.1, 56% identity; match
to R. gnavus gus AAQ76046, 38% identity). The Conserved
Domains Database (Marchler-Bauer & Bryant, 2004) re-
vealed the highest matches to the TIM barrel domain of
glycosyl hydrolases family 2 (pfam02836) and b-glucuroni-
dase (PRK10150) and lower matches to b-galactosidases
(COG3250, PRK09525, PRK10340). The two glutamate
residues involved in the catalytic mechanism of other
members of family 2 b-glucuronidases (Salleh et al., 2006)
are conserved in the R. intestinalis L1-82 gene. The B. ovatus
V975 sequence also showed similarity to family 2 glycosyl
hydrolases. It exhibited 100% identity to a hypothetical
protein from B. ovatus ATCC 8483 (ZP_02065724) and
42–41% identity to b-galactosidases and family 2 glycosyl
hydrolases from other Bacteroides spp. However, it displayed
only 28% identity to the deduced protein sequence from
R. intestinalis L1-82 (EU331462) and 24% to the R. gnavus
sequence (AAQ76046) and is therefore unlikely to encode
the same type of enzyme.
Discussion
The human gut microbiota is involved in the metabolism of
certain xenobiotics and secondary plant compounds; how-
ever, the bacteria responsible and their enzymatic activities
mostly remain poorly characterized. Here, we screened 40
bacterial strains mainly belonging to the numerically im-
portant firmicutes for two glycosidase activities responsible
for the conversion of glycosidic compounds to their respec-
tive aglycones. In accordance with McBain & Macfarlane
(1998), who reported a higher prevalence of b-glucosidase
FEMS Microbiol Ecol 66 (2008) 487–495
493
producers than b-glucuronidase producers based on most
probable number measurements, we found detectable levels
of b-glucosidase activity in 23, but of b-glucuronidase
activity in only nine, of the 40 strains screened. To our
knowledge, these enzyme activities have not previously been
surveyed in a wide range of low G1C% Gram-positive
bacteria belonging to the main intestinal clostridial clusters
XIVa and IV, although other studies have reported respective
activities in strains belonging to Bifidobacterium and Bacter-
oides spp. A direct comparison of the data is difficult, as the
experimental set-up varied greatly between studies. Here, we
performed assays under aerobic conditions, as it was pre-
viously shown that this leads to similar results as anaerobic
incubations, whereas 4-nitrophenol substrates might be
degraded under anaerobic conditions if nitroreductase ac-
tivities are present (Chadwick et al., 1995). McBain &
Macfarlane (1998) determined enzyme activites in the
extracellular compartment as well as in intact cells under
anaerobic conditions. Glycosidase activities were found in
several strains; however, the reported activities mostly were
below the detection limit of our study. Bacteroides ovatus
DCNC 11 exhibited by far the highest b-glucosidase activity
of all strains tested, whereas we could not detect this activity
in B. ovatus V975. However, the different strains used might
behave differently, analogous to the differences McBain &
Macfarlane (1998) have found for Bifidobacterium and
Beaud et al. (2006) for R. gnavus strains. Bifidobacterium
breve DSM 20213T (NCFB 2257) displayed only detectable
b-glucosidase activity in our study, whereas McBain &
Macfarlane (1998) found both enzyme activities with intact
cells; however, b-glucuronidase activity was lower than
b-glucosidase activity. In the present study, closely related
strains mostly showed similar activity profiles; however, the
level of b-glucuronidase activity varied dramatically in the
case of the three F. prausnitzii isolates investigated. Naka-
mura et al. (2002) have also tested activities of anaerobic
cultures and found higher values of b-glucosidase than
b-glucuronidase activity in the Bacteroides and Bifidobacter-
ium species that were also tested in this study. Bacteroides
vulgatus DSM 1447T (JCM 5826T) was also used in this
study, and we also tested the rumen strain C. clostridioforme
JCM 1291T for direct comparison (data not shown) but
could not detect either of the enzyme activities in cell
extracts. However, the detection limit of our study was
higher than the values reported by Nakamura et al. (2002),
as we aimed to identify bacteria carrying high activities,
which are more likely to be important contributors to those
activities in the gut. Apart from differences in cell prepara-
tion and enzyme assay conditions, the results are also
likely to be influenced by the media used and growth
conditions, as we could show here that the enzyme activity
of some strains varied dramatically under different growth
conditions.


c2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
494
The results of the degenerate PCR screen used in the
present study against a b-glucuronidase gene (gus) pre-
viously described in other bacteria (Beaud et al., 2005;
Russell & Klaenhammer, 2001) correlated well with the
results obtained by enzyme activity measurements. Thus,
this method could be useful as a quick tool to identify novel
isolates likely to exhibit b-glucuronidase activity. Only one
strain, B. ovatus V975, exhibited a faint band by degenerate
PCR while it did not show detectable b-glucuronidase
activity; however, the cloned fragment showed only low
similarity to the translated gus gene and is therefore unlikely
to code of a homologous enzyme. Beaud et al. (2006)
screened for the presence of the gus gene in a range of
R. gnavus strains by degenerate PCR and Southern hybridi-
zation, and found strains harbouring enzyme activity that
were negative in the molecular screen and vice versa. There-
fore, more work is needed to resolve whether this gene is
indeed responsible for the enzyme activities measured here.
Two genes within the genome sequence of B. thetaiotaomi-
cron have been annotated as b-glucuronidase genes
(Xu et al., 2003). In the present study, this bacterium did
not display detectable b-glucuronidase activity. The two
genes (BT3292, BT4151), as well as the R. gnavus gene
screened for in this study, belong to family 2 glycosyl
hydrolases (Carbohydrate Active Enzymes database, http://
www.cazy.org/; Coutinho & Henrissat, 1999), but share little
sequence identity (BT3292: 22%, BT4151: 20%) to the
R. gnavus sequence (AY307023), which has been confirmed
as encoding b-glucuronidase activity by complementation
(Beaud et al., 2005). Whether the B. thetaiotaomicron genes
encode b-glucuronidase genes or glycosyl hydrolases with
different specificities remains to be confirmed.
In conclusion, our results indicate that changes in faecal
bulk glycosidase activities in response to changes in dietary
intake are likely to be due to both, changes in the number of
bacteria carrying those activities and regulatory changes
within certain strains. The strong effect on b-glucuronidase
activity seen in R. hominis A2-183 of a glucuronide substrate
as well as of one of the products of the reaction, D-
glucuronic acid, indicates that the level of exposure to
glycosides in the colon, which is dependent on the type of
diet consumed, could affect the enzyme activity levels in
some members of the gut microbiota. However, this is a
complex issue, as many factors could influence those
enzyme activities in vivo. The in vitro results presented here
may help to design future experiments in model systems to
address these points. Further studies are also necessary to
elucidate the underlying mechanisms of regulation.
Acknowledgements
The Rowett Research Institute is funded by the Scottish
Government Rural and Environment Research and Analysis


c 2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
M. Dabek et al.
Directorate. M.D. received funding from the European
Union as a fellow of the framework 5 training site Anaerobe.
We would like to thank Terry Whitehead for strain B. ovatus
V975, Marketa Hrdinova for help with isolating strain 80/3
and Harry Flint for critically reading the manuscript.
References
Altschul SF, Gish W, Miller W, Myers EW & Lipman DJ (1990)
Basic local alignment search tool. J Mol Biol 215: 403–410.
Aminov RI, Walker AW, Duncan SH, Harmsen HJM, Welling GW
& Flint HJ (2006) Molecular diversity, cultivation, and
improved detection of fluorescent in situ hybridisation of a
dominant group of human gut bacteria related to Roseburia
spp. or Eubacterium rectale. Appl Environ Microbiol 72:
6371–6376.
Atkinson C, Frankenfeld CL & Lampe JW (2005) Gut bacterial
metabolism of the soy isoflavone daidzein: exploring the
relevance to human health. Exp Biol Med 230: 155–170.
Barcenilla A (1999) Diversity of the butyrate-producing
microflora of the human gut. Ph.D. Thesis, Robert Gordon
University, Aberdeen, UK.
Barcenilla A, Pryde SE, Martin JC, Duncan SH, Stewart CS,
Henderson C & Flint HJ (2000) Phylogenetic relationships of
butyrate-producing bacteria from the human gut. Appl
Environ Microbiol 66: 1654–1661.
Beaud D, Tailliez P & Anba-Mondoloni J (2005) Genetic
characterization of the b-glucuronidase enzyme from a human
intestinal bacterium, Ruminococcus gnavus. Microbiology 151:
2323–2330.
Beaud D, Ladiré M, Azevedo V, Bridonneau C & Anba-
Mondoloni J (2006) Genetic diversity of b-glucuronidase
activity among 14 strains of the dominant human gut
anaerobe Ruminococcus gnavus. Genet Mol Biol 29: 363–366.
Blaut M & Clavel T (2007) Metabolic diversity of the intestinal
microbiota: implications for health and disease. J Nutr 137:
751S–755S.
Blaut M, Schoefer L & Braune A (2003) Transformation of
flavonoids by intestinal microorganisms. Int J Vitam Nutr Res
73: 79–87.
Brosius J, Palmer ML, Kennedy PJ & Noller HF (1978) Complete
nucleotide sequence of a ribosomal RNA gene from Escherichia
coli. Proc Natl Acad Sci USA 75: 4801–4805.
Chadwick RW, Allison JC, Talley DL & George SE (1995) Possible
errors in assay for b-glycosidase activity. Appl Environ
Microbiol 61: 820–822.
Cole CB, Fuller R, Mallet AK & Rowland IR (1985) The influence
of the host on expression of intestinal microbial enzyme
activities involved in metabolism of foreign compounds. J Appl
Bacteriol 59: 549–553.
Collins MD, Lawson PA, Willems A, Cordoba JJ, Fernandez-
Garayzabal J, Garcia P, Cai J, Hippe H & Farrow JAE (1994)
The phylogeny of the genus Clostridium: proposal of five new
genera and eleven new species combinations. Int J Syst
Bacteriol 44: 812–826.
FEMS Microbiol Ecol 66 (2008) 487–495
b-Glycosidase activity in human gut bacteria
Coutinho PM & Henrissat B (1999) Carbohydrate-active
enzymes: an integrated database approach. Recent Advances in
Carbohydrate Bioengineering (Gilbert HJ, Davies G, Henrissat
B & Svensson B, eds), pp. 3–12. The Royal Society of
Chemistry, Cambridge.
Duncan SH, Barcenilla A, Stewart CS, Pryde SE & Flint HJ (2002)
Acetate utilization and butyryl coenzyme A (CoA): acetate-
CoA transferase in butyrate-producing bacteria from the
human large intestine. Appl Environ Microbiol 68: 5186–5190.
Eriyamremu GE, Osagie VE, Alufa OI, Osaghae MO & Oyibu FA
(1995) Early biochemical events in mice exposed to cycas and
fed a Nigerian-like diet. Annu Nutr Metab 39: 42–51.
Flint HJ, Duncan SH, Scott KP & Louis P (2007) Interactions and
competition within the microbial community of the human
colon: links between diet and health. Environ Microbiol 9:
1101–1111.
Gadelle D, Raibaud P & Sacquet E (1985) b-glucuronidase
activities of intestinal bacteria determined both in vitro and in
vivo in gnotobiotic rats. Appl Environ Microbiol 49: 682–685.
Gestel G, Besançon P & Rouanet J-M (1994) Comparative
evaluation of the effects of two different forms of dietary fibre
(rice bran vs. wheat bran) on rat colonic mucosa and faecal
microflora. Annu Nutr Metab 38: 249–256.
Gill CIR & Rowland IR (2002) Diet and cancer: assessing the risk.
Br J Nutr 88: S73–S87.
Heavey PM & Rowland IR (2004) Gastrointestinal cancer. Best
Pract Res Clin Gastroenterol 18: 323–336.
Hill MJ (1995) Carbohydrate metabolism. Role of Gut Bacteria in
Human Toxicology and Pharmacology (Hill MJ, ed), pp.
95–104. Taylor & Francis, London, UK.
Kim DH & Jin YH (2001) Intestinal bacterial b-glucuronidase
activity of patients with colon cancer. Arch Pharm Res 24:
564–567.
Louis P, Duncan SH, McCrae SI, Millar J, Jackson MS & Flint HJ
(2004) Restricted distribution of the butyrate kinase pathway
among butyrate-producing bacteria from the human colon.
J Bacteriol 186: 2099–2106.
Mallett AK, Bearne CA & Rowland IR (1989) The influence of
incubation pH on the activity of rat and human gut flora
enzymes. J Appl Bacteriol 66: 433–437.
Manach C, Scalbert A, Morand C, Rémésy C & Jiménez L (2004)
Polyphenols: food sources and bioavailability. Am J Clin Nutr
79: 727–747.
Marchler-Bauer A & Bryant SH (2004) CD-Search: protein domain
annotations on the fly. Nucleic Acids Res 32: W327–W331.
FEMS Microbiol Ecol 66 (2008) 487–495
495
McBain AJ & Macfarlane GT (1998) Ecological and physiolo-
gical studies on large intestinal bacteria in relation to
production of hydrolytic and reductive enzymes involved in
formation of genotoxic metabolites. J Med Microbiol 47:
407–416.
Miyazaki K, Martin JC, Marinsek-Logar R & Flint HJ (1997)
Degradation and utilization of xylans by the rumen anaerobe
Prevotella bryantii (formerly P. ruminicola subsp. bovis) B14.
Anaerobe 3: 373–381.
Mueller S, Saunier K, Hanisch C et al. (2006) Differences in fecal
microbiota in different European study populations in relation
to age, gender, and country: a cross-sectional study. Appl
Environ Microbiol 72: 1027–1033.
Nakamura J, Kubota Y, Miyaoka M, Saitoh T, Mizuno F & Benno
Y (2002) Comparison of four microbial enzymes in Clostridia
and Bacteroides isolated from human feces. Microbiol Immunol
46: 487–490.
Russell WM & Klaenhammer TR (2001) Identification and
cloning of gusA, encoding a new b-glucuronidase from
Lactobacillus gasseri ADH. Appl Environ Microbiol 67:
1253–1261.
Salleh HM, Müllegger J, Reid SP, Chan WY, Hwang J, Warren AJ
& Withers SG (2006) Cloning and characterization of
Thermotoga maritima b-glucuronidase. Carbohydr Res 341:
49–59.
Shiau SY & Chang GW (1983) Effects of dietary fiber on fecal
mucinase and b-glucuronidase activity in rats. J Nutr 113:
138–144.
Skantar AM & Carta LK (2000) Amplification of Hsp90
homologs from plant-parasitic nematodes using degenerate
primers and ramped annealing PCR. BioTechniques 29:
1182–1186.
Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4:
molecular evolutionary genetics analysis (MEGA) software
version 4.0. Mol Biol Evol 24: 1596–1599.
Wiseman H, Casey K, Bowey EA, Duffy R, Davies M, Rowland IR,
Lloyd AS, Murray A, Thompson R & Clarke DB (2004)
Influence of 10 wk of soy consumption on plasma
concentrations and excretion of isoflavonoids and on gut
microflora metabolism in healthy adults. Am J Clin Nutr 80:
692–699.
Xu J, Bjursell MK, Himrod J, Deng S, Carmichael LK, Chiang HC,
Hooper LV & Gordon JI (2003) A genomic view of the human-
Bacteroides thetaiotaomicron symbiosis. Science 299:
2074–2076.


c2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved