Toxicology 303 (2013) 107–114

Contents lists available at SciVerse ScienceDirect

Toxicology
journal homepage: www.elsevier.com/locate/toxicol

Chlorogenic acid reduces liver inflammation and fibrosis through inhibition of

toll-like receptor 4 signaling pathway
Haitao Shi, Lei Dong ∗ , Jiong Jiang, Juhui Zhao, Gang Zhao, Xiaoyan Dang, Xiaolan Lu, Miao Jia
Department of Gastroenterology, Second Affiliated Hospital of Xi’an Jiaotong University, No. 157 Xiwu Road, Xi’an, Shaanxi 710004, China

a r t i c l e i n f o a b s t r a c t

Article history: Chlorogenic acid (CGA) is a type of polyphenol with anti-inflammatory, antioxidant activities. Our previ-
Received 23 September 2012 ous studies showed CGA could efficiently inhibit carbon tetrachloride (CCl4 )-induced liver fibrosis in rats.
Received in revised form 28 October 2012 However, the specific underlying mechanism remains unclear. The aim of this study is to investigate the
Accepted 30 October 2012
effects of CGA on liver inflammation and fibrosis induced by CCl4 and whether they are related to inhibi-
Available online 9 November 2012
tion of toll-like receptor 4 (TLR4) signaling pathway. Male Sprague-Dawley (SD) rats were administrated
CCl4 together with or without CGA for 8 weeks. Histopathological and biochemical analyses were carried
Keywords:
out. The mRNA and protein expression levels of proinflammatory and profibrotic mediators were detected
Chlorogenic acid
Liver inflammation
by RT-PCR and Western blot, respectively. The levels of serum proinflammatory cytokines were detected
Liver fibrosis by ELISA. CGA significantly attenuated CCl4 -induced liver damage and symptoms of liver fibrosis, accom-
TLR4 panied by reduced serum transaminase levels, collagen I and ␣-smooth muscle actin (␣-SMA) expression.
As compared with the CCl4 -treated group, the expression levels of TLR4, myeloid differentiation factor
88 (MyD88), inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) were reduced in the
treatment group of CCl4 and CGA, whereas bone morphogenetic protein and activin membrane-bound
inhibitor (Bambi) expression was increased. CGA also suppressed CCl4 induced nuclear factor-␬B (NF-
␬B) activation. Moreover, the hepatic mRNA expression and serum levels of tumor necrosis factor-␣
(TNF-␣), interleukin-6 (IL-6) and interleukin-1␤ (IL-1␤) were significantly increased in CCl4 -treated rats
and attenuated by co-treatment with CGA. Our data indicate that CGA can efficiently inhibit CCl4 -induced
liver fibrosis in rats and the protective effect may be due to the inhibition of TLR4/MyD88/NF-␬B signaling
pathway.
© 2012 Elsevier Ireland Ltd. All rights reserved.

Liver fibrosis is a wound-healing process in injured liver
caused by various agents, including infection with hepatitis
viruses, chronic alcohol abuse, metabolic or autoimmune diseases
(Friedman, 2003; Kawada, 2011). Upon liver injury, quiescent
hepatic stellate cells (HSCs) are activated and produce excessive
extracellular matrix (Bataller and Brenner, 2005; Friedman, 2003,
2010). In chronic liver injury, the injured or damaged cells release
a number of cytokines, which then stimulate the Kupffer cells
to release more inflammatory mediators (Luckey and Petersen,
2001). Kupffer cells and activated HSCs have been implicated
to secrete proinflammatory cytokines, chemokines and adhesion
Abbreviations: CGA, chlorogenic acid; HSCs, hepatic stellate cells; LPS,
lipopolysaccharides; TLR4, toll-like receptor 4; CCl4 , carbon tetrachloride; ␣-SMA,
␣-smooth muscle actin; MyD88, myeloid differentiation factor 88; iNOS, inducible
nitric oxide synthase; COX-2, cyclooxygenase-2; Bambi, bone morphogenetic pro-
tein and activin membrane-bound inhibitor; NF-␬B, nuclear factor-␬B; TNF-␣,
tumor necrosis factor-␣; IL-6, interleukin-6; IL-1␤, interleukin-1␤.
∗ Corresponding author. Tel.: +86 29 87679272; fax: +86 29 87678758.
E-mail addresses: shihaitao7@163.com (H. Shi), Dong556@126.com (L. Dong).
factors which play important roles in liver inflammation, acceler-
ating the liver fibrosis (Pinzani and Macias-Barragan, 2010).
Lipopolysaccharides (LPS) is the major constituent of outer
membrane in gram-negative bacteria. It activates a variety of
the mammalian cell types including monocytes/macrophages and
endothelial cells through the toll like receptor 4 (TLR4) (Zhu and
Mohan, 2010). Previous study shows serum LPS levels are signifi-
cantly elevated in patients with chronic liver disease owing to the
increased intestinal mucosal permeability and bacterial transloca-
tion (Choi et al., 2011; Lin et al., 1995; Parlesak et al., 2000). Many
liver cells including Kupffer cells, HSCs and liver endothelial cells
(LECs) can express TLR4 and respond to LPS, which has an impor-
tant role in liver fibrosis (Aoyama et al., 2010). It is known that LPS
stimulates Kupffer cells to release a number of cytokines to activate
HSCs and TLR4 signaling in LECs regulates angiogenesis, which are
linked to the development of liver fibrosis (Seki and Brenner, 2008).
LPS sensitizes quiescent HSCs to TGF-␤ and Kupffer cell–mediated
activation (Seki et al., 2007), while for activated HSCs, it can pro-
mote them to develop an inflammatory phenotype and make a
contribution to the inflammatory network in the liver during endo-
toxemia (Brun et al., 2005; Paik et al., 2003; Thirunavukkarasu et al.,

0300-483X/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.tox.2012.10.025
108 H. Shi et al. / Toxicology 303 (2013) 107–114
2006). Besides Kupffer cell, HSC is another target for LPS-induced
liver injury and provide a direct link between inflammatory and
fibrotic liver injury (Seki et al., 2007).
Some epidemiological researches suggest that coffee consump-
tion may reduce the risk of liver fibrosis (Ruhl and Everhart, 2005;
Tverdal and Skurtveit, 2003). Our study, as well as one from others,
shows that coffee can improve carbon tetrachloride (CCl4 )-induced
liver fibrosis in rats (Shi et al., 2010; Shin et al., 2010). However,
it is not clear which components of coffee are responsible for the
protective effect. Other than caffeine, kahweol and cafestol, cof-
fee drink is also rich in chlorogenic acid (CGA). Caffeine, kahweol
and cafestol have been shown to have hepatoprotective and anti-
oxidant effects (Gressner et al., 2008; Lee et al., 2007). CGA is a
type of polyphenol with anti-inflammatory, antioxidant, antiobe-
sity and antimicrobial activities (Feng et al., 2005; Kono et al., 1997;
Xu et al., 2010; Zhang et al., 2010). A recent study showed that CGA
can protect mice from LPS-induced hepatotoxicity (Xu et al., 2010).
Another study showed that CGA can inhibit LPS-induced inflamma-
tory cytokines release in RAW264.7 cells (Shan et al., 2009). And
our previous study showed that CGA can efficiently inhibit CCl4 -
induced liver fibrosis in rats (Shi et al., 2009). However, the specific
underlying mechanism remains unclear, but it may be related to its
anti-inflammatory activities. This study is to investigate the effects
of CGA on liver inflammation and fibrosis induced by CCl4 and
whether they are related to inhibition of TLR4 signaling pathway.
1. Materials and methods
1.1. Reagents
CGA was purchased from Sigma–Aldrich (St. Louis, USA). Anti-␣-SMA was from
Epitomic (Burlingame, CA, USA). Anti-TLR4, Bambi and Lamin B were from Pro-
teinTech Group (Chicago, IL, USA). Anti-MyD88, I␬B-␣, p-I␬B-␣, and ␤-actin were
from Bioworld Technology (St. Louis Park, MN, USA). Anti-NF-␬B was from Abcam
(Cambridge, UK). Anti-COX-2, iNOS and horseradish-peroxidase (HRP)-conjugated
secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz,
CA, USA). The SuperSignal Substrate Chemiluminescence Kit was from Pierce (Rock-
ford, USA). All other chemicals used in the experiment were of analytical grade.
1.2. Animals and experimental treatments
Thirty-two SD rats weighing (220–250 g) were housed with free access to food
and water throughout the experiments. The rats were maintained in a controlled
environment at 21 ± 2 ◦ C and 50 ± 5% relative humidity under a 12-h dark/light cycle
and were acclimatized for at least 1 week prior to use. The rats were randomly
divided into four groups (8 rats per group): (1) control group: given the appropri-
ate vehicles (distilled water and olive oil); (2) CGA group: given CGA (60 mg/kg,
dissolved in distilled water, intragastric administration once daily); (3) CCl4 group:
given CCl4 [3 mL/kg, dissolved in olive oil (40%, V/V), intraperitoneal injection twice
weekly]; (4) CCl4 + CGA group: given CCl4 along with CGA (dosages and treatments
as mentioned for CGA group and CCl4 group, respectively). No rats died during the
experimental period. At the end of 8 weeks and 24 h after the last dose of CCl4 the
rats were anesthetized with chloral hydrate and blood was drawn from inferior caval
vein prior to the excision of organ tissues. Serum was collected by centrifugation at
13,000 rpm for 15 min at 4 ◦ C and stored at −70 ◦ C for liver function test and ELISA
analysis. Liver was rapidly excised and stored in liquid nitrogen for later analysis.
The experiment was performed in accordance with the guidelines of the Animal
Care Committee of Xi’an Jiaotong University.
1.3. Liver function test
Alanine transaminase (ALT), aspartate transaminase (AST) activities and albu-
min were measured using a biochemistry analyzer (Olympus AU2700, Japan).
1.4. Histological examinations
A portion of each liver was fixed in 10% formalin, processed by routine histo-
logical procedures, embedded in paraffin, and cut into 5-␮m sections. The samples
were stained with hematoxylin and eosin (H&E) for histopathological examination
and with Masson’s trichrome for assessment of fibrosis. Sections were examined in
a blinded manner under a microscope (Leica TCS SP, German). Fibrosis was graded
according to the method of (Ruwart et al., 1989) as follows: grade 0, normal liver
and no fibrosis; grade 1, increase in collagen without septa formation; grade 2, for-
mation of incomplete septa from the portal tract to the central vein (septa that do
not interconnect with each other); grade 3, complete but thin septa interconnecting
with each other so as to divide parenchyma into separate fragments; and grade 4,
the same as grade 3, except for the presence of thick septa (complete cirrhosis). To
avoid sampling errors, biopsies were obtained from equivalent lobes and the semi-
quantitative grades were performed by independent histopathologists who were
blinded to the treatment assignment. Each sample was observed at 100× magnifi-
cation. The degree of liver damage was expressed as the mean of ten fields of view
on each slide.
1.5. Reverse transcription-polymerase chain reaction (RT-PCR)
Total RNA was extracted from liver tissue samples by the TRIzol kit (Invitrogen)
according to the manufacturer’s protocol. The RNA was then subjected to reverse
transcription using a RevertAidTM First Strand cDNA Synthesis Kit (Fermentas).
The mRNA expression levels of TLR4, myeloid differentiation factor 88 (MyD88),
inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), tumor necrosis
factor-␣ (TNF-␣), interleukin-6 (IL-6), interleukin-1␤ (IL-1␤), bone morphogenetic
protein and activin membrane-bound inhibitor (Bambi), ␣-smooth muscle actin (␣-
SMA), collagen I were measured by RT-PCR. The primer sequences used in PCR are
shown in Table 1. The annealing temperatures and the thermal cycles for each tar-
get gene were as follows: TLR4 (56 ◦ C, 30 cycles), MyD88 (54 ◦ C, 30cycles), iNOS
(56 ◦ C, 30 cycles), COX-2 (54 ◦ C, 30 cycles), TNF-␣ (56 ◦ C, 34 cycles), IL-6 (56 ◦ C, 30
cycles), IL-1␤ (53 ◦ C, 30 cycles), Bambi (57 ◦ C, 30 cycles), ␣-SMA (53 ◦ C, 30 cycles)
and collagen-I (53 ◦ C, 30 cycles), ␤-actin (56 ◦ C, 30 cycles). PCR products were run
on a 2% agarose gel stained with ethidium bromide recorded on polaroid film, and
the bands quantified by densitometry. The expression levels of all the transcripts
were normalized to that of ␤-actin mRNA in the same tissue samples.
1.6. Western blot
The cytosolic and nuclear protein extracts from rat liver were performed as
described previously (Choi et al., 2009). Samples of 50 ␮g of protein were mixed
with gelloading buffer, boiled for 5 min, and loaded on 8% or 10% polyacrylamide
gels. Electrophoresis was then carried out and the proteins transferred to nitrocellu-
lose membranes. Non-specific antibody binding was blocked by preincubation of the
membranes in 1× Tris-buffered saline (TBS) containing 5% skimmed milk for 2 h at
room temperature. The membranes were incubated overnight at 4 ◦ C with primary
antibodies against rat TLR4 (1:500), MyD88 (1:500), NF-␬B (1:400), I␬B–␣ (1:500), p-
I␬B–␣ (1:500), iNOS (1:500), COX-2 (1:500), Bambi (1:800), ␣-SMA (1:1000), Lamin
B (1:1000), and ␤-actin (1:1000) in 1× TBS containing 5% skimmed milk. After wash-
ing, they were incubated for 2 h at room temperature with anti-rabbit IgG at a 1:4000
dilution. Bands were visualized using a SuperSignal Substrate Chemiluminescence
Kit.
1.7. Determination of cytokine levels.
Specific and sensitive enzymelinked immunoassays (ELISA) obtained from R&D
Systems (Minneapolis, MN, U.S.A.) were used to determine concentrations of TNF-␣,
IL-6, and IL-1␤ in serum.
1.8. Statistical analysis
The experimental results were expressed as the mean ± SD. Statistical signifi-
cance among the groups was analyzed by one-way analysis of variance with the
Student–Newman–Keuls test. Histopathological data from the liver were analyzed
by the Kruskal–Wallis non-parametric test, followed by the Mann–Whitney U-test.
P < 0.05 was considered significant.
2. Results
2.1. Effects of CGA on general features and liver function
There was no difference in body weight and liver index [Liver-
weight (g)/body-weight (100 g)] between control group and CGA
control group. CCl4 -treated rats showed significantly decreased
body weight (P < 0.01) and increased liver index (P < 0.01). How-
ever, CCl4 and CGA co-treatment have no effect on body weight
and liver index compared with CCl4 treatment alone. For assess-
ments of hepatocellular damage, the serum transaminase (AST
and ALT) activities and albumin level were measured. There was
no difference in serum transaminase activities and albumin level
between control group and CGA control group. After administra-
tion for 8 weeks, a dramatic increase in liver enzyme activities
and decrease in albumin level were observed in CCl4 -treated rats
compared with controls (P < 0.01). CCl4 and CGA co-treatment sig-
nificantly decreased ALT and AST activities (P < 0.01) and increased
 H. Shi et al. / Toxicology 303 (2013) 107–114 109

Table 1
Primer sequences for RT-PCR.

Target genes Sequences PCR product (bp)

␤-actin Forward 5 - CTATCGGCAATGAGCGGTTCC -3 147

Reverse 5 -TGTGTTGGCATAGAGGTCTTTACG -3
␣-SMA Forward 5 -GGCTTCTCTATCTACCTTCC-3 167
Reverse 5 -ACATTCACAGTTGTGTGCTA-3
Collagen I Forward 5 -ACAGGCGAACAAGGTGACAGAG-3 159
Reverse 5 -GCCAGGAGAACCAGCAGAGC-3
TLR4 Forward 5 - GGCATCATCTTCATTGTCCTTG -3 111
Reverse 5 - AGCATTGTCCTCCCACTCG -3
MyD88 Forward 5 - TACATACGCAACCAGCAG -3 160
Reverse 5 - GGCAGTAGCAGATGAAGG -3
iNOS Forward 5 -CTCACTGTGGCTGTGGTCACCTA-3 101
Reverse 5 -GGGTCTTCGGGCTTCAGGTTA-3
COX-2 Forward 5 - ACCAGCAGTTCCAGTATCAG -3 158
Reverse 5 - AGCAAGTCCGTGTTCAAGG -3
TNF-␣ Forward 5 - CCACCACGCTCTTCTGTCTAC -3 148
Reverse 5 - GCTACGGGCTTGTCACTCG -3
IL-6 Forward 5 -CTTCCAGCCAGTTGCCTTCTTG-3 109
Reverse 5 -TGGTCTGTTGTGGGTGGTATCC-3
IL-1␤ Forward 5 -AATCTCACAGCAGCATCTC-3 189
Reverse 5 -AGCAGGTCGTCATCATCC-3
Bambi Forward 5 - CTCAGGACAAGGAAACAGATACC -3 173
Reverse 5 - TTCGCAGCATTCGCAAGG -3

Table 2
Body weight, liver weight and liver function tests in different treatment group.

Control CGA CCl4 CCl4 + CGA

Body weight (g) 418 ± 17.9 424 ± 21.9 367 ± 10.8* 375 ± 14.3
Liver weight (g) 14.0 ± 1.03 14.1 ± 1.15 13.9 ± 0.69 13.7 ± 0.47
Liver index 3.35 ± 0.26 3.31 ± 0.18 3.78 ± 0.21* 3.67 ± 0.18
ALT (U/L) 48.2 ± 6.0 47.6 ± 8.6 165.1 ± 21.8* 99.7 ± 23.4#
AST (U/L) 39.1 ± 4.1 37.5 ± 7.9 140.6 ± 22.1* 103.7 ± 15.3#
Albumin (g/L) 31.7 ± 2.1 32.2 ± 2.5 20.0 ± 3.4* 23.6 ± 2.8##

Results are mean ± SD (n = 8). Liver index: liver-weight (g)/body-weight (100 g).
*
P < 0.01 as compared with control group.
#
P < 0.01 as compared with CCl4 group.
##
P < 0.05 as compared with CCl4 group.

albumin level (P < 0.05), suggesting that CGA can ameliorate liver 2.3. Effects of CGA on the expression of ˛-SMA and collagen I
injury induced by CCl4 administration (Table 2).
In order to evaluate liver fibrosis at the molecular level, we
2.2. Effects of CGA on liver histopathologic changes detected the expression of ␣-smooth muscle actin (␣-SMA), a
marker of hepatic stellate cell activation, and collagen I, the
The histopathological changes in liver were examined with H&E major component of extracellular matrix in fibrotic liver. The
and Masson’s trichrome staining. Liver tissue samples from the con- expression of ␣-SMA and collagen I were significantly elevated in
trol and CGA control rats showed an integrity lobular structure with CCl4 -treated rats compared with the control group (P < 0.01), and
clear central veins and radiating hepatic cords, without necrosis, these inductions were significantly inhibited by CCl4 and CGA co-
inflammation or fibrosis development (Fig. 1A–D). In contrast, CCl4 - treatment (P < 0.01)(Fig. 2A and B), which suggested CGA could
treated rats showed severe changes in liver morphology, including inhibit the activation of quiescent HSCs and extracellular matrix
necrosis, obvious collagen deposition, formation of pseudo-lobules deposition.
and infiltration of inflammatory cells in liver interstitial (Fig. 1E
and F). However, treatment with CGA significantly alleviated the
2.4. Effects of CGA on the TLR4 signaling pathway
degree of liver fibrogenesis and formation of pseudo-lobulus, which
accompanied with little inflammatory cell infiltration (Fig. 1G and
It has been demonstrated earlier that TLR4 signaling pathway
H, Table 3).
plays an important role in the progression of liver inflammation
and fibrosis, so we detected the effect of CGA on the TLR4 signaling
Table 3 pathway in order to elucidate the precise molecular antiinflamma-
Effect of CGA on the pathologic grading of hepatic fibrosis rats induced by CCl4 .
tion and antifibrosis and mechanism of CGA. After CCl4 treatment,
Group Severity score of fibrosis Mean rank the mRNA and protein levels of TLR4, MyD88, iNOS, COX-2 were
0 1 2 3 4 significantly increased compared to the control group, while the
level of Bambi was decreased (Fig. 3A–D). The expression of pro-
Control 8 0 0 0 0 8.5
CGA 8 0 0 0 0 8.5
inflammatory cytokines in the liver including TNF-␣, IL-6 and IL-␤
CCl4 0 0 1 2 5 27.75* were also up-regulated in CCl4 -treated rats (Fig. 3E). Moreover, CCl4
CCl4 + CGA 0 2 4 2 0 21.25# treatment could reduced I␬B␣ protein level and increased p-I␬B␣
Each group consists of 8 rats and figures represent number of rat per grade. and the nuclear translocation of NF-␬B (Fig. 4A and B). All of these
*
P < 0.01 as compared with control group. results suggested TLR4/NF-␬B signaling pathway was activated in
#
P < 0.01 as compared with CCl4 group. the liver of CCl4 -treated rats. However, CGA treatment could inhibit
110 H. Shi et al. / Toxicology 303 (2013) 107–114

Fig. 1. Effect of CGA on the histological changes in the liver of the CCl4 -treated rats as shown by hematoxylin and eosin staining (histopathology; original magnification
100×) and Masson’s trichrome staining (assessment of fibrosis; original magnification 100×). (A–D) H&E staining; (A) control group:normal lobular architecture and cell
structure, (B) CGA control group: normal lobular architecture and cell structure, (C) CCl4 -treated group: extensive hepatocellular damage with the presence of inflammatory
cell infiltration, and centrizonal necrosis, (D) CCl4 and CGA co-treated group: mild inflammation and minimal hepatocellular necrosis. (E–H) Masson’s trichrome staining,
(E) control group: no significant collagen deposition, (F): no significant collagen deposition, (G) CCl4 group: substantial collagen deposition in the periportal and pericellular
areas and (H) CCl4 and CGA co-treated group: less collagen deposition was observed than that in rats treated with CCl4 alone.
 H. Shi et al. / Toxicology 303 (2013) 107–114
Fig. 2. Effects of CGA on the expression of ␣-SMA and collagen I. (A) ␣-SMA and collagen I mRNA. (B) ␣-SMA protein. The expression levels of ␣-SMA and collagen I were
significantly higher in the CCl4 -treated group as compared to the control group and CGA-treated group (P < 0.01). ␤-actin served as the internal control. * P < 0.01 as compared
with the control group; # P < 0.01 as compared with the CCl4 group.
the activation of TLR4 signaling pathway, including the expres-
sion of TLR4, MyD88, iNOS and COX-2 decreased, Bambi increased,
TNF-␣, IL-6 and IL-␤ down-regulated, I␬B␣ protein increased, the
nuclear translocation of NF-␬B and p-I␬B␣ reduced.
2.5. Effects of CGA on the serum proinflammatory cytokines levels
To determine whether CGA suppresses inflammation caused by
CCl4 , we examined the serum levels of TNF-␣, IL-6 and IL-1␤. TNF-
␣, IL-6 and IL-1␤ levels in serum of CCl4 rats were significantly
higher than those in the control group. In contrast, CGA treatment
attenuate these cytokines levels, suggesting that CGA ameliorated
the CCl4 -induced inflammatory response. However, CGA per se had
no effect on the serum proinflammatory cytokines levels (Fig. 2F).
3. Discussion
The current study shows that the administration of CGA effec-
tively attenuated CCl4 -induced histological changes, including
destruction of the structure of the hepatic lobules, formation of
pseudo-lobules, liver necrosis and inflammation. Meanwhile, lev-
els of serum transaminase and albumin were improved. Moreover,
collagen I and ␣-SMA expression and TLR4 signaling pathway acti-
vation were inhibited. Taken together, our results suggest that CGA
can protect against inflammation response and ameliorate liver
fibrosis in a rat model induced by CCl4.
TLR4, one of the members of the TLR protein family, is essen-
tial for LPS-mediated signaling. After binding to TLR4, LPS triggers
two critical intracellular signaling pathways, including MyD88-
dependent and MyD88-independent signaling cascades (Lu et al.,
2008). The MyD88-dependent pathway signals through activa-
tion of i␬B kinase (IKK), which in turn leads to activation of
transcription factor NF-␬B, and controls the expression of pro-
inflammatory cytokines and other immune-related genes. The
MyD88-independent pathway activates interferon regulatory fac-
tor 3 (IRF3) and induces the expression of interferon IFN-␤ and
IFN-responsive genes. Besides its natural exogenous ligand LPS,
there are endogenous ligands that are also able to bind and acti-
vate TLR4, including HMGB1, hyaluronan, and heat shock protein
60 (Kao et al., 2008). There is rapidly increasing knowledge about
the relationship between TLR4 signaling and the mechanisms of
human diseases, which makes TLR4 signaling inhibition appear to
be a promising strategy for the prevention of many inflammatory
diseases (O’Neill, 2003).
111
Currently, we do not have strong evidence that endogenous
TLR4 ligands are involved in liver fibrosis. It was shown that
HMGB1 stimulates HSCs proliferation and expression of a-SMA
in vitro (Kao et al., 2008). However, the roles of exogenous ligand
LPS in chronic liver diseases have been study for many years. TLR4
and its ligand LPS mediate their effects in liver fibrosis through
different mechanisms. In Kupffer cell, TLR4 activation produces
pro-inflammatory cytokines (for example, TNF-␣, IL-1␤ and IL-6)
and ROS, resulting in hepatocyte damage, leukocyte infiltration
and secretion of pro-fibrogenic cytokines. In HSCs, there are at
least two roles of TLR4 signaling. First, TLR4-stimulated HSCs
produce various chemokines and adhesion molecules (IL-6, IL-8,
MCP-1, MIP2, ICAM-1 and VCAM-1) to recruit Kupffer cells and/or
circulating macrophages by the site of HSCs (Brun et al., 2005; Paik
et al., 2003; Thirunavukkarasu et al., 2006). Second, the activation
of TLR4 signaling enhances TGF-␤ signaling in HSCs through
downregulating Bambi (Seki et al., 2007). Bambi is the TGF-␤1
pseudoreceptor which is downregulated by a TLR4-MyD88-NF-␬B
dependent pathway, thereby sensitizing HSCs to TGF-␤1 signaling
(Sekiya et al., 2004a, b). Regulation of Bambi by TLR4 signaling
provides a link between pro-inflammatory and profibrogenic
signals. In addition, liver endothelial cells (LECs) can also express
TLR4. TLR4 pathway in LECs regulates angiogenesis through its
MyD88 pathway and this process is linked to the development of
liver fibrosis (Jagavelu et al., 2010).
LPS-triggered activation of NF-␬B can induce the expression of
COX-2, iNOS, TNF-␣, IL-6 and IL-1␤ in Kupffer cell or activated HSC.
The protein expression of iNOS is upregulated in kinds of acute
and chronic inflammation and plays a role in the pathogenesis of
liver fibrosis (Aram et al., 2008; McKim et al., 2003; Sanz-Cameno
et al., 2002). Cyclooxygenase-2 (COX-2) is a crucial enzyme in the
biosynthesis of prostaglandins and is inducible by a variety of pro-
inflammatory stimuli, such as cytokines and lipopolysaccharide. In
the liver, COX-2 and prostaglandins production has been impli-
cated in inflammation, matrix remodeling, fibrosis progress and
development of hepatocellular carcinoma (Martinez et al., 2003).
Experimental evidence shows that selective pharmacologic inhibi-
tion of COX-2 could be useful to the treatment of liver fibrosis and
cancer (Breinig et al., 2007; Kim et al., 2008). TNF-␣, IL-6 and IL-
1␤, documented as “proinflammatory cytokines”, can induce liver
inflammation and promote fibrosis (Choi et al., 1994; Kayano and
Okita, 2000; Simeonova et al., 2001; Tiggelman et al., 1995).
It was shown that CCl4 administration elevated the mRNA lev-
els of TLR4 and MyD88, leading to activation of NF-␬B and thus
112 H. Shi et al. / Toxicology 303 (2013) 107–114

Fig. 3. Effect of CGA on the TLR4 signaling pathway. mRNA expression of TLR4(A), MyD88(A). iNOS(C), COX-2(C), Bambi(C), TNF-␣(E), IL-6(E) and IL-␤(E) were detected by
RT-PCR. Protein expression of TLR4(B), MyD88(B). iNOS(D), COX-2(D) and Bambi(D) were measured by Western blot. ␤-actin served as the internal control. TNF-␣(F), IL-6(F)
and IL-1␤(F) levels in serum were detected by ELISA. The average expression of TLR4, MyD88, iNOS, COX-2, TNF-␣, IL-6 and IL-␤ was significantly higher in the CCl4 -treated
group as compared to the control group and CGA co-treated group (P < 0.01). The mRNA and protein expression of Bambi was significantly lower in the CCl4 group as compared
to the control group (P < 0.01) and it was significantly higher in the CGA co-treated group as compared to the CCl4 -treated group (P < 0.01). TNF-␣, IL-6 and IL-1␤ levels in
serum of CCl4 rats were significantly higher than those in the control group and CGA co-treatment could attenuate these cytokine levels. * P < 0.01 as compared with the
control group; # P < 0.01 as compared with the CCl4 group.

increasing the expression of proinflammatory cytokines such as monocytes treated with LPS. In the present study, CGA administra-
iNOS, COX-2, TNF-␣, IL-6, and IL-1␤ in the liver of the experimental tion decreased the hepatic mRNA expression of proinflammatory
rats. CGA is known to inhibit the biosynthesis of proinflam- cytokines, including iNOS, COX-2, TNF-␣, IL-6 and IL-1␤, and their
matory cytokines such as TNF-␣ and interleukin-6 (IL-6) in human upstream signaling molecules, such as TLR4 and MyD88. Apart
 H. Shi et al. / Toxicology 303 (2013) 107–114
Fig. 4. Western blot analyses of NF-␬B activation. The NF-␬B protein in the nuclear and p-I␬B␣ protein were significantly higher in the CCl4 group as compared to the
control group and CGA co-treated group (P < 0.01). The level of I␬B␣ protein was significantly lower in the CCl4 group as compared to the control group (P < 0.01) and it was
significantly higher in the CGA co-treated group as compared to the CCl4 -treated group (P < 0.01). Lamin B and ␤-actin served as the internal control. * P < 0.01 as compared
with the control group; # P < 0.01 as compared with the CCl4 group.
from these, it was shown that CCl4 can reduce the expression of
Bambi, and the treatment of CGA can reverse the reduction. Based
on these results, we speculate that in CCl4 -treated rats, CGA can
attenuate hepatic fibrosis, probably through the suppression of the
TLR4-mediated proinflammatory signaling cascades.
In population studies, greater coffee intake has been associ-
ated with lower risk of cirrhosis. A prospective study conducted
by Klatsky et al. (1993) owed subjects who drank 4 or more cups
of coffee per day had about a five-fold lower risk of cirrhosis
than non-coffee drinkers. Another large prospective study of par-
ticipants with advanced hepatitis C-related liver disease showed
3 or more cups of coffee per day consumption was associated
with lower rate of disease progression (Freedman et al., 2009).
Meanwhile, Tverdal and Skurtveit (2003) provided that the risk
of death from hepatic cirrhosis was distinctively lower amongst
people drinking 3 or more cups of coffee per day, compared
with persons drinking less than 2 cups. One cup of instant cof-
fee (200 ml) contains 100–160 mg of CGA (Olthof et al., 2003)
and Coffee drinkers are said to ingest 500–1000 mg of CGA daily
(3–7 cups) (Olthof et al., 2001). In our study, the dose of CGA
(60 mg/kg) used for rats is equivalent to 576 mg of CGA and
3–4 cups of coffee for a 60-kg person, closing to daily intake of
coffee drinkers. Therefore coffee’s antifibrotic effect may be rel-
evant to CGA. Thus we proposed that a long-term consumption
of coffee or other vegetable which contains substantial amount
of CGA may prevent or retard the progression of liver fibro-
sis.
In conclusion, the current study demonstrates that admin-
istration of CGA can reduce liver inflammation and fibrosis.
The protective effect of CGA may be due to the inhibition of
TLR4/MyD88/NF-␬B signaling pathway. This finding provides a new
insight for understanding the anti-inflammatory effect of CGA. Our
observations suggest that anti-inflammatory action of CGA is one
of the possible mechanisms to improve liver fibrosis. Since TLR4
signaling pathway exists in HSC, Kupffer and endothelial cells,
which one of them is the target of CGA is not clear; in vitro study is
needed in the future.
Conflict of interest statement
The authors declare no conflict of interest.
113
Acknowledgments
This work was supported by National Natural Science Founda-
tion of China (Nos. 81200310 and 81070328). The authors thank
Hao Sun and Huaijie Wang for their language help and writing assis-
tance, and also thank Yaping Liu for her help in the experimental
research.
References
Aoyama, T., Paik, Y.H., Seki, E., 2010. Toll-like receptor signaling and liver fibrosis.
Gastroenterol. Res. Pract., Article ID:192543.
Aram, G., Potter, J.J., Liu, X.P., Torbenson, M.S., Mezey, E., 2008. Lack of inducible
nitric oxide synthase leads to increased hepatic apoptosis and decreased fibro-
sis in mice after chronic carbon tetrachloride administration. Hepatology 47,
2051–2058.
Bataller, R., Brenner, D.A., 2005. Liver fibrosis. J. Clin. Invest. 115, 209–218.
Breinig, M., Schirmacher, P., Kern, M.A., 2007. Cyclooxygenase-2 (COX-2) – a thera-
peutic target in liver cancer? Curr. Pharm. Des. 13, 3305–3315.
Brun, P., Castagliuolo, I., Pinzani, M., Palu, G., Martines, D., 2005. Exposure to bacterial
cell wall products triggers an inflammatory phenotype in hepatic stellate cells.
Am. J. Physiol. Gastrointestinal Liver Physiol. 289, G571–G578.
Choi, H.K., Pokharel, Y.R., Lim, S.C., Han, H.K., Ryu, C.S., Kim, S.K., Kwak, M.K., Kang,
K.W., 2009. Inhibition of liver fibrosis by solubilized coenzyme Q10: role of Nrf2
activation in inhibiting transforming growth factor-beta 1 expression. Toxicol.
Appl. Pharmacol. 240, 377–384.
Choi, I., Kang, H.S., Yang, Y., Pyun, K.H., 1994. IL-6 induces hepatic inflammation and
collagen-synthesis in-vivo. Clin. Exp. Immunol. 95, 530–535.
Choi, Y., Jeon, W.K., Hwang, S.J., Kim, B.I., Sohn, C.I., Park, D.I., Cho, Y.K., Kim, H.J.,
Park, J.H., 2011. The role of the gut barrier function in the pathophysiology of
viral liver cirrhosis. Hepato-Gastroenterol. 58, 1244–1247.
Feng, R.T., Lu, Y.J., Bowman, L.L., Qian, Y., Castranova, V., Ding, M., 2005. Inhibition of
activator protein-1, NF-kappa B, and MAPKs and induction of phase 2 detoxifying
enzyme activity by chlorogenic acid. J. Biol. Chem. 280, 27888–27895.
Freedman, N.D., Everhart, J.E., Lindsay, K.L., Ghany, M.G., Curto, T.M., Shiffman, M.L.,
Lee, W.M., Lok, A.S., Di Bisceglie, A.M., Bonkovsky, H.L., Hoefs, J.C., Dienstag, J.L.,
Morishima, C., Abnet, C.C., Sinha, R., Grp, H.-C.T., 2009. Coffee intake is associated
with lower rates of liver disease progression in chronic hepatitis C. Hepatology
50, 1360–1369.
Friedman, S.L., 2003. Liver fibrosis–from bench to bedside. J. Hepatol. 38, S38–S53.
Friedman, S.L., 2010. Evolving challenges in hepatic fibrosis. Nat. Rev. Gastroenterol.
& Hepatol. 7, 425–436.
Gressner, O.A., Lahme, B., Rehbein, K., Siluschek, M., Weiskirchen, R., Gressner, A.M.,
2008. Pharmacological application of caffeine inhibits TGF-beta-stimulated con-
nective tissue growth factor expression in hepatocytes via PPAR gamma and
SMAD2/3-dependent pathways. J. Hepatol. 49, 758–767.
Jagavelu, K., Routray, C., Shergill, U., O’Hara, S.P., Faubion, W., Shah, V.H., 2010.
Endothelial cell toll-like receptor 4 regulates fibrosis-associated angiogenesis
in the liver. Hepatology 52, 590–601.
Kao, Y.H., Jawan, B., Goto, S., Hung, C.T., Lin, Y.C., Nakano, T., Hsu, L.W., Lai, C.Y.,
Tai, M.H., Chen, C.L., 2008. High-mobility group box 1 protein activates hepatic
stellate cells in vitro. Transplant. Proc. 40, 2704–2705.
114 H. Shi et al. / Toxicology 303 (2013) 107–114
Kawada, N., 2011. Evolution of hepatic fibrosis research. Hepatol. Res. 41, 199–208.
Kayano, K., Okita, K., 2000. Does IL-6 regulate liver fibrosis/cirrhosis directly and
indirectly? J. Gastroenterol. 35, 250–251.
Kim, S.M., Park, K.C., Kim, H.G., Han, S.J., 2008. Effect of selective cyclooxygenase-2
inhibitor meloxicam on liver fibrosis in rats with ligated common bile ducts.
Hepatol. Res. 38, 800–809.
Klatsky, A.L., Armstrong, M.A., Friedman, G.D., 1993. Coffee, tea, and mortality. Ann.
Epidemiol. 3, 375–381.
Kono, Y., Kobayashi, K., Tagawa, S., Adachi, K., Ueda, A., Sawa, Y., Shibata, H., 1997.
Antioxidant activity of polyphenolics in diets - rate constants of reactions of
chlorogenic acid and caffeic acid with reactive species of oxygen and nitrogen.
BBA-Gen. Subjects 1335, 335–342.
Lee, K.J., Choi, J.H., Jeong, H.G., 2007. Hepatoprotective and antioxidant effects of the
coffee diterpenes kahweol and cafestol on carbon tetrachloride-induced liver
damage in mice. Food Chem. Toxicol. 45, 2118–2125.
Lin, R.S., Lee, F.Y., Lee, S.D., Tsai, Y.T., Lin, H.C., Lu, R.H., Hsu, W.C., Huang, C.C.,
Wang, S.S., Lo, K.J., 1995. Endotoxemia in patients with chronic liver-diseases-
relationship to severity of liver-diseases, presence of esophagel-varices, and
hyperdynamic circulation. J. Hepatol. 22, 165–172.
Lu, Y.C., Yeh, W.C., Ohashi, P.S., 2008. LPS/TLR4 signal transduction pathway.
Cytokine 42, 145–151.
Luckey, S.W., Petersen, D.R., 2001. Activation of Kupffer cells during the course of
carbon tetrachloride-induced liver injury and fibrosis in rats. Exp. Mol. Pathol.
71, 226–240.
Martinez, O.N., Ricote, G.C., Monzon, C.G., 2003. Role of cyclooxygenase-2 in the
pathogenesis of chronic liver diseases. Med. Clin. 121, 743–748.
McKim, S.E., Gabele, E., Isayama, F., Lambert, J.C., Tucker, L.M., Wheeler, M.D., Connor,
H.D., Mason, R.P., Doll, M.A., Hein, D.W., Arteel, G.E., 2003. Inducible nitric oxide
synthase is required in alcohol-induced liver injury: studies with knockout mice.
Gastroenterol. 125, 1834–1844.
O’Neill, L.A., 2003. Therapeutic targeting of toll-like receptors for inflammatory and
infectious diseases. Curr. Opin. Pharmacol. 3, 396–403.
Olthof, M.R., Hollman, P.C.H., Buijsman, M., van Amelsvoort, J.M.M., Katan, M.B.,
2003. Chlorogenic acid, quercetin-3-rutinoside and black tea phenols are exten-
sively metabolized in humans. J. Nutr. 133, 1806–1814.
Olthof, M.R., Hollman, P.C.H., Katan, M.B., 2001. Chlorogenic acid and caffeic acid are
absorbed in humans. J. Nutr. 131, 66–71.
Paik, Y.H., Schwabe, R.F., Bataller, R., Russo, M.P., Jobin, C., Brenner, D.A., 2003. Toll-
like receptor 4 mediates inflammatory signaling by bacterial lipopolysaccharide
in human hepatic stellate cells. Hepatol. 37, 1043–1055.
Parlesak, A., Schafer, C., Schutz, T., Bode, J.C., Bode, C., 2000. Increased intestinal per-
meability to macromolecules and endotoxemia in patients with chronic alcohol
abuse in different stages of alcohol-induced liver disease. J. Hepatol. 32, 742–747.
Pinzani, M., Macias-Barragan, J., 2010. Update on the pathophysiology of liver fibro-
sis. Expert Rev. Gastroenterol. Hepatol. 4, 459–472.
Ruhl, C.E., Everhart, J.E., 2005. Coffee and tea consumption are associated with a
lower incidence of chronic liver disease in the United States. Gastroenterol. 129,
1928–1936.
Ruwart, M.J., Wilkinson, K.F., Rush, B.D., Vidmar, T.J., Peters, K.M., Henley, K.S., Appel-
man, H.D., Kim, K.Y., Schuppan, D., Hahn, E.G., 1989. The integrated value of
serum procollagen-III peptide over time predicts hepatic hydroxyproline con-
tent and stainable collagen in a model of dietary cirrhosis in the rat. Hepatology
10, 801–806.
Sanz-Cameno, P., Medina, J., Garcia-Buey, L., Garcia-Sanchez, A., Borque, M.J.,
Martin-Vilchez, S., Gamallo, C., Jones, E.A., Moreno-Otero, R., 2002. Enhanced
intrahepatic inducible nitric oxide synthase expression and nitrotyrosine accu-
mulation in primary biliary cirrhosis and autoimmune hepatitis. J. Hepatol. 37,
723–729.
Seki, E., Brenner, D.A., 2008. Toll-like receptors and adaptor molecules in liver dis-
ease: update. Hepatol. 48, 322–335.
Seki, E., De Minicis, S., Osterreicher, C.H., Kluwe, J., Osawa, Y., Brenner, D.A., Schwabe,
R.F., 2007. TLR4 enhances TGF-beta signaling and hepatic fibrosis. Nat. Med. 13,
1324–1332.
Sekiya, T., Adachi, S., Kohu, K., Yamada, T., Higuchi, O., Furukawa, Y., Naka-
mura, Y., Nakamura, T., Tashiro, K., Kuhara, S., Ohwada, S., Akiyama, T.,
2004a. Identification of BMP and activin membrane-bound inhibitor (BAMBI),
an inhibitor of transforming growth factor-beta signaling, as a target of
the beta-catenin pathway in colorectal tumor cells. J. Biol. Chem. 279,
6840–6846.
Sekiya, T., Oda, T., Matsuura, K., Akiyama, T., 2004b. Transcriptional regulation of the
TGF-beta pseudoreceptor BAMBI by TGF-beta signaling. Biochem. Biophys. Res.
Commun. 320, 680–684.
Shan, J.H., Fu, J., Zhao, Z.H., Kong, X.Q., Huang, H., Luo, L., Yin, Z.M., 2009. Chloro-
genic acid inhibits lipopolysaccharide-induced cyclooxygenase-2 expression in
RAW264.7 cells through suppressing NF-kappa B and JNK/AP-1 activation. Int.
Immunopharmacol. 9, 1042–1048.
Shi, H.Y., Dong, L., Bai, Y.H., Zhao, J.H., Zhang, Y., Zhang, L., 2009. Chlorogenic acid
against carbon tetrachloride-induced liver fibrosis in rats. Eur. J. Pharmacol. 623,
119–124.
Shi, H.Y., Dong, L., Zhang, Y., Bai, Y.H., Zhao, J.H., Zhang, L., 2010. Protective effect
of a coffee preparation (Nescafe pure (R)) against carbon tetrachloride-induced
liver fibrosis in rats. Clin. Nutr. 29, 399–405.
Shin, J.W., Wang, J.H., Kang, J.K., Son, C.G., 2010. Experimental evidence for the pro-
tective effects of coffee against liver fibrosis in SD rats. J. Sci. Food Agric. 90,
450–455.
Simeonova, P.P., Gallucci, R.M., Hulderman, T., Wilson, R., Kommineni, C., Rao, M.,
Luster, M.I., 2001. The role of tumor necrosis factor-alpha in liver toxicity, inflam-
mation, and fibrosis induced by carbon tetrachloride. Toxicol. Appl. Pharmacol.
177, 112–120.
Thirunavukkarasu, C., Watkins, S.C., Gandhi, C.R., 2006. Mechanisms of endotoxin-
induced NO, IL-6, and TNF-alpha production in activated rat hepatic stellate
cells: Role of p38 MAPK. Hepatology 44, 389–398.
Tiggelman, A.M.B., Boers, W., Linthorst, C., Sala, M., Chamuleau, R.A.F., 1995.
Collagen-synthesis by human liver (myo)fibroblasts in culture-evidence for
a regulatory role of IL-1-beta, IL-4, TGF-beta and IFN-gamma. J. Hepatol. 23,
307–317.
Tverdal, A., Skurtveit, S., 2003. Coffee intake and mortality from liver cirrhosis. Ann.
Epidemiol. 13, 419–423.
Xu, Y.X., Chen, J.W., Yu, X.A., Tao, W.W., Jiang, F.R., Yin, Z.M., Liu, C., 2010. Protective
effects of chlorogenic acid on acute hepatotoxicity induced by lipopolysaccha-
ride in mice. Inflamm. Res. 59, 871–877.
Zhang, X., Huang, H., Yang, T.T., Ye, Y., Shan, J.H., Yin, Z.M., Luo, L., 2010. Chlorogenic
acid protects mice against lipopolysaccharide-induced acute lung injury. Injury-
Int. J. Care Injured 41, 746–752.
Zhu, J.K., Mohan, C., 2010. Toll-like receptor signaling pathways-therapeutic oppor-
tunities. Mediat. Inflamm., Article ID:781235.