Genomics Transgenics Molecular Breeding PDF

Global Science Books ®
Head Office and Editorial Office

Miki cho Post Office, Kagawa ken, Kita gun
Miki cho, Ikenobe 3011-2, P.O. Box 7
761-0799, Japan
GSB homepage: www.globalsciencebooks.info

Journals web-page: http://www.globalsciencebooks.info/Journals/GSBJournals.html
GGG web-page: http://www.globalsciencebooks.info/Journals/GGG.html
GSB Japan web-page: http://www17.plala.or.jp/gsbjapan
GSB™ is an acronym and trademark of Global Science Books
Genes, Genomes and Genomics ©2011 Global Science Books

GSB has ceased publication of its entire journal fleet as of mid-2013, but has turned all published content into open access
format. To maintain all GSB content open access, please make a donation at
http://www.globalsciencebooks.info/Journals/GSBJournals.html (press the DONATE button and pay with PayPal).
All content is the copyrighted material of Global Science Books (GSB). Published PDF files may be posted on any web-site,
including authors' personal web-sites, institutional web-sites, PDF repositories and profile-related web-sites (e.g., Research
Gate, LinkedIn, Academia.com, blogs, etc.) provided that a link to the original GSB site is created.
For additional copies, photocopies, bulk orders, or copyright permissions, please refer requests in writing to the above
address, or apply online.
Editors
Dr. Amjad Masood Husaini

Sher-e-Kashmir University of Agricultural Sciences & Technology of Kashmir, India
Dr. José A. Mercado

Departamento de Biología Vegetal, Universidad de Málaga, Spain
Cover photos/figures: Top left: The Chilean strawberry (Fragaria chiloensis spp. chiloensis) (Schmeda-Hirschmann et al.,
pp 85-90). Under top left: Tray plants: root system (left) and in the greenhouse (right) (Massetani et al., pp 12-23). Top
center plate: Developing salt tolerancein ‘Zolushka’ strawberry in vitro: aspects of callus induction, plant growth and field
acclimatization (Shokaeva et al., pp 115-125). Top right plate: Confocal microscopic examination of whole strawberry
flower and mature stamen (Hanhineva et al., pp 65-75). Under top right plate: Colletotrichum acutatum causing anthracnose
in strawberry fruit (Garrido et al., pp 24-39). Center plate: In vitro shoot regeneration in Fragaria × ananassa Duch, control
and transgenic (Husaini et al., pp 1-11). Plate, 2nd from bottom: Histochemical GUS staining of leaf, root, petiole and flower
tissue and of CaMV35S-gus transgenic strawberry fruits at different developmental stages (Schaart et al., pp 108-114).
Bottom plate: Transgenic Fragaria fruit containing dsRNA-producing transgenes such as FaCHS, FaOMT, FaGT1, FaDFR,
FaANS and Fra introduced by transient RNAi (Schwab et al., pp 91-101).
Disclaimers: All comments, conclusions, opinions, and recommendations are those of the author(s), and do not necessarily
reflect the views of the publisher, or the Editor(s). GSB does not specifically endorse any product mentioned in any
manuscript, and accepts product descriptions and details to be an integral part of the scientific content.
Printed in Japan on acid-free paper.

Published: November, 2011.
The Editors
Amjad Masood Husaini José A. Mercado
Dr. Amjad Masood Husaini, a young Scientist working as Assistant Professor in Sher-e-Kashmir University of
Agricultural Sciences & Technology of Kashmir (India) holds a Ph.D. in Biotechnology and PG Diploma in Bioinformatics
(Jamia Hamdard, New Delhi), besides certificates in Intellectual Property Rights (Indian Law Institute, New Delhi) and
Remote Sensing Applications in Agriculture (Indian Agricultural Research Institute-Indian Space Research Organization).
Recipient of Young Scientist Award-2009 in Agriculture (Jammu & Kashmir State Council for Science & Technology,
Government of J&K), Jawahar Lal Nehru Award for Agricultural Research-2008 (Indian Council of Agricultural Research,
Government of India), Junior Scientist of the Year Award-2007 (National Environmental Sciences Academy, New Delhi), he
is listed among Top 100 Scientists of 2010 by the International Biographical Centre (IBC, Cambridge), and his biography
included in 27th edition of Marquis Who’s Who in the World. With an illustrious academic career Dr. Husaini holds the
distinction of being top position holder in National Eligibility Tests for Life Sciences and Agricultural Biotechnology in
India. His publications include book entitled ‘Strawberry- Transgenics for stresses’ and more than two dozen research/
review papers in National and International journals of repute, discussing different aspects of agricultural research and
technology.
Dr. Husaini serves as member of professional associations like World Association of Young Scientists, New York
Academy of Sciences, The Indian Science Congress Association, Biotechnology Society of India, National Environmental
Science Academy (India), Young Professionals’ Platform for Agricultural Research for Development, Scientists Without
Borders, International Association of Computer Science and Information Technology, Royal Society of Crop Science,
International Society for Biosafety Research, and serves in the capacity of editor/ associate editor etc. in editorial boards of
various International journals of repute.
Dr. José A. Mercado is an Associate Professor of Plant Physiology at the University of Málaga, Spain. He was graduated in
Biological Science in 1990, and received his PhD in Biology in 1994, at the University of Malaga. During his PhD, he
conducted research on the effect of chilling injury in sweet pepper plants, focusing on those aspects related to pollen fertility,
fruit quality and postharvest shelf life. In 1995, he joined the IFAPA (Instituto de Formación Agraria y Pesquera, Junta de
Andalucía, Spain) as a postdoctoral researcher, and initiated his studies in strawberry biotechnology. During this stage, Dr.
Mercado developed protocols for the Agrobacterium mediated transformation of wild and cultivated strawberry. In 1997, he
obtained a position as Assistant Professor at the Plant Biology Department from the University of Málaga. Since that year,
Dr. Mercado teaches undergraduate and graduate courses on plant physiology and plant genetic transformation. Dr.
Mercado’s current research interest is focused on the biotechnological improvement of strawberry shelf life by the
transgenic manipulation of genes encoding cell wall proteins related with fruit softening. He also works on the development
of genetic transformation protocols for other recalcitrant crops, such as olive and avocado.
Genomics, Transgenics, Molecular Breeding and Biotechnology of Strawberry. Husaini AM and Mercado JA (Eds) Global Science Books, UK
Foreword
Amjad Masood Husaini*, José A. Mercado**
*Division of Plant Breeding and Genetics, Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir,
Srinagar, Jammu & Kashmir-191121, India
**Instituto de Hortofruticultura Subtropical y Mediterránea “La Mayora”, (IHSM-UMA-CSIC),
Departamento de Biología Vegetal, Universidad de Málaga, 29071, Málaga, Spain
E-mails: * dr.amjadhusaini@hotmail.com ** mercado@uma.es
Strawberry is one of the most popular fruits due to its delicious flavor and attractive aspect, and the demand for
strawberries, as well as its culture, is continuously increasing worldwide. This crop, however, is not absent of problems that
compromise yield or fruit quality. Actually, strawberry is considered by the consumers as one of the most inconsistent
commodities in the marketplace. The use of highly producer cultivars with large but poorly flavored fruits, incorrect crop
management practices such as harvesting the fruits before full ripening, the short postharvest life of strawberry fruits or the
extensive use of dangerous fumigants to control pest are among the main problems of this crop. Nowadays, people demand
plant biology researchers to focus more efforts on safer and sustainable agriculture, avoiding as much as possible the use of
chemicals, and to improve fruit quality traits. The implementation of biotechnological approaches within traditional
breeding programs can be helpful to reach this goal. Besides this practical view, strawberry has been adopted as a model
crop for some molecular and physiological studies, such as the ripening of non climacteric fruits, increasing their
importance in the scientific world. The aim of this volume is to provide updated information about the current stage of
genomics, transgenesis and biotechnology in strawberry, through the inclusion of reviews and research papers wrote by
leader groups in these areas.
Molecular markers have been explored in strawberry from the 80´s but in recent years the development of high
throughput sequencing technologies has increased dramatically the amount of genomic data in this species. These advances
in structural genomics in the genus Fragaria have been reviewed by Bonet and Monfort, and the release of the first draft of
the strawberry genome is expected very soon. Most strawberry cultivars show seasonal flowering, requiring short
photoperiod and/or low temperature for the induction of flowering, while the opposite environmental signals are needed for
runnering. Hytönen and Elomaa have reviewed our current knowledge about candidate genes involved in flowering
induction. This review is complemented by the paper of Massetani et al. who examine the effect of abiotic stresses,
nutritional factors and propagation techniques on strawberry plant architecture. These studies can provide efficient tools to
extend cropping season and increase berry yields.
Besides attractive flavor, strawberries are a rich source of phytochemicals beneficial for human health. Hanhieneva et al.
and Schmeda et al. have reviewed recent advances in metabolomics of both, cultivated strawberry and the Chilean
strawberry Fragaria chiloensis, respectively. While both papers highlight the chemical composition of fruits, data about
metabolomics of vegetative organs are also included. Increasing postharvest shelf life of strawberry fruit is central to
strawberry research, which is very short mainly due to its fast softening rate and enhanced pathogen susceptibility usually
associated with this process. Cell wall disassembly and loss of cell turgor during fruit ripening are considered the main
factors responsible for fruit softening. Posé et al. have reviewed the main features of the disassembly cell wall process, and
how the manipulation of some cell wall genes through transgenesis can reduce fruit softening without affecting other fruit
quality parameters, while Alleva et al. examine the role of the water channel aquaporins in the loss of cell turgor during fruit
ripening. For a limited number of genes, their role on fruit ripening has been assessed by stable genetic transformation.
However, the increased knowledge of genes involved in fruit ripening requires efficient and fast systems for gene function
analysis. Schawb et al. show how gene down-regulation by RNA interference in agroinfiltration experiments has been
successfully used to assess the role of several fruit specific genes, avoiding time-consuming and labor-intensive stable
transformation systems. Genetic modification could be a successful approach in improving quality of strawberry crop, as
has been demonstrated with several fruit ripening genes. The application of this technology requires robust regeneration and
transformation systems for each particular genotype. Currently, Agrobacterium tumefaciens infection in combination with a
leaf disk regeneration system is the most popular method to get transgenic strawberry plants. Husaini et al. analyze key
factors determining the success of genetic transformation in this species, and describe a general transformation protocol that
has been proven useful in several strawberry cultivars. However, the toughest impediment in the development of this
technology is the poor consumer perception of transgenic crops. These concerns are examined by Schaart et al. They
describe the results of a recent consumer survey indicating that transgenic crops would be better accepted if only genes from
the species itself, the so called intragenic or cisgenic plants, were used. This review also describes the attempts to get
intragenic strawberry plants resistant to Botrytis cinerea. Intragenic modification requires the use of native promoters to
drive gene expression. In their research article Schaart et al. describe the characterization of a promoter sequence of the
strawberry fruit expansin FaExp2 gene.
One of the main problems of the strawberry industry is the high amount of pesticides required to avoid loss of
production, mainly due to fungal infections. Natural resistance against important diseases is scarce within the genus
Fragaria, and therefore, alternative approaches to get tolerant cultivars are quite desirable. Garrido et al. summarize recent
advances in the methods for detection and identification of strawberry fungal pathogens as well as strategies for their
biocontrol using microorganisms. In a research paper, Matsubara et al. show that arbuscular mycorrhizal colonization
enhances tolerance to Fusarium wilt and this effect is related to an increased level of antioxidative ability. Finally, Shokaeva
et al. describe a method for the obtainment of plants tolerant to Botrytis cinerea or Phytophtora cactorum, and also to
salinity stress, through screening and selection of somaclonal variants developed after exposure to these stressors under in
vitro conditions.
As many people that enjoy consuming strawberries, for us too it has been a pleasure to work in the preparation of this
project. We hope that readers of this special issue, biotechnologists, physiologists, breeders or simply strawberry lovers,
enjoy the reviews and find them useful. We are thankful to our families for having adjusted with us, while we were busy for
long hours during the preparation of this volume. We finally thank all authors for their excellent contributions, and also for
their patience during the long time required to complete this hybrid book, and to the GSB Editor-in-Chief Dr. Jaime
Teixeira da Silva for his generous support.
November, 2011
Preface
Dr. Daniel James Sargent
Senior researcher in Fragaria molecular genetics and genomics
East Malling Research, East Malling, United Kingdom
IASMA Research and Innovation Centre, San Michele all’Adige, Italy
Strawberries are cultivated for their swollen fleshy receptacles known as berries, which are sweet, juicy and aromatic,
and are enjoyed by millions of people throughout the world. Strawberries have been prized by man for millennia and indeed
the wild strawberry (Fragaria vesca) was mentioned in the verses of Virgil and Ovid in the writings of Pliny. By the 1300s,
strawberries were widely cultivated in the gardens of Europe, including those of Royal gardens of the Louvre in Paris, and
have thus graced the tables of European Kings and Queens for centuries. After the discovery of the Americas in the 15th
century by European explorers, the large-fruited strawberry species made their way to Europe by way of a French spy sent
to Chile on a mission for King Louis XIV. Chance hybridizations between two new world strawberry species F. chiloensis
and F. virginiana led to the production of the cultivated strawberry, F. ×ananassa, which is so prized for it’s berries today.
Nowadays, strawberries are cultivated throughout the world, from China, to Europe, the Americas and as far south as
Australasia, and with their cultivation, the demand for sustainable high-yielding, large-fruited varieties, with juicy, sweet
and flavorsome berries, and with resistance to pests and diseases has developed. Thus today, breeding programs for the
genetic improvement of the cultivated strawberry exist and thrive in all regions of the world where strawberries are
cultivated. To support such endeavors, a wealth of cutting edge scientific research is being carried out, which is developing
our understanding of these highly prized species and will allow sustainable production to continue into the 21st century and
beyond. In this special edition of Genes, Genomes and Genomics entitled ‘Genomics, transgenics, molecular breeding and
biotechnology of strawberry’, leading researchers in the field have contributed a selection of reviews and original research
articles on a diverse range of topics, all of which are contributing to the continued sustainable production of the cultivated
strawberry. The special edition highlights the broad range of excellent research currently being conducted, including the
development of structural genomics resources, functional genomics, the identification of promotors specific to fruit and
genes involved in fruit softening, to the chemistry of the strawberry and metabolomics. It also covers a review of plant
architecture in relation to abiotic stresses, and a review of disease resistance, in particular to a number of economically-
important fungal pathogens, including Botrytis and Phytopthora. Finally, the special edition covers the controversial topic of
genetic modification, and in particular novel routes that are being explored to produce GM strawberries that are acceptable
to consumers. This special edition encapsulates the exciting, cutting-edge research that is currently being conducted in the
field of strawberry biotechnology and it is my pleasure to introduce this exceptional collection of review articles and reports
of original research.
November, 2011
Preface
Prof. Narendra Tuteja
Senior Scientist, International Centre for Genetic Engineering & Biotechnology

Aruna Asaf Ali Marg, New Delhi – 110 067, India
Strawberry (Fragaria sp.) is a delicious, refreshing and the most popular type of berry fruit in the world characterized
by its sweet-sour taste, pleasant flavor, intense colour and soft texture. Fragaria is a genus of flowering plants in the rose
family, Rosaceae. It is basically a commercial fruit of temperate regions, and with the advent of day neutral varieties its
cultivation has spread in tropical and sub-tropical regions across the world. Strawberries are famous in the phytonutrient
world as a rich source of phenols. Strawberries are also an excellent source of vitamin C, manganese, dietary fiber, iodine,
potassium, folate, vitamin B2, vitamin B5, vitamin B6, omega-3 fatty acids, magnesium, copper, and vitamin K. However,
there are certain peculiar problems associated with this alluring fruit. One is the problem of short shelf-life and delicate
nature, second is its susceptibility to rot, and third is sensitivity to salinity stress. Due to the genetic limitations associated
with high heterozygosity and polyploidy, improvement in these traits can be brought about by supplementing traditional
breeding-methods with modern techniques and direct gene manipulations. The publication of a Special Issue on Genomics,
Transgenics, Molecular Breeding and Biotechnology of Strawberry in ‘Genes Genomes and Genomics’ by Global Science
Books is a welcome step, that has certainly made an attempt in addressing these bottlenecks through the use of modern
biotechnological approaches. I wish to congratulate the editors Dr. Amjad Masood Husaini (Sher-e-Kashmir University of
Agricultural Sciences & Technology of Kashmir, India), Professor José A. Mercado (Universidad de Málaga, Spain) and all
other distinguished fellow Scientists from research institutions across the globe for their contributions toward the
publication of this valuable issue. Overall, the editors have done admirable job to assemble a number of experts that share
their knowledge in a very complementary way. I am sure that this issue would be a handy resource for strawberry researcher
community worldwide.
November, 2011
CONTENTS
Amjad Masood Husaini (India), José A. Mercado (Spain), Jaime A. Teixeira da Silva (Japan), Jan G. Schaart (The
Netherlands) Review of Factors Affecting Organogenesis, Somatic Embryogenesis and Agrobacterium tumefaciens-Mediated
Transformation of Strawberry 1
Francesca Massetani, Ramesh Gangatharan, Davide Neri (Italy) Plant Architecture of Strawberry in Relation to Abiotic
Stress, Nutrient Application and Type of Propagation System 12
Carlos Garrido, María Carbú, Francisco Javier Fernández-Acero, Victoria E. González-Rodríguez, Jesús M. Cantoral
(Spain) New Insights in the Study of Strawberry Fungal Pathogens 24
Sara Posé, Juan A. García-Gago, Nieves Santiago-Doménech, F. Pliego-Alfaro, Miguel A. Quesada, José A. Mercado
(Spain) Strawberry Fruit Softening: Role of Cell Wall Disassembly and its Manipulation in Transgenic Plants 40
Karina Alleva, Mercedes Marquez, Jorge Bellati, Natalia Villarreal, Claudia Bustamante, Gustavo Martínez, Marcos
Civello, Gabriela Amodeo (Argentina) Could an Understanding of the Strawberry Softening Process Benefit from
Aquaporins? 49
Timo Hytönen, Paula Elomaa (Finland) Genetic and Environmental Regulation of Flowering and Runnering in Strawberry 56
Kati Hanhineva, Sirpa O. Kärenlampi (Finland), Asaph Aharoni (Israel) Recent Advances in Strawberry Metabolomics 65
Julio Bonet, Amparo Monfort (Spain) Structural Genomic Resources in Fragaria Genus 76
Guillermo Schmeda-Hirschmann, Mario Simirgiotis (Chile), José Cheel (Czech Republic) Chemistry of the Chilean
Strawberry (Fragaria chiloensis spp. chiloensis) 85
Wilfried Schwab, Thomas Hoffmann, Gregor Kalinowski, Anja Preuß (Germany) Functional Genomics in Strawberry Fruit
through RNAi-mediated Silencing 91
Jan G. Schaart (The Netherlands), Trygve D. Kjellsen, Lisbeth Mehli, Reidun Heggem, Tor-Henning Iversen (Norway),
Henk J. Schouten, Frans A. Krens (The Netherlands) Towards the Production of Genetically Modified Strawberries which
are Acceptable to Consumers 102
Jan G. Schaart, Elma M. J. Salentijn, Koen T. B. Pelgrom, Asaph Aharoni, Frans A. Krens (The Netherlands) Isolation
and Characterisation of a Strawberry Fruit-Specific Promoter 108
Dina B. Shokaeva, Natalya V. Solovykh, Dmitry N. Skovorodnikov (Russia) In Vitro Selection and Strawberry Plant
Regeneration for Developing Resistance to Botrytis cinerea Pers., Phytophthora cactorum Leb. et Cohn (Schroet) and Salinity
Stress 115
Yoh-ichi Matsubara (Japan) Tolerance to Fusarium Wilt and Changes in Antioxidative Ability and Free Amino Acid Content
in Mycorrhizal Strawberry Plants 126
How to reference: Author name(s) (2011) Title of chapter. In: Husaini AM & Mercado JA (Eds). Genomics, Transgenics, Molecular Breeding and Biotechnology of Strawberry. Global Science Books, UK, pp. X-XX ®
Review of Factors Affecting Organogenesis,

Somatic Embryogenesis and Agrobacterium tumefaciens-
Mediated Transformation of Strawberry
Amjad Masood Husaini1* • José A. Mercado2 • Jaime A. Teixeira da Silva3 • Jan G. Schaart4
1 Division of Plant Breeding and Genetics, Sher-e-Kashmir University of Agricultural Sciences and Technology of Kashmir, Srinagar, Jammu & Kashmir-191121, India
2 Instituto de Hortofruticultura Subtropical y Mediterránea “La Mayora”, (IHSM-UMA-CSIC), Departamento de Biología Vegetal, Universidad de Málaga, 29071,
Málaga, Spain
3 Department of Horticultural Science, Faculty of Agriculture and Graduate School of Agriculture, Kagawa University, Miki-cho, Ikenobe 2393, Kagawa-ken, 761-0795, Japan
4 Wageningen UR Plant Breeding, Wageningen University and Research Centre, P.O. Box 16, 6700 AA, Wageningen, The Netherlands
Corresponding author: * amjadhusaini@yahoo.com, dr.amjadhusaini@hotmail.com
ABSTRACT
Standardization of an efficient regeneration system for each strawberry genotype is generally an indispensible pre-requisite for the
successful development of transgenic plants. In this paper, we review some key factors affecting the regeneration of strawberry plants via
adventitious organogenesis or somatic embryogenesis, such as type of explant, growth regulators or dark/light treatments. Since Agrobac-
terium tumefaciens-mediated transformation is the method of choice for strawberry transformation, we review the strategies adopted by
different scientists to achieve higher transformation efficiencies and recovery of marker-free transgenic plants. Sufficient Agrobacterium
cells during cocultivation, an adequate cocultivation period, the use of vir gene inducers like acetosyringone, introduction of a pre-
selection phase between co-cultivation and selection, and optimum selection pressure, are all important factors to obtain stable transfor-
mants. For effective transformation, the antibiotic regime should control bacterial growth without inhibiting the regeneration of plant cells.
A general protocol for the Agrobacterium transformation of strawberry leaf discs is also described. Finally, we discuss the metrics
employed by different researchers for measuring the success of transformation, and highlight the difference between transformation
efficiency and transformation percentage.
_____________________________________________________________________________________________________________
Keywords: cocultivation, Fragaria sp., genetic transformation, in vitro, nptII gene, regeneration
Abbreviations: 2,4-D, 2,4-dichlorophenoxyacetic acid; BA, N6-benzyladenine; IAA, indole-3-acetic acid; IBA, indole-3-butyric acid;
Kan, Kanamycin; MS, Murashige and Skoog medium; NAA, -naphthalene acetic acid; PGR, plant growth regulator; TDZ, thidiazuron
CONTENTS
INTRODUCTION.......................................................................................................................................................................................... 1
MICROPROPAGATION AND IN VITRO REGENERATION ...................................................................................................................... 2
Strawberry micropropagation .................................................................................................................................................................... 2
Factors affecting organogenesis in strawberry........................................................................................................................................... 2
Factors affecting somatic embryogenesis in strawberry ............................................................................................................................ 3
FACTORS AFFECTING TRANSFORMATION AND REGENERATION OF TRANSGENIC PLANTS .................................................. 4
Robust regeneration system and efficient Agrobacterium strain................................................................................................................ 4
Antibiotics, regeneration and selection...................................................................................................................................................... 4
Pre-culture (pre-incubation)....................................................................................................................................................................... 5
Co-cultivation and vir inducer treatments.................................................................................................................................................. 5
Pre-selection .............................................................................................................................................................................................. 5
A protocol for strawberry transformation .................................................................................................................................................. 6
Production of marker-free genetically modified strawberry plants............................................................................................................ 6
ESTIMATING TRANSFORMATION SUCCESS......................................................................................................................................... 7
FUTURE PERSPECTIVES ........................................................................................................................................................................... 8
ACKNOWLEDGEMENTS ........................................................................................................................................................................... 9
REFERENCES............................................................................................................................................................................................... 9
_____________________________________________________________________________________________________________
INTRODUCTION breeding programs have been very active in the last few
decades. Faedi et al. (2002) reported that 463 new cultivars
Cultivated strawberry (Fragaria × ananassa Duch.) is an were commercially established from 79 public agencies and
economically important berry crop with immense demand 32 private companies during the 1980s and 90s. Nowadays,
for fresh as well as fruit processing industry, while its wild most strawberry-producing countries have their own breed-
relative, woodland strawberry (Fragaria vesca L.) is of sci- ing programs, both public and private, devoted mainly to
entific importance due to its small genome size, and gen- develop new cultivars adapted to local conditions. However,
ome sequencing project (Shulaev et al. 2008). Strawberry F. × ananassa has a complicated octoploid (2n=8x=56)
Received: 20 April, 2010. Accepted: 6 May, 2011.

Genomics, Transgenics, Molecular Breeding and Biotechnology of Strawberry. Husaini AM and Mercado JA (Eds) Global Science Books, UK Invited Review
Genes, Genomes and Genomics 5 (Special Issue 1), 1-11 ©2011 Global Science Books
How to reference: Author name(s) (2011) Title of chapter. In: Husaini AM & Mercado JA (Eds). Genomics, Transgenics, Molecular Breeding and Biotechnology of Strawberry. Global Science Books, UK, pp. X-XX
genome, and due to genetic limitations associated with high same culture medium (Debnath 2006; Husaini et al. 2008).
heterozygosity and polyploidy, it has a limited potential for The use of microcuttings developing both roots and shoots
improvement using traditional breeding methods. The in a medium containing cytokinin is a better choice than
application of plant tissue culture and genetic engineering multiple shoot proliferation with subsequent rooting of
therefore, holds special significance for strawberry im- shootlets. In ‘Chandler’, after induction of somatic embryos
provement (Husaini and Srivastava 2006a). Octoploid straw- on a medium containing thidiazuron (TDZ), embryos suc-
berry accessions are extremely variable from genotype to cessfully germinate and develop small shoots and roots on a
genotype, and variation in transformation and regeneration medium containing kinetin (Husaini et al. 2008).
ability is as wide as their agro-morphological characters
(Folta and Dhingra 2006). The response to factors affecting Factors affecting organogenesis in strawberry
genotype-specific regeneration makes standardiza-tion of an
efficient regeneration system for each strawberry genotype Regeneration via shoot organogenesis has been described in
an indispensible prerequisite for the successful development different strawberry cultivars and many scientists have in-
of transgenic plants using Agrobacterium-mediated trans- vestigated various factors influencing organogenesis (Deb-
formation (Husaini et al. 2008). nath and Teixeira da Silva 2007). These studies have de-
In this review, we have compared the published lite- monstrated the importance of factors including plant growth
rature according to the main variables in the regeneration regulator (PGR) balance, culture conditions, genotype and
and transformation processes. First, we highlight the factors explant type on successful plant regeneration (Liu and
for efficient regeneration of complete plantlets under in Sanford 1988; Nehra et al. 1989, 1990c; Sorvari et al. 1993;
vitro conditions. Second, we highlight the factors influen- Flores et al. 1998; Schaart et al. 2002; Passey et al. 2003;
cing Agrobacterium-mediated transformation and recovery Zhao et al. 2004; Qin et al. 2005a, 2005b; Husaini and
of transgenic strawberry plants, describing a transformation Abdin 2007; Husaini et al. 2008). The major factors that in-
protocol developed for leaf discs of ‘Chandler’ that has fluence organogenesis are discussed in the sections that
been successfully used in other genotypes of commercial follow.
importance. Next, we discuss the approaches used and
progress made in the development of marker-free genetic- 1. Explant
ally modified strawberry plants. Finally, we discuss the
metrics employed by different researchers for measuring the There are a large number of reports on strawberry shoot
success of transformation and highlight the differences organogenesis using a broad range of explants, e.g. leaf
between them. disks (Jones et al. 1988; Liu and Sanford 1988; Nehra et al.
1989, 1990c; Sorvari et al. 1993; Flores et al. 1998; Passey
MICROPROPAGATION AND IN VITRO et al. 2003; Qin et al. 2005; Debnath 2006; Husaini and
REGENERATION Srivastava 2006b; Husaini and Abdin 2007), petioles (Fou-
cault and Letouze 1987; Isac et al. 1993; Damiano et al.
Plant tissue culture and regeneration in vitro is a complex 1997; Popescu et al. 1997; Infante et al. 1998; Passey et al.
phenomenon, influenced by a number of genetic and envi- 2003; Debnath 2006), stems (Graham et al. 1995), pedun-
ronmental factors. Each species has its own specific re- cles (Foucault and Letouze 1987; Lis 1993), stolons (Lis
quirements for in vitro regeneration, and for some recal- 1993), stipules (Rugini and Orlando 1992; Passey et al.
citrant genotypes this step is the main bottleneck for their 2003), runners (Liu and Sanford 1988), roots (Rugini and
genetic improvement by genetic transformation. Fortunately, Orlando 1992; Passey et al. 2003), anthers (Owen and Mil-
strawberry can be easily managed under in vitro conditions ler 1996), embryos (Wang et al. 1984), sepals (Debnath
and efficient protocols for micropropagation and in vitro 2005), and protoplasts (Nyman and Wallin 1988). Most of
regeneration via adventitious organogenesis or somatic em- the work in strawberry regeneration, however, has been
bryogenesis have been developed for many cultivars. The achieved using leaf discs and petioles as explants. Leaf tis-
main factors affecting strawberry tissue culture will be dis- sue has the greatest regeneration capacity of all strawberry
cussed in the following sections. plant tissue (Jones et al. 1988; Liu and Sanford 1988; Nehra
et al. 1989, 1990c; Jelenkovic et al. 1990; Popescu et al.
Strawberry micropropagation 1997; Passey et al. 2003), and shoot regeneration rates
using this explant are generally high, although very geno-
Micropropagation of strawberry plants was introduced type dependent. Fig. 1 shows the adventitious regeneration
about three and half decades ago (Boxus 1974), and it is process in a leaf disk. Callus production is also more pro-
widely used in the USA in commercial propagation of lific from leaf tissue on Murashige and Skoog (1962) (MS)
strawberries, as well as in breeding programs (Zimmerman medium containing 6-benzyladenine (BA) and indole-3-
1981). This technique has been adopted by most European butyric acid (IBA) (Husaini and Srivastava 2006b). Passey
nurseries producing millions of disease-free plants per year et al. (2003) studied adventitious regeneration on seven
(Mohan et al. 2005). commercial cultivars of strawberry using leaf disks, petioles,
The clonal propagation of strawberry provides added roots, and stipules as explant material. Leaf disks had the
advantage for the stable transfer of a single dominant gene highest regeneration rates for all cultivars with greater than
for a desired trait into commercially important genotypes 90% of explants producing shoots. Therefore, the leaf disk
without sexual recombination (Husaini and Abdin 2007). has been the explant of choice in strawberry transformation
Successful shoot proliferation has been obtained in straw- studies.
berry from single meristems (Boxus 1974), meristem callus A few studies have evaluated the influence of explant
(Nishi and Oosawa 1973) and from node culture (Bhatt and type on transformation efficiencies. James et al. (1990a)
Dhar 2000). However, the explant chosen for strawberry found that petioles of ‘Rapella’ were transformed more
micropropagation has been the meristem from runner tips efficiently than leaf discs. By contrast, this last explant gave
(Sowik et al. 2001). Meristems are cultured on a medium better results than stipules in F. vesca (Alsheikh et al. 2002).
containing a high cytokinin concentration, with no or low Using a different approach, Mathews et al. (1995, 1998)
levels of auxin. This medium promotes axillary budding as observed higher transformation rates when using meriste-
the use of cytokinins overcomes apical dominance and en- matic sections obtained from the base of in vitro prolifer-
hances the branching of lateral buds from the leaf axis ating plantlets. However, a high percentage of regenerated
(Debnath 2003; Haddadi et al. 2010). plants were chimeras.
Amongst a vast number of protocols developed for in
vitro regeneration of strawberry, recently developed proto-
cols enable strawberry micropropagation in a single step
where shoot multiplication and rooting takes place in the
2
Regeneration and transformation of strawberry. Husaini et al.
A B C
D E
Fig. 1 Direct shoot regeneration in Fragaria × ananassa Duch. (A) Shoot bud initiation. (B, C, D) Differentiation of shoot bud. (E) Multiple shoot
formation.
2. Plant growth regulators 16-h photoperiod was the optimum for shoot organogenesis
(Husaini and Abdin 2007).
The kind of PGR and the amount used for strawberry re- Regarding light intensity, Barceló et al. (1998) and
generation has been highly variable. In general, a combi- Husaini and Abdin (2007) found that 40-48 mol m2 s1
nation of auxin and cytokinin is necessary for successful was optimal for regeneration of ‘Chandler’ leaf explants.
regeneration. Indole-3-acetic acid (IAA) and BA were suc- However, a study by Nehra et al. (1990c) in which identical
cessfully used by Nehra et al. (1989) in ‘Redcoat’ and by sets of cultures of ‘Redcoat’ were incubated at 12.5 and
Singh and Pandey (2004) in ‘Sweet Charli’ and ‘Pajaro’ cul- 65.5 mol m2 s1 revealed that calli from in vitro leaves did
tivars, while IBA and BA gave promising results in ‘Hiku’, not form shoots under high light intensity on any of the cul-
‘Jonsok’ (Sorvari et al. 1993) and ‘Chandler’ (Barceló et al. ture media, but at low light intensity some calli developed
1998; Husaini and Srivastava 2006b). Finstad and Martin into shoots.
(1995) regenerated plants by using 2,4-dichlorophenoxy-
acetic acid (2,4-D) and BA in ‘Totem’ and ‘Hood’, while Factors affecting somatic embryogenesis in
Qin et al. (2005a, 2005b) used TDZ and IBA in ‘Toyonoka’. strawberry
In recent years, there has been an increased interest in
the use of the cytokinin TDZ in strawberry regeneration. In the plant body, all cells have specific functions to play
Many studies have revealed that TDZ is very effective pro- and cells dedifferentiate prior to becoming competent to
moting shoot regeneration in strawberry leaf disks (Nyman respond to the new signals. In vitro plant organization in-
and Wallin 1992; Sutter et al. 1997; Hammoudeh et al. volves a two-step process where first, a cell or a tissue
1998; Flores et al. 1998; Schaart et al. 2002; Passey et al. acquires developmental competency (totipotency) and sub-
2003; Zhao et al. 2004; Qin et al. 2005a, 2005b; Landi and sequently is determined for one structure or another by
Mezzetti 2006; Husaini and Abdin 2007), sepals and peti- environmental factors (Decout et al. 1994). Somatic em-
oles (Debnath 2008, 2009). The variability in the regenera- bryogenesis is a process by which the somatic cells undergo
tion percentages obtained in these reports is due to the use a developmental process similar to the development of
of different concentrations of TDZ and different strawberry zygotic embryos (Williams and Maheshwaran 1986) and it
cultivars, indicating that each genotype has specific require- is considered as an extreme response of somatic plant cells
ments that are vital for regeneration.
3. Light/dark period
A B
The problem of darkening of culture medium of in vitro cul-
tured strawberry explants is well-known and it is attributed
to phenolic compounds exuding from these tissues. This
process is initiated by browning of the surface of plant tis-
sues due to the oxidation of phenolic compounds resulting
in the formation of quinines which are highly reactive and
toxic to plant tissue (Taji and Williams 1996). Dark incuba-
tion reduces tissue browning by arresting the enzymatic
activity responsible for tissue oxidation (George 1993; C D
Titov et al. 2006). In strawberry, incubation of leaf explants
in the dark decreases browning of the culture medium
(Nehra et al. 1989; Rugini and Orlando 1992; Blando et al.
1993; Popescu et al. 1997; Barceló et al. 1998; Husaini and
Abdin 2007). Besides this, it seems that a dark treatment for
several weeks (Liu and Sanford 1988; Barceló et al. 1998;
Husaini and Abdin 2007) or even continuous darkness incu-
bation (Landi and Mezzetti 2006), depending on the cultivar,
enhances organogenesis in strawberry leaf explants. In Fig. 2 Direct somatic embryogenesis in Fragaria × ananassa Duch. (A)
‘Chandler’, a comparison of photoperiods (24-, 16-, 12-h) Globular embryos on leaf epidermis. (B) Heart-shaped embryo. (C) Ad-
used for incubation of strawberry leaf disks revealed that a vanced cotyledonary embryos. (D) Embryos germinating.
3
towards specific stress conditions. Only a few studies have number of somatic embryos per explant. Chilling treatment
so far focused on somatic embryogenesis in strawberry, might have some effect on the microtubule network of the
primarily showcasing the importance of PGRs and growth cytoskeleton in strawberry as has been reported in chicory,
media (Wang et al. 1984; Lis 1987; Donnoli et al. 2001; where it was postulated that low temperature might induce a
Biswas et al. 2007; Husaini and Abdin 2007; Husaini et al. different behaviour of the cytoskeleton leading to different
2008; Kordestani and Karami 2008; reviewed by Debnath morphogenesis (Decout et al. 1994).
and Teixeira da Silva 2007). The next sections review the
main factors influencing somatic embryogenesis in straw- FACTORS AFFECTING TRANSFORMATION AND
berry; this process is illustrated in Fig. 2. REGENERATION OF TRANSGENIC PLANTS
1. Plant growth regulators and culture media During the last two decades a number of studies with the
objective of standardizing transformation protocols for
Several culture media and PGR combinations have been different strawberry cultivars were undertaken (reviewed in
used to achieve somatic embryogenesis in strawberry. Ac- Folta and Dhingra 2006; Husaini and Srivastava 2006a;
cording to Wang et al. (1984) the most effective medium for Mercado et al. 2005, 2007a; Quesada et al. 2007; Qin et al.
inducing strawberry somatic embryos contained 2,4-D 2008). Most of these studies used Agrobacterium tumefa-
(22.62 μM), BA (2.22 μM) and casein hydrolysate (500 mg ciens infection as the system for gene delivery. It is well-
l–1), while Lis (1987) reported the formation of adventitious known that a rigorous transformation process can reduce
buds and somatic embryos using the medium of Lee and de the regeneration capacity of a strawberry tissue (leaf) dras-
Fossard (1977). Biswas et al. (2007) found that -naphtha- tically, and may slash it from approximately 95% to 1-6%
lene acetic acid (NAA) at 21.5 μM was the most efficient (Passey et al. 2003). In Agrobacterium-mediated transfor-
for leaf callus induction, and that MS medium supplemen- mation, a sufficient quantity of bacteria during cocultivation,
ted with 4.5 μM 2,4-D, 2.2 μM BA and 50% proline was a long enough cocultivation period, use of vir gene inducers
the best medium for somatic embryogenesis. Kordestani like acetosyringone, and stringent selection pressure are
and Karami (2008) reported the induction of somatic em- important to obtain stable transformants. Furthermore, for
bryogenesis in leaves from ‘Camarosa’ and ‘Selva’ cultured effective transformation, the antibiotic regime should con-
on MS medium supplemented with 8.3 μM picloran. In this trol bacterial overgrowth without inhibiting the regeneration
study, globular embryos were transferred to a hormone free of the plant cells (Graham et al. 1995; Alsheikh et al. 2002;
medium for maturation, and later converted to plantlets Qin et al. 2011). It is therefore appropriate to review the
after transfering cotyledonal embryos to MS supplemented effect of such factors on genetic transformation of straw-
with gibberellic acid. Husaini and Abdin (2007) for the first berry.
time could achieve shoot regeneration in strawberry simul-
taneously through both somatic embryogenesis and shoot Robust regeneration system and efficient
bud formation. In this study, leaf explants were cultured in Agrobacterium strain
MS medium supplemented with a relatively high TDZ con-
centration (18.16 μM). Based on this study, more recently, Establishment of a regeneration system for efficient re-
Husaini et al. (2008) developed a reliable and highly effici- covery of transformed cells following agroinfection is of
ent somatic embryogenesis system for ‘Chandler’ and exa- utmost importance in Agrobacterium-mediated transforma-
mined the effect of temperature on the induction and main- tion of strawberry (Husaini and Srivastava 2006b; Debnath
tenance of somatic embryos. and Teixeira da Silva 2007; Husaini et al. 2008). Use of a
high efficiency regeneration system greatly enhances induc-
2. Light and photoperiod tion of shoot organogenesis from transformed cells. The
better a regeneration system, the greater are the chances of
Light is known to affect somatic embryogenesis through its successful recovery of transgenic plants (Husaini 2010).
effect on induction (Verhagen and Wann 1989) and on some Even on the same selection medium, the efficiency of shoot
morphological characteristics of differentiated somatic em- production varies with the strain of A. tumefaciens and
bryos (Halperin 1966; Ammirato and Steward 1971). Des- binary vector used. Most binary vectors used to transform
pite these powerful effects of light, little attention has been strawberry are derived from pBIN19 (Bevan 1984) and
devoted to its role in in vitro culture (Torné et al. 2001) and contain the neomycin phosphotransferase-II (nptII) gene for
particularly somatic embryogenesis. Photoperiod has been kanamycin (Kan) selection of transgenic shoots (Mercado et
implicated in the regulation of cytokinin levels (Forsline al. 2007a). As a combination, Agrobacterium strain
and Langille 1975) as well as in photoconversion of phyto- LBA4404 and gene construct pBI121 have been used exten-
chromes (Torné et al. 1996). In strawberry, a negative effect sively in strawberry transformation of ‘Rapella’ (James et al.
of light on somatic embryo induction has been reported in 1990ab), ‘Melody’, ‘Rhapsody’, ‘Symphony’ (Graham et al.
‘Clea’ (Donnoli et al. 2001) and the clone pbgel-2000 (Bis- 1995), ‘Chandler’ (Barceló et al. 1998; Husaini and Srivas-
was et al. 2007). Similarly, in ‘Chandler’, a dark treatment tava 2006b) and F. vesca (El Mansouri et al. 1996; Alsheikh
significantly increased the number of somatic embryos in et al. 2002). In addition, Agrobacterium strain GV2260 has
the leaf explants cultured on 18.16 M TDZ and later incu- also been successfully used for genetic transformation of
bated under a 16-h photoperiod (Husaini and Abdin 2007). ‘Marmolada onebor’ (Martinelli et al. 1997), ‘Selekta’ (Du-
The response to photoperiod, however, can be modified by Plessis et al. 1997), Fragaria × ananassa breeding selec-
other environmental factors, since explants subjected to a tion ‘AN 93.231.53’ (Mezzetti et al. 2004) and ‘Chandler’
chilling treatment showed an optimal photoperiod of 12-h (Husaini and Abdin 2008a, 2008b). Finally, the superviru-
instead of the 16-h treatment (Husaini and Abdin 2007). lent Agrobacterium strain Agl0 (Lazo et al. 1991) and deri-
vatives EHA101 and EHA105 (Hood et al. 1986) have been
3. Chilling successfully used in transformation of ‘Tristan’, ‘Totem’
(Matthews et al. 1995), Elsanta (Puite and Schaart 1998),
High or low temperature stress can stimulate somatic em- ‘Polka’, ‘Gariguette’, breeding line 88312 (Schaart et al.
bryogenesis. Heat stress is effective for the induction of 2002) and ‘Calypso’ (Schaart et al. 2011a).
pollen embryos in canola (Pechan et al. 1991) while cold
stress increases the embryogenic potential of strawberry Antibiotics, regeneration and selection
(Husaini and Abdin 2007). Husaini et al. (2008) clearly
demonstrated that the concentration of TDZ is the primary Post-agroinfection exposure of explant tissues to two
factor responsible for induction of somatic embryogenesis classes of antibiotics, one for selection of transformed cells
in strawberry, while incubation at a temperature regime of and other for eliminating Agrobacterium, is optimized to
10 ± 1qC had a complementary effect on increasing the effect a compromise between producing transgenics and
4
screening-out escapes. Among the antibiotics used for sel- A combination of agrocidal antibiotics with a synergis-
ection, Kan is the most widely used for transformation tic effect has proven less phytotoxic and better in elimi-
studies in strawberry, while some have successfully used nating Agrobacterium than when used in isolation at iden-
hygromycin (Nyman and Wallin 1992; Mathews et al. 1995; tical concentrations (Tanprasert and Reed 1998; Husaini
Oosumi et al. 2006), geneticin (Mathews et al. 1995), and 2010). Husaini (2010) showed that a combination of timen-
the herbicide phosphinothricin (Wang et al. 2004; Folta et tin and cefotaxime at 250 mg l-1 each is less phytotoxic to
al. 2006). The concentration of Kan in the selection media leaf disks of ‘Chandler’ than the use of either of these
has a significant effect on transformation efficiencies. Shoot antibiotics alone at higher concentrations (500 mg l-1).
regeneration from leaf disks is impaired at Kan concentra-
tions as low as 10 mg l-1 (El Mansouri et al. 1996; Barceló Pre-culture (pre-incubation)
et al. 1998; Gruchala et al. 2004a) and higher Kan concen-
trations in the selection medium significantly reduce shoot Prior to inoculation with Agrobacterium, explants are
regeneration (Alsheikh et al. 2002; Husaini 2010). The con- sometimes incubated on a regeneration medium for a period
centration of Kan used for transgenic selection varies with of 1-10 days, allowing these explants to adjust to the re-
cultivar, explant type and the selection procedure employed. generation media. This practice of pre-culturing explants
For example, Nehra et al. (1990a, 1990b), in ‘Redcoat’ leaf has been shown to be beneficial in most cases (Sorvari et al.
explants, used a Kan concentration of 50 mg l-1 during the 1993; El Mansouri et al. 1996; Asao et al. 1997; Barceló et
first 4 weeks of culture and then transferred the explants to al. 1998; Cordero de Mesa et al. 2000; Alsheikh et al. 2002;
25 mg l-1 Kan. Similarly, Graham et al. (1995) cultured stem Husaini 2010). Pre-culturing improves transformation per-
sections of ‘Melody’, ‘Rhapsody’ and ‘Symphony’ at 20 mg centage, probably by increasing the number of plant cells
l-1 Kan for 5 days and later at 10 mg l-1. Others have used an competent for regeneration and transgene integration (Birch
opposite selection procedure; e.g., Husaini and Abdin 1997).
(2008a) and Husaini (2010) used higher Kan concentration
(50 mg l-1) in the beginning of the selection phase, just after Co-cultivation and vir inducer treatments
a 5 days pre-selection period, and later reduced Kan to 25
mg l-1. In other cases, constant selection pressure was ap- Cocultivation of explant with genetically engineered Agro-
plied, e.g. ‘Rapella’ petioles were cultured at 25 mg l-1 bacterium is a crucial step in gene transfer, as an excessive
(James et al. 1990b), ‘Chandler’ leaf at 25 mg l-1 (Barceló et number of bacteria imposes stress on plant cells, negatively
al. 1998; Cordero de Mesa et al. 2000), ‘Teodora’ and affecting their regeneration potential, and a lower number
‘Egla’ stipules at 50 mg l-1 (Monticelli et al. 2002). Interes- reduces the frequency of T-DNA transfer (Montoro et al.
tingly, in ‘Calypso’, Kan was used at 150 mg l-1 for selec- 2003). Increased co-cultivation period can enhance trans-
tion of transgenic plants (Schaart et al. 2004), indicating fection events but may also cause tissue necrosis due to
that some genotypes may be very resistant to the compound. related stress. Co-cultivation period varies between 15 min
In some strawberry transformation studies the use of (Nehra et al. 1990b) and 2 h (Mathews et al. 1998); how-
Kan has been related to the risk of formation of shoots con- ever, most strawberry researchers advocate co-cultivation
taining transgenic and non-transgenic sections (chimeras) for a duration between 24 and 72 h in the dark (Zhang and
(Mathews et al. 1998; Shestibratov and Dolgov 2005), Wang 2005; Folta and Dhingra 2006; Husaini 2010).
especially when using stipules (Monticelli et al. 2002; It is well known that phenolics, like acetosyringone, and
Chalavi et al. 2003) or meristematic sections of in vitro other bacterial culture factors such as low pH, increase
plants (Mathews et al. 1998) as explants. This is probably Agrobacterium virulence by the activation of vir genes
due to high antibiotic tolerance of the particular cultivar, (Karami et al. 2009). In most strawberry cultivars the ad-
since non-transformed shoots (control) were also able to dition of acetosyringone during preculture and cocultivation
grow and proliferate at the Kan concentration used for sel- showed a synergistic effect on Agrobacterium-mediated
ection (Mercado et al. 2007a). Two methods are employed transformation, increasing the number of transformed cells
to induce transgenic shoots on selection medium, one in in target tissues (James et al. 1993; Alsheikh et al. 2002;
which the concentrations of Kan are kept constant (non- Gruchala et al. 2004a; Husaini 2010). However, there is
iterative method), the other where its levels are increased huge variation in the degree of responses between these stu-
gradually during subculture (iterative method). The iterative dies, which may be due to extreme genotype dependence
method has been shown to inhibit the development of and variability in regeneration and transformation rates for
chimeric plants (Mathews et al. 1998; Houde et al. 2004). different cultivars (Alsheikh et al. 2002; Quesada et al.
Various antibiotics used to control Agrobacterium growth 2007) or to suppression of virulence in some strain/plant
exhibit phytotoxicity, especially at high concentrations. The species interactions (Godwin and Todd 1991).
use of carbencillin to control Agrobacterium after transfor-
mation of strawberry leaf explants (cultivar ‘Totem’) resul- Pre-selection
ted in stunted top and root growth of plantlets while with
timentin [a mixture of ticarcillin (96%) and clavulanic acid Selective agents like Kan have been shown to interfere with
(4%)] the regenerated plantlets showed vigorous, healthy the regeneration of transformants (van Wordragen 1992;
top and root growth (Finstad and Martin 1995). In contrast, Husaini 2010). A delay period of 2 to 10 days before chal-
in octaploid strawberry genotype ‘LF9’ timentin, though lenging the infected cells to selective agents (called the pre-
found to be effective in curbing Agrobacterium growth, selection phase) is sometimes introduced to allow the trans-
slowed its growth and differentiation slightly (Folta et al. formed cells to recover from the infection process and to
2006). Alsheikh et al. (2002) compared regeneration of F. express the selectable marker gene (Alsheikh et al. 2002;
vesca and F. vesca semperflorens in the presence of dif- Zhao et al. 2004). Leaf disks inoculated with Agrobacte-
ferent concentrations of carbenicillin, cefotaxime, and cefo- rium regenerate shoots at a low frequency when subjected
xitin, from 10 to 500 mg l-1, and concluded that amongst to selection pressure immediately after co-cultivation, while
these antibiotics, carbenicillin was the least phytotoxic. the introduction of a short preselection phase significantly
Moreover, phytotoxicity varied with the type of explant increases the percentage of leaf disks regenerating shoots
used, petioles being more sensitive to antibiotic toxicity (Nehra et al. 1990a, 1990b; Alsheikh et al. 2002). In
than leaf disks. Hanhineva and Karenlampi (2007) found ‘Chandler’, the percentage of explants regenerating shoots
that cefotaxime inhibited shoot regeneration in cv. ‘Jonsok’, increased by almost 6-fold with a 5-day preselection phase,
especially at a high concentration (500 mg l-1). These results from 0.5% (no preselection) to 3.1% (5-days preselection)
show that the interaction of antibiotic with plant species is (Husaini 2010). By contrast, the absence of selection during
genotype dependent, and that variations occur because of a long period after explant infection, e.g. 3 weeks, can
Agrobacterium strain, explant type and the cultivar under reduce transformation efficiency (Mathews et al. 1995).
study. One effective mechanism to reduce damage from stress
5
A B C D
E F G H I
Fig. 3 Development of transgenic plants of Fragaria × ananassa Duch. (A) Shoot initiation. (B, C, D) Differentiation of shoots. (E, F, G) Multiple
shoot formation and elongation. (H) Root formation. (I) Acclimatization in pot.
is the accumulation of high intracellular levels of trehalose filter sterilized acetosyringone, 100 μM. The suspension is
(Crowe et al. 1984; Drennan et al. 1993; Goddijn and van grown for 3-4 h at 28°C until it attains an optical density of
Dun 1999). Recently, Husaini (2010) used a specific tre- 1 at 600 nm (approximately 108 cells/ml).
halase inhibitor, validamycin A, in pre-selection culture
medium to reduce the effect of stress on transformed cells 3. Inoculation and co-cultivation of explants
imposed by the process of transformation and to facilitate
the recovery of Kan-resistant putative transformants. The Precultured leaf explants are immersed in the Agrobacte-
addition of validamycin A in the preselection medium resul- rium suspension for 25 min with gentle agitation. After-
ted in a two-fold (from 3.1 to 7.4%) increase in the average wards, explants are blotted dry on sterile filter paper and
percentage of leaf disks regenerating shoots on selection cultured in the regeneration medium for 2 days, at 25°C in
medium. As the plant trehalose biosynthesis pathway is the dark.
tightly regulated by multiple stress signals (Drennan et al.
1993; Pramanik and Imai 2005), the addition of validamy- 4. Selection of transformed plants
cin A probably reduces the ‘transformation-stress’ on the
cells caused due to agroinfection. After co-cultivation, explants are sequentially washed with
sterile water and a solution of cefotaxime and timentin
A protocol for strawberry transformation (both at 250 mg l-1) for 15 min. Then, explants are blotted
dry with sterile filter paper and cultured in the pre-selection
The following section describes a general protocol for the medium (regeneration medium supplemented with cefo-
Agrobacterium-mediated transformation of strawberry leaf taxime and timentin, both at 250 mg l-1, and 100 μM val-
disks. This method was developed for the transformation of idamycin A) for 5 days. Afterwards, explants are transferred
‘Chandler’ (Barceló et al. 1998; Husaini 2010) but, with to selection medium (pre-selection medium supplemented
modifications, has been used to transform other commercial with 50 mg l-1 Kan), and subcultured every 4 weeks onto
cultivars, such as ‘Camarosa’, ‘Andana’ or ‘Carisma’. This fresh medium. Selection is accomplished at 25°C with a 16-
protocol uses disarmed A. tumefaciens strains, LBA4404 or h photoperiod of 40 μmol m-2 s-1. Regenerated shoots start
GV2260, containing a binary vector harboring the Kan re- to appear after 4-8 weeks of culture in the selection medium,
sistance gene nptII, driven by the nopaline synthase promo- usually in form of clusters composed of several shoots.
ter, for selection. Leaf disks for Agrobacterium inoculation Then, a single shoot per explant is isolated and micropro-
are obtained from stocks of plants micropropagated in vitro pagated in the appropriate medium supplemented with Kan
derived from the culture of runner tips of virus-free plants at 25 mg l-1. In the case of ‘Chandler’ and ‘Camarosa’,
growing in the greenhouse. Adventitious regeneration N30K medium (Margara 1984) supplemented with 2.21 μM
medium should be adjusted for each specific cultivar. A kinetin can be used for shoot elongation and rooting. Plants
medium containing N30K macroelements supplemented with shoots 5-6 cm in length can be acclimated to ex vitro
with 2.46 μM IBA and 8.8 μM BA has been found to be op- conditions following standard techniques (López-Aranda et
timal for ‘Chandler’ and ‘Camarosa’ regeneration (Barceló al. 1994).
et al. 1998; Mercado et al. 2007b). Husaini (2010), on the Using this protocol, a transformation rate varying bet-
other hand, used MS supplemented with 18.1 μM TDZ. ween 4 and 10%, estimated as the number of independent
transgenic plants recovered from 100 inoculated leaf disks,
1. Explant preculture can be obtained in a period of 16-20 weeks. Fig. 3 shows
the development of transgenic plants in ‘Chandler’ employ-
Green leaves from in vitro stocks are cut into small pieces ing this transformation method. The differences in protocols
(0.5 cm2), and precultured on shoot regeneration medium in between the Husaini (2010) and the Barceló et al. (1998)
the dark for 7 days. transformation protocols are highlighted in Tables 1 and 2.
2. Growth of Agrobacterium culture Production of marker-free genetically modified

strawberry plants
Agrobacterium is grown at 28°C in Luria Broth supplemen-
ted with appropriate antibiotics for bacterial and binary Public concerns on the issue of the environmental and food
plasmid selection, 200 mg l-1 streptomycin for LBA4404 safety of genetically modified plants have led to a demand
and 75 mg l-1 rifampicin for GV2260 strain. After 24 h, bac- for technologies allowing the production of transgenic
terial cultures are centrifuged at 5000 rpm and the pellet re- plants without selectable (antibiotic resistance) markers. In
suspended in 25 ml MS liquid medium with the addition of strawberry, marker-free genetically modified plants have
6
Table 1 Major differences in Agrobacterium tumefaciens mediated transformation protocols of Fragaria x ananassa Duch ‘Chandler’.
Parameter Barceló et al. 1998 Husaini 2010
Source of explant Variable 20-day-old plantlets maintained on MS salts + B5 Vit +
glucose (2%) + agar (0.9%) + kinetin (1 mg/l)
Shoot regeneration medium Lopez Aranda et al. 1994 Murashige and Skoog 1962 + B5 Vit + 2% glucose*
Efficiency of regeneration system (%) 66.7 100
Agrobacterium tumefaciens strain LBA 4404 GV 2260
Binary vector pBI121 pBinAR
Acetosyringone (μM) 0 100
Co-cultivation duration (h) 72 72
Kanamycin in selection medium (mg/l) 25 50 and 25
Agrobactericidal antibiotics (mg/l) Carbencillin 500 Cefotaxime 250 + Timentin 250
Osmoprotectant (μM) 0 Validamycin A 100
Pre-culture/pre-incubation duration (days) 3, 10 7
Pre-selection (days) 0 5
Transformation % based on number of explants regenerating 4.2 10
shoots on kanamycin
* Also see Table 2
Table 2 Media used for transformation and recovery of transgenic plants of cultivar ‘Chandler’ (according to Husaini 2010).
Medium Components
MS liquid medium MSL MS salts and vitamins + 3% sucrose
Regeneration medium RM MS salts + B5 vitamins + 2% glucose + 4 mg l-1 TDZ
Shoot elongation medium SMI MS salts + B5 vitamins + 2% sucrose + 1% glucose + 0.1 mg l-1 BA + 0.05 mg l-1 Kn + 2 mg l-1 GA3
Pre-selection regeneration medium PSLMIA MS salts + B5 vitamins + 2% glucose + 4 mg l-1 TDZ + 500 μg ml-1 Cefotaxime
PSLMIB MS salts + B5 vitamins + 2% glucose + 4 mg l-1 TDZ + 500 μg ml-1 Timentin
PSLMIC MS salts + B5 vitamins + 2% glucose + 4 mg l-1 TDZ + 250 μg ml-1 Cefotaxime + 250 μg ml-1 Timentin
Selective regeneration medium SLMIA MS salts + B5 vitamins + 2% glucose + 4 mg l-1 TDZ + 500 μg ml-1 Cefotaxime + 50 μg ml-1 Kanamycin
SLMIB MS salts + B5 vitamins + 2% glucose + 4 mg l-1 TDZ + 500 μg ml-1 Timentin + 50 μg ml-1 Kanamycin
SLMIC MS salts + B5 vitamins + 2% glucose + 4 mg l-1 TDZ + 250 μg ml-1 Cefotaxime + 250 μg ml-1 Timentin
+ 50 μg ml-1 Kan
Selective shoot elongation medium SLMII MS salts + B5 vitamins + 2% sucrose + 1% glucose + 0.1 mg l-1 BA + 0.05 mg l-1 Kn + 2 mg l-1 GA3
+ 25 μg ml-1 Kan
SLMIII MS salts + B5 vitamins + 2% sucrose + 1% glucose + 1.0 mg l-1 Kn + 25 μg ml-1 Kan
Root induction medium RIM MS salts + B5 vitamins + 2% sucrose + 1% glucose + 1.0 mg l-1 Kn
been produced using a method that employs site-specific plants, a strawberry polygalactronase inhibiting protein
recombination-mediated excision of the gene originally gene (FaPGIP) (Mehli et al. 2004) which was combined
used for selection of transgenic plants. This method, des- with the strong and ripe fruit-specific regulatory elements
cribed by Schaart et al. (2004, 2010) uses the site-specific (promoter and terminator) of a strawberry expansin gene
recombination system R/Rs from Zygosaccharomyces (FaExp2) (Schaart et al. 2011b) was introduced. Selection
rouxii, in which activity of the recombinase protein was of kanamycin resistant plants and subsequent elimination of
directly regulated by a chemical inducer. The recombina- the marker genes resulted in strawberry plants in which
tion-induced elimination of undesired sequences was com- only gene elements originating from strawberry itself were
bined with a negative selection step. This step allows to present. Therefore these plants are called intragenic, rather
select against failed or incomplete marker elimination, than transgenic. A derived version of pMF1, pHUGE was
using a negative selectable marker, the Escherichia coli produced and used to transfer large genomic DNA frag-
cytosine deaminase (codA) gene. This is a conditionally ments to the strawberry plant genome (personally com-
lethal dominant gene encoding an enzyme that converts the municated by Dr. A. Untergasser and Dr. R Geurts, Wage-
non-toxic 5-fluorocytosine (5-FC) to cytotoxic 5-fluoro- ningen University; results to be published elsewhere). This
uracil (5-FU). The method was tested in strawberry cv vector has the vector backbone of pYLTAC7 (Liu et al.
‘Calypso’ because of its superior regeneration and transfor- 1999) and has Gateway cloning sites to facilitate cloning of
mation capacity (Passey et al. 2003) and using the test- large DNA fragments. Using the pHUGE vector for trans-
vector pRCNG (Schaart et al. 2004). This test vector has a formation of the strawberry cultivar ‘Calypso’ 33 transgenic
promoterless gus reporter gene which will be combined strawberry plants could be obtained of which 55% con-
with a CaMV35S promoter following removal of marker tained a complete integrated T-DNA fragment of 72 or 74
gene sequences which separate both promoter and gus gene. kbp. Subsequent dexamethasone treatment of leaf explants
So, the gus-reporter could be used to monitor recombination of these plants followed by secondary regeneration removed
events in pRCNG- transformed plants. At first, kanamycin marker sequences in 80% of these plants. These results
resistant strawberry plants were produced using a standard demonstrate the possibility of transferring large DNA frag-
transformation protocol and selection on 150 mg l-1 kana- ments into strawberry genome in an efficient way, and
mycin. In a secondary step, leaf explants from the trans- allow the introduction of complete BAC cloned sequences,
genic strawberry plants were subjected to an overnight without the need to subclone candidate genes from these
dexametasone (dex) treatment for induction of the R BAC clones. Therefore pHUGE may be an interesting tool
recombinase activity and subsequently shoots were regene- to perform functional analysis of strawberry genes in their
rated from the dex-treated leaf explants using 5-FC as a chromosomal context in strawberry.
negative selection agent. This resulted in a high proportion
of transgenic plants from which the selectable marker ESTIMATING TRANSFORMATION SUCCESS
sequences had been removed (Schaart et al. 2004). An
adapted version of the pRCNG-vector, pMF1 (Schaart et al. There is a wide difference in the methods employed for esti-
2010) which lacks the gus reporter gene, and which was mating regeneration and transformation efficiencies. Most
equipped with a multiple cloning site, was used to produce strawberry transformation experiments have been per-
intragenic strawberry plants (Schaart et al. 2011a). In these formed using leaf disks as explants, and transformation rate
7
Table 3 Different ways of calculating transformation success in strawberry transformation.

Formula $ Description of formula Remarks References
(NSPT ÷ NEAi) × 100 Number of putative transgenic shoots regenerated on This formula can be used at early stages of Husaini 2010
selection medium (usually after 8 weeks) ÷ Number of regeneration but may include escapes too.
explants agro-infected
(NSPT ÷ NESM) × 100 Number of putative transgenic shoots regenerated on It ignores the positive/negative effect of pre-selection Nehra et al.
selection medium (usually after 8 weeks) ÷ Number of strategy (pre-culture, pre-selection, Agro-infection) on 1990a, 1990b
explants put on selection medium transformation
(NESPT ÷ NEAi) × 100 Number of explants regenerating putative transgenic It ignores multiple transformation events occurring on Zhao et al.
shoots on selection medium (usually after 8 weeks) ÷ the same explant but at separate loci. 2004
Number of explants agro-infected
(NSPCR ÷ NEAi) × 100 Number of PCR confirmed transgenic shoots Most accurate formula, but can be used at later stage Husaini 2010
regenerated on selection medium (usually after 8 when sufficient tissue material becomes available for
weeks) ÷ Number of explants agro-infected DNA isolation/PCR. However, since some
transformants perish in various stages of development,
such transformation events are not taken into account.
(NSPT÷NEAi) × [Number of putative transgenic shoots regenerated on Technically this is the most appropriate formula for Gruchala et al.
(NEnsm÷NSnsm) × 100 selection medium (usually after 8 weeks) ÷ Number of describing transformation ‘efficiency’, as it compares 2004a, 2004b
explants agro-infected] × [Number of explants cultured the relative regeneration capacities of agro-infected and
on non-selective (kanamycin-free) medium ÷ Number normal (non agro-infected) explants.
of shoots regenerated on non-selective medium]
$
N stands for ‘Number’, S for ‘shoots’ and E for ‘explants’. SPT means ‘putative transgenic shoots’, EAi ‘agro-infected explants’, ESM ‘explants on selection medium’, ESPT
‘explants regenerating putative transgenic shoots’, SPCR ‘shoots confirmed as transgenic using PCR’, Ensm ‘explants on non-selective medium’, Snsm ‘shoots regenerated on
non-selective medium’.
is based on the number of shoots regenerated per 100 Agro- than ‘1’ i.e. 100%. However, transformation percentage of
bacterium inoculated explants or explants cultured on selec- greater than 100% is quite possible especially because each
tion medium. However, each researcher uses his own metric leaf explant can regenerate multiple shoots/shoot clusters in
to describe the success of transformation. For example, strawberry. When calculating transformation percentage we
Gruchala et al. (2004b) analyzed 25 strawberry cultivars to actually aim to calculate the ‘number of transformation
select genotypes most suitable for transformation and ex- events’ that ‘successfully regenerate shoots/plantlets’ when
pressed transformation/regeneration efficiency as the ‘trans- exposed to appropriate selection pressure. Transformation
formant number per 100 explants’, varying this value bet- efficiency reports the ‘relative’ regeneration capacities of
ween 3 to 9.5, depending on the cultivar. Zhao et al. (2004) agroinfected and control explants, while transformation
used the term ‘transformation rate’ to express transforma- percentage measures the ‘success’ in recovering transgenic
tion success and calculated it as the percentage of ‘explants’ shoots only (Husaini 2010). Furthermore, as described by
that regenerated shoots on selection medium after 8 weeks. Husaini (2010), the parameters used to calculate transfor-
However, a closer examination reveals that actually trans- mation ‘percentage’ are extremely important because, based
formation success was calculated as a percentage of ‘puta- on the method of calculation, different values for transfor-
tive transgenic shoots’ on selection medium. In the study mation percentages can be derived.
(Zhao et al. 2004), transformation rates varied between
68% in diploid strawberry to 10% in octoploid ‘Hecker’. FUTURE PERSPECTIVES
The number of independent shoots generated per ex-
plant is usually referred to as ‘regeneration efficiency’, Since the pioneering works of Nehra et al. (1990b) and
while the percentage of ‘explants’ that produce a transgenic James et al. (1990a), who for the first time described gene-
shoot is referred as ‘transformation efficiency’ (Folta and tic transformation in strawberry, many protocols have been
Dhingra 2006). However, this definition leads to many dif- developed for the Agrobacterium transformation of culti-
ferent formulae (Table 3). Formulae 1 to 4 (from the top vated and wild strawberry. Even more, these procedures
downwards) in Table 3 give more weight to the regene- have been used to improve important traits, such as fruit
ration system used, and hence do not reflect the actual quality (Jiménez-Bermúdez et al. 2002; Quesada et al.
transformation efficiency. These formulae actually aim at 2009), fruit production (Mezzetti et al. 2004), fungal resis-
calculating the ‘number of transformation events’ that ‘suc- tance (Schestibratov and Dolgov 2005; Vellicce et al. 2006)
cessfully regenerate shoots/plantlets’ after application of an or abiotic tolerance (Houde et al. 2004; Husaini and Abdin
appropriate ‘selection pressure’, and assume that ‘every sin- 2008a). However, in vitro regeneration and transformation
gle shoot’ represents a ‘unique transformation event’. This of strawberry is still far from be a routine technique. A
assumption may however not be correct, because straw- robust regeneration system is an indispensable prerequisite
berry leaves may regenerate multiple shoots (clusters or for the success of genetic transformation, and genotype
colony) per explant per initiation site, resulting in transfor- appears as the main factor determining the response of plant
mation percentage higher than 100%. tissue to its in vitro culture. This dependence on the regene-
The terms ‘transformation efficiency’ and ‘transforma- ration system makes transformation efficiencies highly vari-
tion percentage’ are not synonymous (Husaini 2010). The able among the different transformation studies performed,
former describes the number of transgenic shoots that arise even when using the same strawberry genotype. The search
on selection medium as compared with the number of for novel transformation systems, more efficient and geno-
regeneration events that occur in the absence of selection type independent, is therefore desirable. Towards this end, it
(Table 3, formula 5). On the other hand, reporting ‘transfor- is noteworthy that strawberry researchers have paid limited
mation efficiency’ as the number of transformants per ex- attention to somatic embryogenesis. This process has only
plant distorts the representation, since Oosumi et al. (2006) been described in a few cultivars, and, as far as we know,
and Folta et al. (2006) reported transformation efficiencies somatic embryos have not been used in genetic transforma-
greater than 100%. This metric simply means that each ex- tion studies. This system has some advantages over adven-
plant produced at least one transgenic shoot. Actually, the titious regeneration, such as the higher availability of ex-
transformation efficiency described by Folta et al. (2006) is plants for agroinfection, the possibility of exerting a more
quite low (1–3%). In our opinion there is an objection to controlled selection procedure, or the conversion to rooted
reporting ‘transformation efficiency’ as greater than 100% plants in a single step. Other authors have proposed an al-
as mathematically it is incorrect to have efficiencies greater ternative way to achieve this, consisting of the identification
8
of easily transformed lines that could be used as model adventitious shoot regeneration. In Vitro Cellular and Developmental Biology
genotypes in functional genomics, both in cultivated (Folta - Plant 41, 671-676
et al. 2006) and wild strawberry (Oosumi et al. 2006; Slo- Debnath SC (2006) Zeatin overcomes thidiazuron-induced inhibition of shoot
elongation and promotes rooting in strawberry culture in vitro. Journal of
vin et al. 2009). The usefulness of this strategy still needs to
Horticultural Science and Biotechnology 81, 349-354
be addressed. Debnath SC (2008) Developing a scale-up system for the in vitro multiplica-
Despite the problem of low transformation efficiency tion of thidiazuron-induced strawberry shoots using a bioreactor. Canadian
and reproducibility, other aspects of strawberry transforma- Journal of Plant Science 88, 737-746
tion should be investigated. Few studies have been devoted Debnath SC (2009) Characteristics of strawberry plants propagated by in vitro
to analyze the occurrence of somaclonal variation in a bioreactor culture and ex vitro propagation method. Engineering in Life Sci-
population of transgenic strawberries, although it is well ences 9, 239-246
known that this process is a source of unintended effects Debnath SC, Teixeira da Silva JA (2007) Strawberry culture in vitro - a
and may influence transgene expression (Bhat and Sriniva- review. Fruit, Vegetable and Cereal Science and Biotechnology 1, 1-12
Decout L, Dubois T, Guedira M, Dubois J, Audran JC, Vasseur J (1994)
san 2002). Environmental risk analysis of transgenic straw-
Role of temperature as a triggering signal for organogenesis or somatic em-
berry is also needed for a future field release of these plants. bryogenesis in wounded leaves of chicory cultured in vitro. Journal of Ex-
Some authors have indicated that the potential risk of trans- perimental Botany 45, 1859-1865
genic strawberries is quite low, but this should be demons- Donnoli R, Sunseri F, Martelli G, Greco I (2001) Somatic embryogenesis,
trated with deeper studies (Quesada et al. 2007). Finally, the plant regeneration and genetic transformation in Fragaria spp. Acta Horticul-
development of transformation procedures for wild straw- turae 560, 235-239
berry other than F. vesca, would be beneficial for funda- Du Plessis HJ, Brand RJ, Glyn-Woods C, Goedhart MA (1997) Efficient
mental studies and also for breeding purposes. genetic transformation of strawberry (Fragaria × ananassa Duch.) cultivar
Selekta. Acta Horticulturae 447, 289-294
Drennan PM, Smith MT, Goldsworthy D, Van Staden J (1993) The occur-
ACKNOWLEDGEMENTS rence of trehalose in the leaves of the desiccation-tolerant angiosperm Myro-
thamnus flabellifolius Welw. Plant Physiology 142, 493-496
AMH is thankful to Professors MZ Abdin, DK Srivastava, KC El Mansouri I, Mercado JA, Valpuesta V, Lopez-Aranda JM, Pliego-Alfaro
Bansal and Dr. AM Rafiqi for technical and other support, and to F, Quesada MA (1996) Shoot regeneration and Agrobacterium-mediated
the Council of Scientific and Industrial Research, New Delhi, for transformation of Fragaria vesca L. Plant Cell Reports 15, 642-646
financial support. JAM thanks the Ministerio de Ciencia e Innova- Faedi W, Mourgues F, Rosati C (2002) Strawberry breeding and varieties:
ción of Spain and FEDER EU funds for financial support (grant nº Situation and perspectives. Acta Horticulturae 567, 51-59
AGL2008-02356). Finstad K, Martin RR (1995) Transformation of strawberry for virus resis-
tance. Acta Horticulturae 385, 86-90
Flores R, Oliveira M de F, Camargo JT, Andrade L, Peters JA, Fortes GR
REFERENCES de L (1998) In vitro callogenesis and organogenesis in two strawberry cul-
tivars. Agropecuaria Clima Temperado 1 (2), 155-161
Alsheikh MK, Suso HP, Robson M, Battey NH, Wetten A (2002) Appropriate Folta KM, Dhingra A (2006) Transformation of strawberry: The basis for
choice of antibiotic and Agrobacterium strain improves transformation of translational genomics in Rosaceae. In Vitro Cellular and Developmental
antibiotic-sensitive Fragaria vesca and F.v. semperflorens. Plant Cell Reports Biology - Plant 42, 482-490
20, 1173-1180 Folta KM, Howard L, Dhingra A, Stewart PJ, Chandler CK (2006) Charac-
Ammirato PV, Steward FC (1971) Some effects of environment on the deve- terization of LF9, an octoploid strawberry genotype selected for rapid regene-
lopment of embryos from cultured free cells. Botanical Gazette 132, 149-158 ration and transformation. Planta 224, 1058-1067
Asao H, Nishizawa Y, Arai S, Sato T, Hirai M, Yoshida K, Shinmyo A, Hibi Forsline PL, Langille AR (1975) Endogenous cytokinins in Solanum tubero-
T (1997) Enhanced resistance against a fungal pathogen Sphaerotheca sum as influenced by photoperiod and temperature. Physiologia Plantarum
humuli in transgenic strawberry expressing a rice chitinase gene. Plant Bio- 34, 75-77
technology 14, 145-149 Foucault C, Letouze R (1987) In vitro regeneration de plantes de fraisier a par-
Barceló M, El Mansouri I, Mercado JA, Quesada MA, Alfaro FP (1998) tir de fragmentes de petiole et de bourgeons floraux. Biologia Plantarum 29,
Regeneration and transformation via Agrobacterium tumefaciens of the 409-414
strawberry cultivar Chandler. Plant Cell, Tissue and Organ Culture 54, 29-36 George EF (1993) Plant Propagation by Tissue Culture. Part 1. The Tech-
Bhatt ID, Dhar U (2000) Micropropagation of Indian wild strawberry. Plant nology, Exegetics Ltd., Edington, England, pp 3-36
Cell, Tissue and Organ Culture 60, 83-88 Goddijn OJM, van Dun K (1999) Trehalose metabolism in plants. Trends in
Bhat SR, Srinivasan S (2002) Molecular and genetic analysis of transgenic Plant Science 4, 315-319
plants: Considerations and approaches. Plant Science 163, 673-681 Godwin I, Todd G (1991) The effects of acetosyringone and pH on Agrobacte-
Bevan M (1984) Binary Agrobacterium vectors for plant transformation. Nuc- rium-mediated transformation vary according to plant species. Plant Cell
leic Acids Research 12, 8711-8721 Reports 9, 671-675
Birch RG (1997) Plant transformation: Problem and strategies for practical ap- Graham J, McNicol RJ, Grieg K (1995) Towards genetic based insect resis-
plication. Annual Review of Plant Physiology and Plant Molecular Biology tance in strawberry using the cowpea trypsin inhibitor gene. Annals of Ap-
48, 297-326 plied Biology 127, 163-173
Biswas MK, Islam R, Hossain M (2007) Somatic embryogenesis in strawberry Gruchala A, Korbin M, Zurawicz E (2004a) Conditions of transformation and
(Fragaria sp.) through callus culture. Plant Cell, Tissue and Organ Culture regeneration of ‘Induka’ and ‘Elista’ strawberry plants. Plant Cell, Tissue and
90, 49-54 Organ Culture 79,153-160
Blando F, Niglio A, Frattarelli A (1993) Cell suspension cultures in straw- Gruchala A, Korbin M, Zurawicz E (2004b) Suitability of selected strawberry
berry: Growth characterization and variability. Acta Horticulturae 336, 257- cultivars for genome modification by Agrobacterium tumefaciens. Acta Hor-
262 ticulturae 663, 491-494
Boxus P (1974) The production of strawberry plants by in vitro micropropaga- Haddadi F, Aziz MA, Saleh G, Rashid AA, Kamaladini H (2010) Micropro-
tion. Journal of Horticultural Science 49, 209-210 pagation of strawberry cv. Camarosa: Prolific shoot regeneration from in
Chalavi V, Tabaeizadeh Z, Thibodeau P (2003) Enhanced resistance to Verti- vitro shoot tips using thidiazuron with N6-benzylamino-purine. HortScience
cillium dahliae in transgenic strawberry plants expressing a Lycopersicon 45, 453-456
chilense chitinase gene. Journal of American Society of Horticultural Scien- Halperin W (1966) Alternative morphogenetic events in cell suspensions. Ame-
ces 128, 747-753 rican Journal of Botany 53, 443-453
Cordero de Mesa M, Jiménez-Bermúdez S, Pliego-Alfaro F, Quesada MA, Hammoudeh HY, Suwwan MA, Abu Quoud HA, Shibli RA (1998) Micro-
Mercado JA (2000) Agrobacterium cells as microprojectile coating: A novel propagation and regeneration of Honeoye strawberry. Dirasat Agricultural
approach to enhance stable transformation rates in strawberry. Australian Sciences 25 (2), 170-178
Journal of Plant Physiology 27, 1093-1100 Hanhineva KJ, Kärenlampi SO (2007) Production of transgenic strawberries
Crowe JH, Crowe LM, Chapman D (1984) Preservation of membranes in an- by temporary immersion bioreactor system and verification by TAIL-PCR.
hydrobiotic organisms: the role of trehalose. Science 223, 701-703 BMC Biotechnology 7, 11
Damiano C, Monticelli S, Frattarelli A, Nicalini S, Corazza L, Altman A, Hood EE, Helmer GL, Fraley RT, Chilton MD (1986) The hypervirulence of
Zir M (1997) Somaclonal variability and in vitro regeneration of strawberry. Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside
Acta Horticulturae 447, 87-93 of T-DNA. Journal of Bacteriology 168, 1291-1301
Debnath SC (2003) Micropropagation of small fruits. In: Jain SM, Ishii K Houde M, Dallaire S, N’Dong D, Sarhan F (2004) Overexpression of the aci-
(Eds) Micropropagation of Woody Trees and Fruits, Kluwer Academic Pub- dic dehydrin WCOR410 improves freezing tolerance in transgenic strawberry
lishers, Dordrecht, Germany, pp 465-506 leaves. Plant Biotechnology Journal 2, 381-387
Debnath SC (2005) Strawberry sepal: Another explant for thidiazuron-induced Husaini AM (2010) Pre- and post-agroinfection strategies for efficient leaf disc
9
transformation and regeneration of transgenic strawberry plants. Plant Cell 173

Reports 29, 97-110 Mathews H, Wagoner W, Kellogg G, Bestwick R (1995) Genetic transforma-
Husaini AM, Abdin MZ (2007) Interactive effect of light, temperature and tion of strawberry: Stable integration of a gene to control biosynthesis of
TDZ on the regeneration potential of leaf discs of Fragaria × ananassa Duch. ethylene. In Vitro Cellular and Developmental Biology – Plant 31, 36-43
In Vitro Cellular and Developmental Biology – Plant 43, 576-584 Mathews H, Dewey V, Wagoner W, Bestwick RK (1998) Molecular and cel-
Husaini AM, Abdin MZ (2008a) Development of transgenic strawberry (Fra- lular evidence of chimaeric tissues in primary transgenics and elimination of
garia × ananassa Duch.) plants tolerant to salt stress. Plant Science 174, chimaerism through improved selection protocols. Transgenic Research 7,
446-455 123-129
Husaini AM, Abdin MZ (2008b) Overexpression of tobacco osmotin gene Mehli L, Schaart JG, Kjellsen TD, Tran DH, Salentijn EMJ, Schouten HJ,
leads to salt stress tolerance in strawberry (Fragaria × ananassa Duch.) Iversen T-H (2004) A gene encoding a polygalacturonase-inhibiting protein
plants. Indian Journal of Biotechnology 7, 465-472 (PGIP) shows developmental regulation and pathogen-induced expression in
Husaini AM, Aquil S, Bhat M, Qadri T, Kamaluddin, Abdin MZ (2008) A strawberry. New Phytologist 163, 99-110
high-efficiency direct somatic embryogenesis system for strawberry (Fra- Mercado JA, Cordero de Mesa M, Jiménez-Bermúdez S, Quesada MA,
garia × ananassa Duch.) cultivar Chandler. Journal of Crop Science and Pliego-Alfaro F (2005) Genetic transformation of strawberry. In: Dris R (Ed)
Biotechnology 11, 107-110 Crops: Growth, Quality and Biotechnology, WFL Publisher, Helsinki, pp
Husaini AM, Srivastava DK (2006a) Genetic transformation in strawberry - A 1186-1195
review. Asian Journal of Microbiology, Biotechnology, and Environmental Mercado JA, Pliego-Alfaro F, Quesada MA (2007a) Strawberry. In: Pua EC,
Sciences 8, 75-81 Davey MR (Eds) Transgenic Crops V. Biotechnology in Agriculture and For-
Husaini AM, Srivastava DK (2006b) Plant regeneration and Agrobacterium- estry (Vol 60), Springer, Berlin, pp 309-328
mediated gene transfer studies in strawberry tissues (Fragaria × ananassa). Mercado JA, Martín-Pizarro C, Pascual L, Quesada MA, Pliego-Alfaro F,
Asian Journal of Microbiology, Biotechnology and Environmental Sciences 8, de los Santos B, Romero F, Gálvez J, Rey M, de la Viña G, Llobell A,
671-678 Yubero-Serrano E-M, Muñoz-Blanco J, Caballero JL (2007b) Evaluation
Infante R, Mazzara M, Rosati P (1998) Growth estimation of in vitro cultured of tolerance to Colletotrichum acutatum in strawberry plants transformed
callus and plant regeneration from leaf disk and petiole callus of musk straw- with Trichoderma derived-genes. Acta Horticulturae 738, 383-388
berry (Fragaria moschata Duch.) subcultured for 18 months. Journal of the Mezzetti B, Landi L, Pandolfini T, Spena A (2004) The defH9-iaaM auxin-
Japanese Society for Horticultural Science 67 (1), 39-43 synthesizing gene increases plant fecundity and fruit production in strawberry
Isac V, Popesu AN, Coman M, Schmidt H, Kellerhals M (1993) Studies on and raspberry. BMC Biotechnology 4 (4), 1-10
plant regeneration from tissue derived callus in Fragaria × ananassa Duch. Mohan R, Chui EA, Biasi LA, Soccol CR (2005) Alternative in vitro propaga-
In: Proceedings of the Eucarpia Fruit Breeding Section Meeting, Switzerland, tion: Use of sugarcane bagasse as a low cost support material during rooting
1, 395-398 stage of strawberry cv. Dover. Brazilian Archives of Biology and Technology
James DJ, Passey AJ, Barbara DJ (1990a) Agrobacterium-mediated transfor- 48, 37-42
mation of the cultivated strawberry (Fragaria × ananassa Duch.) using dis- Monticelli S, Gentile A, Damiano C (2002) Regeneration and Agrobacterium-
armed binary vectors. Plant Science 69, 79-94 mediated transformation in stipules of strawberry. Acta Horticulturae 567,
James DJ, Passey AJ, Barbara DJ (1990b) Agrobacterium mediated transfor- 105-107
mation of apple and strawberry using disarmed Ti-binary vectors. Acta Horti- Montoro P, Rattana W, Pujade-Renaud V, Michaux-Ferrieere N, Monkol-
culturae 280, 495-502 sook Y, Kanthapura R, Adunsadthapong S (2003) Production of Hevea
James DJ, Uratsu S, Cheng J, Negri P, Viss P, Dandekar AM (1993) Aceto- brasiliensis transgenic embryogenic callus lines by Agrobacterium tumefaci-
syringone and osmoprotectents like betaine or proline synergistically enhance ens: roles of calcium. Plant Cell Reports 21, 1095-1102
Agrobacterium-mediated transformation of apple. Plant Cell Reports 12, Murasighe T, Skoog F (1962) A revised medium for rapid growth and bio-
559-563 assays with tobacco tissue cultures. Physiologia Plantarum 15, 473-497
Jelenkovic G, Chin C, Billings S, Eberhardt J, Dale A, Luby JJ (1990) Nehra NS, Chibbar RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C
Transformation studies in cultivated strawberry, Fragaria × ananassa Duch. (1990a) Genetic transformation of strawberry by Agrobacterium tumefaciens
In: The strawberry into the 21st century. Proceedings of the 3rd North Ameri- using a leaf disk regeneration system. Plant Cell Reports 9, 293-298
can Strawberry Conference, Texas, pp 91-97 Nehra NS, Chibbar RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C
Jiménez-Bermúdez S, Redondo-Nevado J, Muñoz-Blanco J, Caballero JL, (1990b) Agrobacterium-mediated transformation of strawberry calli and re-
López-Aranda JM, Valpuesta V, Pliego-Alfaro F, Quesada MA, Mercado covery of transgenic plants. Plant Cell Reports 9, 10-13
JA (2002) Manipulation of strawberry fruit softening by antisense expression Nehra NS, Stushnoff C, Kartha KK (1989) Direct shoot regeneration from
of a pectate lyase gene. Plant Physiology 128, 751-759 strawberry leaf disks. Journal of the American Society of Horticultural Sci-
Jones OP, Waller BJ, Beech MG (1988) The production of strawberry plants ence 114, 1014-1018
from callus culture. Plant Cell, Tissue and Organ Culture 12, 235-241 Nehra NS, Stushnoff C, Kartha KK (1990c) Regeneration of plants from im-
Karami O, Esna-Ashari M, Karimi Kurdistani G, Aghavaisi B (2009) Agro- mature, leaf-derived callus of strawberry. HortScience 66, 119-126
bacterium-mediated genetic transformation of plants: The role of host. Biolo- Nishi S, Oosawa K (1973) Mass propagation method of virus-free strawberry
gia Plantarum 53, 201-212 plants through meristem callus. Japan Agricultural Research Quarterly 7,
Kordestani GK, Karami O (2008) Picloram-induced somatic embryogenesis 189-194
in leaves of strawberry (Fragaria Ananassa L.). Acta Biologica Cracoviensia Nyman M, Wallin A (1988) Plant regeneration from strawberry (Fragaria ×
Series Botanica 50, 69-72 ananassa) mesophyll protoplasts. Journal of Plant Physiology 133, 375-377
Landi L, Mezzetti B (2006) TDZ, auxin and genotype effects on leaf organo- Nyman M, Wallin A (1992) Improved culture technique for strawberry (Fra-
genesis in Fragaria. Plant Cell Reports 25, 281-288 garia × ananassa Duch.) protoplasts and the determination of DNA content
Lazo GR, Stein PA, Ludwig RA (1991) A DNA transformation competent in protoplast derived plants. Plant Cell, Tissue and Organ Culture 30, 127-
Arabidopsis genomic library in Agrobacterium. Bio/Technology 9, 963-967 133
Lee ECM, de Fossard RA (1977) Some factors affecting multiple bud forma- Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL,
tion of strawberry (Fragaria ananassa Duchesne) in vitro. Acta Horticultu- Veilleux RE, Shulaev V (2006) High-efficiency transformation of the diploid
rae 78, 187-195 strawberry (Fragaria vesca) for functional genomics. Planta 223, 1219-1230
Lis EK (1987) Somatic embryogenesis and plantlets formation from flower Owen HR, Miller AR (1996) Haploid plant regeneration from anther cultures
buds cultivated in vitro. Acta Horticulturae 212, 731 of three North American cultivars of strawberry (Fragaria × ananassa
Lis EK (1993) Strawberry plant regeneration by organogenesis from peduncle Duch.). Plant Cell Reports 15, 905-909
and stolon segments. Acta Horticulturae 348, 435-438 Passey AJ, Barrett KJ, James DJ (2003) Adventitious shoot regeneration from
Liu YG, Shirano Y, Fukaki H, Yanai Y, Tasaka M, Tabata S, Shibata D seven commercial strawberry cultivars (Fragaria × ananassa Duch.) using a
(1999) Complementation of plant mutants with large genomic DNA frag- range of explant types. Plant Cell Reports 21, 397-401
ments by a transformation-competent artificial chromosome vector ac- Pechan PM, Bartels D, Brown DCW, Schell J (1991) Messenger RNA and
celerates positional cloning. Proceedings of the National Academy of Scien- protein changes associated with induction of Brassica microspore embryo-
ces USA 96, 6535-6540 genesis. Planta 184, 161-169
Liu ZR, Sanford JC (1988) Plant regeneration by organogenesis from straw- Popescu AN, Isac VS, Coman MS, Radulescu MS (1997) Somaclonal varia-
berry leaf and runner tissue. Horticulture Science 23, 1057-1059 tion in plants regenerated by organogenesis from callus culture of strawberry
López-Aranda JM, Pliego-Alfaro F, López-Navidad I, Barceló-Muñoz M (Fragaria × ananassa). Acta Horticulturae 439, 89-96
(1994) Micropropagation of strawberry (Fragaria × ananassa Duch.). Effect Pramanik MHR, Imai R (2005) Functional identification of a trehalose-6-
of mineral salts, bezyladenide levels and number of subcultures on the in phosphatise gene that is involved in transient induction of trehalose biosyn-
vitro and field behaviour of the obtained microplants and the fruiting capacity thesis during chilling stress in rice. Plant Molecular Biology 58, 751-762
of their progeny. Journal of Horticultural Science 69, 625-637 Puite KJ, Schaart JG (1998) Agrobacterium-mediated transformation of the
Margara J (1984) Bases de la Multiplication Vegetative, INRA, Versailles, apple cultivars ‘Gala’, ‘Golden Delicious’ and ‘Elstar’, and the strawberry
Paris, 262 pp cultivars ‘Gariguette’, ‘Polka’ and ‘Elsanta’. Acta Horticulturae 484, 547-
Martinelli A, Gaiani A, Cella R (1997) Agrobacterium-mediated transforma- 556
tion of strawberry cultivar Marmolada onebar. Acta Horticulturae 439, 169- Qin Y-H, Zhang S, Zhang LX, Zhu D, Asghar S (2005a) Response of straw-
10
berry cv. Toyonoka in vitro to silver nitrate (AgNO3). HortScience 40, 747- Sorvari S, Ulvinen S, Hietaranta T, Hiirsalmi H (1993) Preculture medium
751 promotes direct shoot regeneration from micropropagated strawberry leaf
Qin Y-H, Zhang SL, Asghar S, Zhang LX, Qin QP, Chen KS, Xu CJ disks. HortScience 28, 55-57
(2005b) Regeneration mechanism of Toyonoka strawberry under different Sowik I, Bielenin A, Michalczuk L (2001) In vitro testing of strawberry resis-
color plastic films. Plant Science 168, 1425-1431 tance to Verticillium dahliae and Phytophthora cactorum. Scientia Horticul-
Qin Y, Teixeira da Silva JA, Zhang L-X, Zhang S-L (2008) Transgenic straw- turae 88, 31-40
berry: State of the art for improved traits. Biotechnology Advances 26, 219- Sutter EG, Ahmadi H, Labavitch JM, Altman A, Ziv M (1997) Direct re-
232 generation of strawberry (Fragaria × ananassa Duch.) from leaf disks. Acta
Qin Y, Bi J-H, Teixeira da Silva JA, Zhang S-L, Hu G-B (2011) Response of Horticulturae 447, 243-245
in vitro strawberry to antibiotics. Plant Growth Regulation 65 (1), 183-193 Taji AM, Williams RR (1996) Overview of Plant Tissue Culture. In: Taji AM
Quesada MA, Martín-Pizarro C, García-Gago JA, Posé S, Santiago N, and Williams RR (Eds) Tissue Culture of Australian Plants: Past, Present and
Sesmero R, Pliego-Alfaro F, Mercado JA (2007) Transgenic strawberry: Future, University of New England Press, Armidale, Australia, pp 1-15
Current status and future perspectives. Transgenic Plant Journal 1, 280-288 Tanprasert P, Reed BM (1998) Detection and identification of bacterial con-
Quesada MA, Blanco-Portales R, Posé S, García-Gago JA, Jiménez- taminants of strawberry runner explants. Plant Cell, Tissue and Organ Cul-
Bermúdez S, Muñoz-Serrano A, Caballero JL, Pliego-Alfaro F, Mercado ture 52, 53-55
JA, Muñoz-Blanco J (2009) Antisense down-regulation of the FaPG1 gene Titov S, Bhowmik SK, Mandal A, Alam MS, Nasiruddin S (2006) Control of
reveals an unexpected central role for polygalacturonase in strawberry fruit phenolic compound secretion and effect of growth regulators for organ for-
softening. Plant Physiology 150, 1022-1032 mation from Musa spp. cv. Kanthali floral bud explants. American Journal of
Rugini E, Orlando R (1992) High efficiency shoot regeneration from calluses Biochemistry and Biotechnology 2, 97-104
of strawberry (Fragaria × ananassa Duch.) stipules of in vitro cultures. Jour- Torné JM, Moysset L, Claparols I, Simón E (1996) Photocontrol of somatic
nal of Horticultural Science 67, 577-582 embryogenesis and polyamine content in Araujia sericifera petals. Physiolo-
Schaart JG, Salentijn EMJ, Krens FA (2002) Tissue-specific expression of gia Plantarum 98, 413-418
the -glucuronidase reporter gene in transgenic strawberry (Fragaria × ana- Torné JM, Moysset L, Santos M, Simon E (2001) Effects of light quality on
nassa) plants. Plant Cell Reports 21, 313-319 somatic embryogenesis in Araujia sericifera. Physiologia Plantarum 111,
Schaart JG, Krens FA, Pelgrom KTB, Mendes O, Rouwendal GJA (2004) 405-411
Effective production of marker-free transgenic strawberry plants using indu- Van Wordragen MG, Dons HJM (1992) Agrobacterium tumefaciens-mediated
cible site-specific recombination and a bifunctional selectable marker gene. transformation of recalcitrant crops. Plant Molecular Biology Reporter 10,
Plant Biotechnology Journal 2, 233-240 12-36
Schaart JG, Krens FA, Wolters A-MA, Visser RGF (2010) Transformation Vellicce GR, Díaz Ricci JC, Hernández L, Castagnaro AP (2006) Enhanced
methods for obtaining marker-free genetically modified plants. In: Stewart resistance to Botrytis cinerea mediated by the transgenic expression of the
CN Jr., Touraev A, Citovsky V, Tzfira T (Eds) Plant Transformation Tech- chitinase gene ch5B in strawberry. Transgenic Research 15, 57-68
nologies, Wiley-Blackwell Publishing, pp 229-242 Verhagen SA, Wann SR (1989) Norway spruce somatic embryogenesis: high-
Schaart JG, Kjellsen TD, Mehli L, Heggem R, Iversen T-H, Schouten HJ, frequency initiation from light-cultured mature embryos. Plant Cell, Tissue
Krens FA (2011a) Towards the production of genetically modified straw- and Organ Culture 16, 103-111
berries which are acceptable to consumers In: Husaini AM, Mercado JA Wang D, Wergin WP, Zimmerman RH (1984) Somatic embryogenesis and
(Eds) Genomics, Transgenics, Molecular Breeding and Biotechnology of plant regeneration from immature embryos of strawberry. HortScience 19,
Strawberry. Genes, Genomes and Genomics 5 (Special Issue 1), 102-107 71-72
Schaart JG, Salentijn EMJ, Pelgrom KTB, Aharoni A, Krens FA (2011b) Wang J, Ge H, Peng S, Zhang H, Chen P, Xu J (2004) Transformation of
Isolation and characterisation of a strawberry fruit-specific promoter. In: strawberry (Fragaria × ananassa Duch.) with late embryogenesis abundant
Husaini AM, Mercado JA (Eds) Genomics, Transgenics, Molecular Breeding protein gene. Journal of Horticultural Science and Biotechnology 79, 735-
and Biotechnology of Strawberry. Genes, Genomes and Genomics 5 (Special 738
Issue 1), 108-114 Wawrzynczak D, Sowik I, Michalczuk L (2000) Agrobacterium-mediated
Shestibratov KA, Dolgov SV (2005) Transgenic strawberry plants expressing a transformation of five strawberry genotypes. Journal of Fruit and Ornamen-
thaumatin II gene demonstrate enhanced resistance to Botrytis cinerea. Sci- tal Plant Research 8, 1-8
entia Horticulturae 106, 177-189 Williams EG, Maheshwaram G (1986) Somatic embryogenesis: Factors influ-
Shulaev V, Korban SS, Sosinski B, Abbott AG, Aldwinckle HS, Folta KM, encing coordinated behaviour of cells as an embryogenic group. Annals of
Iezzoni A, Main D, Arus P, Dandekar AM, Lewers K, Brown SK, Davis Botany 57, 443-462
TM, Gardiner SE, Potter D, Veilleux RE (2008) Multiple models for Rosa- Zhang HM, Wang JL (2005) Establishment of genetic transformation system
ceae genomics. Plant Physiology 147, 985-1003 of ‘‘Allstar’’ strawberry leaf. Biotechnology 15, 68-70
Singh AK, Pandey SN (2004) Genotypic variation among strawberry cultivars Zhao Y, Liu Q, Davis RE (2004) Transgene expression in strawberries driven
for shoot organogenesis. Acta Horticulturae 662, 277-280 by heterologous phloem-specific promoter. Plant Cell Reports 23, 224-230
Slovin JP, Schmitt K, Folta KM (2009) An inbred line of the diploid straw- Zimmerman RH (1981) Micropropagation of fruit plants. Acta Horticulturae
berry Fragaria vesca f. semperflorens for genomic and molecular genetic stu- 120, 217-222
dies in the Rosaceae. Plant Methods 5, 1-10
11
Plant Architecture of Strawberry in Relation to Abiotic Stress,

Nutrient Application and Type of Propagation System
Francesca Massetani • Ramesh Gangatharan • Davide Neri*
Dipartimento di Scienze Ambientali e delle Produzioni Vegetali, Università Politecnica delle Marche, Via Brecce Bianche, 60131 Ancona, Italy
Corresponding author: * d.neri@univpm.it
ABSTRACT
Vegetative growth of strawberry plants turns to generative growth (flower induction and differentiation) under specific thermo-
photoperiods, but agronomic and nutritional factors may establish which kind of growth (vegetative or reproductive) to be strengthened.
As a consequence, environmental stressing conditions assume a key function in determining plant quality during plant propagation and
culture, in relation to different physiological internal factors. The result is a significant modification of plant architecture that influences
the timing of forcing conditions for out of season production, the quantity of chilling to be applied and the effect of day length. Plant
architecture describes the spatial distribution of vegetative and reproductive organs and their developmental phase and thus it is useful to
evaluate plant quality and also to study the results of a few different propagation techniques in the nursery. Time of transplanting,
regulated nutrient deficit, water application and limited substrate soil volume (smaller pot) in tray plant production are some possible
stress manipulations to control plant quality. Important differences in plant architecture are also possible between cultivars, within the
same cultivar grown in different environments and between farms (growers) in the same area, because growing conditions affect plant
vigour, induce the formation of a very different number of lateral flower buds and modify the ability of the plant to form new lateral
shoots along the main shoot. The developmental phase of the flowers is also affected. Depending on the desired production system, the
plant architecture and its potential fruit production can be strongly modified, but in a predictable way, by changing and modulating the
growing techniques in the nursery.
_____________________________________________________________________________________________________________
Keywords: fertilization, flower bud development, flower induction, Fragariaananassa Duch., plant propagation, stolon propagation,
temperature response
Abbreviations: DN, day-neutral; LD, long-day; SD, short day; WB, waiting bed
CONTENTS
INTRODUCTION........................................................................................................................................................................................ 12
Plant architecture ..................................................................................................................................................................................... 13
PLANT ARCHITECTURE IN RELATION TO ABIOTIC FACTORS ....................................................................................................... 15
Abiotic stress ........................................................................................................................................................................................... 15
Photoperiod ............................................................................................................................................................................................. 15
Light intensity and quality ....................................................................................................................................................................... 15
Temperature............................................................................................................................................................................................. 15
Altitude.................................................................................................................................................................................................... 16
Plant propagation..................................................................................................................................................................................... 16
Nutrients .................................................................................................................................................................................................. 18
Water ....................................................................................................................................................................................................... 19
Growing substrate.................................................................................................................................................................................... 19
CONCLUSIONS.......................................................................................................................................................................................... 20
REFERENCES............................................................................................................................................................................................. 20
_____________________________________________________________________________________________________________
INTRODUCTION peratures (threshold ranging between 9-21°C; Hartmann

1947; Went 1957; Ito and Saito 1962; Heide 1977) for
Strawberry (Fragaria spp.) is a herbaceous perennial plant flower initiation (Darrow 1936; Darnell and Hancock 1996).
that shows good ability to adapt to different growing con- This photoperiod sensitivity leads plants to bear only one
ditions and environments (Darrow 1966). This behaviour is spring-summer production coming from inflorescences in-
related to the epigenetic regulation (plasticity) of strawberry duced in the preceding late summer-autumn. Vegetative and
growth and development, and it can be heavily manipulated reproductive developments are oppositely regulated by
by agronomic practices. photoperiod and temperature.
Strawberry cultivars can be classified into 3 main types Cultivars are classified as long-day (LD) plants if
on the basis of photoperiod sensitivity of their flowering flower initiation takes place when daylength is longer than
characters. Junebearing cultivars are widely cultivated and 12 h (Darrow and Waldo 1934); they bear more than one
are considered facultative short-day (SD) plants, requiring production during the year (double cropping). Cultivars are
daylengths shorter than about 11-16 h (Van den Muijzen- considered day-neutral (DN) (Bringhurst and Voth 1980)
berg 1942; Borthwick and Parker 1953; Ito and Saito 1962; genotypes if flower initiation takes place irrespective of
Benoit 1975; Heide 1977; Konsin et al. 2001) or low tem- photoperiod (Durner et al. 1984); they are multiple (triple)
Received: 20 August, 2010. Accepted: 8 May, 2011.

24 position or rank of the flower within the inflorescence

(Guttridge 1985) and also between flowers of the same
position (Webb et al. 1978). Low quality of floral parts can
lead to the production of malformed fruits (Kronenberg
18 Vegetative growth 1959).
Floral organs differentiation takes place with high tem-
perature. Differentiation pace and duration determine the
final number of flowers per inflorescence. A good cor-
relation between the number of flowers inside the buds of
12
Floral induction
the plants and their final fruit production has been reported
(Jemmali and Boxus 1993; Savini 2003).
The inflorescence is located in the terminal position on
a crown: its formation terminate the vegetative growth of
6 the crown and is associated with a change in the rate of ex-
5 10 15 20 25 30 35 40 tension growth of the three or four uppermost axillary buds
Temperature°C that continue the vegetative extension growth on secondary
axis and become branch crowns (Guttridge 1955; Kurokura
Fig. 1 Relation between photoperiod and temperature to induce rep-
et al. 2005a, 2005b). Removal of flower-induced terminal
roductive (flower induction) or vegetative development. Modified from
apex stimulates the growth of axillary buds developing into
Ito and Saito (1962).
branch crowns (Neri et al. 2003). The delay in differentia-
tion of terminal flower is associated with a less lateral shoot
formation because it is possible only after the arrest of main
cropping. shoot growth. Under inductive conditions, terminal inflores-
Plant erratic and complex responses to daylength are cences initiation may occur also on branch crown, leading
also possible, thus the above mentioned classification has to further crown branching. The total number of inflores-
been described as inadequate (Durner et al. 1984) and cul- cences in a plant is dependent on the number of apical meri-
tivars should be classified in a continuum between obligate stems. The secondary branches located underneath the last
single-cropping and continuous flowering forms and the expanded leaf differentiate a very early flower before chil-
difference are only quantitative (Darrow 1966; Nicoll and ling and do not continue this development after of chilling,
Galletta 1987; Sønsteby and Nes 1998; Savini 2003). Pro- whereas those above this leaf are able to continue their dif-
longed short-day exposure of already induced plants can ferentiation (Bosc et al. 2010). Axillary meristems may be
delay floral initiation (Moore and Hough 1962) whereas inactive for months and they can break out in the next
long photoperiod can hasten the development of initiated growing season after a chill period.
buds in SD cultivars that can be thus characterized as SD Flower induction can be asynchronous because induc-
plants in relation to floral induction and LD plants regar- tive factors are effective only on receptive organs, i.e. apex
ding floral development (van der Veen and Meijer 1959; with slowing growth. It is possible to find lateral buds at
Salisbury and Ross 1991). same developmental stage as terminal bud in the basal por-
The photoperiod interact with the temperature and the tion of the crown. In this case, they grow and produce fruit
same daylength may produce different effects according to at same time and they compete as nutrient sink with the
the temperature (Ito and Saito 1962; Heide 1977; Sønsteby main inflorescence and thus they are often referred as ‘vam-
and Nes 1998), with cultivar dependent response (Heide pire buds’. Growers usually remove them manually or, if
1977; Sønsteby 1997; Serçe and Hancock 2005). The longer they want to maintain them appropriately, they provide
the photoperiod, the lower the temperature needed to maxi- higher nutrient supply to the plant.
mize flower bud number (Fig. 1; Ito and Saito 1962). Fur- Vegetative growth is expressed with stolon formation
thermore, flower buds initiation is also possible under un- that is stimulated under high growth rate conditions and
favorable conditions (Takeda et al. 2009). Everbearing vari- weak apical dominance (Neri et al. 2003; Sugiyama et al.
eties show a much shorter vegetative cycle before flower 2004) or higher temperature under long day conditions
formation than in Junebearing ones and form more lateral (Darrow 1936; Heide 1977; Durner et al. 1984; Guttridge
branches and inflorescences per plant. 1985; Le Mière et al. 1996). Some stolons might appear late
The developmental morphology of flower initiation and in the season when the flower induction is already started,
differentiation in strawberry has been described using light but this is due to a delay between formation and elongation
(Ruef and Richey 1926; Waldo 1930; Scilletter and Richey of the stolon, therefore they appear when the flower induc-
1931; Guttridge 1955; Jahn and Dana 1970) and scanning tion is completed. Stolon differentiation begins early in the
electron (Taylor et al. 1997; Manakasem and Goodwin year and often first axillary meristem becomes the first sto-
1998; Kurokura et al. 2005a) microscopy. Floral initiation lon.
is first evident as a raising and broadening of the apical Stolons show a sylleptic behaviour (Neri et al. 2003)
meristem, followed by differentiation of the first bracts and without a rest phase, starting the growth immediately after
of the organs of the primary flower (Jahn and Dana 1970; their formation as axillary meristems (Savini 2003). This
Taylor et al. 1997): sepals followed by the petals, stamens capability to produce stolons is linked with the possibility to
and carpels, respectively. Secondary flowers appear early in make one or several cycles during the same growing season.
the axils of the bracts primordia. In most cultivars, a sec- Additional branch crowns are formed if conditions are
ondary flower develops terminally on each of two or three favourable to increase plant size, when newly formed
branches of the main floral axis, two tertiary flowers for- branch crown buds are present. This time is limited, in vigo-
ming on each secondary branch, and so on (Guttridge 1985) rously growing plants, to the period between the emergence
but inflorescences vary considerably in size and branching of the last stolon in late summer or autumn, and the emer-
structure (Darrow 1929; Anderson and Guttridge 1982). For gence of the first stolon in spring, which approximately
the progressive stages of flower bud development, a con- coincides with flowering. Vegetative growth seems to be
ventional numerical scale has been proposed (Jahn and contrasted by flower differentiation and vice-versa. Plants
Dana 1970; Savini 2003) according to the primary flower less inclined to produce stolons usually have more lateral
that shows more advanced developmental stage than other branches (Savini et al. 2005).
flowers of the inflorescence (Waldo 1930). Also the final
fruit size is bigger for primary fruits and decreases in higher Plant architecture
order fruits.
The size of the flowers and the number and quality of Strawberry plant is a rosette, with a very short stem
floral parts vary between cultivars and depending upon the (crown); its growth is determined, with a terminal inflores-
13
Plant architecture in relation to abiotic factors. Massetani et al.
Fig. 2 Schematic drawing of strawberry plant architecture. From Savini G, Neri D, Zucconi F, Sugiyama N (2005) Strawberry growth and
flowering. An architectural model. International Journal of Fruit Science 5, 29-50, ©2005 with kind permission of Taylor & Francis, London, UK.
A B
Fig. 3 Schematic representation of the physiological mechanism of

flower induction. Each growing axis experiences a rapid growth and a
reduction phase during which the flower differentiation can develop. Dor-
mancy and chilling may interfere with the arrest phase resuming the
growth (modified from Savini 2003). This is repeated both in the central
axis or in the lateral.
cence. The features of the growth habit differ between

varieties or crowns, between plants of different ages or
growing under differing environments. Architecture of the Fig. 4 Strawberry architecture 120 days after transplanting in Medi-
strawberry plant can be represented as extended axes (Gutt- terranean climatic conditions. (A) The plant shows 3 orders of inflores-
ridge 1955; Nicoll and Galletta 1987; Yanagi and Oda cences. (B) 4 orders of inflorescences are shown (represented in Arabic
1990) on which plant vegetative and reproductive organs numerals 1, 2, 3 and 4). Modified from Savini et al. (2006b).
are reported with different colors and symbols (Fig. 2).
Reporting the fate of all the meristems and the develop-
mental stages of flower organs, the analysis of plant archi- plants differ according to their dimension, initial propaga-
tecture is able to show the spatial relationship between tion material, presence of the soil, pot type, storage tech-
organs, along a selected period of time. Thus it is possible nique before planting and to the presence of differentiated
to dynamically study the response of the plants to growing inflorescence. Plants propagated under different environ-
conditions in the nursery, in the field or in forcing culture mental and climatic conditions can differ in the number of
(Figs. 3, 4) and to better understand its behaviour. shoots, stolons, inflorescences or flowers and require spe-
The signal response by the plant varies in relation to its cific growing techniques. Plant quality evaluation is strictly
physiological phase; therefore the same cultural techniques related to the typology, but it should be even based on their
may induce a very different result depending on the plant crop potential. On the other hand, in the nursery stolon for-
quality from the nursery and on the interaction with envi- mation in mother plants is needed to produce new plants,
ronmental conditions. If the architectural analysis is pro- and the presence of flowers is not desirable. Techniques for
perly applied it can also help for the evaluation of plant delaying flower induction are thus useful in this context.
quality in the nursery according to farmer necessity (Savini Information about inflorescence number and their posi-
and Neri 2004). tion along the crown are important to estimate the plant
Propagation techniques allow to produce many different crop potential, developmental stage of floral organs is use-
plant types and to manage production planning. Nursery ful to estimate production earliness and synchronicity.
14
Numerous studies concerning the effects of photoperiod and Table 1 Effect of red light-emitting diode lamps on flowering in straw-
temperature on flowering (Serçe and Hancock 2005; Ver- berry ‘Festival’ (Takeda et al. 2008).
heul et al. 2006; Sønsteby and Heide 2006) are available, Flowered plants (%)
but few take into account the effects of growing conditions 3 October 24 October 27 November 17 December
on the architecture of the plant (Savini and Neri 2004; Control 70.3 83.0 95.7 95.7
Savini et al. 2005, 2006b; Van Delm et al. 2009; Bosc et al. Red Light 37.3 45.7 58.3 62.3
2010).
PLANT ARCHITECTURE IN RELATION TO

ABIOTIC FACTORS prevail (Heide 1977). The place of cultivation modify
notably the ability of the plant to form new crowns along
Abiotic stress the principal axis, for instance more in the Center and North
Italy and less in the South which have a warmer winter. On
Abiotic stresses play an important role to control plant the contrary, the total number of the inflorescences per plant
growth and development in the strawberry nursery tray increased going to South. In South Italy, the later plantation
plant production, strictly interacting with the physiological under conditions of cooler temperature and short photo-
processes which lead to flower induction and differentiation. period, which are favorable to the flower differentiation
As a consequence, programmed environmental stressing determines lower vegetative growth and the formation of
conditions may assume a key function in determining plant only one extension crown per plant.
quality in relation to different physiological internal factors
of the plants. In fact, flower induction is sensitive to Light intensity and quality
thermo-photoperiod but even to other several agronomic
and nutritional factors, such as mineral nutrition and water Flower initiation in SD strawberries may be regulated by
supply (Guttridge 1985) then to their growth rate or to the light quality (Collins 1966; Vince-Prue and Guttridge 1973)
presence of stress, but usually they are considered to play a and intensity. Increasing light intensity (e.g. from 25 or 150
minor role and there is little detailed information on their to 650 μmol m-2 s-1), the number of flowers per plant is sig-
influence on plant architecture. Agronomic and nutritional nificantly higher both in the wild strawberry Fragaria vesca
factors may establish which kind of growth (vegetative or (Chabot 1978) and in a DN cultivated strawberry (Dennis et
reproductive) to be strengthened. The knowledge of envi- al. 1970). Increasing the percentage of shading on the plant,
ronmental and growing factors that affect the generative and a reduction in crown (Wright and Sandrang 1995) leaves
vegetative behaviour of the plants is therefore strategic to and inflorescence number (Awang and Atherton 1995) can
improve yield and fruit quality by anticipating or delaying be observed. Kumakura and Shishido (1985) found that
flower induction and determining inflorescence number and light intensity reduction (85% shading) along with lower
dimension. temperature increased flower induction, but affected it
Furthermore, it is well known that tray plants propa- during reducing day-length period.
gated under different growing conditions in the nursery, Spectral composition of the irradiation appears to
coming from different nurseries or growing systems and quantitatively affect flower bud initiation (Table 1; Takeda
countries may show differences in plant vigour and fruit 2010). Photoperiod extension on SD plants does not delay
production. In effect, specific growing conditions induced floral initiation when using red light, whereas using far red
the formation of a different number of lateral flower buds light it retards floral initiation and using red along with far
and modified the ability of the plant to form new shoots red light decreases floral initiation only when the red/far red
along the central axis. Developmental phases of floral buds ratio is low (Vince-Prue and Guttridge 1973; Kadman-
were also affected (Van Delm et al. 2009). Zahavi and Ephrat 1974; Guttridge 1985). Red light from
Planned and controlled stress or balanced fertilizations Light Emitting Diode lamps at 662 nm can delay flower
can be effective means to induce and stimulate flower for- bud initiation (Takeda 2010). But Jonkers (1965) found no
mation. It is interesting to understand how these factors marked differences in the number of flowering plants or in
interact with plant physiology and architecture, but we can days to flower bud development under either incandescent
assume that there is a main indirect effect through the whole (rich in far-red) or fluorescent (rich in red) light. The use of
plant vigour modification (Fig. 3). photo-selective nets over the plants may select the light
signal that stimulates flower initiation, in particular red and
Photoperiod blue nets prevent flower initiation (Takeda 2010).
Photoperiod is a primary environmental factor controlling Temperature

the transition from vegetative to reproductive growth in
strawberry. The application of LD conditions on SD plants Temperature affects the response of flower induction to
delayed flower induction and then the blooming ability was photoperiod in both SD and DN cultivars. Temperature
delayed too (Bosc et al. 2010). Artificial light or light-proof affects also the rate of flower initiation and the number of
covering can be used to alter the flower differentiation deg- flowers within the inflorescences without significant control
ree and the plant architecture: plants under SD conditions or of photoperiod. Flower bud formation can be totally (Ito
SD followed by LD conditions showed similar plant archi- and Saito 1962; Chabot 1978) or partially (Okimura and
tecture, with advanced flower development for the terminal Igarashi 1997; Verheul et al. 2006) inhibited at prolonged
flower and some flower buds in the top portion of the plant; high temperatures, in the range of 26°C (Durner et al. 1984;
under LD or LD followed by SD conditions plants showed Oda and Yanagi 1993) to 30°C (Ito and Saito 1962; Chabot
less developed terminal inflorescence and less flower buds 1978; Durner and Poling 1988; Okimura and Igarashi 1997)
and differentiated secondary branch (Bosc et al. 2010). whereas flower number is lower in plants at 24°C, com-
Short induction period resulted in less-developed inflores- pared to 18°C (Heide 1977). In warm areas, such as at tro-
cences than the long induction period (Bosc and Demené pical to equatorial latitudes, strawberry can be com-
2009). mercially grown only in the highlands, where temperatures
Propagation, location (altitude and latitude) and trans- are lower.
planting time are main factors in modulating environmental Natural daily fluctuation of temperatures (26.7°/15.6°C
conditions. Plants can be propagated under favorable con- day/night), induce earlier flower formation compared to a
ditions for floral induction in northern areas and then trans- constant temperature of 21°C (Hartmann 1947), and earlier
planted in southern areas to stimulate floral organs forma- flower initiation than at higher (35°/25°C) day/night tem-
tion. Temperature is considered as important as photoperiod perature (Bish et al. 1996). No similar effects of fluctuating
for flowering at high latitudes where long photoperiods temperatures are reported in DN cultivar under a 16 h
15
Fig. 5 Strawberry architecture of different plant types. (A) Frigo plant planted in July, (B) fresh plant planted in September (modified from Savini et
al. 2005). The plants were dissected before winter rest. Arabic numerals represent the orders of inflorescences.
photoperiod (Okimura and Igarashi 1997). The fluctuating Altitude

temperatures can be artificially applied to reproduce natural
environment or to manipulate flower induction (Reichart The location of the nursery affects the flower induction that
1973; Chabot 1978; Durner et al. 1984; Bish et al. 1997). takes place earlier at higher altitude (Savini et al. 2006b)
Regardless of temperature level, a temperature gradient whereas environments with long photoperiod and relatively
from root to shoot stimulates vegetative growth in compari- high temperature minimize flower induction and promote
son to a gradient in the opposite direction and to lack of vegetative growth. Then the differentiation proceeds and all
such gradient (Leshem and Koller 1965). the flowers reach the same development degree, but the
Temperatures below 15.6°C delay flower differentiation number of flowers is different (Savini et al. 2006b). At low
(Darrow 1966). Low temperature is also related to chilling. altitude (higher temperature) plants show reduced vege-
Exposure to cold temperatures (below 7-10°C) applied to tative growth and develop lower number of leaves com-
overcome dormancy may induce strong vegetative growth pared to higher altitude (Riyaphan et al. 2005). Fresh plants
in strawberry (Guttridge 1958; Voth and Bringhurst 1958; from the Spanish highlands nurseries (800-1200 m) give
Pringer and Scott 1964; Wahdan and Waister 1984; The- good fruit productions, beginning in February, when dug up
ranifar et al. 1998). Under favorable climatic conditions within first ten days of October and transplanted in Sou-
plants may balance reproductive responses (Darnell and thern Italy, after few days of storage and transport (Savini
Hancock 1996), and for greenhouse strawberry production 2003). Transplanting at low altitude allows longer flower
cold treatments can avoid the yield decreasing due to a induction and differentiation period with the production of
reduction of vegetative vigour. Chilling reduces flower more flowers and earlier fruits (Savini et al. 2006b). In
induction and stimulates floral differentiation (Durner and Southern Italy, the major part of the flower differentiation
Poling 1987) along with leaf number and runner formation take place in the buds of 2nd and 3rd order on the extension
(Bringhurst et al. 1960; Porlingis and Boynton 1961; Pirin- crown because the mild weather during the fall allow a pro-
ger and Scott 1964; Bailey and Rossi 1965; Guttridge 1969; longed favorable period to differentiation (Fig. 4). In this
Braun and Kender 1985; Rice 1990; Kahangi et al. 1992; condition, vegetative growth may be easily resumed using
Lieten 1997; Tehranifar and Battey 1997). In warm regions, flashlight or gibberellins application (Aspuria and Fujime
chilling preceding the optimum digging date in the nursery 1995; Robert et al. 1999). Moreover in the Northern Italy
may be advantageous for early fruit production, while extra the inflorescence in the primary bud has a higher number of
chilling after the optimum digging date may reduce flower- flowers (13-14) in comparison to the South (10). This beha-
ing (Durner and Polling 1988). Flower production is pos- vior could be due to the prolonged positive conditions for
sible in non-chilled plants (Lieten 1997) but trusses are the differentiation that are common in the north during the
shorter and produce smaller berries (Hamann and Poling growth of the primary buds at the beginning of the fall sea-
1997). A lack of cold can be compensated by artificial son. This favorable time is drastically shorter during sec-
lighting (Van Delm et al. 2010). ondary buds differentiation because of the early arrival of
Cold temperatures are usually applied to store the plants the autumn cold. While in the south, the useful time for the
before planting for programmed cropping (Blommers 1965; differentiation has the tendency to sustain a constant dif-
Rosati 1971; Dijkstra and Van Oosten 1972; Benoit 1973; ferentiation for the whole warm autumn and both orders of
Dammann 1974; Anderson and Guttridge 1975). During inflorescence have a similar number of flowers (Savini
prolonged cold storage, sugars and starch content can 2003).
decline and this is correlated with a decrease of number of
emerging inflorescences and flowers (Molot and Leroux Plant propagation
1973; Kinet et al. 1993; Dradi et al. 1996; Sønsteby and
Hytonen 2005). The stress related to the duration of cold Nursery plant productions undergo continuous development.
storage may result in earlier flowering (Lieten et al. 1995). In the past, when the cultivation was polyennial, fresh
16
A A
B B
Fig. 6 Tray plants production in Belgium. (A) In the field during Fig. 7 Tray plants in the green house in Belgium. (A) Plants after
September. (B) Root system of tray plant. transplanting, (B) fruit production after 40 days of transplanting.
plants were transplanted in autumn or in spring depending production. Refrigerated plants are ready for planting in
on winter climate. Subsequently the use of frigo stored different seasons because they are already flower induced
plants for Junebearing annual systems with summer plan- under appropriate thermo-photoperiodic conditions (Fig. 7).
ting became popular to increase fruit size and shorten pro- To increase the number of flowers per plant, the stolons
duction period in the next spring. The frigo plants, before prepared in the summer can last for longer in the nursery
the plantation, have only one terminal bud with an inflo- fields with favourable conditions (Waiting Bed - WB) to
rescence, differentiated in the preceding year before the grow so much to have more than one differentiated crown
cold storage period. While after transplanting, the period of per plant and a potential production of 500-800 g fruit (Fig.
growth at the end of the summer induces the development 8). They are stored with bare roots at the same refrigerated
of a different number of lateral buds during the autumn (Fig. condition of the tray plants. An intermediate situation
5; Savini et al. 2005). between frigo (bare root cold stored) plants and WB plants
If the frigo plants are stored too long, they suffer the results when selected big plants from the nursery (com-
transplanting in September-October and they are not able to mercial class A++) are cold stored after flower differenti-
well grow and differentiate so to give a production starting ation in the same refrigerated condition. A++ plants have a
from December or January in mild climate (South Italy and good potential to give a production after transplanting, but
in general in Mediterranean conditions). In this condition, generally less than 400 g per plant.
the frigo plants are actually substituted by the use of fresh Planning strategies and techniques with fresh plants
dug plants with naked root from the altitude nursery or the allow as well as to control the vegetative and generative
north regions with early cold in the autumn. behaviour of the plants. Remarkable thermal excursion
Nowadays to programme the out-of-season production, between day and night and low summer temperatures (high
tray plants are increasingly used as they are less susceptible altitude) are favourable conditions in the strawberry nursery,
to problems associated with adverse winter conditions and interesting for fresh plants production: flower induction
able to preserve a vegetative-reproductive equilibrium, with takes place early and leads to higher inflorescence number
particularly high flower differentiation and starch reserves than in the low land. These conditions in tray plants stimu-
in the crown. To produce this type of plant, stolons are late vegetative growth too (Savini et al. 2006a).
planted in August in trays with peat substrate (Lieten 2000). Plant architecture shows significant modification chan-
Tray plant cultural techniques in autumn must provide ging the date of forcing. The plants respond to low tempera-
adequate conditions for floral induction to obtain an optimal tures in different ways depending on the physiological
fruit production and quality during winter and spring (Fig. phase of particular organs and their relative positions.
6). The plants are characterised by very rapid growth in late Axillary meristems at maximum level of dormancy
summer and early autumn. Then after the growth ceases due (middle of September in France) do not develop secondary
to low temperatures, plants are moved into the climate shoots after placing the plants in the greenhouse. As the
control chambers at low temperature (-2°C) for cold storage chilling requirement is increasingly satisfied, the axillary
until the time of forcing in the greenhouse for programmed meristems initiate new secondary shoots, but when the
17
(Palha et al. 2010).

A When the formation of shoots stimulate prolonged and
no contemporary fruit production, delayed planting is
necessary. When transplanting delay is needed, plants must
be already differentiated from the nursery. Small planting
distance (high density) affect lateral shoots growth with
advantage for uppermost buds.
Nutrients
The nutrient level and type of substrate strongly influence

the growth and architecture of the plant (Savini 2003;
Savini and Neri 2003). The relative ratio between nitrogen
and phosphorous controls the vegetative equilibrium in
many plant species. High nitrogen availability can stimulate
both stolon and shoot formation, depending upon the supply
time and plant growth rate (Savini 2003; Savini and Neri
2004). When apex growth is fast, stolons formation is
induced. Excess nitrogen in fertilization can affect flower
B induction (Fujimoto 1972; Furuya et al. 1988; Matsumoto
1991; Yamasaki et al. 2002) determining a delay in flower
differentiation and stimulating stolon or vampire buds for-
mation. Increasing nitrogen can increase stolon number and
affect their length, with genotype dependent response (Sil-
berbush and Lips 1988; Moon et al. 1990; Tworkoski et al.
2001). If high nutrient supply stimulates vigour after apex
growth is stopped, axillary latent meristems are reactivated
to growth and generate shoots in the basal part of the crown
increasing the total number of possible inflorescences, but
not stolons. When fertilization is made later on, it can sti-
mulate shoot formation in the upper portion of the plant.
These shoots show less developed flowers compared to
terminal primary inflorescence. Very high nitrogen levels
(50 mg/plant) may totally prevent flower buds formation,
even under extended inducing treatment (Yamasaki et al.
2002). The reduction in availability of soil nutrients, espe-
cially nitrogen deficiency, seems to increase plant sensiti-
Fig. 8 Waiting Bed (WB) plants in Belgium. (A) Plants after trans- vity to inductive conditions (Strik 1985; Battey et al. 1998;
planting in the field in July, (B) good production obtained in September. Lieten 2002). Nevertheless, during inductive period, nitro-
gen, potassium, phosphorus and manganese content in shoot
apex and leaves of induced plants is higher compared to
non induced plants (Yamasaki et al. 2000; Eshghi and Tafa-
temperature is too cold (delayed placing in the greenhouse zoli 2007). However, the rates of uptake are lower in
after the end of October) lateral growth is damaged (Savini autumn than in spring for all nutrients (Tagliavini et al.
et al. 2006a). 2005). Reduced nutritional level depress vegetative growth
In bare rooted plants, root system mainly serves for and can promote flower induction (Guttridge 1985) and
overcoming the transplantation crisis and subsequently de- production of more flowers. Plants under low nitrogen
generates. Removal of part of the leaves stimulate compen- availability start to initiate flower buds after few days of
sative growth of the plant (Hansen 1996) and shoot forma- inducing treatment, but after flower bud initiation, the
tion in the basal part of the crown, coming out from existing differentiation of the floral organs requires more nitrogen
meristems; plant vigour and fruiting increase (Guttridge et (Yamasaki et al. 2002). If low nutrient supply persists
al. 1960). Small cold stored plants transplanted without during flower induction and differentiation it could revert
leaves have small vegetative growth compared to larger tray, the meristem from reproductive to vegetative growth (van
waiting-bed or frigo plants transplanted with initial leaves den Muijzenberg 1942) or affect the regular formation
(Palha et al. 2010). Plant defoliation after repotting pro- (Strik 1985; Battey et al. 1998; Lieten 2002) and reduce the
duces low nutrition conditions that can reduce numbers of numbers of flowers and the inflorescence size, apparently
flowers and then inflorescence size, apparently because of because of initiation failures (Anderson and Guttridge
initiation failures (Anderson and Guttridge 1982). 1982).
Plant deblossoming increase leaves (Daugaard 1999) Nutrient application effect is therefore dependent on the
and runner production in some cultivars (Scott and Marth timing of the application: if applied at the beginning of
1953; Robertson and Wood 1954; Moors and Scott 1965), inductive thermo-photoperiod conditions, nitrogen, phos-
in some other cultivars runner increasing is reported only phate and potassium fertilizer delays flower bud initiation
with defoliation combined treatment, whereas in other more than delayed application (Yamasaki and Yano 2009).
genotypes flower removal does not promote runner produc- Temporary suspension of fertigation, during the flower in-
tion (Waithaka 1985). Removal of runners stimulates and duction of tray plants, allows to anticipate the differentia-
hastens branch crown development (Hancock 1999). tion of terminal flower bud with positive effects on inflores-
Early transplanting stimulates shoot formation and cence development and flower number (Fig. 9; Savini
flower differentiation, whereas late transplanting reduce 2003); while continuous high nutrition delays flower initia-
crop load. Advancing the plugging date of SD plants to tion and may induce some defect in primary berries
early July can induce the plants to flower early (Takeda and (Yoshida 1992; Lieten 2002). Malformed fruits are reduced,
Newell 2007) instead of growing transplants in artificial, if high nitrogen supply is delayed after sepal differentiation.
SD and low temperature conditions in late summer (Verheul With continuous supply of nutrients, lateral shoots out-
et al. 2006, 2007). Planting date does not affect vegetative growth take place from the apical part and continue down-
growth whereas flowers and inflorescence number increase ward, whereas, if the fertigation is suspended, shoots forma-
with later planting dates in autumn production systems tion occur exclusively from apical buds (Savini 2003). With
18
Table 2 Number of branch crowns and flowers of strawberry plants cul-

A B tivar ‘Korona’ as influenced by different levels of water supply (Gehrmann
1985).
Water supply
(% of daily water consumption)
100 75 50 25
Crowns on 19 February 5 3 3 2
Crowns on 19 September 6 3 3 2
Crowns on 7 May 19 8 4 3
Flowers 25 23 20 21
1992).
Stolon production and growth are sensitive to moisture
stress (van Der Zanden and Cameron 1996; Tworkoski
2001). A sufficient water supply is essential for an accepta-
ble yield, but water stress after the beginning of the flower-
ing may allow flower induction even under unfavorable
environmental conditions (Naumann 1961). This is particu-
larly important during bud differentiation, flower and fruit
development. Naumann (1964) obtained higher yield pro-
viding water in autumn as compared to spring irrigation,
Fig. 9 Plant architecture in relation to nutrient supply technique. (A) because of a better supply during flower bud initiation and
Under continuous fertigation and (B) with suspension of nutrition. The differentiation.
plants were dissected 45 days after the treatment (modified from Savini The stress due to the excess of salt in irrigation water
2003). Capital letters represent progressive stages of flower bud develop- can significantly reduce the production of inflorescences,
ment, according to the primary flower, from A: Primary flower primor- flowers (Khayyat et al. 2009) but even of leaves and crowns
dium to H: formed primary flower with yellow anthers. (Awang and Atherton 1995). As a consequence there is a
loss of fruit setting (Saied et al. 2005) even in absence of
visible plant injury (Brown and Voth 1955). Furthermore,
reduced nutrition at the end of summer until mid–Septem- high salt concentration has inhibitory effects on stolon out-
ber, crowns do not became bigger, but floral initiation is growth (Ondrašek et al. 2006).
favored and fruit number can increase, with more quarter-
nary and quinary flowers on first and second truss and more Growing substrate
secondary and tertiary flowers on second and third truss
(Lieten 2002). Starting nutrient application after September The substrate is one of the fundamental factors to modulate
can strongly reduce crown size. During nursery, reduced the plant development. Because sensitivity of the plant to
nitrogen application (7.5 kg N/ha) at the beginning, fol- flower induction is greater when the growth is reduced, sub-
lowed by increased supply (15 kg N/ha) at the end of strate can affect the plant response inducing different levels
August or in September and decreased nitrogen application of vegetative vigour and number of nodes per shoot in
(7.5 kg N/ha) in October may advance flower initiation in relation to the cultivar. Production potential changes in rela-
comparison to low or high constant supply from the begin- tion to the type of substrate and it is possible to make SD
ning of August (Desmet et al. 2009). Low nutrient supply cultivars produce similarly to Everbearing cultivars using
during flower differentiation until mid October prevents the appropriate substrate. Even shoot location and number
further development of initiated flowers that cannot produce along the crown is affected by the substrate (Fig. 10; Savini
fruits, even with high nutrient conditions during the other 2003).
growth phases of the plant. Reduction after mid October Fine peat is an optimal substrate for propagation of
does not affect the fruit production. large runner (Kehoe et al. 2009). With organic substrate
The lack of manganese does not have any effect on the (peat and compost) plants of DN cultivar showed lower
flower characteristics, and fruit number (Lieten 2004). flower differentiation in the second flower flush compared
About the source of nutritional factors, the addition of or- to inert substrate (Savini 2003) and earlier fruit production.
ganic matter (cattle, poultry, sheep or manure) stimulate Organic substrate led to lower development of the plant
production of leaves and accelerate flowering date com- with a lower number of inflorescences per plant and con-
pared to conventional fertilizer (Abu-Zahra and Tahboub sequent low production. The low fruit load resulted in an
2008). increase of vegetative growth and this probably led to the
In relation to interaction with plant architecture and formation of a greater number of stolons (Savini 2003) in
growth, nutritional protocol should be managed in different the following growth. When grown with an inert substrate,
ways during propagation in the nursery and during plant plants produce many high order inflorescences, leading to
growing. asynchronous production (Savini 2003). In substrate con-
taining peat, ‘Camarosa’, ‘Gaviota’ (SD) and ‘Selva’ (DN)
Water cultivar produce the highest number of crowns and leaves
compared to sand or perlite without peat (Tehranifar et al.
Mild water deficits (-0.03, -0.05 and -0.07 Mpa) can reduce 2007). Plants grown in sand 100% produce flowers earlier
fruit production because of decreased mean fruit weight and but lowest number of fruit than in other growing media
diminished fruit number (Table 2; Davies and Albrigo (peat, perlite, cocopeat or combined media) (Tehranifar et al.
1983; Gehrmann 1985; Peñuelas et al. 1992; Serrano et al. 2007). Without nutrition adjustment, rockwool substrate
1992). This can be related to the fact that branch crowns determines less vegetative growth, lower yield and earlier
development is dependent on water supply and they do not harvest in comparison to peat (Jansen 1997).
develop under strongly reduced water supply (25% of daily Small pot volumes increase plant sensitivity to inducing
water consumption) while few shoots develop under mild conditions (Fujishighe 1994) and stimulate early flower
water stress (Gehrmann 1985). Moreover, even mild water induction during plant root system formation, but if the
stress determines rapid reduction of photosynthesis (Lenz growing period in the tray is too prolonged, root occupies
1975). Different water regimes have no effects on the dura- the whole substrate volume and it is under stress condition,
tion of fruit production (Dwyer et al. 1987; Serrano et al. resulting in lower flower quality. At low plant density (33-
19
A B C
Fig. 10 Architecture of ‘Darselect’ plants grown with different substrates. (A) Blonde peat/pine bark/coco fibre, (B) Blonde peat /brown peat /perlite,
(C) commercial mould. Modified from Savini (2003).
43 plants/m2) during the autumn, more inflorescences and fate of high-order flower buds. Crop Research 22, 105-122
flowers form and higher yield is possible in the following Aspuria JR, Fujime Y (1995) Eco-physiological studies in the analysis of dor-
spring than at higher density (66-87 plants/m2) (Jansen mancy in strawberry. Acta Horticulturae 395, 97-104
Awang YB, Atherton JG (1995) Growth and fruiting responses of strawberry
1997).
plants grown on rockwool to shading and salinity. Scientia Horticulturae 62,
25-31
CONCLUSIONS Bailey JS, Rossi AW (1965) Effect of fall chilling, forcing temperature, and day
length on the growth and flowering of ‘Catskill’ strawberry plants. Proceed-
Reproductive and vegetative behaviour of strawberry plants ings of the American Society for Horticultural Science 87, 245-252
are known to be sensitive not only to temperature and Battey NH, Le Mière P, Tehranifar A, Cekic C, Taylor S, Shrives KJ,
photoperiod but also to several agronomic and nutritional Hadley P, Greenland AJ, Darby J, Wilkinson MJ (1998) Genetic and envi-
factors. Plant propagation systems and growing techniques ronmental control of flowering in strawberry. In: Cockshull KE, Gray D, Sey-
can modulate many abiotic factors to modify environmental mour GB, Thomas B (Eds) Genetic and Environmental Manipulation of Hor-
ticultural Crops, CAB International, Wallingford, pp 111-131
conditions. Knowledge about the effect of abiotic factors on
Benoit F (1973) How do we get to a late-season strawberry crop? A comparison
the production of flowers, shoots or runners in strawberries, between several methods. Fruitteeltblad 17, 133-136
provide management tools to program the plants and the Benoit F (1975) Further observations on the induction of a second flowering in
yield. the strawberry cultivar ‘Redgauntlet’. Agricultura 23, 29-35
Even mild and controlled abiotic stressing conditions Bish EB, Cantliffe DJ, Chandler CK (1996) Pretransplant temperature regime
can be powerful means to modify strawberry plant architec- and container size alter strawberry plant morphology. HortScience 31, 566
ture. They play an important role to control plant growth (Abstract)
and development, through the control of the intrinsic vigour Bish EB, Cantliffe DJ, Hochmuth GJ, Chandler CK (1997) Development of
during plant propagation in the nursery, and thus strictly containerized strawberry transplants for Florida’s winter production system.
Acta Horticulturae 439, 461-468
interacting with the physiological processes which lead to
Blommers J (1965) De teelt van verlate aardbeien in 1965. Groenten en Fruit
stolon formation, branching and flower induction/differen- 21, 543
tiation. Therefore, the control of growth and development of Borthwick HA, Parker MW (1953) Light in relation to flowering and vege-
the plant in the nursery can strongly modify the entity and tative development. In: 13th International Horticultural Congress, September
the time of fruit production in the field after transplanting. 1952, London, The Royal Horticultural Society, London, pp 801-810
Plant architecture that describes the spatial distribution Bosc JP, Demené MN (2009) Floral induction duration, plant architecture and
of vegetative and reproductive organs and their develop- fruit production relations in strawberry cv. ‘Ciflorette’. Acta Horticulturae
mental phase is therefore useful to evaluate plant quality. 842, 667-670
This will have an impact on the possibility to predict the Bosc JP, Neri D, Massetani F, Bardet A (2010) Relationship between plant
architecture and fruit production of the short-day cultivar strawberry ‘Gari-
production (time and quantity) by analysing the real archi-
guette’. In: 28th International Horticultural Congress, 22-27 August, 2010,
tecture of plants at the moment in which the plants are Lisbon, Portugal, p 9 (Abstract)
forced or chilled. The plant dimension, amount of chilling Braun JW, Kender WJ (1985) Correlative bud inhibition and growth habit of
and growing degree hours are the other basic information to the strawberry as influenced by application of gibberellic acid, cytokinin, and
manage the production potential and timing. The genetic chilling during short day length. Journal of the American Society for Horti-
differences have a high hierarchic rank in the control of cultural Science 110, 28-34
flowering but the interaction with the type of propagation Bringhurst RS, Voth V (1980) Six new strawberry varieties released. Califor-
and cultural techniques, such as planting date and forcing nia Agriculture 34, 12-15
condition, make impossible to generalize and to predict any Bringhurst RS, Voth V, van Hook D (1960) Relationship of root starch content
and chilling history to performance of California strawberries. Proceedings of
results without an empirical approach. Even though, it can
the American Society for Horticultural Science 75, 373-381
be argued that, knowing the plant architecture, the potential Brown JG, Voth V (1955) Salt damage to strawberries. California Agriculture
fruit production can be modified in a predictable way by 9, 11-12
changing and modulating the growing techniques in the Chabot BF (1978) Environmental influences on photosynthesis and growth in
nursery and after transplanting, according to the desired Fragaria vesca. New Phytologist 80, 87-98
production system and the specific genetic material. Collins WB (1966) Floral initiation in strawberry and some effects of red and
far-red radiation as components of continuous white light. Canadian Journal
REFERENCES of Botany 44, 663-668
Dammann HJ (1974) Erdbeerkultur mit Frigopflanzen. Mitteilungen des Obst-
Abu-Zahra T, Tahboub A (2008) Strawberry (Fragaria x ananassa Duch.) bauversuchsringes des Alten Landes 29, 327-329
growth, flowering and yielding as affected by different organic matter sour- Darnell R, Hancock JF (1996) Balancing vegetative and reproductive growth
ces. International Journal of Botany 4, 481-485 in strawberry. In: Pritts MV, Chandler CK, Crocker TE (Eds) Proceedings of
Anderson HM, Guttridge CG (1975) Survival and vigour of cold-stored the IV North American Strawberry Conference, February 15-17, 1995,
strawberry runner plants after different lifting dates, storage temperatures and Gainesville, University of Florida, Orlando, pp 144-150
pre-storage treatments. Experimental Horticulture 27, 48-57 Darrow GM (1929) Inflorescence types of strawberry varieties. American
Anderson HM, Guttridge CG (1982) Strawberry truss morphology and the Journal of Botany 16, 571-585
20
Darrow GM (1936) Interrelation of temperature and photoperiodism in the pro- Jonkers H (1965) On the flower formation, the dormancy and the early forcing
duction of fruit buds and runners in the strawberry. Proceedings of the Ame- of strawberries. PhD thesis, Mededelingen van de Landbouwhogeschool,
rican Society for Horticultural Science 34, 360-363 Wageningen, 59 pp
Darrow GM (1966) The Strawberry. History, Breeding and Physiology, Holt, Kadman-Zahavi A, Ephrat E (1974) Opposite response groups of short-day
Rinehart & Winston, New York, 447 pp plants to the spectral composition of the main light period and to end-of-day
Darrow GM, Waldo GF (1934) Responses of strawberry varieties to the dura- red or far-red irradiations. Plant and Cell Physiology 15, 693-699
tion of the daily light period. USDA Technical Bulletin 453, 1-31 Kamakura H, Shishido Y (1985) Effect of temperature and light condition on
Daugaard H (1999) The effect of flower removal on the yield and vegetative flower initiation and fruit development in strawberry. Japan Agricultural Re-
growth of A+ frigo plants of strawberry (Fragaria × ananassa Duch.). Scien- search Quarterly 26, 241-250
tia Horticulturae 82, 153-157 Kahangi EM, Fujime Y, Nakamura E (1992) Effects of chilling and growth
Davies FS, Albrigo LG (1983) Water relations of small fruits. In: Kozlowski regulators on runner production of three strawberry cultivars under tropical
TT (Ed), Water Deficits and Plant Growth, Academic Press, New York, pp conditions. Journal of Horticultural Science 67, 381-384
89-136 Kehoe E, Savini G, Neri D (2009) The effects of runner grade, harvest date and
Dennis FG, Lipecki J, Kiang CL (1970) Effects of photoperiod and other fac- peat growing media on strawberry tray plant fruit production. Acta Horticul-
tors upon flowering and runner development of three strawberry cultivars. turae 842, 699-702
Journal of the American Society for Horticultural Science 95, 750-754 Khayyat M, Vazifeshenas MR, Rajaee S, Jamalian S (2009) Potassium effect
Desmet EM, Verbraeken LV, Baets W (2009) Optimisation of nitrogen fertili- on ion leakage, water usage, fruit yield and biomass production by strawberry
sation prior to and during flowering process on performance of short day plants grown under NaCl stress. Journal of Fruit and Ornamental Plant
strawberry ‘Elsanta’. Acta Horticulturae 842, 675-678 Research 17, 79-88
Dijkstra J, van Oosten AA (1972) Harvesting strawberries in August and Sep- Kinet J, Parmentier A, Lieten P (1993) Changes in quality of cold-stored
tember. Fruitteelt 62, 175-176 strawberry plants cv. ‘Elsanta’ as a function of storage duration: The flower-
Dradi R, Faedi W, Lavarone E (1996) Influenza della frigoconservazione sulle ing response in controlled environments. Acta Horticulturae 348, 287-293
riserve glucidiche di piante di fragola adatte alle colture fuori suolo. Rivista Konsin M, Voipio I, Palonen P (2001) Influence of photoperiod and duration
di Frutticoltura e di Ortofrutticoltura Italiana 58, 73-76 of short-day treatment on vegetative growth and flowering of strawberry
Durner EF, Barden JA, Himelrick DG, Poling EB (1984) Photoperiod and (Fragaria × ananassa Duch.). Journal of Horticultural Science and Biotech-
temperature effects on flower and runner development in day-neutral, June- nology 76, 77-82
bearing and Everbearing strawberries. Journal of the American Society for Kronenberg HG (1959) Poor fruit setting in strawberries. I. Causes of a poor
Horticultural Science 109, 396-400 fruit set in strawberries in general. Euphytica 8, 47-57
Durner EF, Poling EB (1987) Flower bud induction, initiation, differentiation Kurokura T, Inaba Y, Neri D, Sugiyama N (2005a) A morphological study of
and development in the ‘Earliglow’ strawberry. Scientia Horticulturae 31, the development of the second inflorescences in strawberry (Fragaria x ana-
61-69 nassa Duch.). Annals of Applied Biology 146, 511-515
Durner EF, Poling EB (1988) Strawberry developmental responses to photo- Kurokura T, Iwama T, Inaba Y, Sugiyama N (2005b) Effect of day-length on
period and temperature: A review. Advances in Strawberry Production 7, 6- the developmental pattern of axillary buds in June-bearing strawberry plants.
14 Journal of Horticultural Science and Biotechnology 80, 139-142
Dwyer LM, Stewart DW, Hoewing L, Balchin D (1987) Response of straw- Le Mière P, Hadley P, Darby J, Battey NH (1996) The effect of temperature
berries to irrigation scheduling. HortScience 22, 42-44 and photoperiod on the rate of flower initiation and onset of dormancy in the
Eshghi S, Tafazoli E (2007) Changes in mineral nutrition levels during floral strawberry (Fragaria × ananassa Duch.). Journal of Horticultural Science
transition in strawberry (Fragariaananassa Duch.). International Journal and Biotechnology 71, 361-371
of Agricultural Research 2, 180-184 Lenz F (1979) Wachstum und Wasserverbrauch bei jungen Erdbeerpflanzen
Fujimoto K (1972) Studies on physiological and ecological characteristics of (‘Senga Sengana’) in Abhängigkeit von der Wurzeltemperatur. Erwerbs-
strawberry ‘Hoko-wase’ and development of new cropping type. Special Bul- Obstbau 21, 146-148
letin of the Nara Agricultural Experiment Station 1, 1-151 Leshem Y, Koller D (1965) The control of runner development in the straw-
Fujishige N (1994) Strawberry. In: Konishi K, Iwahori S, Kitagawa H, Yakuwa berry Fragaria × ananassa Duch. Annals of Botany 29, 699-708
T (Eds) Horticulture in Japan, Asakura Publishing Co. Ltd, Tokyo, pp 78-81 Lieten P (1997) Effects of chilling and night-break treatment on greenhouse
Furuya S, Yamashita M, Yamasaki A (1988) Effects of nitrogen content on production of ‘Elsanta’. Acta Horticulturae 439, 633-640
the flower bud initiation induced by chilling under dark condition in straw- Lieten P (2000) Recent advances in Strawberry plug transplant technology.
berries. Bulletin of the Vegetative and Ornamental Crops Research Station, Acta Horticulturae 513, 383-388
Series D 1, 51-57 Lieten P (2002) The effect of nutrition prior to and during flower differentiation
Gehrmann H (1985) Growth, yield and fruit quality of strawberries as affected on phyllody and plant performance of short day strawberry ‘Elsanta’. Acta
by water supply. Acta Horticulturae 171, 463-469 Horticulturae 567, 345-348
Guttridge CG (1955) Observations on the shoot growth of the cultivated straw- Lieten P (2004) Manganese nutrition of strawberries grown on peat. Acta Hor-
berry plant. Journal of Horticultural Science 30, 1-11 ticulturae 649, 227-230
Guttridge CG (1958) The effects of winter chilling on the subsequent growth Lieten P, Kinet J, Bernier G (1995) Effect of prolonged cold storage on the
and development of the cultivated strawberry plant. Journal of Horticultural production capacity of strawberry plants. Scientia Horticulturae 60, 213-219
Science 33, 119-127 Manakasem Y, Goodwin PB (1998) Using the floral status of strawberry
Guttridge CG (1969) Fragaria. In: Evans LT (Ed) The Induction of Flowering, plants, as determined by stereomicroscopy and scanning electron microscopy,
Cornell University Press, New York, pp 247-267 to survey the phenology of commercial crops. Journal of the American Soci-
Guttridge CG (1985) Fragaria × ananassa. In: Halevy A (Ed) Handbook of ety for Horticultural Science 123, 513-517
Flowering, CRC Press, Boca Raton, pp 16-33 Matsumoto O (1991) Studies on the control of flower initiation and dormancy
Guttridge CG, Anderson HM, Thompson PA, Wood CA (1960) Post-harvest in the cultivation of strawberry, Fragaria × ananassa Duch. Special Bulletin
defoliation of strawberry plantations. Journal of Horticultural Science 36, of the Yamaguchi Agricultural Experiment Station 31, 1-102
93-101 Molot PM, Leroux JP (1973) Evolution des glucides dans le rhizome du frai-
Hamann KK, Poling EB (1997) The influence of runner order, night tempera- sier en cours de conservation au frigorifique. Comptes Rendus des Seances de
ture and chilling cycles on the earliness of ‘Selva’ plug plant fruit production. l’Academie d’Agriculture de France 59, 187-189
Acta Horticulturae 439, 597-603 Moon JW, Bailey DA, Fallahi E, Jensen RG, Zhu G (1990) Effect of nitrogen
Hancock JF (1999) Strawberries, CABI Publishing, Wallingford, 237 pp application on growth and photosynthetic nitrogen use efficiency in two eco-
Hansen P (1996) Effects of plant and organ removals and light reduction on types of wild strawberry, Fragaria chiloensis. Physiologia Plantarum 80,
flower and fruit development in strawberry. Acta Agriculturae Scandinavica, 612-618
Section B - Plant Soil Science 46, 74-78 Moore JN, Hough LF (1962) Relationships between auxin levels, time of flo-
Hartmann HT (1947) Some effects of temperature and photoperiod on flower ral induction and vegetative growth of the strawberry. Proceedings of the
formation and runner production in the strawberry. Plant Physiology 22, 407- American Society for Horticultural Science 81, 255-264
420 Moore J, Scott DH (1965) Effects of gibberellic acid and blossom removal on
Heide OM (1977) Photoperiod and temperature interactions in growth and runner production of strawberry varieties. Proceedings of the American Soci-
flowering of strawberry. Physiologia Plantarum 40, 21-26 ety for Horticultural Science 87, 240-244
Ito H, Saito T (1962) Studies on the flower formation in the strawberry plants. I. Naumann WD (1961) Die Wircung zeitlich begrenzter Wassergaben auf Wuch-
Effects of temperature and photoperiod on the flower formation. Tohoku sund Ertragleistun von Erdbeeren. Gartenbau 26, 441-458
Journal of Agricultural Research 13, 191-203 Naumann WD (1964) Bewässerungstermin und Blütenknospendifferenzierung
Jahn OL, Dana MN (1970) Crown and inflorescence development in the bei Erdbeeren. Gartenbauwiss 29, 21-30
strawberry, Fragaria x Ananassa. American Journal of Botany 57, 605-612 Neri D, Sugiyama N, Iwama T, Akagi H (2003) Effect of apical pinching on
Jansen WAGM (1997) Growing media and plant densities for strawberry tray the development of axillary buds in strawberry plants. Journal of the Japa-
plants. Acta Horticulturae 439, 457-460 nese Society for Horticultural Science 72, 389-392
Jemmali A, Boxus P (1993) Early estimation of strawberry floral intensity and Nicoll MF, Galletta GJ (1987) Variation in growth and flowering habits of
its improvement under cold greenhouse. Acta Horticulturae 348, 357-360 Junebearing and Everbearing strawberries. Journal of the American Society
21
for Horticultural Science 112, 872-880 Sønsteby A, Hytönen T (2005) Manipulating flower induction through tempe-
Okimura M, Igarashi I (1997) Effects of photoperiod and temperature on rature and photoperiod fluctuations. International Journal of Fruit Science 5,
flowering in Everbearing strawberry seedlings. Acta Horticulturae 439, 605- 17-27
607 Sønsteby A, Nes A (1998) Short days and temperature effects on growth and
Ondrašek G, Romi D, Romi M, Duralija B, Musta I (2006) Strawberry flowering in strawberry (Fragaria × ananassa Duch.). Journal of Horticultu-
growth and fruit yield in a saline environment. Agriculturae Conspectus Sci- ral Science and Biotechnology 73, 730-736
entificus 71, 155-158 Strik BC (1985) Flower bud initiation in strawberry cultivars. Fruit Varieties
Palha MG, Campo JL, Oliveira PB (2010) Strawberry plant growth and dry Journal 39, 5-9
matter partitioning as influenced by planting date and plant type in an autumn Sugiyama N, Iwama T, Inaba Y, Kurokura T, Neri D (2004) Varietal dif-
production system. In: 28th International Horticultural Congress, 22-27 Aug- ferences in the formation of branch crowns in strawberry plants. Journal of
ust, 2010, Lisbon, Portugal, p 25 (Abstract) the Japanese Society for Horticultural Science 73, 216-220
Peñuelas J, Savé R, Marfà O, Serrano L (1992) Remotely measured canopy Tagliavini M, Baldi E, Lucchi P, Antonelli M, Sorrenti G, Baruzzi G, Faedi
temperature of greenhouse strawberries as indicator of water status and yield W (2005) Dynamics of nutrients uptake by strawberry plants (Fragaria
under mild and very mild water stress conditions. Agricultural and Forest ananassa Duch.) grown in soil and soilless culture. European Journal of
Meteorology 58, 63-77 Agronomy 23, 15-25
Porlingis I, Boynton D (1961) Growth responses of the strawberry plant Fra- Takeda F (2010) Methods for altering the flowering time in strawberries. In:
garia chiloensis var. ‘Ananassa’, to gibberellic acid and to environmental 28th International Horticultural Congress, 22-27 August, 2010, Lisbon, Por-
conditions. Proceedings of the American Society for Horticultural Science 78, tugal, p 11 (Abstract)
261-269 Takeda F, Glenn DM, Stutte GW (2009) Flower bud formation in short-day
Pringer AA, Scott DH (1964) Interrelation of photoperiod, chilling, and flower strawberry cultivar under non-photo inductive conditions. Acta Horticulturae
cluster and runner production by strawberries. Proceedings of the American 842, 761-764
Society for Horticultural Science 84, 295-301 Takeda F, Newell M (2007) Effects of runner tip size and plugging date on fall
Reichart G (1973) Vegetative growth and flower and fruit development in Fra- flowering in short-day strawberry (Fragaria × ananassa Duch.) cultivars.
garia × ananassa cv. ‘Senga Sengana’ under controlled conditions. Horticul- International Journal of Fruit Science 6, 103-117
tural Abstracts 44, 1426 Taylor DR, Atkey PT, Wickenden MF, Crisp CM (1997) A morphological
Rice RPJ (1990) Effects of cultivar and environmental interactions on runner study of flower initiation and development in strawberry (Fragaria x ana-
production, fruit yield, and harvest timing of strawberry (Fragariaana- nassa) using cryo-scanning electron microscopy. Annals of Applied Biology
nassa) in Zimbabwe. Acta Horticulturae 279, 327-332 130, 141-152
Riyaphan P, Pipattanawong N, Subhardrabandu S (2005) Influences of Tehranifar A, Battey NH (1997) Comparison of the effects of GA3 and chilling
elevation on growth and yield of strawberry in Thailand. Kasetsart Journal on vegetative vigour and fruit set in strawberry. Acta Horticulturae 439, 627-
(Natural Science) 39, 535-545 631
Robert F, Risser G, Pétel G (1999) Photoperiod and temperature effect on Tehranifar A, Le Mière P, Battey NH (1998) The effects of lifting date, chil-
growth of strawberry plant (Fragaria × ananassa Duch.). Development of ling duration and forcing temperature on vegetative growth and fruit pro-
morphological test to assess the dormancy induction. Scientia Horticulturae duction in the Junebearing strawberry cultivar ‘Elsanta’. Journal of Horticul-
82, 217-226 tural Science and Biotechnology 73, 453-460
Robertson M, Wood CA (1954) Studies on the development of the strawberry. Tehranifar A, Poostchi M, Arooei H, Nematti H (2007) Effects of seven sub-
I. Flower bud initiations and development in early and late-formed runners in strates on qualitative and quantitative characteristics of three strawberry cul-
1951 and 1952. Journal of Horticultural Science 29, 104-111 tivars under soilless culture. Acta Horticulturae 761, 485-488
Rosati P (1971) Influenza della data di piantagione e della grossezza delle Tworkoski TJ, Benassi TE, Takeda F (2001) The effect of nitrogen on stolon
piante sui risultati della coltura estiva di piante di fragola frigoconservate and ramet growth in four genotypes of Fragaria chiloensis L. Scientia
della cv. ‘Souvenir de Charles Machiroux’. Annali dell’Istituto Sperimentale Horticulturae 88, 97-106
per la Frutticoltura 2, 159-191 Van Delm T, Massetani F, Savini G, Neri D (2009) Plant architecture of straw-
Ruef JU, Richey HW (1926) A study of flower bud initiation in the Dunlap berry trayplants in relation to nutrient application system. VII Convegno
strawberry. Proceedings of the American Society for Horticultural Science 22, AISSA, December 2-4, 2009, Ancona, Italy, AISSA, Firenze, pp 57-58
252-260 Van Delm T, Melis P, Stoffels K, Baets W (2010) Cyclic lighting in strawberry
Saied AS, Keutgen AJ, Noga G (2005) The influence of NaCl salinity on greenhouse cultivation. In: 28th International Horticultural Congress, 22-27
growth, yield and fruit quality of strawberry cvs. ‘Elsanta’ and ‘Korona’. Sci- August, 2010, Lisbon, Portugal, p 12 (Abstract)
entia Horticulturae 103, 289-303 Van den Muijzenberg EWB (1942) De invloed van licht en temperatuur op de
Salisbury FB, Ross CW (1991) Plant Physiology, Wadsworth Publishing Co., periodieke ontwikkeling van de aardbei en de beteekenis daarvan voor de
Belmont, CA, 682 pp teelt (The influence of light and temperature on the periodic development of
Savini G (2003) Architectural model and factors implicated in the flower dif- the strawberry and its significance in cultivation). PhD thesis, Laboratorium
ferentiation of strawberry plant. PhD thesis, Università Politecnica delle voor Tuinbouwplantenteelt, Wageningen, 160 pp
Marche, Ancona, 151 pp (in Italian) Van der Veen R, Meijer G (1959) Light and Plant Growth, Philips Technical
Savini G, Letouzé A, Sabbadini C, Neri D (2006a) Evaluation of tray-plant Library, Eindhoven, 163 pp
quality in the propagation phase. Acta Horticulturae 708, 231-236 Van Der Zanden AM, Cameron JS (1996) Effect of water deficit stress on 11
Savini G, Neri D (2004) Strawberry architectural model. Acta Horticulturae native Fragaria chiloensis clones selected as ornamental groundcovers. Sci-
649, 169-176 entia Horticulturae 66, 241-253
Savini G, Neri D, Mercadante L, Molari G, Magnani D, Capriolo G (2006b) Verheul MJ, Sønsteby A, Grimstad SO (2006) Interactions of photoperiod,
Meristem analysis on strawberry plants during propagation and production. temperature, duration of short-day treatment and plant age on flowering of
Acta Horticulturae 708, 237-240 Fragaria x ananassa Duch. cv. ‘Korona’. Scientia Horticulturae 107, 164-
Savini G, Neri D, Zucconi F, Sugiyama N (2005) Strawberry growth and 170
flowering. An architectural model. International Journal of Fruit Science 5, Verheul MJ, Sønsteby A, Grimstad SO (2007) Influences of day and night
29-50 temperatures on flowering of Fragaria × ananassa Duch., cvs. ‘Korona’ and
Schilletter JC, Richey HW (1931) Four years study on the time of flower bud ‘Elsanta’, at different photoperiods. Scientia Horticulturae 112, 200-206
formation in ‘Dunlap’ strawberry. Proceedings of the American Society for Vince-Prue D, Guttridge CG (1973) Floral initiation in strawberry: Spectral
Horticultural Science 27, 175-178 evidence for the regulation of flowering by long-day inhibition. Planta 110,
Scott DH, Marth PC (1953) Effect of blossom removal on growth of newly set 165-172
strawberry plants. Proceedings of the American Society for Horticultural Sci- Voth V, Bringhurst RS (1958) Fruiting and vegetative response of ‘Lassen’
ence 62, 255-256 strawberries in Southern California as influenced by nursery source, time of
Serçe S, Hancock JF (2005) The temperature and photoperiod regulation of planting, and plant chilling history. Journal of the American Society for Hor-
flowering and runnering in the strawberries Fragaria chiloensis, F. virginiana, ticultural Science 72, 186-197
and F. x ananassa. Scientia Horticulturae 103, 167-177 Wahdan HA, Waister PD (1984) Flower initiation, fruit production and vege-
Serrano L, Carbonell X, Savé R, Marfà O, Peñuelas J (1992) Effects of ir- tative development in non-induced strawberry plants exposed to outdoor con-
rigation regimes on the yield and water use of strawberry. Irrigation Science ditions in Scotland. Journal of Horticultural Science 59, 187-196
13, 45-48 Waithaka K (1985) Growth and runner production of Everbearing strawberries
Silberbush M, Lips SH (1988) Nitrogen concentration, ammonium/nitrate ratio in Kenya. Acta Horticulturae 158, 151-156
and NaCl interaction in vegetative and reproductive growth of peanuts. Phy- Waldo GF (1930) Fruit-bud development in strawberry varieties and species.
siologia Plantarum 74, 493-498 Journal of Agricultural Research 40, 393-407
Sønsteby A (1997) Short-day period and temperature interactions on growth Webb R, Terblanche J, Purves JV, Beech M (1978) Size factors in strawberry
and flowering of strawberry. Acta Horticulturae 439, 609-616 fruit. Scientia Horticulturae 9, 347-356
Sønsteby A, Heide OM (2006) Dormancy relations and flowering of the straw- Went FW (1957) The Experimental Control of Plant Growth, Chronica Bota-
berry cultivars ‘Korona’ and ‘Elsanta’ as influenced by photoperiod and tem- nica Co., Waltham, Massachusetts, 343 pp
perature. Scientia Horticulturae 110, 57-67 Wright CJ, Sandrang AK (1995) Efficiency of light utilization in the straw-
22
berry (Fragaria × ananassa) cv. ‘Hapil’. Journal of Horticultural Science 70, studies on the allocation of carbon and nitrogen during flower induction of
705-711 strawberry plants as affected by the nitrogen level. Acta Horticulturae 567,
Yamasaki A, Yano T (2009) Effect of supplemental application of fertilizers on 349-352
flower bud initiation and development of strawberry–possible role of nitro- Yanagi T, Oda Y (1990) Effects of chilling history on successive flowering and
gen. Acta Horticulturae 842, 765-768 runner development of Everbearing and non-Everbearing strawberry cultivars.
Yamasaki A, Yoneyama T, Tanaka F (2000) Carbon and nitrogen status of Journal of the Japanese Society for Horticultural Science 59, 357-363
flower-induced strawberry as revealed by 13C and 15N tracer. Acta Horticul- Yoshida Y (1992) Studies on flower and fruit development in strawberry with
turae 514, 301-310 special reference to fruit malformation in ‘Ai-Berry’. Memoirs of the Faculty
Yamasaki A, Yoneyama T, Tanaka F, Tanaka K, Nakashima N (2002) Tracer of Agriculture, Kagawa University 57, 1-94
23
New Insights in the Study of Strawberry Fungal Pathogens

Carlos Garrido • María Carbú • Francisco Javier Fernández-Acero •
Victoria E. González-Rodríguez • Jesús M. Cantoral*
Laboratory of Microbiology, Department of Biochemistry and Biotechnology, Environmental and Marine Sciences Faculty. University of Cádiz, 11510, Puerto Real, Spain
Corresponding author: * jesusmanuel.cantoral@uca.es
ABSTRACT
Strawberry (Fragaria ananassa) is one of the world’s most commercially important fruit crops, and is grown in many countries The
commercial viability of the crop is continually subject to various risks, one of the most serious of which is the diseases caused by
phytopathogenic organisms. More than 50 different genera of fungi can affect this cultivar, including Botrytis spp., Colletotrichum spp.,
Verticillium spp., and Phytophthora spp. The development of new molecular biology technologies, based on genomics, transcriptomics
and proteomics approaches, is revealing new insights on the diverse pathogenicity factors causing fungal invasion, degradation and
destruction of the fruit (in planta and during storage and transport). Researchers have focused attention on the plant’s own defence mecha-
nisms against these pathogens. In this review, advances in the study and detection of fungal plant pathogens, new biocontrol methods, and
proteomic approaches are described and the natural defence mechanisms recently discovered are reported.
_____________________________________________________________________________________________________________
Keywords: biocontrol, elicitor, molecular tools, proteomics, real-time PCR

Abbreviations: AFLP, amplified fragment length polymorphism; APS, America phytopathological society; CECT, Spanish type culture
collection; CTAB, cetyl trimethyl ammonium bromide; CUE, critical use exemption; DGGE, denaturing gradient gel electrophoresis;
ELISA, enzyme-linked immunosorbent assay; EPPO, the European and Mediterranean Plant Protection Organization; FAO, the Food
and Agriculture Organization of the United Nations; GADPH, glyceraldehyde-3-phosphate dehydrogenase; IGS, interGenic spacer; ITS,
internal transcribed spacer; LUX, light upon extension; MALDI-TOF, matrix-assisted laser desorption/ionization-time of flight; MDH,
malate dehydrogenase; MeBr, methyl bromide; PCR, polymerase chain reaction; PIC, chloropicrin; PMF, peptide mass fingerprinting;
RAPD, random amplified polymorphic DNA; RFLP, restriction fragment length polymorphism; SCAR, sequence characterized
amplified region; QPS, quarantine and preshipment; U.S., United States
CONTENTS
INTRODUCTION........................................................................................................................................................................................ 24
MAIN STRAWBERRY FUNGAL DISEASES ........................................................................................................................................... 26
Leaf diseases............................................................................................................................................................................................ 26
Fruit diseases ........................................................................................................................................................................................... 28
Crown and root diseases .......................................................................................................................................................................... 29
BIOCONTROL OF DISEASES................................................................................................................................................................... 30
DIAGNOSIS AND MONITORING OF DISEASES ................................................................................................................................... 32
PROTEOMICS APPROACHES AS A TOOL TO STUDY STRAWBERRY FUNGAL PATHOGENS...................................................... 34
CONCLUSIONS.......................................................................................................................................................................................... 36
ACKNOWLEDGEMENTS ......................................................................................................................................................................... 37
REFERENCES............................................................................................................................................................................................. 37
_____________________________________________________________________________________________________________
INTRODUCTION modern cultivated strawberry F. x ananassa Duch. In the

following years, after further hybridizations, F. x ananassa
The genus Fragaria is a member of the Rosaceae family, developed a larger, more fragrant and tastier red berry than
Rosoideae subfamily, which comprises twenty eight species its progenitors and, in the middle years of the 1800’s, this
and several subspecies. Fragaria x ananassa Duch. is the new species was introduced into America from Europe.
most important species commercially, being the predomi- Cultivation of the other older species has progressively de-
nant species cultivated for strawberry production globally clined and they have been superseded by F. x ananassa; the
(FAO 2000); it is, however, of only recent historical origin. other species are only occasionally grown domestically or
Prior to the relatively recent development of F. x ananassa, in small isolated regions around the world (Bertelson 2010).
other species, such as F. chiloensis, F. virginiana, F. vesca Many different cultivars or varieties of F. x ananassa
and F. moschata, had been cultivated in Europe, America are found around the world. Since this species has been
and Asia for centuries (JA 2004). Over the last two hundred distributed and cultivated very widely geographically, new
and 50 years, these species were largely superseded by cul- cultivars are constantly appearing because the strawberry
tivation of F. x ananassa. In the middle of the 18th century, plant is strongly influenced by photoperiod, temperature,
the North American F. virginiana Duchesne (male) and the and other environmental conditions of various regions.
South American F. chiloensis Duchesne (female) were Although there are about a dozen cultivars constituting the
crossed in France, leading to production of hybrid seedlings most common varieties used for world strawberry produc-
that came to be known as Pineapple or Pine strawberries tion, it is very complicated to discover the exact number
(Maas 1998). These hybrids are the progenitors of the and names of actual cultivars of strawberry existing in the
Received: 24 March, 2010. Accepted: 21 August, 2010.

world. Strawberry cultivars are often grouped or classified not present in the EPPO region, and the A2 list includes
based on environmental control or habit of flowering. There pests that are locally present in the region. In response to
are three main types of cultivars: “short-day”, “long-day” the lists and reports published by this organization, the
and “day-neutral”, in reference to the sensitivity of the plant member countries adopt various different phytosanitary
to day length, and the type of photoperiod which induces measures and plant protection programs. Although in recent
flower formation. In spite of the different classifications, years several genera of strawberry fungal pathogens, such
any particular strawberry cultivar will differ greatly in its as Colletotrichum acutatum, Botrytis cinerea, Phytophthora
adaptation to regional and environmental conditions; a cul- spp. have been included in the EPPO A2 list (EPPO 2004),
tivar may grow satisfactorily in one area, and present re- currently only Phytophthora fragariae (specific for straw-
sistance to several species of strawberry pathogens, but the berry), and Verticillium dahliae and Verticillium albo-atrum
same cultivar may not thrive in another region with di- are in the updated A2 list (EPPO 2009). This limited listing
fferent environmental conditions. A cultivar may be resis- means that the other genera or species of fungi are likely to
tant to a particular pathogen in one region yet be very sus- be either currently absent or else only present in small poc-
ceptible to it elsewhere because pathogens present different kets, scattered widely across the EPPO region. Therefore
strains or pathotypes (Garrido et al. 2008, 2009b). the main pest control efforts are likely to be focused on pre-
The Food and Agriculture Organization of the United venting Verticillium spp. from becoming definitively esta-
Nations estimates that the annual world production of blished in the EPPO region, while other action may be
strawberry exceeds 3,800,000 tons. The fruit is produced in taken to identify the other pathogens, and to control and
seventy-three countries all around the world, and the total fight them where they may be found.
area cultivated is approximately 215,000 ha (FAO 2007). Currently, the detection and identification of pathogenic
The European Union is a major producer of strawberry (ac- fungi have traditionally been performed using classical
counting for 47% of world output), grown on 165,000 ha. mycological methods involving isolation from host material,
The United States produces approximately a 29% of world by plating plant parts, soil or soil extracts onto selective
output) (JA 2004; FAO 2007). In the USA strawberry pro- media, followed by morphological, biochemical, chemical
duction is concentrated in three states, California, Florida and immunological analyses (Singleton et al. 1992; Lievens
and Oregon, in order of importance. The growers of Califor- et al. 2005). However, these methods are often time-con-
nia account for 80% of the U.S. strawberry production suming, laborious, and require extensive knowledge of clas-
(FAO 2000; Martin et al. 2002). In Europe, Spain is the sical taxonomy. Furthermore, quantification, based on these
main producer country, with annual output of approxi- culture-plating techniques, is considered relatively inac-
mately 333,000 and 264,000 tons in 2006 and 2007, respec- curate and unreliable (McCartney et al. 2003; Lievens et al.
tively. This production is concentrated in the provinces of 2005; Garrido et al. 2008). As has been reported by Garrido
Huelva and Cádiz, in southwest Spain, on the Atlantic coast et al. (2008, 2009b), since 1991 several molecular methods
and near the mouths of the Guadalquivir and Guadiana for more accurate characterization and differentiation of
rivers, where weather conditions are particularly suitable phytopathogenic fungi have been developed and are being
for the intensive cultivation of this fruit. This area has more implemented widely. These methods include iso-enzyme
than 5,000 commercial horticultural operations dedicated to comparisons, restriction fragment length polymorphism
the cultivation of strawberry and other crops (JA 2004). (RFLP) analyses of mitochondrial DNA, AT-rich analyses,
In line with the financial and economic importance re- random amplified polymorphic DNA (RAPD), genus and
presented by the cultivation and marketing of this crop, species-specific polymerase chain reactions (PCR) and
serious financial losses can be incurred due to health pro- enzyme-linked immunosorbent assay (ELISA).
blems affecting the strawberry plant. These plants, like other When the pathogens are detected in the field, or to pre-
commercial crops, can be damaged by environmental, gene- vent their appearance between crop seasons, disease control
tic and biological factors, either directly or through inter- has been carried out using chemical treatments. Since
action between these factors. Diseases produced by biologi- 1950’s, Californian growers have produced “back-to-back”
cal factors require a pathogen, a susceptible host, and envi- crops of strawberry on the same soil fumigated with MeBr
ronmental conditions that favour the growth of the pathogen. and Pic (Martin et al. 2002), and the use of these chemical
However, the cultivated strawberry plant presents conside- treatments has spread around the world since that date.
rable genetic differences between various clones and culti- Although such treatments are still widely used to control
vars, and this implies differences in their reactions to many diseases caused by plant pathogens, the emergence of fun-
pathogens. The strawberry plant can be affected by arthro- gicide-resistant strains, de-registration of fungicides, and
pods, nematodes, and many types of fungus, bacteria and public concerns regarding the health and environmental im-
virus, among other pests. The group of phytopathogenic pacts of agrochemicals may all act to limit their application
fungi that attack this crop is especially extensive in terms of in the future (Massart et al. 2007). Alternative approaches
the number of genera and species that can produce diseases, to disease control, such as the use of biological, cultural and
and hence in terms of the considerable financial losses, physical methods, must be integrated to reduce the amount
running into hundreds of millions of dollars/euros per year, of fumigant used for soil and plant treatments. Biological
that this agrarian sector may suffer (FAO 2000; JA 2004). control of fungal plant pathogens with microorganisms has
More than 50 different genera can affect F. x ananassa cul- been studied for more than 60 years (Howell et al. 2003).
tivars, but not all of them have the same commercial impor- This form of biocontrol appears to be an attractive and rea-
tance. The genera Botrytis, Colletotrichum, Verticillium, and listic approach, and numerous microorganisms have been
Phytophthora are included among the most significant. identified as potential biocontrol agents. Nevertheless,
These pathogens are capable of infecting not only the straw- using microbiological, microscopic, and biochemical tech-
berry crop but more than one hundred other crops cultivated niques over many years, researchers have tried to under-
around the world. stand the mechanisms of action of fungal biocontrol agents
At the global level, there are several agencies working without yet fully elucidating them.
in cooperation with governments to control trade in this The development of molecular techniques has yielded
crop between countries. The United States has no federal innovative alternative tools for understanding and demons-
certification program for strawberry plant production, but trating the mechanisms underlying the properties of bio-
some states and countries, such as the United Kingdom, do control agents. To date, many studies have been published
have such programs (Maas 1998). The EPPO is an inter- describing the use of molecular techniques for this purpose
governmental organization, with 50 member countries, res- (Martin et al. 2002; Fernández-Acero et al. 2007; Massart
ponsible for cooperation in plant protection in Europe and et al. 2007). Proteomics studies for the description of biolo-
the Mediterranean region (www.eppo.org). Since the 1970’s, gical, metabolic, physiological processes have been under-
this organization has published and maintained two quaran- going rapid development in the last few years. Advances in
tine pest lists for this large region. The A1 list includes pests proteomic techniques have yielded extensive and definitive
25
Strawberry fungal pathogens. Garrido et al.
Table 1 Strawberry fungal pathogens causing leaf diseases.

Fungal pathogen Phylum Strawberry disease Authorsa
Alternaria alternata Ascomycota black leaf spot Miyamoto et al. 2009
Cercospora fragariae Ascomycota cercospora leaf spots Maas et al. 1998
Cercospora vexans Ascomycota cercospora leaf spots Maas et al. 1998
Colletotrichum acutatum Ascomycota anthracnose leaf spot Garrido et al. 2009
Colletotrichum gloeosporioides Ascomycota anthracnose leaf spot Chung et al. 2010
Colletotrichum fragariae Ascomycota anthracnose leaf spot Ortega-Morales et al. 2009
Diplocarpon earlianum Ascomycota leaf scorch Whitaker et al. 2009
Gnomonia comari Ascomycota leaf blotch Morocko et al. 2007
Macrophomina phaseolina Ascomycota macrophomina leaf blight Maas et al. 1998
Mycosphaerella fragariae Ascomycota purple leaf spot Ehsani-Moghaddam et al. 2006
Mycosphaerella louisianae Ascomycota purple leaf spot Maas et al. 1998
Phoma lycopersici Ascomycota leaf stalk rot Maas et al. 1998
Phomopsis obscurans Ascomycota phomopsis leaf blight Nita et al. 2003
Rhizoctonia solani Basidiomycota rhizoctonia leaf blight Chiba et al. 2009
Sclerotium rolfsii Basidiomycota sclerotium rot Errakhi et al. 2009
Septoria fragariae Ascomycota septoria leaf spot Maas et al. 1998
Septoria aciculosa Ascomycota septoria leaf spot Maas et al. 1998
Septoria fragariaecola Ascomycota septoria leaf spot Maas et al. 1998
Sphaerotheca macularis Ascomycota powdery mildew Davik et al. 2005
a
Recent and relevant publication working with the pathogen in the plant pathology field
biological information, describing the link between gene they give rise. These lists are continually updated in the
and phenotypical features, thus bridging the gap between APS databases (www.apsnet.org/online/common/toc.asp).
genotype and phenotype. The application of these tech- Pathogenic organisms are classified into bacteria, viruses,
niques to phytopathogenic fungi is helping us to understand fungi and nematodes. In the case of strawberry, the list is
the highly complex life cycle of fungal plant pathogens alphabetically arranged by common names of plant diseases.
(Fernández-Acero et al. 2006, 2007a, 2007b). The APS describes a total of 57 species of fungal pathogens.
In this review, we will consider the most recent advan- This list includes thirty nine species of ascomycota, seven
ces in the study of these phytopathogenic fungi that cause of oomycetes, four of basidiomycota, and five basal fungal
diseases in strawberry crops. The continuous development lineages (Tables 1-3). Sometimes, the name of a disease
of molecular methods, resulting from research projects ca- covers several species of pathogens: for example, anthrac-
rried out by laboratories and research centres on the world, nose fruit rot can be caused by Colletotrichum acutatum, C.
is providing more and better knowledge about these patho- fragariae and C. gloeosporioides. In other cases, one parti-
gens, and is equipping the scientific community, official cular disease can even be caused by more than one genus:
laboratories of governments and strawberry growers in for example, black leaf spot is caused by Alternaria alter-
many countries with more and better techniques and tools nata or by Colletotrichum gloeosporioides. When a patho-
for fighting these harmful fungi. gen is very damaging, or when several species of one genus
produce similar symptoms, the disease takes the name of
MAIN STRAWBERRY FUNGAL DISEASES the pathogen genus; for example, phytophthora crown rot
and root rot are caused by Phytophthora cactorum, P. ci-
The cultivation of F. x ananassa is now widely spread tricola, P. citrophthora, P. megasperma or P. nicotinae.
around the world, and progressively more countries are Most of the species listed in the tables (Tables 1-3) are
adopting cultivars of this genus due to the good commercial fungal pathogens that are not exclusive to strawberry. They
results obtained from this crop. Currently, numerous di- can cause disease in many other crops; this is the case with
fferent cultivars of F. x ananassa exist, and this number is Botrytis cinerea, Phytophthora citricola and Colletotrichum
continually increasing, because researchers and growers are gloeosporioides. Hence, because these fungi can affect
looking for the “perfect strawberry plant”. This ideal plant several different genera of commercially important plants,
should produce a large, fragrant, tasty red berry, with a high governments, researchers and growers take more interest in
production yield per plant and per year; it should be well them. The greater the potential commercial losses, the more
adapted to the particular environmental factors of particular important it is to study them and acquire more knowledge
regions, and of course, it must be resistant to all pathogens. about pathogenic cycles, diagnostic methods, control mea-
To date, a strawberry plant with all these characteristics has sures and practical means to combat them.
not been developed. Among these requirements, one of the One of the most common ways to classify strawberry
most difficult characteristics to obtain is general resistance fugal pathogens is to arrange them by reference to the part
to the main diseases. of plant in which they produce the damage. In this section,
The initiation and evolution of a disease in plants we have compiled the information published by other
requires a susceptible host plant, a pathogen, and favourable authors in reports, articles and chapters of books, describing
environmental conditions (Maas 2004). Most of the fungal the main symptoms caused by the fungal diseases in leaves,
pathogen species affecting strawberry can be found in all fruits, crowns and roots.
the crop regions around the world, but the damage caused in
the strawberry crop and the commercial losses suffered by Leaf diseases
the growers due to these species are of a different scale in
each region. This is because several strawberry pathogens The leaf of a plant is the principal site of the conversion of
also exist as races or pathotypes which, although indistin- light energy to metabolic energy by photosynthesis. Thus,
guishable at the species level, differ genetically in their abi- the number of leaves and the total leaf area of strawberry
lities to cause disease. The races are not evenly distributed plants in the fall or autumn are directly correlated with fruit
around the world, and they are often found only in one spe- production. Individual strawberry leaves usually have a life
cific strawberry crop region (Maas 2004). of 1-3 months. The morphology of leaves varies between
Since 1978, the American Phytopathological Society cultivar of strawberry, but a common characteristic is the
(APS) has had a standing a committee charged with main- large number of stomata that they have on the surface
taining listings of plant pathogens and the diseases to which (Maas 1998). Leaf diseases commonly appear on straw-
26
Table 2 Strawberry fungal pathogens causing fruit diseases.

Alternaria tenuissima Ascomycota alternaria fruit rot Shafique et al. 2009
Aspergillus niger Ascomycota aspergillus fruit rot Chiotta et al. 2009
Botrytis cinerea Ascomycota botrytis fruit rot; gray mold Fernández-Acero et al. 2009
Cladosporium spp. Ascomycota cladosporium fruit rot Ruiz-Moyano et al. 2009
Colletotrichum acutatum Ascomycota anthracnose fruit rot Garrido et al. 2009
Colletotrichum gloeosporioides Ascomycota anthracnose fruit rot Chung et al. 2010
Colletotrichum fragariae Ascomycota anthracnose fruit rot Ortega-Morales et al. 2009
Gnomonia comari Ascomycota stem end rot Morocko et al. 2007
Mucor hiemalis Basal fungal lineages mucor fruit rot Hauke et al. 2004
Mucor mucedo Basal fungal lineages mucor fruit rot Hauke et al. 2004
Mucor piriformis Basal fungal lineages mucor fruit rot Hauke et al. 2004
Mycosphaerella fragariae Ascomycota black seed disease Ehsani-Moghaddam et al. 2006
Pestalotia longisetula Ascomycota pestalotia fruit rot Maas et al. 1998
Penicillium cyclopium Ascomycota penicillium fruit rot Gutierrez et al. 2009
Penicillium expansum Ascomycota penicillium fruit rot Liu et al. 2007
Penicillium frequentans Ascomycota penicillium fruit rot Redondo et al. 2009
Penicillium purpurogenum Ascomycota fruit rot; fruit blotch Redondo et al. 2009
Peronospora potentillae Oomycete downy mildew; fruit blotch Choi et al. 2009
Phytophthora cactorum Oomycete leather rot Nicastro et al. 2009
Phytophthora citrophthora Oomycete leather rot; phytophthora crown and root rot Kong et al. 2009
Phytophthora nicotianae Oomycete leather rot; phytophthora crown and root rot Böszörményi et al. 2009
Rhizoctonia fragariae Basidiomycota anther and pistil blight Lamondia et al. 2005
Rhizopus solonifer Basal fungal lineages rhizopus rot Maas et al. 1998
Rhizopus sexualis Basal fungal lineages rhizopus rot Maas et al. 1998
Rhizoctonia solani Basidiomycota hard brown rot Liu et al. 2009
Schizoparme straminea Ascomycota fruit blotch
Sclerotinia sclerotiorum Ascomycota sclerotinia fruit rot Ren et al. 2010
Stagonospora fragariae Ascomycota stagonospora hard rot Maas et al. 1998
Sclerotium rolfsii Basidiomycota southern blight; fruit blotch Errakhi et al. 2009
Septoria fragariae Ascomycota septoria hard rot and leaf spot **
Sphaeropsis malorum Ascomycota fruit blotch **
Sphaerotheca macularis Ascomycota powdery mildew Davik et al. 2005
a
Recent and relevant publication working with the pathogen in the plant pathology field.
Table 3 Strawberry fungal pathogens causing crown and root diseases.

Armillaria mellea Basidiomycota armilla crown rot and root rot Prodorutti et al. 2009
Colletotrichum acutatum Ascomycota anthracnose fruit rot, crown rot and black spot Garrido et al. 2009
Colletotrichum gloeosporioides Ascomycota anthracnose fruit rot, crown rot and black leaf spot Chung et al. 2010
Colletotrichum fragariae Ascomycota anthracnose fruit rot, crown rot and black spot Ortega-Morales et al. 2009
Cylindrocarpon destructans Ascomycota root rot Martin et al. 2002
Fusarium oxysporum Ascomycota fusarium wilt Avis et al. 2009
Idriella lunata Ascomycota idriella root rot Maas et al. 1998
Macrophomina phaseolina Ascomycota macrophomina root rot Javaid et al. 2009
Phytophthora cactorum Oomycete* phytophthora crown and root rot Nicastro et al. 2009
Phytophthora citricola Oomycete* phytophthora crown and root rot Haesler et al. 2008
Phytophthora fragariae Oomycete* phytophthora crown and root rot Nicastro et al. 2009
Pythium ultimum Oomycete* black root rot Triky-Dotan et al. 2009
Rhizoctonia fragariae Basidiomycota black root rot Lamondia et al. 2005
Rhizoctonia solani Basidiomycota hard brown rot Liu et al. 2009
Sclerotinia sclerotiorum Ascomycota sclerotinia crown and fruit rot Ren et al. 2010
Verticillium albo-atrum Ascomycota verticillium wilt Larsen et al. 2007
Verticillium dahliae Ascomycota verticillium wilt Costa et al. 2007
a
Recent and relevant publication working with the pathogen in the plant pathology field.
berry plants. Stomata also are often sites of infection by in alphabetical order, Alternaria alternata (alternaria black
pathogens that cause leaf diseases, although some fungi can leaf spot); Colletotrichum acutatum, Colletotrichum gloeos-
penetrate the leaf cuticle directly. Although many species of porioides and Colletotrichum fragariae (anthracnose leaf
fungi can occasionally cause damage on leaves, there are at spot and irregular leaf spot); Diplocarpon earlianum (leaf
least nineteen species that cause damage on susceptible scorch); Mycospharella fragariae (leaf spot); Phomopsis
cultivars if environmental conditions are conducive to their obscurans (phomopsis leaf blight); Rhizoctonia solani (rhi-
development (Table 1). When enough leaf tissue has been zoctonia leaf blight) and Sphaerotheca macularis (powdery
destroyed by disease, the plant is weakened and, in such mildew) (Fig. 1). These diseases occur on strawberry plants
cases, the plant is more subject to winter injury. Ad- in all areas of the world where they are grown, from tempe-
ditionally, the pathogens that cause these diseases on leaves rate climates to subtropical and tropical regions. The major
can infect berries, causing quality problems or even loss of effect of these pathogens is the progressive destruction of
fruits. the foliage, which may weaken plants and reduce yields.
Taking into account the amount of commercial damage Some pathogens cause very distinctive leaf symptoms; for
caused by disease in leaves and the worldwide spread of the example, Sphaerotecha macularis forms white patches of
corresponding pathogens, attention must be focussed on mycelium on the abaxial surface of the leaf. Other species,
eight species of fungal pathogens from Table 1. These are, however, cause similar, even identical, symptoms, from cir-
27
Fig. 1 Sphaerotheca macularis causing powdery mildew in strawberry Fig. 2 Botrytis cinerea affecting strawberry fruit.
leaves cv. ‘Camarosa’.
A B C
Fig. 3 Colletotrichum acutatum causing anthracnose in strawberry. (A) Fruit, (B) plant dead, (C) lesions inside the crown.
cular spots with grey centres and dark margins to irregular Fruit diseases
purplish red or brown areas with dark reddish purple mar-
gins. It is usual in the literature to find incorrect identifica- A number of diseases affect strawberry fruit. The fruit di-
tions and many citations confirm that symptoms are often seases are very important since they are the most direct and
confused between pathogens; for example, leaf scorch, visible cause of commercial losses, not only while the plant
caused by Diplocarpon earlianum is often confused with is in the field but also during the storage and transport of
symptoms of leaf spot, caused by Mycosphaerella fraga- the fruit to the market. Botrytis cinerea and Colletotrichum
riae; and the symptoms produced by the latter are also spp. are the pathogens responsible for the major strawberry
wrongly identified as phomopsis leaf blight caused by Pho- fruit diseases around the world. They also cause the greatest
mopsis obscurans (Maas 1998). Two anthracnose diseases losses of fruit; and they are responsible for the largest
affect strawberry leaves: anthracnose leaf spot, caused by quantities of fungicides used in most nations for strawberry
Colletotrichum fragariae and C. gloeosporioides, and fruit production, and the consequent expenditure on these
irregular leaf spot, caused by C. acutatum. These three spe- treatments (Maas 2004). The yearly cost of treatments to
cies can be found in any part of the plant and produce simi- combat B. cinerea in all vulnerable crops, in all countries,
lar symptoms, including circular lesions similar to those has been estimated at up to €540 million, which constitutes
described above caused by other fungi (Garrido et al. about 10% of total world expenditure on fungicides; in
2009a). This confusion or incorrect observation is a serious Spain around €2 million are spent on fungicides for protec-
matter because the correct identification of the disease, and ting strawberry crops (Fernández-Acero et al. 2007a).
therefore of the causal pathogen, is necessary before apply- Botrytis fruit rot, also called grey mould (caused by B.
ing the correct control treatment, whether chemical pro- cinerea) appears in the fields before harvest, especially
ducts, biocontrol agents, or even changing to cultivars that when the crop has remained persistently wet, but it chiefly
are resistant to the pathogen identified. develops in picked fruit. Losses can be severe (i.e. proporti-
Leaves of strawberry can be also attacked by other onately high) at harvest, during marketing and shipping,
fungi than those discussed above, but their commercial im- and after final sale. Lesions in green and white fruit develop
portance is minor since they are limited to a few particular slowly. The fruit becomes misshapen as it enlarges and may
regions or countries and they occur only occasionally in die before reaching maturity. The rot expands rapidly in the
strawberry. These other minor diseases of leaves include fruit as it nears maturity, often until the entire fruit is
Gnominia comari (leaf blotch); Mycophaerella louisianae affected. A key diagnostic feature of botrytis fruit rot is the
(purple leaf spot); Septoria fragariae, S. aciculosa and S. greyish mass of mycelium, conidiophores, and conidia of B.
fragariaecola (septoria leaf spots); Macrophomina phaseo- cinerea on the surface of rotted tissues (Fig. 2). Since the
lina (macrophomina leaf blight); Cercospora fragariae and 1960’s, recommendations for control of B. cinerea have
C. vexans (cercospora leaf spots); Sclerotium rolfsii (sclero- emphasized applications of fungicides during blooming of
tium rot); and Phoma lycopersici (leaf stalk rot) (Maas flowers (Maas 2004). A degree of variation in susceptibility
1998). to botrytis rot exists among cultivars, but since genetic re-
28
sistance to B. cinerea infection in strawberry is apparently a percolation of subsurface water through the soil. In cold
multigene characteristic and has a very low general com- parts of the world, winter injury to strawberry roots, caused
bining ability, there has been little success in breeding and by alternate freezing and thawing of the soil, favour root
selecting cultivars resistant to this disease (Maas 2004). infection by Fusarium spp., Cylindrocarpon destructans,
Anthracnose of strawberry, especially anthracnose fruit and many other fungi, and thus contributes to the incidence
rot, is a very destructive disease caused by the same three of root diseases. Strawberry roots, perhaps more than roots
species of Colletotrichum described above for the anthrac- of other plants, are closely associated with numerous spe-
nose leaf spot, but the predominant species is C. acutatum cies of fungi and bacteria, many of which may be patho-
(Fig. 3A). Infected flowers and buds may become dry and genic under certain conditions.
withered. Fruit infection can be devastating during periods The genus Colletotrichum, including the same three
of favourable temperature and the presence of moisture, species previously described C. acutatum, C. gloeos-
either in the form of rain or high relative humidity. Circular, porioides and C. fragariae, attacks the crowns and roots of
firm, sunken lesions that typically become black may deve- strawberry causing serious anthracnose crown rot disease.
lop on ripening fruit (Garrido et al. 2008). Control of an- Colletotrichum spp. causes red-brown discoloration and
thracnose can be difficult since few available fungicides are necrosis within the crown tissue (Garrido et al. 2008; Smith
effective against anthracnose of strawberry; once an epi- et al. 2008). Other symptoms of crown rot are the wilting of
demic of anthracnose fruit rot begins in a susceptible culti- infected plants during periods of moisture stress, such as
var, it is nearly impossible to control (Maas 2004). In the early afternoon in the summer. Under environmental con-
literature, several strawberry cultivars have been reported to ditions that favour infection, this process may continue for
be resistant to at least one anthracnose disease, and an infor- several days until the crown infection is extensive and
mative list has been published by Maas (2004). causes the entire plant to wilt and die (Figs. 3B, 3C). Fungi-
Leather rot is the third disease in importance for straw- cidal control of anthracnose has not been satisfactorily
berry fruit, especially considering that it can occur world- achieved in most areas. Currently only a few resistant culti-
wide, from the USA to Europe and Asia. The losses of fruit vars are available. Resistant cultivars to one anthracnose
may be considerable; fruit with leather rot has a distinctly pathogen are usually resistant to the other two; however,
unpleasant odour and taste that may be imparted to pro- races of the fungi can occur, and therefore a cultivar resis-
cessed fruit products. Phytophthora cactorum is the causal tant in one locality may not be resistant in another. Cultivars
pathogen of the disease but this species is more important resistant to petiole and crown infections are not necessarily
because it also causes a serious crown rot. Control of lea- resistant to fruit infection.
ther rot requires a program that integrates various cultiva- Another important pathogen, that is favoured by cool
tion practices and the use of effective fungicides. Captan is climates, which is the most widespread strawberry root
the most effective fungicide available at present (Maas pathogen, is the genus Pythium spp., especially the species
2004). P. ultimum. This species has been shown to be a major
There are other 12 genera of fungi that cause considera- cause of black root rot disease. Pythium spp. is not only a
ble losses on strawberry when they appear, but it happens strawberry pathogen; it can attack many other crops, both
only sporadically in widely separated areas. This group of annual and perennial. In strawberry, Pythium spp. destroys
fungi includes the next genera: Rhizoctonia fragariae (an- juvenile root tissue, such as feeder rootlets. Control of
ther and pistil blight), Mycosphaerella fragariae (black seed Pythium spp. is effective with the application of chloropic-
disease) and Sclerotinia sclerotiorum (sclerotinia fruit rot) rin mixtures.
vary widely in severity and no specific control measures Phytophthora spp. is another important genus causing
have been developed for them, although preplant soil treat- disease of crowns and roots. Crown or rhizome rot, whose
ment and cultivation practices, such as mulching and re- causal pathogen is P. cactorum, has resulted in commercial
moval of plant debris, may help to minimize the incidence losses in several European countries since about 1960. The
of these diseases. Gnominia comari (stem-end rot), Pestalo- disease, which is generally worse in warmer climates, has
tia longisetula (pestalotia fruit rot), Alternaria spp. (alter- also been reported in the United States and other temperate
naria rot) and Cladosporium spp. (cladosporium rot), Asper- to subtropical regions. The youngest leaves turn bluish
gillus niger (aspergillus rot), and Stagonospora fragariae green and often wilt suddenly; wilting quickly spreads to
(stagonospora hard rot) are of less commercial importance. the entire plant, which collapses and dies, typically within a
Lastly, there is one group of pathogens that are especially few days. Phytophthora citricola root rot, caused by P. citri-
important because they cause postharvest losses to straw- cola, usually develops in fields with a high incidence of
berry in storage. This group includes Rhizopus solonifer and dead plants, and is also caused by an unidentified species of
R. sexualis (rhizopus rot); Mucor mucedo, M. piriformis and Phytophthora. In California, P. citricola has been adequately
M. hiemalis (mucor fruit rot); Penicillium frequentans, P. controlled by preplant soil fumigation, applying mixtures of
cyclopium, P. expansum and P. purpugenum (penicillium methyl bromide and chloropicrin. Red stele root, caused by
fruit rot). The importance of these pathogens causing post- Phytophthora fragariae, was first observed in Scotland and
harvest rot has been substantially reduced by modern sto- it is a major disease in areas with cool and moist climates.
rage and shipping methods (Maas 1998). Plants with severe root rot are often stunted, and they may
wilt in hot weather. The most characteristic root symptom is
Crown and root diseases a reddish discoloration of the steles, which occurs when the
soil is cool. Locally-adapted cultivars with resistance to
Strawberry roots and crowns are attacked by several fungi. several races of P. fragariae should be selected for planting,
Phytophthora fragariae, P. cactorum, Colletotrichum acu- but none is known to be resistant to all races.
tatum, and Verticillium, for example, are species that cause The pathogens, Verticillium albo-atrum and V. dahliae
specific and important diseases. Other diseases, such as find a wide range of hosts among annual and perennial
black root rot, may be caused by one or more of several crops and weeds, and are capable of persisting for long
fungal pathogens, with or without the interaction of other periods in the soil. They cause verticillium wilt which
factors, such as nematodes, bacteria, winter damage, poor occurs throughout the temperate zones of the world. The
drainage, depletion of soil oxygen, soil fertility imbalance, initial symptoms appear rapidly, when a sudden onset of
and drought stress. high temperatures, high light intensity, or drought, interrupt
In the case of strawberry roots, their growth is influ- mild conditions. Verticillium wilt tends to be most severe in
enced not only by the external environment of soil and air plants that are already fruiting, and symptoms may continue
but also by the amount of food reserves stored by the plant. throughout summer and autumn. Excellent long-range con-
Drainage is a key factor to maintaining strawberry rootlet trol of verticillium wilt has been obtained by preplant soil
health, including the removal of standing water on the sur- fumigation, with the application of mixtures of chloropicrin
face, especially during winter, as well as provisions for the and methyl bromide, but new strategies of biocontrol will
29
be explained in later sections of this review. international community is increasingly committed to fin-
Fusarium wilt and rhizoctonia root rot are two crown ding alternative disease control methods, including biolo-
and root diseases that are favoured by high temperatures; gical, cultural or other chemical measures, to integrate into
when they appear severe damage, with losses as high as their general crop production systems.
50%, can result. Fusarium oxysporum produces distinct red- The biocontrol of fungal plant pathogens with micro-
dish brown discoloration on the crown, and the lower crown organisms has been studied for more than 70 years (Massart
tissues may decay extensively as the disease advances. et al. 2007). Today, biocontrol is becoming a feasible alter-
Rhizoctonia solani and R. fragariae kill structural roots as native but, although much knowledge has been accumulated
well as feeder rootlets of strawberries. Lesions on young from studies conducted in recent years, there is still a long
roots are reddish brown at first, and darken with age. The way to go before a realistic and effective alternative to the
infected crowns show internal brown discoloration of basal use of chemical products is available. One of the first pro-
tissues and frequently collapse and die. Traditionally these blems that the scientific community found was that, because
diseases have been controlled by fumigating the soil prior to MeBr and other biocides had been widely used for more
planting. than 50 years, little was known about the pathogens that
Crowns and roots of strawberry plants may be also need to be controlled, in their own environmental niches;
attacked by other fungi, with less serious commercial con- understanding the ecology of these pathogens and how
sequences; these include Idriella lunata (idriella root rot); biocontrol agents exert their protective effects are prerequi-
Sclerotinia sclerotiorum (sclerotinia crown rot); Armillaria sites in managing these diseases and for the effective prac-
mellea (armillaria root and crown rot); Dematophora neca- tical application of biocontrol agents (Martin et al. 2002).
trix (dematophora root and crown rot) and Macrophomina Microbiological, microscopic, biochemical studies and,
phaseolina (macrophomina root rot) (Agrios 1998). more recently, advanced molecular techniques have all con-
tributed to existing knowledge on the antagonistic mecha-
BIOCONTROL OF DISEASES nisms of biocontrol agents (Massart et al. 2007).
Microorganisms introduced to control disease must
Currently, the control of strawberry pathogens is still based interact with the crop plants, with potential pathogens, with
on the use of fungicides and other biocides. World-wide, the environmental variables, and with indigenous organisms
most prevalent strawberry disease management practice is under prevailing microclimate conditions (Sutton et al.
the application of chemical treatments, in conjunction with 1994). In strawberry, most attention has been focussed on
other practices for managing plant health, including, for rhizosphere ecology, in which numerous populations of
example, the reduction of over-crowding and over-watering bacteria, yeasts and fungi have been identified and isolated
of plants, the rapid removal of diseased plants and plant for their ability to antagonize plant pathogens. The rhizos-
debris, the constant monitoring of plants to ensure healthy phere is the soil surrounding the root, the micro-environ-
production stocks, and more recently the progressive use of ment where intense microbial activity and more numerous
biocontrol agents in the field (Maas 2004). Soil fumigation microbial populations occur, and is the site for interactions
has been of paramount importance for strawberry fruit and between plants, pathogenic microorganisms, antagonistic
nursery-plant production in recent decades, and has enabled rhizobacteria and fungi (Berg et al. 2000). The biocontrol
growers to develop systems for very high-value annual crop agent is assumed to be a natural colonizer of strawberry
production. fruit, leaves, and roots, and to be either non-pathogenic or
Historically, one of the primary reasons for soil fumiga- only weakly so, or else saprophytic, and to be capable of
tion was to reduce the incidence of destructive pathogens interacting successfully with the plant, microbiological and
such as Verticillium dahliae and several species of Phytoph- other environmental conditions, and cultivation systems
thora spp. (Martin et al. 2002). MeBr and chloropicrin, in- (Maas 2004). From consulting the literature on strawberry
dividually or in mixtures, are the classic chemical products diseases, two main groups of microorganisms, between
used most widely as preplant treatments and for soil fumi- others, can be found that previously have been studied as
gation, to control a broad range of pathogens around the biocontrol agents against strawberry fungal pathogens: i)
world. Preplant MeBr fumigation was first used to control rhizobacteria, with the Pseudomonas and Streptomyces
verticillium wilt in California in 1956. Apart from being species being the main members of this group; and ii) the
very effective for pathogen control, this compound has been genus Trichoderma, which is the most studied and effective
demonstrated to increase growth and yield responses in fungal biocontrol agent identified to date (Berg et al. 2000;
strawberry crops when planted in soil that had first been Woo et al. 2006).
fumigated with MeBr. The benefits include increased growth Rhizobacteria antagonism toward plant pathogenic
response (especially of the root system), reduction in N fer- fungi may result from various mechanisms, based mainly
tilizer requirements (by approximately 50% in some cases), on competition for space and nutrients, mycoparasitism or
improved nutrient uptake, and control of weed species antibiosis, or the elicitation of plant defences. The physiolo-
(Wilhelm et al. 1980). gical and molecular characterization of potential rhizobac-
Although there are many advantages in using chemical terial antagonisms is important in order to select the isolates
products to control crop pathogens – mainly their proven for detailed study as candidate biological control agents.
effectiveness and other positive benefits for the crops – they Berg et al. (2000) developed a screening strategy to inves-
nevertheless have very serious negative effects for the envi- tigate rhizobacterial populations isolated from strawberry
ronment, and their use can cause fungicide-resistant strains species and to determine their antagonistic activity against
of pathogens to evolve. The use of MeBr, for example, is Verticillium dahliae, V. albo-atrum, Fusarium culmorum,
currently regulated by United Nations under the Montreal Rhizoctonia solani, Pythium ultimum, and Phytophthora
protocol on substances that deplete the ozone layer (Mon- cactorum. Twenty rhizobacterial isolates, out of more than
treal protocol) and the clean air act (CAA). The protocol three hundred, were isolated from strawberry cultivars
calls for a 50% reduction per year of methyl bromide sold because they presented a powerful antifungal activity. The
to users, although some exemptions from the phase-out date species included Pseudomonas fluorescens and P. chloror-
are allowed, including: i) the quarantine and preshipment phis, Streptomyces albidoflavus, S. rimosus, S. diastatochro-
(QPS) exemption, to eliminate quarantine pests; and ii) the mogenes, and S. exfoliates. After in vitro assays, the authors
critical use exemption (CUE), designed for agricultural concluded that all isolates inhibited the growth of V. dahliae
users for whom no technically or economically feasible and four isolates of Streptomyces species were active against
alternatives are available. Strawberry nurseries and straw- all of the fungi tested. The rhizobacteria tested produced
berry fruit production are included in the list of critical uses antibiotics and presented siderophore activity. Streptomyces
of methyl bromide; therefore strawberry growers have been isolates also presented chitinase activity, whereas none of
given additional and valuable time to adapt their control the Pseudomonas did.
practices before the phase-out date for methyl bromide. The Berg et al. (2000) also studied the antagonistic activity
30
of these isolates against verticillium wilt in greenhouse and ces; the fungi are among the most resistant microorganisms
fields. The results showed that, in the greenhouse and in to natural and man-made chemicals and toxins; and they are
fields naturally infected by Verticillium, bacterial treatment capable of effectively degrading some of them, including
resulted in the efficient suppression of the pathogen. Ad- hydrocarbons, chlorophenolic compounds, polysaccharides
ditionally, the authors observed an indirect effect on the and xenobiotic pesticides (Harman et al. 2004). It is impor-
yield, a phenomenon that often occurs with some antago- tant to understand the mechanisms employed by Tricho-
nistic microorganisms through their activity in rhizosphere derma spp. to act in the biological control of plant diseases.
ecology. It was found that Pseudomonas treatment en- Advances in molecular biology have permitted the genetic
hanced the yield of strawberry fruits by as much as 344% modification of these fungi in a very precise manner, and
(Berg et al. 2004). The explanation of this effect lies in the this has led to the improvement of their ability to secrete
interactions that take place between the host and the micro- desired enzymes, to kill plant pathogens, and to stimulate
organisms; this association provides the plant with the nu- plant growth and resistance to diseases. Intensive research
trients and environmental conditions for enhanced develop- into biocontrol using T. harzianum has been carried out
ment of its root systems. This effect will also be considered under commercial conditions, and there have been some
later in this section with respect to the fungus Trichoderma significant achievements in greenhouse crops and in vine-
spp. Berg et al. (2000) obtained encouraging results because yards (Freeman et al. 2003). Trichoderma spp. are now
they isolated several good candidates for combating seven widely used in agriculture and industry; the first biocontrol
important species of strawberry fungal pathogens. In ad- agent to be commercialized, registered and used was isolate
dition, it was possible to patent three biocontrol agents (one T-39 of T. harzianum (TRICHODEX), which is effective for
P. fluorescens isolate and two Streptomyces diastatochromo- the control of B. cinerea, S. sclerotiorum, C. fluvum and C.
genes isolates). In recent years, studies of rhizobacteria acutatum. Today, more than fifty different Trichoderma-
populations and their antagonistic potential have been based agricultural products have been registered in the
focussed on the molecular aspects of the community. With world, and are sold and applied to protect and improve
the advances made in molecular biology techniques, much yields of vegetables, ornamental plants and fruit trees (Woo
more is now understood about the molecular mechanisms et al. 2006).
and genes involved in this antagonistic activity. Costa et al. During the last few decades, the scientific community
(2007) studied the presence of Pseudomonas spp. com- has been learning more and more about the mechanisms
munities in the rhizosphere using a novel PCR-DGGE sys- involved in the biocontrol activities of Trichoderma spp.
tem developed to characterize gacA types within a col- This fungus is very versatile in adapting many different
lection of Pseudomonas isolates antagonistic to V. dahliae. environmental situations and has a large arsenal of mole-
The gene gacA is required for the production of many se- cular weapons to use against the particular microbe that
condary metabolites and exoenzymes in Pseudomonas spp. they are confronting. One of the most salient characteristics
(Heeb et al. 2001). The study carried out by Costa et al. of the genus Trichoderma is its ability to parasitize other
(2007) suggests that this family of genes, in conjunction fungi. What has been called the “mycoparasitism” of Rhi-
with the PCR-DGGE system, might be a suitable strategy zoctonia solani hyphae by the hyphae of this biocontrol
for the simultaneous analysis of Pseudomonas community agent has been described, and its actions include coiling
structure and function in soil studies. around the hyphae of the pathogen, penetrating and subse-
Other groups of antagonistic microorganisms that are quently dissolving the cytoplasm of the host (Howell 2003).
important for biocontrol of strawberry fungal pathogens are The fungus also excretes several kinds of “toxins” which
several genera of filamentous fungi. The first of such micro- are toxic for R. solani, Sclerotinia americana, and even
organisms to be considered here is Glicocladium roseum. strongly inhibitory for Pythium ultimum and Phytophthora
This ascomycete has been shown to be effective in reducing species; two of the most important toxins excreted by Tri-
the incidence in fruit of grey mould caused by Botrytis choderma virens are gliotoxin and gliovirin (Howell 2003).
cinerea. It has been proved that Glicocladium roseum acts In subsequent studies, a mutant of T. virens deficient for
by reducing the inocula from infected leaves and protecting both mycoparasitism and toxins biosynthesis still retained
the flower parts from attack by B. cinerea (Maas 2004). In biocontrol efficacy; these results indicate that neither myco-
one curious case it was found that non-pathogenic isolates parasitism nor toxins are essential for biocontrol of these
of Fusarium oxysporum can be used to control fusarium pathogens (Liu et al. 2009).
wilt in a field test when plants were inoculated with the Competition through rhizosphere competence is another
non-pathogenic isolates prior to planting (Okayama 1991; control mechanism that has been proposed because Tricho-
Tezuka et al. 1991). derma grows rapidly and easily colonizes the root systems
Although we have already presented some attractive of plants. Rhizosphere competence is important because
and interesting results of biocontrol agents, the genus Tri- biocontrol agents can work by competing successfully for
choderma is the most studied and most effective fungal bio- space and nutrients. However one problem for this theory is
control agent found to date. Fungal species belonging to that some species of Trichoderma (excellent roots coloni-
this genus occur all around the world and are easily isolated zers) exhibit little or no biocontrol activity against R. solani
from soil, decaying wood and other forms of plant organic in cotton seedlings (Howell 2003). In addition, this genus is
matter (Howell 2003). Since the 1930s, it has been known characterized by its capacity to secrete a large number of
that fungi of the Trichoderma species have the potential to compounds, and even to generate complex interactions bet-
act as biocontrol agents of plant diseases. Trichoderma spp. ween plants and pathogens; therefore a control mechanism
have developed an astonishing ability to interact, both based on physical competition does not seem to be very
parasitically and symbiotically, with different substrates and likely or feasible. During its interactions with host plants
living organisms, including plants and other microbes (Woo Trichoderma spp. exhibits other characteristics that may
et al. 2006). Over the past several decades, the literature has contribute to disease resistance or tolerance by the plants.
contained many publications reporting the results obtained This mechanism is similar to that employed by Pseudo-
with these fungi as biocontrol agents, but even today we do monas spp., explained above, in that it induces plant root
not have a complete understanding of the complex mecha- and shoot growth, resistance to biotic and abiotic stresses,
nisms that the fungi use to carry out their antagonistic acti- and improvements in the nutritional status of the plant.
vity. In two reviews Howell (2003) and Woo et al. (2006) Harman et al. (2000) showed that, after treatment of seed
tried to summarize the main features of the molecular boil- with T. harzianum (T-22), corn planted in low nitrogen soil
ogy of the interactions between Trichoderma spp., plants produced plants that were greener and larger in the early
and phytopathogenic fungi, and the main aspects of this re- part of the growing season. Harman et al. (2000) reported a
search area and the conclusions that can be drawn will be strong interaction between T-22 and the nitrogen-fixing
discussed next. bacterium Bradyrhizobium japonicum. Theoretically, the
Trichoderma spp. can utilize a variety of nutrient sour- combination of a nitrogen-fixing bacterium and a fungus
31
that enables the plant to utilize nitrogen more efficiently is et al. 1997). These methods are faster and can be used by
directly related to a general beneficial growth effect on the personnel with little experience in plant pathology (McCart-
root system, which thereby gives the plant more resistance ney et al. 2003). Additionally, non-cultivable microorga-
against pathogens (Harman et al. 2000). nisms can also be detected and quantified, samples can be
Research data accumulated in the past few years have tested directly, and isolates do not require culturing because
led to a completely novel understanding of the ways in minute quantities of fungal DNA can be detected from envi-
which these fungi interact not only with other microbes but ronmental samples, even before symptoms occur. Diagnosis
also with plants and soil components (Woo et al. 2006). The time can be reduced from a period of weeks, typically expe-
production of enzymes and the induction of defence res- rienced with culture plating, to only a few days, thus
ponses in plants by Trichoderma spp. have been discussed. allowing the appropriate control methods to implemented
The use of relatively novel tools to investigate these com- much sooner and more effectively (Atkins et al. 2004;
plex processes, in particular proteomic analysis, has de- Lievens et al. 2005). These methods can show also some
monstrated that a molecular “cross-talk” or intercommuni- disadvantages because non-viable or dead propagules are
cation is established between Trichoderma spp., the plants also detected, but this can lead only to overestimate the pos-
and the pathogens. sibilities of risk in a very low percentage. In comparison
with the advantages that these methods provide, they are a
DIAGNOSIS AND MONITORING OF DISEASES potential alternative to conventional diagnostic methods
(Garrido et al. 2009b).
The ability to detect, identify and quantify plant pathogens Advances in polymerase chain reaction technology have
accurately is the cornerstone of plant pathology. The reli- opened alternative approaches to the detection and identifi-
able identification of the organism(s) responsible for a crop cation of strawberry fungal pathogens. The development of
disease is an essential prerequisite to the implementation of PCR technology relies on three fundamental steps: i) the
disease management strategies. Therefore, in the diagnosis selection of a specific target region of DNA/RNA to iden-
of strawberry fungal infections, it is essential to devise and tify the fungus; ii) extraction of total community DNA/
carry out a correct preventive disease management program. RNA from the environmental sample; iii) a method for
Because many fungal pathogens of strawberry (e.g. Diplo- identifying the presence of the target DNA/RNA region in
carpon earlianum, Mycosphaerella fragariae and Phomop- the sample (Atkins et al. 2004). In recent years, many re-
sis obscurans) produce similar symptoms, as described in search studies have been published reporting improvements
the preceding section, it is important to be able to distin- to each of the three fundamental steps described above, and
guish between different species. Decisions must be made, working on some of the most serious fungal pathogens of
for example, on the extent to which the disease is likely to strawberry, such as Botrytis cinerea (Suárez et al. 2005),
damage the crop, and what are the most appropriate control Colletotrichum acutatum (Debode et al. 2009; Garrido et al.
measures to take. Fungus identification needs to take into 2009b), Colletotrichum gloeosporioides, Colletotrichum
account not only those pathogens included in the current spp. (Garrido et al. 2009b), Fusarium oxysporum (Lievens
EPPO quarantine lists and discussed in this review (e.g. et al. 2003), Verticillium albo-atrum (Larsen et al. 2007),
Colletotrichum acutatum and Verticillium dahliae), but also and Verticillium dahliae (Atallah et al. 2007). We will next
those that appear only on previous lists. Many pathogens describe the main results obtained in the study of these
are subjected to special regulation through quarantine pro- pathogens.
grams agreed among producer countries. For all these rea- There are two main ways to select the target DNA: i)
sons, accurate and rapid methods of detection and identi- using specific sequence information available in databases;
fication are essential (Debode et al. 2009; Garrido et al. and ii) cloning and sequencing arbitrary parts of the fungal
2009b). More generally, pathogen identification is crucial to genome (Atkins et al. 2004). The most commonly-used
all aspects of fungal diagnostics and epidemiology in the DNA region targeted to design primers for PCR-based iden-
field of plant pathology, medical science, environmental tification and detection of fungal plant pathogens are the
studies and biological control (McCartney et al. 2003; At- ribosomal RNA genes, because of the highly variable se-
kins et al. 2004). quences of the internal transcribed spacers ITS1 and ITS2,
Classic methods have been used for many years in the which separate the 18S/5,8S and 5,8S/28S ribosomal RNA
detection and identification of pathogenic fungi, including genes, respectively (Garrido et al. 2009b). These regions
interpreting visual symptoms of the plant or the morpholo- have been used by Debode et al. (2009) and Garrido et al.
gical characteristics of fungal structures after growing in (2009b) to develop protocols of identification for the genus
several media. Biochemical, chemical and immunological Colletotrichum, and to distinguish between the three species
analyses have also been used until recently. These traditi- causing anthracnose in strawberry: Colletotrichum acuta-
onal methods can contribute a great deal of information tum, C. gloeosporioides and C. fragariae. Another highly
increasing the biological knowledge of the fungal species, variable region of the ribosomal RNA genes is the IGS
but they have many disadvantages related with the accuracy region which separates the 28S/18S genes. This region has
and reliability. They are often time-consuming and labo- been less used than ITSs, but Suárez et al. (2005) used it
rious methods and the organism itself must be capable of successfully to design primers in the polymorphic regions
being cultured. This is a significant handicap because less for the specific identification of B. cinerea. Although the
than 1% of the microorganisms present in an environmental ITS and IGS regions are the main targets, other genes are
sample can be cultured (Lievens et al. 2005). Such analyses becoming more widely studied, in particular the -tubulin
also require experienced and skilled laboratory staffs, which gene (Atkins et al. 2004). Sequences of the -tubulin gene
needs to have extensive knowledge of taxonomy (McCart- were also analyzed by Suárez et al. (2005), Atallah et al.
ney et al. 2003). (2007) and Debode et al. (2009).
Since the 1990s, new methods based on molecular bio- In some cases, where the data obtained using specific
logy have provided new tools for more accurate and reliable sequences from databases are inadequate because a specific
detection, identification and quantification of plant patho- primer cannot be designed, screening arbitrary regions of
gens. These methods are based on immunological and DNA/ the genome is often the next step. This strategy consists of
RNA study strategies, including, amongst others: RFLP an initial screening of random amplified polymorphism
analyses of mitochondrial DNA (Sreenivasaprasad et al. DNA (RAPD), and subsequent analyses of the products
1992; Garrido et al. 2008), AFLP, AT-rich analyses (Free- with the object of developing a SCAR marker. This protocol
man et al. 2000), RAPD-DNA (Whitelaw-Weckert et al. was used by Larsen et al. (2007) to develop SCAR markers
2007), genus-specific and species-specific PCR primers for quantifying Verticillium albo-atrum DNA. Rigotti et al.
(Mills et al. 1992; Sreenivasaprasad et al. 1996; Martinez- (2002), studying B. cinerea isolates, identified SCAR mar-
Culebras et al. 2003; Garrido et al. 2008), real-time PCR kers for the specific identification of this pathogen in Fra-
studies (Garrido et al. 2009b), and ELISA assays (Hughes garia x ananassa. Three years later, Suárez et al. (2005)
32
compared their primers designed in the IGS regions and The level of specificity and sensitivity of real-time
proved that this new assay was more sensitive than all the PCR-based methods with some of the main strawberry
previous assays for B. cinerea. fungal pathogens reported in several publications vouch for
The sensitivity of PCR-based protocols depends mainly the results offered by this technology. Suárez et al. (2005)
on the instrumentation and technique used (i.e. conventional designed three TaqMan® probe/primers sets based on the
PCR vs. real-time PCR), but in a high proportion of cases ribosomal IGS spacer, the -tubulin gene, and the SCAR
this sensitivity depends on the quality of the total com- marker of B. cinerea published by Rigotti et al. (2002). The
munity DNA/RNA extracted from the environmental sam- specificity of the assays was tested by investigating cross-
ples. There are many methods that can be used to extract reactivity with several species of Botrytis very closely rela-
DNA directly from fungal colonies removed from an agar ted to B. cinerea (i.e. B. fabae, B. elliptica, B. tulipae and B.
plate. When working with environmental samples (mainly narcissicola). The assays described were specific for B.
with plant material), a very common problem encountered cinerea even when they were tested with DNA from other
is that chemical products are extracted in conjunction with genera of fungal pathogens, in particular S. sclerotiorum,
total DNA, and these act as PCR-inhibitors; as a result, the which is closely related to the Botrytis genus. When the
sensitivity of the method decreases and can even lead to sensitivity of the assays was investigated, the IGS assay
false negative results. One strategy for solving the problem proved to be more sensitive than all the other assays, with a
is to dilute the samples, but in that case, the quantity of the limit of detection of approximately 0.2 pg of fungal DNA.
target DNA and the sensitivity of detection are also reduced. Detection and quantification of B. cinerea was also tested
A range of different commercial kits are available for ex- using Pelargonium sp. leaf discs inoculated with a range of
traction of fungal DNA from environmental samples such spores from B. cinerea (101 – 104). All the assays, apart
as plant tissue or soil, supplied by several companies from that based on -tubulin, were shown to be sensitive for
(Dynal’s DNA direct, the Soil DNA isolation kit from Mo the total quantity of spores.
Bio Laboratories, Inc., and the Qiagen DNeasy range are In 2007, Larsen et al. proposed a new assay for quan-
examples). These kits are characterized by their simplicity tifying Verticillium albo-atrum DNA from plant samples.
of use; however they can represent a high cost per sample This is currently one of the quarantine pathogens of straw-
analysed and are not always totally reliable in not co- berry. They designed a TaqMan® set of probe/primers
extracting PCR inhibitors. Garrido et al. (2009b) optimized located inside the sequence of a SCAR product produced by
a DNA extraction protocol that can be used for samples of RAPD primer Op87. Using that real-time PCR assay, DNA
strawberry plant material, directly, or from fungal colonies of V. albo-atrum could be detected in linear assay within a
removed from an agar plate. This method uses sample mate- range of DNA quantities from 0.001 to 50 ng, and the assay
rial physically ground using a grinding machine, in the pre- did not amplify DNA from other pathogens evaluated by the
sence of CTAB lysis buffer. The lysated samples are authors, thus showing it to be highly specific for V. albo-
washed in various chemical products (chloroform, isopropa- atrum. Atallah et al. (2007) published also in this year other
nol, ethanol, etc.) and then the final step involves using study to detect and quantify Verticillium dahlia using Q-
Magnesil® beads and GITC lysis buffer (guanidinium thio- PCR. The study was designed using the -tubulin gene and
cyanate buffer) in a Kingfisher robotic processor (King- achieving efficiency greater than 95%, and sensitivity as
fisher ML, Thermo Scientific). Garrido et al. (2009b) de- few as 148 fg of V. dahliae DNA, which is equivalent to
monstrated that this method is very reliable for extracting five nuclei. QPCR detected V. dahliae in naturally infected
DNA from any strawberry plant material. It was tested with potato stems and fresh stems of inoculated plants (Atallah et
roots, crowns, petioles, leaves and fruits and the extraction al. 2007).
methods always showed very high yields of DNA in both In 2009, Garrido et al. published sets of new protocols
quantity and quality. PCR-inhibitors were not co-extracted for the detection of Colletotrichum spp., C. acutatum and C.
from any samples, and therefore, a dilution step is not gloeosporioides, and for monitoring strawberry anthracnose
necessary prior to using the sample with a PCR test. The using real-time PCR. Several months later, Debode et al.
sensitivity of the entire detection protocol is thus improved, (2009) proposed an additional set of probe/primers for Col-
using this protocol. letotrichum acutatum in strawberry. Both groups of authors
The third difficulty that an effective detection protocol used mainly the ITS regions to design the sets of probe/
must overcome is the detection stage. Conventional PCR primers. Garrido et al. (2009b) tested the specificity of all
has been a fundamental part of fungal molecular diagnostics, assays using DNA from isolates of six species of Colleto-
but due to its limitations: gel-based methods, possibility of trichum and from DNA of another nine fungal species com-
quantification, sensitivity, etc. The development of real- monly found associated with strawberry material. Ad-
time PCR has been a valuable response to these limitations; ditionally, they checked that samples did not contain PCR
it is more sensitive, more accurate and less time-consuming inhibitors co-extracted during the DNA extractions using
than conventional end-point quantitative PCR (Lievens et al. one universal pair of primers for the 5,8S ribosomal gene by
2005). A specific target organism is both detected and quan- PCR SYBR®Green amplifications. All the new assays were
tified by measuring the intensity of amplification-specific highly specific for Colletotrichum spp., C. acutatum and C.
fluorescence generated during each cycle in a closed tube gloeosporioides, no cross-reactions were observed with
format using an integrated cycler/fluorimeter. Real-time either related plant pathogens or healthy strawberry plant
PCR can be performed using different chemistries, such as material. The sensitivity of the new real-time PCR assays
TaqMan®, SYBR® Green I dye, or a new approach, deve- was compared with that of previously published conven-
loped by Invitrogen, called LUX. The TaqMan® system tional PCR assays; they were confirmed to be 100 times
consists of a fluorogenic probe specific to the DNA target, more sensitive than the latter. The C. acutatum-specific
which anneals to the target between the PCR primers; The real-time PCR assay was also compared with an existing
TaqMan® system tends to be the most sensitive of the ELISA assay for the diagnosis of this pathogen. Real-time
methods but the new approach, LUX, is achieving the same PCR permitted the detection of the pathogen in samples that
level of sensitivity while further simplifying the techniques, gave negative results for C. acutatum using ELISA. The
as well as reducing the cost. This new system uses two real-time PCR assay detected the equivalent of 7.2 conidia
primers, one of which has a hairpin loop structure with a per plant inoculated with a serial dilution of C. acutatum
fluorophore (Suárez et al. 2005). Although this method is spores, demonstrating the high degree of sensitivity of the
replacing TaqMan® probes in real-time PCR technology, method (Garrido et al. 2009b).
with the object of providing cheaper, reliable methods with Although we have shown the advantages and promising
the specificity of TaqMan® probes without some of the results achieved with these real-time PCR assays, there are
constraints, to date TaqMan® technology is continuing to be other assay formats that have not yet been applied to plant
used in the majority of research projects working with pathogens, such as multiplex PCR, which enables the simul-
strawberry fungal pathogens. taneous detection and quantification of different pathogens
33
in one single reaction. The total number of PCR reactions techniques in several fields, including plant pathology,
that it is possible to detect in a single tube is severely some authors have started to describe the current period as
limited by the number of different fluorescent dyes avail- the “post-genomic era” (Fernández-Acero et al. 2007a).
able, and the common use of a monochromatic energizing Until recently, few advances had been made regarding the
light source in the most common real-time PCR instruments proteome of phytopathogenic and non-phytopathogenic
(Lievens et al. 2003, 2005). To overcome these limitations, fungi. However in the last few years, dozens of teams have
another technology based on DNA arrays is becoming focussed their research activities on the proteomic analysis
available: this technology may lead to unlimited multi- of these filamentous fungi, and they are making significant
plexing, that is, the detection and identification of numerous advances in the knowledge of the biology, mechanisms of
plant pathogens per assay. DNA arrays were originally infection, and even the antagonistic activity of some impor-
developed as a technique for screening for human genetic tant fungi, including B. cinerea (Fernández-Acero et al.
disorders in the 1990’s but recently several authors have 2006a, 2009a, 2009b) and Trichoderma spp. (Grinyer et al.
shown the utility of DNA arrays for multiplex detection and 2004, 2005; Woo et al. 2006).
identification of plant pathogens from complex environ- The increasing interest of the scientific community in
mental samples (Lievens et al. 2003). proteomic analysis has been due to improvements in the
This technology combines nucleic acid amplification proteomics technologies available, such as protein separa-
with the unlimited screening capability of DNA arrays, tion by two-dimensional gel electrophoresis (2-DE), and
resulting in high degrees of sensitivity, specificity and peptide analysis by mass spectrometry (MS), becoming a
throughput capacity. With this technology, oligonucleotide powerful strategy for gaining a better understanding of the
detectors are covalently bound to a solid support, such as a complex molecular cross-talk that is known to take place
nylon membrane. The target DNA segment to be tested is between filamentous fungi and their environments, inclu-
simultaneously amplified and labelled, and subsequently ding other populations of microorganisms and plant hosts
hybridized to the membrane under stringent conditions. (Fernández-Acero et al. 2006b, 2007b). Proteomic analyses
Lieven et al. (2005) developed a DNA array for the specific of filamentous fungi, both pathogenic and non-pathogenic,
detection and identification within twenty four hours of the have raised serious limitations or handicaps. One of these
strawberry fungal pathogen Fusarium oxysporium and the limitations is the need to have an effective protein extrac-
quarantine pathogens Verticillium albo-atrum and Verticil- tion method for obtaining a good resolution in the 2-DE
lium dahliae. This assay detects at the species level, based gels, because various contaminants such as nucleic acids,
on the fungal ITS region, from several different sample salts, lipids, pigments, cell wall polysaccharides, etc., can
matrices, including plant material, soils and soil extracts. be dragged along with the protein during the extraction pro-
This assay has proved to be highly sensitive, detecting 2.5 cess (Fernández-Acero et al. 2007a).
pg of DNA for V. dahliae, 0.35 pg DNA for V. albo-atrum, Another major handicap is the protein identification.
and 0.5 pg DNA for F. oxysporium. DNA arrays may be Protein spots are often identified by MALDI-TOF using
used for the detection and identification of microorganisms PMF. This technique compares the fragmentation masses
that are important for agricultural and horticultural practice; obtained by MALDI with existing masses in the databases,
however a major limitation of the current technology is the but the information in those databases about the masses of
reliable quantification of pathogen presence. Further inves- filamentous fungi is not yet sufficient for successful iden-
tigations carried out by Lieven et al. (2005) demonstrated tification. Fernández-Acero et al. (2007) deal with this
that a DNA macro-array could be used for accurate patho- handicap by identifying the protein using PMF followed by
gen quantification, at concentration ranges typically en- “de novo” peptide sequencing and sequence alignment. For
countered in horticultural practice. They developed an ini- more information regarding the experimental design of
tial approach including several controls. The hybridization proteomic studies, protocols for obtaining fungal proteomic
results can be standardized and accurately quantified, ena- extracts, the identification of protein spots, and applications
bling pathogen biomass to be quantitatively estimated. This of proteomic advances to phytopathogenic fungi, reference
DNA array for diagnostic purposes in plant pathology to the specific review by Fernández-Acero et al. (2007a) is
requires PCR amplification; therefore the sensitivity of the strongly recommended.
results depends to a large degree on how this step is per- Considering again the biocontrol agents Trichoderma
formed. Lievens et al. (2005) demonstrated that the detec- spp., during the last few years many authors have developed
tion limit is determined by the total population of micro- various approaches based on 2-DE studies and considerable
organisms whose DNA is amplified by the same primer pair advance have been made in understanding the mechanisms
that amplifies the DNA of the target organisms. The lowest by which Trichoderma spp. is capable of controlling the
amount of fungal target DNA detected by the authors was diseases produced by other phytopathogenic fungi. Sum-
0.25 pg, but it could not be detected when the amount of marized below are some of the main achievements obtained
non-target fungal DNA exceeded the target DNA by more with Trichoderma spp. In addition to the biocontrol mecha-
than 1000 times. nisms of this genus explained in the preceding section, it
In conclusion, DNA array technology has proved to be has also been demonstrated that Trichoderma spp. provides
another practical alternative for the detection and identifica- an abundance of biotechnologically-valuable proteins and
tion of an unlimited number of microorganisms in a single secondary metabolites. Grinyer et al. (2004) reported the
assay. This array-based detection procedure for plant patho- first data on the proteome of T. harzianum and T. atroviride
gens has been proved to be relatively cost-effective, and grown on liquid substrates enriched with various different
may lead to a comprehensive pathogen assessment method carbon sources, including pathogen cell walls. Subsequently,
for detecting and quantifying all known pathogens (inclu- Woo et al. (2006) developed a method for separating the
ding fungi, bacteria, and nematodes, as well as viruses); it proteome of T. harzianum and T. atroviride from that of
could also be used for the description of microbial com- bean or tomato while being cultivated together under con-
munities in soil. trolled conditions. They identified a large number of pro-
teins involved in disease resistance processes during colo-
PROTEOMICS APPROACHES AS A TOOL TO nization of these plants by Trichoderma spp. The authors
STUDY STRAWBERRY FUNGAL PATHOGENS concluded that several resistance genes used for the recog-
nition of microbial metabolites are up-regulated or activated
Proteomics studies for the description of biological, meta- by the presence of the beneficial fungus and probably allow
bolic, physiological and pathological processes have made the plant to recognize them (Woo et al. 2006).
considerable progress in recent years. Advances in prote- Four different ABC-transporter encoding genes of Tri-
omic techniques have been useful for obtaining extensive choderma spp., which are specifically expressed to a greater
and decisive biological information about the life cycles of or less degree when the fungi are exposed to culture filtrates
many organisms. Given the achievements made using these and antibiotics produced by B. cinerea and P. ultimum, have
34
been described by Woo et al. (2006). These Trichoderma gested previously, because this enzyme catalyzes the rever-
spp. fungi are known to be able to compete strongly with sible conversion of oxalacetate and malate; oxalacetate has
other microbes and to possess a high innate degree of resis- been shown to be an oxalic acid precursor which has been
tance to an astonishing assortment of chemicals and natural described as a pathogenicity factor in B. cinerea (Lyon et al.
toxins produced by other microbes (Harman 2000, 2004). 2004). In fact, the influence of pH on the expression and
The results obtained by Woo et al. on the ABC-transporter secretion of virulence factors, such as cell wall degrading
genes may demonstrate the presence in these fungi of a enzymes, and the biosynthesis of phytotoxins (botrydial and
large number and variety of effective membrane pumps; dihydrobotrydial, secreted exclusively in acidic media),
this would therefore help explain their remarkable resis- support the hypothesis that MDH is likely to play a key role
tance to such environmental and biochemical stresses. in the cascade of events leading to plant cell death: MDH
It is now accepted that Trichoderma spp. fungi establish therefore is probably essential for the whole infection pro-
a strong molecular-based communication/interaction with cess (Fernández-Acero et al. 2007b).
infected plants (the “cross-talk” referred to previously). In A transcriptional regulator protein of the metE/meth
these fungi there is a direct interaction between the living family was found to co-migrate with MDH. This was also
cells of plants and the fungal structures; this has been ob- found in the proteome of B. cinerea in 2006, but now it was
served and demonstrated in vivo. The type of induced under-expressed in the less pathogenic strain of B. cinerea
resistance mechanism so far demonstrated for Trichoderma (B. cinerea CECT-1.11) (Fernández-Acero et al. 2006b,
spp. resembles that of the induced systemic resistance (ISR) 2007b). The variability of these fungicide targets may be
caused by rhizobacteria but, in contrast, researchers have involved in the basic molecular structure of the different
not yet established the mechanism by which Trichoderma fungicide resistance phenotypes described for B. cinerea, as
spp. fungi provide a stimulus for the plant defence mecha- suggested by Fernández-Acero et al. (2007b). Several
nism and remains an avirulent symbiont that grows together GAPDHs and a cytosolic cyclophilin were also identified in
with the plant root system. It is suggested that Trichoderma that work, and these were only present in the more virulent
spp. transfer to or even exchange with the crop plant vari- B. cinerea strain. GAPDH is involved in oxidative meta-
ous receptive molecules that are recognized and able to acti- bolism and the results support the hypothesis that this meta-
vate a variety of processes such as defence against phyto- bolism may be more active in the pathogenic than in the
pathogenic fungi and accelerated development or resistance non-pathogenic strain. In the case of cyclophilin, the role of
to such pathogens. It has been demonstrated that Tricho- this protein as a virulence factor in B. cinerea has previ-
derma spp. produce at least three different types of mole- ously been described by Viaud et al. (2003), and it is asso-
cules, called elicitors. ciated with the later stages of infection, such as penetration
The first type of elicitor produced may include various or plant colonization. Thus, the proteomic analyses of two
peptides and proteins, such as serine protease, xylanases, strains of B. cinerea, which differ in virulence as well as in
chitinases and glucanases. Trichoderma spp. fungi secrete toxin production, was very useful for relating various di-
them when the presence of the pathogen is sensed and the fferent cellular components involved in the infection pro-
plant recognizes these molecules as foreign fungal mole- cess (Fernández-Acero et al. 2007b).
cules, thus activating the expression of resistance genes. In a subsequent work, Fernández-Acero et al. (2009)
The second type of elicitor may be avr-like proteins similar describe an analysis of the proteins produced by B. cinerea
to those found in avirulent pathogens and the avr proteins of during cellulose degradation. It is known that B. cinerea is
Trichoderma spp. itself. The third type of elicitor comprises capable of secreting many different cell wall degrading en-
molecules released from the pathogen and the plant cell zymes; therefore since cellulose is one of the major compo-
wall by the Trichoderma cell wall degradation enzymes nents of the plant cell wall, the authors adopted this experi-
(CWDEs). These molecules would stimulate the biocontrol mental approach in their attempt to identify proteins with
fungi and their antagonistic activity by activating the myco- crucial roles in this degradation. A total of 267 spots were
parasitic gene expression cascade, but also act as elicitors identified; a list with the identifications is available in the
when plant cells are exposed to them or when injected into World-2PAGE public database (www.expasy.org/world-
the root and leaf under-surfaces (Woo et al. 2006). 2dpage/; accession number: 0005-“B. cinerea mycelium
With respect to recent research into the biology of phy- cultured in carboxymethyl cellulose”). Proteins that could
topathogenic fungi, our group has accumulated a considera- play a significant role in plant infection were identified,
ble amount of new information about the biology of Bo- specifically B. cinerea peptidyl-prolyl cis-trans isomerase
trytis cinerea from various different proteomic approaches, and glyceraldehydes 3-phosphate dehydrogenase (Fernán-
which has resulted in the publication of five papers and dez-Acero et al. 2009) (Fig. 4).
more than ten congress communications during the last four In 2009, Shah et al. (2009) published an approach to the
years (Fernández-Acero et al. 2006b, 2007a, 2007b, 2009, secretome of Botrytis cinerea using a high-throughput LC-
2010). In 2006, Fernández-Acero et al. (2006b) reported the MS/MS approach. The authors used a cellophane membrane
first approach to the proteome analysis of Botrytis cinerea. and a media supplemented with extract of tomato, straw-
Up to four hundred protein spots were resolved in 2-DE berry and/or Arabidopsis leaf extract. Botrytis cinerea se-
after optimizing a protocol for protein extraction using phos- creted proteins were identified such as transport proteins,
phate buffer followed by TCA-acetone precipitation. Due to carbohydrate metabolism proteins, peptidases, and oxida-
the absence of genomic data on B. cinerea, the proteins had tion/reduction proteins used by B. cinerea secreted proteins
to be sequenced de novo, and 21 protein spots were posi- for plant infection and colonization (Shah et al. 2009). Our
tively identified; these correspond to MDH and GADPH, group has developed a proteomics approach for studying
and some of them are associated with virulence, including the secretome of B. cinerea; recently, an article has been
these latter two and cyclophilin. This study constituted the published showing interesting results that open the door to
basis of subsequent research and was the first approach to understanding the protein that B. cinerea secretes to the
analysing the proteome of this important fungus. external environment and its induction pathways (Fernán-
Later, Fernández-Acero et al. (2007b) carried out a dez-Acero et al. 2010). This work constitutes the first pro-
comparative analysis between two B. cinerea isolates dif- teomic approach to the secretome of this phytopathogenic
fering in both virulence and toxin production, in an attempt fungus based on 2-DE combined with MS/MS analysis. The
to find differences between mycelia extracts from the two secretome has been studied using carbon sources and plant-
isolates that could be related to the differences in virulence. based elicitors under controlled culture conditions. The
The results reported in that study were in agreement with different elicitors, as explained in preceding paragraphs, are
previous identifications of proteins. MDH proteins were molecules that activate the plant defences and accelerate the
identified and found to be overexpressed in the more development of resistance against phytopathogenic fungi;
virulent strains used in that work (B. cinerea CECT-2100). these have been used, in this proteomic approach, to stimu-
The role of MDH as a pathogenicity factor had been sug- late the fungal infection mechanisms in order to identify the
35
A B C
Fig 4 2-DE CBB-stained gels from mycelial extracts of B. cinerea 2100 growing in different carbon sources. (A) Glucose, (B) pectin, (C) starch.
Proteins were separated on 17 cm, pH 3–10 non-linear gradient IPG gels (IEF) and 14% polyacrylamide gels (SDS-PAGE).
protein secreted by the fungus (Fernández-Acero et al. improvement of molecular technologies. New and more
2010). More than seventy protein spots have been identified accurate methods for the detection, identification and moni-
in this work. The proteins identified from the B. cinerea toring of fungal pathogens, even directly from plant mate-
secretome were assigned to categories according to their rials, have been demonstrated. Real-time PCR assays offer
involvement in different biological processes, including increased sensitivity compared with current gel-based PCR
carbohydrate metabolic processes, metabolic processes, and for the diagnosis of these pathogens. Diagnosis based on
cell wall organization and biogenesis. Classifying the pro- real-time PCR gives a rapid, sensitive and accurate result in
teins by function, hydrolase activity, catalytic activity, car- 1–2 days, allowing high-throughput and inexpensive
bohydrate binding, and binding activity, among others, were screening of samples. These methods also permit the detec-
found. A detailed study of the spots found in our approach tion of pathogens from plant material before any symptoms
show a clear relationship between the proteins identified are apparent, and have proved to be a useful tool for study-
and the virulence data obtained from B. cinerea. Many pro- ing the epidemiological routes of these strawberry patho-
teins identified in this work have not yet been functionally gens in fields and nurseries.
assigned, but their regulation under the conditions assayed Many research groups are devoting considerable efforts
demonstrates their functional significance in the mecha- to identifying new species of antagonism organisms with
nisms of infection used by B. cinerea, and the study will capacity to act as biocontrol agents. The soil microflora is a
advance our functional understanding of Botrytis patho- complex microenvironment. Research is needed to clarify
genesis. which of the pathogens adversely affect growth and cause
All of these new proteomics approaches and the results yield reductions in field planting, how they are distributed
achieved by the several research groups working with bio- in the production area, the time of year that they have the
control agents or directly with the phytopathogenic fungi, most significant impact on the strawberry plant, the effect
improve our understanding of the complex biology of these of environmental parameters on disease, and the influence
microorganisms. The proteome-mining approaches are par- of cropping practices on disease severity (Martin et al.
ticularly promising from a biotechnological perspective 2002). The success of biological approaches to controlling
because the kinds of biomolecule synthesized and secreted plant diseases must be judged by their performance under
by these filamentous fungi can be studied in depth, and may field conditions. Although we have shown in this review
be future alternatives as biocontrol molecules, instead of that several research projects have achieved promising re-
using biological organisms that depend to a greater or less sults in terms of the antagonist activity of several species of
extent on the particular environmental conditions for their bacteria and fungi, the main problem is reliability. Unfortu-
growth. In addition, the proteins identified from these stu- nately, discrepancies exist between the antagonistic effect
dies can be used as therapeutic targets to enable the design under in vitro conditions and the corresponding in situ ef-
of more specific and ecological fungicides, based on tar- ficacy, and although a good efficacy is shown in greenhouse
geted molecular research; some of the proteins identified assays under controlled conditions, this is not well cor-
may even be useful for developing a procedure for field related with the efficacy under field conditions, because
diagnosis of plant infections (Fernández-Acero et al. 2010). many factors influence the growth and activity of the pros-
pective biocontrol agents. Further studies are necessary to
CONCLUSIONS understand the mechanisms of action of antagonism in
microorganisms and thereby to improve the biocontrol prac-
Strawberry is a commercially important crop which produc- tices based on those mechanisms.
tion and marketing generate hundreds of millions of Euros. Advances in proteomics studies and proteome-mining
The commercial viability of the crop is continually subject approaches are providing a compendium of tools for a
to various risks, one of the most serious of which is the dis- better understanding of the complex biological metabolisms
eases caused by phytopathogenic organisms. Until the last presented by plants, biocontrol agents, and phytopathogenic
decade, the cultivation of strawberry has followed lines of fungi. Given the achievements reported for these techniques
action established in the 1950s and 60s. During the last in several fields, including plant pathology, some authors
years the advances in control measures applied in agricul- have described the current period as the “post-genomic era”
ture, and the new laws and regulations imposed by the inter- (Fernández-Acero et al. 2007a). We have presented the re-
national community, the traditional approaches are chan- sults obtained by several groups in this field, and their
ging towards a more rational kind of agriculture. contributions in identifying proteins that may be involved in
In this review we have discussed recent advances in pathogenesis. Proteomics is a promising field for dis-
molecular biology, which are being applied in molecular covering new factors of pathogenicity and for dissecting
technologies, to provide new strategies and weapons for infection mechanisms. In the near future, the proteins
combating the diseases that affect the strawberry – specific- identified will be used as therapeutic targets, allowing the
ally those caused by fungal pathogens. The development of design of more specific and ecological fungicides based on
new methods for studying and controlling phytopathogenic targeted molecular research. Some of the proteins identified
fungi has occurred in parallel with the development and may even be used to develop a procedure for field diagnosis
36
of plant infections (Fernández-Acero et al. 2010). of Pseudomonas species in soil and in the rhizosphere of field-grown Verti-
After reading this review, one might believe that cillium dahliae host plants. Environmental Microbiology 8, 2136-2149
solutions to most of the problems associated with straw- Cunningham MJ (2000) Genomics and proteomics: The new millennium of
drug discovery and development. Journal of Pharmacological and Toxicolo-
berry fungal pathogens have now been found, but nothing
gical Methods 44, 291-300
could be further from the truth. A broad selection of alter- Curry KJ, Abril M, Avant JB, Smith BJ (2002) Strawberry anthracnose:
native improved methods has been considered in the current Histopathology of Colletotrichum acutatum and C. fragariae. Phytopathol-
review. Moreover, more accurate and reliable protocols will ogy 92, 1055-1063
be published in the coming years. However, the phytopatho- Davik J, Honne BI (2005) Genetic variance and breeding values for resistance
genic organisms will continue evolving and new species to a wind-borne disease Sphaerotheca macularis (Wallr. ex Fr.) in strawberry
and new pathotypes of the same pathogens will appear in (Fragaria x ananassa Duch.) estimated by exploring mixed and spatial
the field, better adapted to changing environmental condi- models and pedigree information. Theoretical and Applied Genetics 111 (2),
tions and more resistant to fungicides and biomolecules/ 256-264
Debode J, Hemelrijck WV, Baeyen S, Creemers P, Heungens K, Maes M
toxins produced by biocontrol agents. It is necessary to
(2009) Quantitative detection and monitoring of Colletotrichum acutatum in
continue undertaking research projects aimed at developing strawberry leaves using real-time PCR. Plant Pathology 58, 504-514
new methods with practical application, but it is also neces- Duarte FL, Pais C, Spencer-Martins I, Leão C (2004) Isoenzyme patterns: a
sary to continue studying the complex biology of these valuable molecular tool for the differentiation of Zygosaccharomyces species
microorganisms, in order to gain a better understanding that and detection of misidentified isolates. Systematic and Applied Microbiology
will enable strategies to be devised for their future control, 27 (4), 436-442
and for the preservation of the highest possible quality of Ehsani-Moghaddam B, Charles MT, Carisse O, Khanizadeh S (2006)
the strawberry crop in the future. Superoxide dismutase responses of strawberry cultivars to infection by Myco-
sphaerella fragariae. Journal of Plant Physiology 163 (2), 147-153
EPPO (2004) European and Mediterranean Plant Protection Organization. Qua-
ACKNOWLEDGEMENTS
rantine Pests for Europe. Available online: http://www.eppo.org/
EPPO (2009) European and Mediterranean Plant Protection Organization. Qua-
We would like to thank the Spanish Government, the Ministerio de rantine Pests for Europe. Available online: http://www.eppo.org/
Ciencia y Tecnología, and the Junta de Andalucía (Regional Gov- Errakhi R, Lebrihi A, Barakate M (2009) In vitro and in vivo antagonism of
ernment) for the financing of most of the work presented in this actinomycetes isolated from Moroccan rhizospherical soils against Sclero-
Review article, which was carried out by Garrido et al. and Fer- tium rolfsii: A causal agent of root rot on sugar beet (Beta vulgaris L.). Jour-
nández-Acero et al. (Spanish DGICYT AGL2006-13401-C02- nal of Applied Microbiology 107 (2), 672-681
02/AGR and AGL2009-13359-C02-02; Junta de Andalucía, PO7- FAO (2000) Food and Agriculture Organization of the United Nations. Statis-
FQM-02689). tical Databases. Available online: http://www.fao.org/
FAO (2004) Food and Agriculture Organization of the United Nations. Statis-
tical Databases. Available online: http://www.fao.org/
REFERENCES FAO (2007) Food and Agriculture Organization of the United Nations. Statis-
tical Databases. Available online: http://www.fao.org/
Abad ZG, Abad JA, Coffey MD, Oudemans PV, Man in't Veld WA, de Fernández-Acero FJ, Carbú M, Garrido C, Cantoral JM, Vallejo I (2006a)
Gruyter H, Cunnington J, Louws FJ (2008) Phytophthora bisheria sp. nov., Screening study of potential lead compounds for natural products-based fun-
a new species identified in isolates from the Rosaceous raspberry, rose and gicides against Phytophthora species. Journal of Phytopathology 154, 616-
strawberry in three continents. Mycologia 100 (1), 99-110 621
Agrios GN (2004) Plant Pathology (5th Edn), Academic Press, London, 643 pp Fernández-Acero FJ, Carbú M, Garrido C, Vallejo I, Cantoral JM (2007a)
Atallah ZK, Bae J, Jansky SH, Rouse DI, Stevenson WR (2007) Multiplex Proteomic advances in phytopathogenic fungi. Current Proteomics 4, 79-88
real-time quantitative PCR to detect and quantify Verticillium dahliae colo- Fernández-Acero FJ, Colby T, Harzen A, Cantoral JM, Schmidt J (2009)
nization in potato lines that differ in response to Verticillium wilt. Phyto- Proteomic analysis of the phytopathogenic fungus Botrytis cinerea during
pathology 97, 865-872 cellulose degradation. Proteomics 9, 2892-2902
Atkins SD, Clark M (2004) Fungal molecular diagnostics: A mini review. Fernández-Acero FJ, Colby T, Harzen A, Carbu M, Wieneke U, Cantoral
Journal of Applied Genetics 45 (1), 3-15 JM, Schmidt J (2010) 2-DE proteomic approach to the Botrytis cinerea
Avis TJ, Rioux D, Simard M, Michaud M, Tweddell RJ (2009) Ultrastruc- secretome induced with different plant elicitors. Proteomics 10 (12), 2270-
tural alterations in Fusarium sambucinum and Heterobasidion annosum 2280
treated with aluminum chloride and sodium metabisulfite. Phytopathology 99 Fernández-Acero FJ, Jorge I, Calvo E, Vallejo I, Carbú M, Camafeita E,
(2), 167-175 López JA, Cantoral JM, Jorrín J (2006b) Two-dimensional electrophoresis
Bertelson D (2010) The U.S. strawberry industry. United States Department of protein profile of the phytopathogenic fungus Botrytis cinerea. Proteomics 6,
Agriculture. Economic research service. Statistical Bulletin Number 914. S88-S96
Available online: http://www.nal.usda.gov/pgdic/Strawberry/ers/ers.htm Fernández-Acero FJ, Jorge I, Calvo E, Vallejo I, Carbú M, Camafeita E,
Böszörményi E, Ersek T, Fodor A, Fodor AM, Földes LS, Hevesi M, Hogan Garrido C, López J, Jorrin J, Cantoral JM (2007b) Proteomic analysis of
JS, Katona Z, Klein MG, Kormány A, Pekár S, Szentirmai A, Sztaricskai phytopathogenic fungus Botrytis cinerea as a potential tool for identifying
F, Taylor RA (2009) Isolation and activity of Xenorhabdus antimicrobial pathogenicity factors, therapeutic targets and for basic research. Archives of
compounds against the plant pathogens Erwinia amylovora and Phytoph- Microbiology 187, 207-215
thora nicotianae. Journal of Applied Microbiology 107 (3), 746-759 Fiume G, Fiume F (2008) Biological control of corky root in tomato. Com-
Cao S, Zheng Y, Tang S, Wang K (2008) Improved control of anthracnose rot munication in Agricultural and Applied Biological Sciences 73 (2), 233-248
in loquat fruit by a combination treatment of Pichia membranifaciens with Freeman S, Minz D, Jurkevitch E, Maymon M, Shabi E (2000) Molecular
CaCl(2). International Journal of Food Microbiology 126 (1-2), 216-220 analyses of Colletotrichum species from almond and other fruit. Phytopathol-
Chiba S, Salaipeth L, Lin YH, Sasaki A, Kanematsu S, Suzuki N (2009) A ogy 90, 608-614
novel bipartite double-stranded RNA Mycovirus from the white root rot fun- Garrido C, Carbú M, Fernández-Acero FJ, Budge G, Vallejo I, Coyler A,
gus Rosellinia necatrix: molecular and biological characterization, taxonomic Cantoral JM (2008) Isolation and pathogenicity of Colletotrichum spp.
considerations, and potential for biological control. Journal of Virology 83 causing anthracnose of strawberry in south west Spain. European Journal of
(24), 12801-12812 Plant Pathology 120, 409-415
Chiotta ML, Ponsone ML, Combina M, Torres AM, Chulze SN (2009) Garrido C, Carbú M, Fernández-Acero FJ, Vallejo I, Cantoral JM (2009a)
Aspergillus section Nigri species isolated from different wine-grape growing Phylogenetic relationships and genome organisation of Colletotrichum acu-
regions in Argentina. International Journal of Food Microbiology 136 (1), tatum causing anthracnose in strawberry. European Journal of Plant Pathol-
137-141 ogy 125, 397-411
Choi YJ, Shin HD, Thines M (2009) Two novel Peronospora species are asso- Garrido C, Carbú M, Fernández-Acero FJ, Boonham N, Colyer A, Canto-
ciated with recent reports of downy mildew on sages. Mycological Research ral JM, Budge G (2009b) Development of protocols for detection of Col-
113 (12), 1340-1350 letotrichum acutatum and monitoring of strawberry anthracnose using real-
Chung WH, Chung WC, Peng MT, Yang HR, Huang JW (2010) Specific time PCR. Plant Pathology 58, 43-51
detection of benzimidazole resistance in Colletotrichum gloeosporioides Grinyer J, Hunt S, McKay M, Herbert BR, Nevalainen H (2005) Proteomic
from fruit crops by PCR-RFLP. New Biotechnology 27 (1), 17-24 response of the biological control fungus Trichoderma atroviride to growth
Costa R, Gomes NC, Krögerrecklenfort E, Opelt K, Berg G, Smalla K on the cell walls of Rhizoctonia solani. Current Genetics 47, 381-383
(2007) Pseudomonas community structure and antagonistic potential in the Grinyer J, McKay M, Nevalainen H, Herbert BR (2004) Fungal proteomics:
rhizosphere: Insights gained by combining phylogenetic and functional gene- Initial mapping of biological control strain Trichoderma harzianum. Current
based analyses. Environmental Microbiology 9 (9), 2260-2273 Genetics 45, 163-169
Costa R, Salles JF, Berg G, Smalla K (2006) Cultivation-independent analysis Gutiérrez L, Escudero A, Batlle R, Nerín C (2009) Effect of mixed antimic-
37
robial agents and flavors in active packaging films. Journal of Agricultural 465-474
and Food Chemistry 57 (18), 8564-8571 Mertely JC, Seijo T, Peres N (2005) First report of Macrophomina phaseolina
Haesler F, Hagn A, Frommberger M, Hertkorn N, Schmitt-Kopplin P, causing ac Rot of strawberry in Florida. Plant Disease 89, 434
Munch JC, Schloter M (2008) In vitro antagonism of an actinobacterial Mills PR, SreenivasaprasadS S, Brown AE (1992) Detection and differenti-
Kitasatospora isolate against the plant pathogen Phytophthora citricola as ation of Colletotrichum gloeosporioides isolates using PCR. FEMS Micro-
elucidated with ultrahigh resolution mass spectrometry. Journal of Micro- biology Letters 98, 137-144
biological Methods 75 (2), 188-195 Miyamoto Y, Ishii Y, Honda A, Masunaka A, Tsuge T, Yamamoto M, Oh-
Harman GE (2000) Myths and dogmas of biocontrol: Changes in perceptions tani K, Fukumoto T, Gomi K, Peever TL, Akimitsu K (2009) Function of
derived from research on Trichoderma harzianum T-22. Plant Disease 84, genes encoding acyl-coa synthetase and enoyl-coa hydratase for host-selec-
377-393 tive act-toxin biosynthesis in the tangerine pathotype of Alternaria alternata.
Harman GE, Lorito M, Lynch JM (2004) Uses of Trichoderma spp. to alle- Phytopathology 99 (4), 369-377
viate or remediate soil and water pollution. Advances in Applied Microbiol- Morocko I, Fatehi J (2007) Molecular characterization of strawberry pathogen
ogy 56, 313-330 Gnomonia fragariae and its genetic relatedness to other Gnomonia species
Hauke K, Creemers P, Brugmans W, Van Laer S (2004) Signum, a new fun- and members of Diaporthales. Mycological Research 111, 603-614
gicide with interesting properties in resistance management of fungal dis- Nicastro G, Orsomando G, Ferrari E, Manconi L, Desario F, Amici A, Naso
eases in strawberries. Communication in Agricultural and Applied Biological A, Carpaneto A, Pertinhez TA, Ruggieri S, Spisni A (2009) Solution struc-
Sciences 69 (4), 743-755 ture of the phytotoxic protein PcF: The first characterized member of the
Heeb S, Hass D (2001) Regulatory roles of the GacS/GacA two-component Phytophthora PcF toxin family. Protein Science 18 (8), 1786-1791
system in plant-associated and other gram negative bacteria. Molecular Nita M, Ellis MA, Madden LV (2003) Reliability and accuracy of visual esti-
Plant-Microbe Interactions 14 (12), 1351-1363 mation of phomopsis leaf blight of strawberry. Phytopathology 93 (8), 995-
Herrera-Vasquez JA, Cebrian MD, Alfaro-Fernández A, Cordoba-Selles 1005
MD, Jorda C (2009) Multiplex PCR assay for the simultaneous detection Okayama K (1991) Selection [sic] and effect of antagonistic on Fusarium wilt
and differentiation of Olpidium bornovanus, O. brassicae, and O. virulentus. of strawberries. Bulletin of the Nara-ken Agricultural Experiment Station 19,
Mycological Research 113 (5), 602-610 67-78
Howell CR (2003) Mechanisms employed by Trichoderma species in the bio- Ortega-Morales BO, Ortega-Morales FN, Lara-Reyna J, De la Rosa-García
logical control of plant diseases. Plant Disease 87, 4-10 SC, Martínez-Hernández A, Montero-M J (2009) Antagonism of Bacillus
Hughes KJD, Lane CR, Cook RTA (1997) Development of a rapid method for spp. isolated from marine biofilms against terrestrial phytopathogenic fungi.
the detection and identification of Colletotrichum acutatum. In: Diagnosis Marine Biotechnology (NY) 11 (3), 375-383
and Identification of Plant Pathogens. Kluwer Academic Publishers, Nether- Ozaki S, Fukuda S, Fujita T, Kishimoto N (2008) RAPD analysis of salt-
lands, pp 113-116 tolerant yeasts from contaminated seasoned pickled plums and their growth
JA (2004) Government of Andalusia (in Spanish). Junta de Andalucía. Available inhibition using food additives. Biocontrol Science 13 (4), 125-130
online: http://www.juntadeandalucia.es/organismos/agriculturaypesca.html Polianskaia LM, Ozerskaia SM, Kochkina GA, Ivanushkina NE, Golov-
Javaid A, Amin M (2009) Antifungal activity of methanol and n-hexane ex- chenko AV, Zviagintsev DG (2003) The quantity and structure of the root-
tracts of three Chenopodium species against Macrophomina phaseolina. associated microbial complexes of two greenhouse rose cultivars. Mikro-
Natural Products Research 23 (12), 1120-1127 biologiya 72 (4), 554-562
Kong P, Moorman GW, Lea-Cox JD, Ross DS, Richardson PA, Hong C Prodorutti D, Vanblaere T, Gobbin D, Pellegrini A, Gessler C, Pertot I
(2009) Zoosporic tolerance to pH stress and its implications for Phytophthora (2009) Genetic diversity of Armillaria spp. infecting highbush blueberry in
species in aquatic ecosystems. Applied and Environmental Microbiology 75 northern Italy (Trentino region). Phytopathology 99 (6), 651-658
(13), 4307-4314 Rawsthorne H, Phister TG (2009) Detection of viable Zygosaccharomyces
Lamondia JA, Cowles RS (2005) Comparison of Pratylenchus penetrans in- bailii in fruit juices using ethidium monoazide bromide and real-time PCR.
fection and Maladera castanea feeding on strawberry root rot. Journal of International Journal of Food Microbiology 131 (2-3), 246-250
Nematology 37 (2), 131-135 Redondo C, Cubero J, Melgarejo P (2009) Characterization of Penicillium
Larsen RC, Vandemark GJ, Hughes TJ, Grau CR (2007) Development of a species by ribosomal DNA sequencing and BOX, ERIC and REP-PCR analy-
real-time polymerase chain reaction assay for quantifying Verticillium albo- sis. Mycopathologia 168 (1), 11-22
atrum DNA in resistant and susceptible alfalfa. Phytopathology 97 (11), Ren L, Li G, Jiang D (2010) Characterization of some culture factors affecting
1519-1525 oxalate degradation by the mycoparasite Coniothyrium minitans. Journal of
Lievens B, Brouwer M, Vanachter ACRC, Lévesque CA, Cammue BPA, Applied Microbiology 108 (1), 173-180
Thomma BPHJ (2003) Design and development of a DNA array for rapid Rose JKC, Bashir S, Giovannoni JJ, Jahn MM, Saravanan R (2004) Tack-
detection and identification of multiple tomato vascular wilt pathogens. ling the plant proteome: practical approaches, hurdles and experimental tools.
FEMS Microbiological Letters 223, 113-122 The Plant Journal 39, 715-733
Lievens B, Brouwer M, Vanachter AC, Lévesque CA, Cammue BP, Ruiz-Moyano S, Benito MJ, Martín A, Aranda E, Hernández A, Córdoba
Thomma BP (2005) Quantitative assessment of phytopathogenic fungi in MG (2009) Characterization of molds isolated from smoked paprika by PCR-
various substrates using a DNA microarray. Environmental Microbiology 7 RFLP and micellar electrokinetic capillary electrophoresis. Food Microbiol-
(11), 1698-1710 ogy 26 (8), 776-782
Liu LN, Zhang JZ, Xu T (2009) Histopathological studies of sclerotia of Rhi- Santana AS, Rosenthal A, Massaguer PR (2009) Heat resistance and the
zoctonia solani parasitized by the EGFP transformant of Trichoderma virens. effects of continuous pasteurization on the inactivation of Byssochlamys fulva
Letters in Applied Microbiology 49 (6), 745-750 ascospores in clarified apple juice. Journal of Applied Microbiology 107 (1),
Liu X, Wang J, Gou P, Mao C, Zhu ZR, Li H (2007) In vitro inhibition of 197-209
postharvest pathogens of fruit and control of gray mold of strawberry and Shafique S, Bajwa R, Shafique S (2009) Mutation of Alternaria tenuissima
green mold of citrus by aureobasidin A. International Journal of Food Micro- FCBP-252 for hyper-active alpha-amylase. Indian Journal of Experimental
biology 119 (3), 223-229 Biology 47 (7), 591-596
Lyon GD, Goodman BA, Williamson B (2004) Botrytis cinerea perturbs redox Shah P, Atwood JA, Orlando R, El Mubarek H, Podila GK, Davis MR
processes as an attack strategy in plants. In: Edad Y, Williamson B, Tudzyn- (2009) Comparative proteomic analysis of Botrytis cinerea secretome. Jour-
ski P, Delen N (Eds) Botrytis: Biology, Pathology and Control, Kluwer Aca- nal of Proteome Research 8, 1123-1130
demic Publishers, Dordrecht, The Netherlands, pp 119-141 Singleton LL, Mihail JD, Rush CM (1992) Methods for Research on Soil-
Martin FN, Bull CT (2002) Biological approaches for control of root patho- borne Phytopathogenic Fungi, APS Press, St. Paul, MN, USA, 265 pp
gens of strawberry. Phytopathology 92 (12), 1356-1362 Smith BJ (2008) Epidemiology and pathology of strawberry anthracnose: a
Maas JL (1998) Compendium of Strawberry Diseases (2nd Edn), American Phy- North American perspective. HortScience 42, 69-73
topathological Society Press, St. Paul, MN, 98 pp Sreenivasaprasad S, Brown AE, Mills PR (1992) DNA sequence variation
Maas JL (2004) Strawberry disease management. In: Diseases of Fruits and and interrelationships among Colletotrichum species causing strawberry an-
Vegetables (Vol II), Kluwer Academic Publishers, Netherlands, pp 441-483 thracnose. Physiological and Molecular Plant Pathology 41, 265-281
Martínez-Culebras PV, Querol A, Suárez-Fernández MB, García-López Sreenivasaprasad S, Sharada K, Brown AE, Mills PR (1996) PCR-based
MD, Barrio E (2003) Phylogenetic relationships among Colletotrichum detection of Colletotrichum acutatum on strawberry. Plant Pathology 45,
pathogens of strawberry and design of PCR primers for their identification. 650-655
Journal of Phytopathology 151, 135-143 Suárez-Fernández MB, Walsh K, Boonham N, O'Neill T, Pearson S, Barker
Massart S, Jijakli HM (2007) Use of molecular techniques to elucidate the I (2005) Development of real-time PCR (TaqMan) assays for the detection
mechanisms of action of fungal biocontrol agents: A review. Journal of and quantification of Botrytis cinerea in planta. Plant Physiology and Bio-
Microbiological Methods 69, 229-241 chemistry 43, 890-899
McCartney HA, Foster SJ, Fraaije BA, Ward E (2003) Molecular diagnos- Sutton JC (1994) Biological control of strawberry diseases. Advances in Straw-
tics for fungal plant pathogens. Pest Management Science 59, 129-142 berry Research 13, 1-12
Mehli L, Kjellsen TD, Dewey FM, Hietala AM (2005) A case study from the Tezuka N, Makino T (1991) Biological control of Fusarium wilt of strawberry
interaction of strawberry and Botrytis cinerea highlights the benefits of co- by non-pathogenic Fusarium oxysporum isolated from strawberry (in Japa-
monitoring both partners at genomic and mRNA level. New Phytologist 168, nese). Annual Meeting of Phytopathological Society from Japan 57, 506-511
38
Triky-Dotan S, Austerweil M, Steiner B, Peretz-Alon Y, Katan J, Gamliel A chum acutatum isolates from grape in subtropical Australia. Plant Pathology
(2009) Accelerated degradation of metam-sodium in soil and consequences 56, 448-463
for root-disease management. Phytopathology 99 (4), 362-368 Woo SL, Fogliano V, Mach RL, Scala F, Zoina A, Kibicek CP, Lorito M
Viaud M, Brunet-Simon A, Brygoo Y, Pradier JM, Levis C (2003) Cyclo- (2002) Mycoparasitic Trichoderma strains are activated by host-derived
philin A and calcineurin functions investigated by gene inactivation, cyclo- molecules. In: Vannacci G, Sarrocco S (Eds) 6th European Conference on
sporine A inhibition and cDNA arrays approaches in the phytopathogenic Fungal Genetics, April 6-9, Edizioni Plus, Pisa, Italy, p 306 (Abstract)
fungus Botrytis cinerea. Molecular Microbiology 50, 1451-1465 Woo SL, Ruocco M, Ciliento R, Lanzuise S, Vinale F, Formisano E, Scala V,
Wilhelm S, Paulus A (1980) How soil fumigation benefits the California straw- Turrà D, Scala F, Zoina A, Abadi K, Lorito M (2003) Molecular factors
berry industry. Plant Diseases 64, 264-270 involved in the interaction between plants, pathogens and biocontrol fungi.
Whitaker VM, Bradeen JM, Debener T, Biber A, Hokanson SC (2009) Rdr3, In: 11th International Congress on Molecular Plant-Microbe Interactions,
a novel locus conferring black spot disease resistance in tetraploid rose: July 18-27, St. Petersburg, Russia, p 368 (Abstract)
Genetic analysis, LRR profiling, and SCAR marker development. Theoretical Woo SL, Scala F, Ruocco M, Lorito M (2006) The molecular biology of the
and Applied Genetics 120 (3), 573-585 interactions between Trichoderma spp., phytopathogenic fungi, and plants.
Whitelaw-Weckert MA, Curtin SJ, Huang R, Steel CC, Blanchard CL, Phytopathology 96, 181-185
Roffey PE (2007) Phylogenetic relationships and pathogenicity of Colletotri-
39
Strawberry Fruit Softening: Role of Cell Wall Disassembly

and its Manipulation in Transgenic Plants
Sara Posé • Juan A. García-Gago • Nieves Santiago-Doménech •
F. Pliego-Alfaro • Miguel A. Quesada • José A. Mercado*
Instituto de Hortofruticultura Subtropical y Mediterránea “La Mayora”, Universidad de Málaga-Consejo Superior de Investigaciones Científicas (IHSM-UMA-CSIC),
Departamento de Biología Vegetal, Universidad de Málaga, 29071, Málaga, Spain
Corresponding author: * mercado@uma.es
ABSTRACT
Strawberry is the most economically important soft fruit characterized by its delicious flavour, intense colour and soft texture. The rapid
loss of firmness during strawberry ripening is the main determining factor of its short shelf life, and great losses occur by bruising,
oversoftening and subsequent fungal infections during postharvest transportation and storage. Cell wall disassembly and the reduction of
cell to cell adhesion due to middle lamella dissolution have been recognized as the main causes of fruit softening. In the case of straw-
berry fruit, cell wall disassembly during ripening is characterized by a solubilization of pectins, a slight depolymerization of covalently
bound pectins, a loss of galactose and arabinose, as well as a reduction in the hemicellulosic content. The genetic manipulation of genes
encoding proteins involved in wall disassembly has been explored as a biotechnological approach to reduce fruit softening. Thus, the
silencing of fruit specific pectate lyase or polygalacturonase genes, both acting on demethylated pectins, by antisense transformation
increased significantly the firmness of ripe strawberry fruit without affecting other fruit quality parameters. By contrast, the down-regu-
lation of the expression of genes involved in the processing of hemicellulosic polymers, such as endo-E-1,4-glucanase or expansin genes,
did not modify fruit firmness. Other cell wall genes, e.g. E-xylosidase, E-galactosidase, -arabinofuranosidase, have been cloned in straw-
berry fruit, and their expression analyzed along fruit development, but their function on fruit softening has not been assessed yet by trans-
genic approaches. Overall, these results indicate that pectin processing during ripening is a critical factor in the softening of strawberry
fruit, and the manipulation of this process by down-regulating pectinase genes a successful approach to improve this trait. This review
summarizes recent progress on strawberry fruit softening, focusing in the role of cell wall disassembly and genes involved in that process.
_____________________________________________________________________________________________________________
Keywords: cell wall, Fragaria u ananassa, fruit ripening, fruit shelf life, fruit softening, pectin, postharvest
Abbreviations: CDTA, trans-1,2-diaminocyclohexane-tetraacetic acid; CNR, colorless non-ripening; EGase, endoglucanase; GalA,
galacturonic acid; HGA, homogalacturonan; NMR, nuclear magnetic resonance; PG, polygalacturonase; PL, pectate lyase; PME, pectin
methyl esterase; RIN, ripening-inhibitor; RG, rhamnogalacturonan; PAW, phenol:acetic acid:water
CONTENTS
INTRODUCTION........................................................................................................................................................................................ 40
CELL WALL MODIFICATIONS DURING STRAWBERRY RIPENING ................................................................................................. 41
Primary cell wall...................................................................................................................................................................................... 41
Cell wall disassembly in strawberry ripening .......................................................................................................................................... 42
CELL WALL GENES AND STRAWBERRY SOFTENING....................................................................................................................... 43
Pectate lyase ................................................................................................................................................................................................. 43
Polygalacturonase.................................................................................................................................................................................... 44
Pectin methylesterase .............................................................................................................................................................................. 44
Endo--1,4-glucanase .............................................................................................................................................................................. 45
Expansin .................................................................................................................................................................................................. 45
Other cell wall genes ............................................................................................................................................................................... 45
CONCLUDING REMARKS ....................................................................................................................................................................... 46
REFERENCES............................................................................................................................................................................................. 46
_____________________________________________________________________________________________________________
INTRODUCTION Texture is a key quality character for fleshy fruits.

Strawberry belongs to the group of soft fruits which are
Strawberry, Fragaria × ananassa Duch., belongs to the characterised by a high and rapid loss of firm texture during
genus Fragaria of the Rosaceae family, and is one of the the ripening process, acquiring a melting texture in few
most economically important small fruits. World production days after ripening. This fast softening is the major source
and consumer demands for strawberry have increased of commercial losses and results in a short shelf life and
steadily since the 1970s, reaching over 4 million tons in susceptibility to diseases (Perkins-Veazie 1995). It is esti-
2009 (FAOSTAT 2009). This colourful and delicious fruit mated that a 5-30% of strawberry yield is loss due to over-
has also a high nutritional value with essential minerals, or- softening and/or fungal decay. Furthermore, the rapid rate
ganic acids, vitamins and antioxidant compounds, benefits of strawberry softening influences the frequency of harvest
to human health (Hannum 2004). and limits transportation and storage of harvested fruits.
Received: 27 April, 2010. Accepted: 10 August, 2010.

Therefore, improvement of strawberry texture to reduce ditionally, cell wall processing is the result of the coordi-
spoilage during ripening and postharvest is of great com- nated expression of several families of genes and unpredic-
mercial importance. This topic constitutes one of the main table unintended changes may occur. Moreover, the com-
objectives of strawberry breeding programs, using both, plex structure, composition and interactions among the dif-
traditional and biotechnological approaches (Faedi et al. ferent polymers of the cell wall determine that confirmation
2002; Graham 2005; Mercado et al. 2007). Fruit texture is a of activity in planta, or substrate specificity, is lacking for
complex trait depending on numerous factors such as tissue most genes encoding cell wall-modifying proteins. Despite
composition and architecture, cell shape, turgor pressure, these limitations, the manipulation of cell wall related genes
mechanical properties of the cell wall and the strength and has been extensively explored in tomato, the model system
extension of adhesion areas between adjacent cells (Harker for transgenic analysis of fruit softening and ripening, with
et al. 1997; Bourne 2002). It is generally accepted that the limited success (Brummell and Harpster 2001), although a
cell wall disassembly and the reduction of cell to cell ad- recent work describes a significant shelf life extension by
hesion, as result of middle lamella dissolution, are the main suppressing N-Glycan processing enzymes (Meli et al.
factors that cause fruit softening (Brummell and Harpster 2010). A reduction in softening has also been achieved in
2001; Brummell 2006). In general, cell wall modifications strawberry fruits by silencing pectinases (Jiménez Bermú-
responsible for the softening involve the depolymerization dez et al. 2002; Quesada et al. 2009a) and the quality of
of matrix glycans, the solubilization and/or depolymeriza- processed fruits was also improved in these transgenic
tion of pectins, and the loss of neutral sugars from side- plants (Sesmero et al. 2007, 2009). In spite of these pro-
chains of pectins (Brummell 2006; Goulão and Oliveira mising results, inhibiting or delaying textural changes in
2008). These changes induce the loosening of the xylo- ripe strawberry fruit while maintaining other quality attrib-
glucan-cellulose network and cell wall swelling, increasing utes still remains as a major challenge to breeders and fruit
wall porosity that may facilitate degradative enzymes to physiologists. In this paper, we review recent insights into
access to their substrate (Brummell 2006). These cell wall mechanisms of tissue softening in strawberry, focusing on
modifications are common to the ripening of most fleshy the cell wall disassembly taking place during ripening, and
fruits, independently on its classification as climacteric or enzymes and genes involved in that process.
non-climacteric, although each species has specific patterns
of cell wall disassembly. Strawberry ripening is charac- CELL WALL MODIFICATIONS DURING
terized by an extensive dissolution of the middle lamella of STRAWBERRY RIPENING
the cortical parenchyma cells. In ripe fruits, cells appear
separated by a considerable intercellular space and a little Primary cell wall
cell to cell contact area (Redgwell et al. 1997a; Santiago-
Doménech et al. 2008). At the cell wall level, a moderate The flesh of most fruit is composed of parenchyma cells
pectin solubilization and depolymerization and a slight re- which have a thin primary wall. In the most accepted model,
duction of the molecular weight of hemicellulosic polymers the type I primary cell wall is fundamentally a network of
are general features of strawberry softening. However, these cellulose microfibrils coated with and cross-linked together
changes can vary depending on the cultivar and strawberry by matrix glycans. The spaces in the cellulose-matrix gly-
species considered, as discussed later. can network are filled by highly hydrated pectins, forming
Biotechnological attempts to reduce fruits softening also a network, held together and cross-linked with other
using transgenic plants have followed two main strategies. wall components by different types of bonds (Carpita and
Firstly, in climacteric fruits, the suppression of ethylene Gibeaut 1993).
production through transformation with antisense sequences Cellulose is the single component of the microfibrillar
of genes responsible for its synthesis prevents the ripening phase, and it is formed by long linear chains of c. 8000 D-
process as a whole, including softening (Hamilton et al. glucose residues linked by -(14) linkages. Approxi-
1990; Oeller et al. 1991). However, when fruits are treated mately, 36 parallel chains are associated by extensive hyd-
with ethylene to induce ripening the shelf life is usually as rogen bonds forming a microfibril (Taylor 2008). The inter-
short as in wild-type fruits. Moreover, this strategy is not nal region of microfibrils is crystalline and excludes water,
feasible to non-climacteric fruits as the strawberry. More whereas the external layers are more amorphous, and matrix
recently, the genes underlying the tomato mutants pheno- glycans may be interwoven with the glucan chains (Pauly et
types RIPENING INHIBITOR (RIN) and COLOURLESS al. 1999). Matrix glycans or hemicelluloses are composed
NON RIPENING (CNR), which fail to ripen and are not res- predominantly of neutral sugars and do not contain galactu-
ponsive to ethylene, have been cloned (Vrebalov et al. ronic acid (GalA). Xyloglucans, the most abundant glycan,
2002; Manning et al. 2006). Both genes encode transcrip- are linear chains of (14)--D-glucan, like cellulose, but
tion factors that are located upstream to ethylene biosynthe- with numerous xylose residues regularly spaced (Carpita
sis in the ripening regulatory network. It has been suggested and Gibeaut 1993). The glucan backbone of xyloglucan
that these regulators might be conserved between both cli- binds tightly to the surface of cellulose microfibrils, and
macteric and non-climacteric fruits. Supporting this hypo- also these molecules can span the distance between adjacent
thesis, a ripening related strawberry gene homolog to microfibrils linking them together.
tomato RIN gene has been cloned (Vrebalov et al. 2002). The fundamental cellulose-xyloglucan framework rep-
However, the genetic manipulation of these regulatory resents about 50% of the wall mass, and it is embedded in a
genes in tomato causes pleiotropic effects, reducing fruit more soluble matrix of polysaccharides, glycoproteins, low-
quality, or even leads to lethality (Matas et al. 2009). molecular weight compounds and ions (Willats et al. 2001).
A second strategy employed in different fruits has been Pectin is the most abundant class of macromolecule within
based on reduction of the rate of softening by transgenic this matrix, representing about 30% in primary cell wall,
manipulation of the expression of genes encoding cell wall although fruits are usually enriched in pectins, accounting
modifying enzymes. This alternative to the prevention of for up to 60% in many species (Redgwell et al. 1997a). Fur-
ripening might extend shelf life allowing the normal deve- thermore, pectin is the most abundant polymer in the mid-
lopment of other ripening events, such as accumulation of dle lamella, regulating intercellular adhesion (Willats et al.
sugars, volatiles or pigments. This approach could be ap- 2001). The principal component of pectins is D-galacturo-
plied to climacteric and non-climacteric fruits, and it could nic acid that form the backbone of three polysaccharide
also be commercially desirable for fruit processed products domains present in all pectin species: homogalacturonan
where improved integrity is an important quality trait, as (HGA), rhamnogalacturonan-I (RG-I) and rhamnogalactu-
yoghurt or jam. The main limitation of this transgenic ap- ronan-II (RG-II). HGA is a linear homopolymer of GalA
proach is that most cell wall proteins are present as multi linked by -(14) glycosidic bonds, and is thought to con-
gene families, and therefore, the suppression of a single tain 100-200 GalA residues. HGA is synthesized in the
gene can be complemented by another related gene. Ad- Golgi apparatus and deposited in the cell wall with the 70-
41
Strawberry fruit softening. Posé et al.
80% of GalA residues methyl-esterified at the C-6 carboxyl although these changes were more prominent during fruit
(Willats et al. 2001). The removal of this methyl ester growth than at ripening stage.
groups in muro allows the cross-linking of HGA chains by The solubilization of pectins is the most consistent
calcium, and the formation of gels. RG-I is formed by a feature of strawberry softening. Knee et al. (1977) observed
backbone of the disaccharide (1o2)--L-rhamnose-(1o4)- that from 7 to 21 days after petal fall over 90% of the poly-
-D-galacturonic acid, with 20-80% of rhamnose residues uronides were cell wall bound, and then declined to 30% at
substituted by side chains of neutral sugars. The number of ripening. The percentage of pectins extracted with EDTA
lateral residues varies from a single glycosyl residue to 50 also increased up to day 21 and diminished thereafter.
or more, producing a highly variable family of polysac- Huber (1984) showed that the polyuronide content in cell
charides. Arabinans, galactans and arabinogalactans are the wall extracts treated with Na2EDTA increased from 30% in
most common side chains, although other sugars and acids, undeveloped fruit to 65% in ripe fruit. The increase of
such as L-fucose, D-glucose, D-mannose, D-xylose, and D- soluble pectin occurred between large green and pink fruit,
glucuronic acid, are sometimes found (Van Buren 1991). but full ripe red fruit showed a content of Na2EDTA soluble
The highly branched RG-I is known as “hairy” pectin in pectins similar to pink fruit. A more detailed characteriza-
comparison with the “smooth” region of HGA. Pectins are tion of cell wall fractions, as described in the above section,
classically depicted as an extended chain of HGA and RG-I has been reported by several authors (Koh and Melton
regions, although an alternative model has been suggested 2002; Rosli et al. 2004; Figueroa et al. 2010). Koh and
where HGA are side chains of RG-I (Vincken et al. 2003). Melton (2002) showed that the Phenol-Hepes and Water
The third pectin domain is RG-II, a branched polymer con- cell wall fractions, both containing soluble pectins, in-
taining a HGA backbone of 9 GalA residues substituted by creased in a cell wall basis from unripe to ripe fruit, as well
4 heteropolymeric side chains of consistent length. RG-II as the polyuronide content in both fractions. By contrast,
glycosyl sequence is highly conserved in all vascular plants, CDTA and Na2CO3 fractions, containing quelated and
and it is present in the cell wall as dimmers covalently covalently bound pectins, respectively, decreased during
cross-linked by a borate diester (O’Neill et al. 2004). ripening. Both fractions also contained a less amount of
To analyze the ripening-related changes in the cell wall, polyuronides. A similar trend in the behaviour of water and
isolated walls are sequentially extracted to produce frac- 50 mM HCl fractions was observed by Rosli et al. (2004)
tions enriched in a specific component. Usually, these ex- when comparing three F. u ananassa cultivars with contras-
tractions are performed with: 1) PAW (phenol-acetic acid- ting firmness, and by Figueroa et al. (2010) when com-
water) or water, yielding pectins freely soluble in the apo- paring this species with F. chiloensis. HCl extracted pectins,
plast and solubilized by in vivo processes; (2) chelating however, does not full correspond with sodium carbonate
agents, usually CDTA, solubilizing pectins ionically bound fraction (Prasanna et al. 2007). Contrary to the results of
to the cell wall, thought to derived mainly from the middle Koh and Melton (2002), Figueroa et al. (2010) did not ob-
lamella; (3) sodium carbonate, releasing pectins covalently serve significant changes in quelated polymers during
bound to the primary wall; (4) weak alkali, such as 1 M ripening. Interestingly, the largest changes in water-soluble
KOH, which solubilizes matrix glycans loosely bound in and covalently-linked polymers occurred in the transition
the wall; (5) strong alkali, 4 M KOH, releasing matrix gly- from green to turning stages, both in F. u ananassa (cv.
cans tightly bound in the wall, mainly xyloglucans. The ‘Chandler’) and F. chiloensis (Figueroa et al. 2010). Finally,
residue after this sequential extraction is mainly composed Redgwell et al. (1997a) also observed an increase in the
of cellulose. The solubilization of pectins into different frac- content of uronic acid in PAW fraction during the ripening
tions occurs during ripening, and for example, sodium car- of strawberry fruit, although this increment was moderate in
bonate-extractable pectins in an immature fruit may be ex- comparison with other fruit such as avocado or kiwifruit.
tracted from ripe fruit in the water or chelator-soluble frac- Therefore, it seems clear that pectin solubilization occurs at
tion (Rose et al. 2003). the expense of the pectin fraction covalently bound to the
cell wall.
Cell wall disassembly in strawberry ripening This consensus on the role of pectin solubilization
during strawberry ripening does not exist for pectin depoly-
A few numbers of studies have analyzed cell wall modifi- merization. For a long time since Huber report (1984), no
cations during development and ripening of strawberry fruit. role for enzymatic hydrolysis in pectin solubilization was
However, the different experimental procedures used for assumed. He did not found depolymerization of chelated
cell wall extraction and fractionation and the different geno- pectins, leading to the general view that depolymerization
types analyzed make difficult the achievement of a clear does not play a major role in strawberry fruit softening.
picture of this process. However, Redgwell et al. (1997a) showed a slight depoly-
Cell wall and cellulose contents slightly decreased merization of PAW pectins, and more recent papers confirm
during ripening in all cultivars studied, independently of its that depolymerization of covalently bound pectins occurs in
firmness (El-Zoghbi 1994; Redgwell et al. 1997a; Koh and the ripening of fruit from cv. ‘Toyonaka’ (Rosli et al. 2004)
Melton 2002; Rosli et al. 2004). The loss of cell wall mate- and ‘Chandler’ (Santiago-Doménech et al. 2008; Figueroa
rial is more pronounced in cortical than pith tissues (Koh et al. 2010). Finally, Figueroa et al. (2010) indicate that the
and Melton 2002), but this parameter does not seem to be higher softening of F. chiloensis is not related to pectin de-
related to fruit firmness (Figueroa et al. 2010). As is gene- polymerization but to some other process that solubilise
rally observed in most fruits, cellulose networks remain pectins at an earlier developmental stage than in F. u ana-
unaltered during ripening, although NMR studies indicate nassa.
that strawberry contains an exceptionally small amount of The content of neutral sugars does not change signifi-
crystalline celullose (Koh et al. 1997). cantly during strawberry ripening (Gross and Sam 1984;
The hemicellulose content also diminished during Redgwell et al. 1997b; Koh and Melton 2002; Figueroa et
strawberry ripening in cultivars with contrasting firmness al. 2010). Arabinose, xylose and galactose are the major
(Koh and Melton 2002; Rosli et al. 2004). Regarding the neutral sugars in unripe and ripe strawberry fruit. During
molecular weight of these polymers, controversial results ripening, a loss of arabinose and galactose occurs, while the
have been obtained. In an early work, Huber (1984) repor- amount of xylose increased, and rhamnose, fucose, manose
ted a significant depolymerization of hemicellulosic poly- and glucose remain unchanged (Redgwell et al. 1997b).
mers during ripening of fruits from cv. ‘Dover’. By contrast, Most galactose and arabinose were associated with pectin
Rosli et al. (2004) did not observe hemicellulose changes in polymers attached to the cell wall after 4 M KOH extraction
‘Pajaro’ fruits and only a very slight depolymerization in (Redgwell et al. 1997b), and this fraction and the 4 M
firm (cv. ‘Camarosa’) and soft fruits (cv. ‘Toyonaka’). KOH-residue supported the highest loss of both neutral
Nogata et al. (1996) also detected a reduction of the high sugars (Redgwell et al. 1997b; Koh and Melton 2002). Ac-
molecular weight polymers in hemicellulose fractions, cording to Redgwell et al. (1997b) the loss of neutral sugars
42
Table 1 Summary of experimental results derived from transgenic strawberry plants in which softening related genes have been suppressed.
Protein family Cell wall target Gene Effect of gene suppression References
Pectate lyase Demethylated HGA plC Increased fruit firmness and extended Jiménez-Bermúdez et al. 2002; Youssef et
shelf life al. 2009
Polygalacturonase Demethylated HGA FaPG1 Increased fruit firmness and extended Quesada et al. 2009a; García-Gago et al.
shelf life 2009a
Pectin methylesterase Methylated pectins FaPE1 Firmness not evaluated. Increased fungal Osorio et al. 2008
pathogen resistance
Endo--(1,4)-glucanase Xyloglucan FaEG1 No effect on firmness Wolley et al. 2001; Palomer et al. 2006
FaEG3 No effect on firmness Mercado et al. 2010
Expansin Xyloglucan-Cellulose FaExp2 No effect on firmness. Significant growth García-Gago et al. (personal
network alterations communication)
did not correlate with softening. measuring PL activity have been reported, but as far as we
In conclusion, despite the different works performed to know, the presence of PL activity in fruit has only been
correlate cell wall changes with fruit firmness, a straight- demonstrated in banana and mango (Marín-Rodríguez et al.
forward relation between wall metabolism and texture has 2003; Payasi and Sanwal 2003; Chourasia et al. 2006).
not been found, probably because of the limited number of Three ripening-related PL genes, plA to plC, have been
genotypes surveyed. Overall, the most characteristic cell identified in cultivated strawberry (Medina-Escobar et al.
wall modification during strawberry ripening is the solubi- 1997; Benítez-Burraco et al. 2003). The three genes show a
lization of pectins which supposedly occurs at the expense similar pattern of gene expression, being detected in fruit
of the polyuronides covalently linked to the cell wall. Seve- but not in vegetative tissue, and up regulating their expres-
ral hypotheses have been proposed to explain this solubili- sion during ripening. F. chiloensis fruit also express a PL
zation. Huber (1984) pointed out to the synthesis of a modi- gene during ripening (Figueroa et al. 2008).
fied more freely soluble form of pectins during ripening. Strong evidences for an important role of PL genes in
Koh and Melton (2002) postulated that solubilization could strawberry softening have been obtained by their manipula-
be associated with the disentanglement of pectins in the cell tion in transgenic plants. Jiménez-Bermúdez et al. (2002)
walls due to the degradation of arabinan side chains or to showed that the inhibition of pectate lyase gene in straw-
the cleavage of linkages between pectins and hemicel- berry by antisense transformation resulted in fruits firmer
luloses. Finally, Rosli et al. (2004) and Santiago-Doménech than control at the ripe stage, not affecting other fruit
et al. (2008) indicated that pectin solubilization could be characteristics such as color, soluble solids or anthocyanin
due to a slight depolymerization of covalently linked pec- content. Cell wall analysis of the PL silenced lines revealed
tins. that transgenic fruits showed a lower degree of in vitro cell
wall swelling and pectin solubilization, and a decreased
CELL WALL GENES AND STRAWBERRY depolymerization of more tightly bound polyuronides,
SOFTENING quelated and covalently bound pectins (Jiménez-Bermúdez
et al. 2002; Santiago-Doménech et al. 2008). The charac-
Cell wall disassembly during fruit ripening is mediated by teristic ripening-associated loss of cell-cell adhesion was
genes encoding enzymes and proteins able to modify the also substantially reduced in transgenic fruits (Santiago-
different polysaccharide moieties, especially matrix glycans Doménech et al. 2008). More recently, Youssef et al. (2009)
and pectins. These enzymes have been reviewed in different obtained transgenic strawberry lines with low levels of plC
papers (Fischer and Bennett 1991; Fry 2004; Goulão and expression through transformation with this gene in sense
Oliveira 2008; Wong 2008). Cell wall modifying enzymes orientation. The introduction of extra copies of plC resulted
are usually classified in pectolytic, able to cleave or modify in a co-suppression of the gene, and, as previously observed
the nature of pectin polysaccharides, and non-pectolytic, in antisense transgenic plants, transgenic fruits were signifi-
responsible for hemicellulose modifications. Several of cantly firmer than control. Interestingly, a correlation bet-
these genes have been cloned in strawberry, and, for a few ween gene expression and fruit firmness was deduced from
of them, their role on softening analyzed through genetic these results, since co-suppressed lines showed a lower plC
modification (Table 1). Most of these genes are fruit- down-regulation and were slightly softer than antisense
specific and its expression repressed by auxin, a common lines (Youssef et al. 2009).
feature of ripening-related genes in strawberry (Manning As should be expected, the reduction of softening in
1994). Main cell wall enzyme activities will be discussed in transgenic PL fruits improved the postharvest shelf life and
the next sections, focusing in those genes where functional the textural properties of processed fruits. After a 7 days
analyses are available. period of storage at 5°C, antisense PL fruits were firmer and
also showed a lower softening rate than controls (García-
Pectate lyase Gago et al. 2009a). Regarding fruit derived product, trans-
genic fruits were more resistant to the cooking process than
Pectate lyases (PLs) were firstly described as pathogen- control when processed into jam (Sesmero et al. 2007).
secreted extracellular enzymes that help pathogenesis by Therefore, transgenic jams were enriched in berry frag-
cleaving polygalacturonate blocks in the plant host cell-wall ments that were also firmer than berries in control jams. It
(Davis et al. 1984). In plant genomes, many genes that is noteworthy that berry content is one of the most impor-
show similarity with PL genes from pathogens have been tant quality attribute in jam. The physical characteristics of
isolated and characterized. The abundance of ESTs for these juices made from control and transgenic PL fruits have also
genes in tomato and the presence of PL-like transcripts in been analyzed (Sesmero et al. 2009). Transgenic juices were
several fruits would indicate that these enzymes may have a more viscous than control, supposedly due to the higher
more important role in ripening than previously suspected content of large particles in the solid fraction of juices (Ses-
(Marín-Rodríguez et al. 2002), specially in those fruits with mero et al. 2009).
low levels of polygalacturonase activity. This enzyme cata- In summary, these results indicate that pectate lyase
lyzes the cleavage of glycosidic bonds of unsaturated re- genes play an important role in the biochemical changes
gions of pectins by a -elimination reaction, at a pH opti- that occur in primary wall and middle lamella during straw-
mum of 8-11. PL requires the presence of calcium ions and berry fruit ripening, and should be included in synergistic
generates oligosaccharides with de-esterified galacturonosyl models of cell wall disassembly.
residues at their non-reducing ends. Different methods for
43
Polygalacturonase earlier stages of development than F. u ananassa, sug-

gesting that the faster softening of these fruits could be
Polygalacturonases (PGs) were first identified in the sixties related to the earlier expression of cell wall degrading genes
and have been suggested to be involved in the disassembly (Figueroa et al. 2008). However, these results are contradic-
of pectin that accompanies many stages of plant develop- tory, since F. chiloensis showed a clear reduction on total
ment, particularly those that require cell separation (Had- PG activity during ripening (Figueroa et al. 2010).
field and Bennett 1998). PGs catalyze the hydrolytic cleav- The role of FaPG1 on fruit softening has been assessed
age of galacturonic linkages, and can be exo- or endo-type. by genetic transformation (Quesada et al. 2009a; García-
The exo-PGs remove single galacturonic acid residues from Gago et al. 2009b). These authors obtained several trans-
the non-reducing end of de-esterified polygalacturonic acid, genic lines, cv. ‘Chandler’, expressing an antisense se-
while endo-type PGs, the most frequent in fruits, cleave quence of FaPG1 under the control of the constitutive pro-
these linkages at random. These enzymes have been exten- moter CaMV35S. Fruits from selected transgenic lines
sively studied in tomato where PG protein and mRNA showed a 90-95% decrease in the FaPG1 transcript level,
levels, as well as enzyme activity, correlate with fruit ripen- and were significantly firmer than control at ripening.
ing and softening (Brummell and Harpster 2001). Tomato Moreover, the postharvest behaviour of these transgenic
PG was the first cell wall hydrolase examined by trans- lines was improved, and a decrease on the rate of softening
genesis at the end of the 1980s (Sheehy et al. 1988; Smith was observed when transgenic fruits were stored for several
et al. 1988). Transgenic tomato fruits expressing an anti- days at low temperature (Quesada et al. 2009a; García-
sense PG sequence resulted in 99% suppression of PG Gago et al. 2009a). The expression of FaPG2 gene was not
mRNA. This silencing reduced pectin depolymerization but modified in transgenic fruits as could be expected because
not pectin solubilization during ripening (Smith et al. 1990). of the low homology between the two genes. Further ana-
Despite this change, fruit softening was not significantly lysis of ripe fruit showed that PG activity was only partially
altered, but an extended shelf life of overripe fruits and a reduced, suggesting that FaPG2 or other undiscovered PG
reduction on postharvest decay in transgenic fruits was ob- genes were responsible for this remaining PG activity in
served (Kramer et al. 1992). These results led to the hypo- strawberry. At the cell wall level, the firmer fruit phenotype
thesis that PG activity alone is not sufficient to affect tex- in silenced FaPG1 plants was associated with a reduction
ture, but it contributes significantly to tissue deterioration in on pectin solubilization and an increase on pectins cova-
the later stages of ripening (Hadfield and Bennet 1998; lently bound to the cell wall (Quesada et al. 2009a). Al-
Giovannoni 2001). though in general, changes in the cell wall induced by the
In strawberry fruit, PG activity is low when compared silencing of FaPG1 were similar to those above described
with other fruits such as tomato, peach or avocado, which in antisense PL plants, transgenic PG fruits at the ripe stage
showed a peak of PG activity during ripening (Hadfield and were slightly firmer than PL fruits (Quesada et al. 2009b;
Bennett 1998). Although early works were unable to detect García-Gago et al. 2009a).
PG activity in strawberry (Neal 1965; Barnes and Patchett
1976; Huber 1984; Abeles and Takeda 1990), many other Pectin methylesterase
researchers found a low level of PG activity in ripe fruit of
several strawberry cultivars (Nogata et al. 1993; Lefever et Pectins are secreted into the wall as highly methylesterified
al. 2004; Villarreal et al. 2008; Quesada et al. 2009a). In form, and later processed by pectinases such as pectin
‘Toyonaka’ fruits, Nogata et al. (1993) partially purified methylesterase (PME), which catalyze the demethylesterifi-
three different PG activities, two of them exo-PGs and one cation of homogalacturonans, releasing acidic pectins and
endo-acting. One of the exo-enzymes, decreased consis- methanol (Micheli 2001; Pelloux et al. 2007). This enzyme
tently from small green to overripe fruit stages (Nogata et al. plays a dual role in the cell wall. Its activity could give rise
1993). Contrary to these results, other authors have found to blocks of free carboxyl groups, allowing the cross-
an increase on total PG activity during strawberry ripening linking of pectins by calcium bridges that contribute to cell
(El-Zoghbi 1994; Villarreal et al. 2008). Furthermore, Lefe- wall stiffening. However, PME is also necessary for cell
ver et al. (2004) found a negative correlation between fruit wall loosening, since PG or PL only cleaves bonds between
firmness and PG activity in several strawberry varieties galacturonic acid residues within blocks of de-esterified
evaluated for their resistance to processing. More recently, polygalacturonic acid. The most accepted hypothesis con-
Figueroa et al. (2010) showed a contrasting behaviour in F. cerning the mode of action of PME is that this enzyme can
u ananassa and F. chiloensis fruits. While in the first case act either randomly, promoting the action of other pec-
PG activity increased during ripening, F. chiloensis fruits tinases, or linearly, favouring the formation of calcium-
displayed a significant reduction in PG activity, more pro- mediated pectin gels (Micheli 2001). In plants, this enzyme
nounced in the transition from the green to the turning stage. is encoded by large multigene families whose members
Three ripening-related polygalacturonase genes have have different pattern of expression. The role of PME on
been cloned in strawberry: FaPG1, also know as spG fruit softening has been assessed in tomato by antisense
(Redondo-Nevado et al. 2001), FaPG2 or B4 (Salentijn et suppression (Tieman et al. 1992; Gaffe et al. 1994). Despite
al. 2003), and T-PG (Villarreal et al. 2008). The three genes a 90% reduction on PME activity, no effect on tomato fruit
are upregulated during ripening and their expression is firmness was observed and, furthermore, fruit shelf life was
repressed by auxins (Villarreal et al. 2008; Quesada et al. reduced (Tieman et al. 1992). The alteration of the cation
2009a; Villarreal et al. 2009). Interestingly, T-PG is almost levels in the apoplast could be the responsible of the lower
identical to FaPG1 gene but it shows a deletion of 85 bp tissue integrity of these PME antisense fruits (Tieman and
that causes a frame shift and produces an inactive protein Handa 1994).
(Villarreal et al. 2008). According to these authors, firmer According to Barnes and Patchett (1976), PME activity
cultivars expressed preferentially T-PG during ripening, increased during strawberry fruit development from the
whereas softer cultivars showed higher expression of small green to the ripe stage, but then fell to its initial level
FaPG1and lower levels of T-PG. The differential expres- in overripe fruit. Figueroa et al. (2010) also observed a
sion of these two genes could be therefore related to fruit maximum on PME activity at the turning stage and later
softening. More recently, Villarreal et al. (2009) found that decreased in ripe fruit at levels similar to those obtained in
the expression of both FaPG1 and T-PG genes can also be green fruit. However, Draye and Van Cutsem (2008) repor-
regulated by ethylene, in spite of the non-climacteric nature ted that PME activity decreased continuously from the
of this fruit. Comparative studies of two different straw- green to the overripe stage. This result, however, is para-
berry species, F. chiloensis and F. u ananassa, have also doxical, since the same authors reported an increase on the
shown that the PG transcript level correlates with the prog- content of calcium-bound acidic pectin during ripening.
ress of softening in both species (Figueroa et al. 2008). F. Some discrepancies are also apparent in the results reported
chiloensis fruits displayed higher levels of PG transcripts at by Lefever et al. (2004). They found that firmer cultivars
44
contained lower PME activity than softer cultivars, with the racteristics were similar in control and transgenic plants, in
exception of ‘Camarosa’ fruits that showed an extremely spite of the strong silencing of FaEG1 achieved. As regard
high PME activity, being one of the firmer genotype. Even FaEG3, Mercado et al. (2010) down-regulated this gene by
more, a good negative correlation between PME activity antisense transformation in cv. ‘Chandler’. As previously
and resistance to fruit cooking was deduced in that paper. observed for FaEG1, no effect on fruit firmness or EGase
However, when compared the degree of methylated pectin activity was detected in transgenic plants showing a 95%
in a soft and a firm cultivar, water soluble pectin from the reduction in FaEG3 transcript level. However, cell walls of
firm cv. contained a lower content of methylated pectins transgenic fruit were enriched in hemicellulosic polymers
than the soft genotype, despite its low PME activity (Lefe- and the molecular size of these polysaccharides was also
ver et al. 2004). To entangle the role of PME on softening, slightly larger than in wild type. Overall, these results sug-
vacuum infiltration of solutions containing PME and Ca2+ gest that EGases do not play a significant role in fruit sof-
increases strawberry fruit firmness (Suutarinen et al. 2000; tening, although they can modify the extractability and/or
Duvetter et al. 2005), supposedly due to the formation of molecular size of hemicelluloses.
pectin gels that adds rigidity to the wall.
In strawberry, four different PME genes, FaPE1 to Expansin
FaPE4, have been identified. One of them, FaPE1, is spe-
cifically expressed in fruit, showing an increasing expres- Expansins are proteins of unknown enzymatic activity that
sion during the ripening process up to a maximum in the promote cell wall loosening and extension. Their mecha-
turning stage (Castillejo et al. 2004). It was shown that the nism of action or cell wall substrates has not been eluci-
expression of FaPE1 was induced by auxin at the onset of dated yet. It has been hypothesised that expansins disrupt
fruit ripening and down-regulated by ethylene during fruit noncovalent interactions between hemicellulose and cel-
senescence (Castillejo et al. 2004). This gene was expressed lulose microfibrils. This could have the effect of exposing
in the wild strawberry F. vesca under the control of the previously inaccessible structurally important polymers to
CaMV35S promoter (Osorio et al. 2008). Two transgenic the action of ripening-associated cell wall hydrolases. This
lines with higher PME activity in fruit were selected. Cell suggestion is consistent with the cellulose binding domain-
wall analysis of these fruit showed a 20% reduction in the like motif that is conserved among expansins (McQueen-
methyl esterification of soluble and quelated pectin. Interes- Mason and Cosgrove 1994). These proteins were originally
tingly, the mean molecular mass of the Na2CO3 soluble detected in growing tissues, where they play a role on cell
pectin fraction was significantly higher in the FaPE1 over- elongation (Cosgrove 2000). However, expansin genes have
expressing lines, when the contrary effect would be expec- also been detected in many other tissues, including those of
ted because of the higher susceptibility of de-methylated ripe fruits. In tomato, fruit specific expansin genes seem to
pectins to pectinase degradation. The effect of FaPE1 ex- play a critical role on fruit softening. The down-regulation
pression on fruit firmness and postharvest shelf life was not of LeExp1 reduces fruit softening while the overexpression
reported by Osorio et al. (2008), but these fruits showed an of this gene increases softening (Brummell et al. 1999b).
enhanced resistance to Botrytis cinerea due to the consti- In the case of strawberry, seven expansin genes (FaExp1
tutive expression of a pathogenesis-related gene, involved to FaExp7) have been isolated (Civello et al. 1999;
in the salicylic acid pathway. The activation of this patho- Harrison et al. 2001; Dotto et al. 2006). Some of them are
gen defence response could be related to the lower degree expressed in fruit, and the expression of FaExp1, FaExp2
of methyl esterification of oligogalacturonides (Osorio et al. and FaExp5 correlated with the ripening process (Harrison
2008), small pectins that elicit different cellular responses, et al. 2001; Dotto et al. 2006). Furthermore, several studies
including fruit ripening (Dumville and Fry 2000). using cultivars with different rates of softening showed
higher transcript levels of these three expansin genes on the
Endo--1,4-glucanase softer cultivars during ripening (Salentijn et al. 2003; Dotto
et al. 2006). Most of the seven expansin genes are also ex-
Plant endo--1,4-glucanases or EGases have been involved pressed in F. chiloensis, although the expression pattern of
in processes in which cell wall weakening and cell separa- some of them is slightly different to the one observed in
tion take place, such as organ abscission and fruit softening. cultivated strawberry (Figueroa et al. 2009).
Their natural substrate within the cell wall is largely un- Transgenic strawberry plants expressing low transcript
known, but it has been proposed that xyloglucans, integral levels of FaExp2 by RNAi silencing have been generated
and peripheral regions of non-crystalline cellulose and (García-Gago et al. unpublished data). Firmness of ripe
glucomannans are target of these enzymes (Brummell and fruit was not modified in any transgenic line, and further-
Harpster 2001). In general, all fruits show EGase activity more, most of the lines showed altered phenotypes, being
that increase during ripening (Brummell and Harpster 2001). the most common a reduced plant vigour and dwarf growth.
However, the transgenic modification of several EGase These results suggest that FaExp2 could be involved in cell
genes in different fruits neither affected fruit softening nor growth rather than fruit softening. As far as we know, no
modified hemicellulose metabolism (Brummell et al. other strawberry expansin gene has been assessed by trans-
1999a; Harpster et al. 2002a, 2002b). genic technology.
EGase activity increases significantly during strawberry
fruit development, reaching a maximum level in overripe Other cell wall genes
fruit (Abeles and Takeda 1990; El-Zoghbi 1994; Figueroa et
al. 2010). Two EGase isoforms, encoded by two divergent Other cell wall related genes which could be involved in
genes, FaEG1 and FaEG3, are responsible for this EGase fruit softening have been identified and their expression
activity (Harpster et al. 1998; Llop-Tous et al. 1999; Trai- analyzed in several strawberry cultivars. Martínez et al.
notti et al. 1999a, 1999b). The temporal expression pattern (2004) cloned a cDNA encoding a putative E-xylosidase
of both genes overlaps only partially. FaEG1 is fruit speci- gene (FaXyl) from ripe fruit. The full-length FaXyl gene
fic and its expression starts at the white stage. By contrast, and its promoter region have been isolated more recently
FaEG3 is detected at earlier stages of fruit development, (Bustamante et al. 2006, 2009). E-xylosidase enzymes rel-
and also in growing vegetative tissues (Trainotti et al. ease single xylosyl residues from xylose containing oligo-
1999a). Additionally, FaEG3 contains a putative cellulose- saccharides. Xylose is present in hemicelluloses (xyloglu-
binding domain which apparently would make FaEG3 pro- can and mainly xylans) and pectins (xylogalacturonan). As
tein especially active against xyloglucans coating cellulose most xylose in strawberry fruit appears in the hemicel-
microfibrils (Trainotti et al. 1999b). Woolley et al. (2001) lulosic fraction (Koh and Melton 2002), it is most likely
and Palomer et al. (2006) obtained transgenic strawberry that FaXyl gene product acts on these cell wall polymers
plants containing antisense sequences of FaEG1 gene. In rather than pectins. Higher levels of FaXyl expression and
both cases, fruit firmness, EGase activity and cell wall cha- E-xylosidase activity have been reported in ‘Camarosa’, a
45
firm cultivar, than in ‘Toyonaka’, a soft cultivar (Busta- New genes acting on different cell wall components should
mante et al. 2006). Similarly, higher -xylosidase activity be tested to shed light on the softening process in straw-
was found in F. chiloensis than in F. × ananassa, cv. berry fruit. XTH, E-xylosidase, E-galactosidase, -arabino-
‘Chandler’, also suggesting a correlation between this furanosidase or enzymes degrading rhamnogalactunorane I
activity and fruit firmness (Figueroa et al. 2010). However, are candidates to these future studies. Furthermore, con-
the pattern of FaXyl gene expression during fruit develop- sidering the complexity of the cell wall and the coordinate
ment and ripening differs among the different cultivars action of the different genes involved in its processing, the
tested, making difficult the understanding of the role of this simultaneous silencing of genes from different cell wall
gene on softening. families appears as an essential tool to gain an insight into
As previously discussed, galactose and arabinose are this process.
the neutral sugars that most decreased during strawberry The transgenic manipulation of pectinase genes has pro-
ripening. Both, E-galactosidase and -arabinofuranosidase ven to be successful to improve strawberry softening and to
genes have been isolated in strawberry. -Arabinofurano- extend the shelf life of this extremely delicate fruit. From a
sidase activity was detected at all fruit developmental stages commercial point of view, the main concern to this ap-
except in small green fruit (Rosli et al. 2009). This activity proach is the poor public acceptance of transgenic crops,
increased with fruit ripening, being the levels higher in a particularly important in the case of fruits. To overcome this
soft than in a firm cultivar. -Arabinofuranosidase activity problem, some authors have proposed the use of native
was also detected in F. chiloensis fruits, although in this genes from the crop plant itself or from crossable species
case, the highest activity was observed in large green fruit for genetic modification. The so called intragenic (Rom-
(Figueroa et al. 2010). Three -arabinofuranosidase genes mens 2004) or cisgenic (Schouten et al. 2006) approaches
(FaAra1 to FaAra3) are responsible for this activity. The would be therefore comparable to classical breeding and
expression analysis of the three genes showed a complex should be exempted from the GMO regulation. The recent
pattern, being all them expressed during the whole fruit finding of a significant fruit firmness increase in strawberry
development, including the ripening stage. Apparently, none plants transformed with a sense sequence of the plC gene
of them clearly correlated with softening, although con- (Yousseff et al. 2009) indicates that intragenic strawberry
sidering the global expression of the three FaAra genes, the plants with improved fruit texture can be obtained, provi-
soft cultivar showed a higher expression than the firm cul- ding that the cell wall gene were conducted by a strong
tivar (Rosli et al. 2009). promoter to induce co-suppression. To fully accomplish this
-galactosidase activity increases during fruit develop- biotechnological approach, the search for ripening-specific
ment and remains high in ripe fruit, which is in accordance promoters and the application of protocols for the elimina-
with the loss of galactose from cell wall (Trainotti et al. tion of marker genes are research areas that should be stren-
2001; Figueroa et al. 2010). Three full length cDNAs en- gthened.
coding -galactosidases (Fagal1 to Fagal3) were isolated
by Trainotti et al. (2001) from a library constructed in ripe ACKNOWLEDGEMENTS
fruit. The expression pattern of the three genes was complex,
and only Fagal1 showed an increasingly high expression This work was funded by Ministerio de Ciencia e Innovación of
along the ripening process. Furthermore, Fagal1 and Spain and FEDER EU Funds (Grant nº AGL2008-02356).
Fagal2 contain a lectin-like domain in its C-terminus to
anchor itself to specific sugars. This domain could increase REFERENCES
its efficiency in releasing galactose residues from cell wall
polymers. Abeles FB, Takeda F (1990) Cellulase activity and ethylene in ripening straw-
berry and apple fruits. Scientia Horticulturae 42, 269-275
Barnes MF, Patchett BJ (1976) Cell wall degrading enzymes and the softening
CONCLUDING REMARKS of senescent strawberry fruit. Journal of Food Science 41, 1392-1395
Benítez-Burraco A, Blanco-Portales R, Redondo-Nevado J, Luz Bellido M,
Several authors have proposed strawberry as a model for Moyano E, Caballero JL (2003) Cloning and characterization of two ripen-
the study of the ripening process in non-climacteric fruit. ing-related strawberry (Fragaria x ananassa cv. Chandler) pectate lyase
The significant advances achieved in our knowledge of genes. Journal of Experimental Botany 54, 633-645
genetic factors involved in strawberry fruit softening and Bourne M (2002) Food Texture and Viscosity, Academic Press, London, 427 pp
other ripening components, such as aroma development, Brummell DA (2006) Cell wall disassembly in ripening fruit. Functional Plant
support this proposal. Nowadays, strawberry is probably the Biology 33, 103-119
second fruit in importance, behind tomato, where more Brummell DA, Harpster MH (2001) Cell wall metabolism in fruit softening
and quality and its manipulation in transgenic plants. Plant Molecular Biol-
ripening-related genes have been assessed by transgenesis. ogy 47, 311-340
Concerning softening, cell wall disassembly seems to be the Brummell DA, Hall BD, Bennett AB (1999a) Antisense suppression of tomato
most determinant factor in the loss of firm texture during endo-1,4-E-glucanase Cel2 mRNA accumulation increases the force required
ripening. This process involves the coordinate action of to break fruit abscission zones but does not affect fruit softening. Plant
numerous enzymes, acting on different wall polysaccharides. Molecular Biology 40, 615-622
Previous studies in tomato led to the view that the modi- Brummell DA, Harpster MH, Civello PM, Palys JM, Bennett AB, Duns-
fication of a complex trait as fruit texture would be rather muir P (1999b) Modification of expansin protein abundance in tomato fruit
difficult through the manipulation of a single gene. How- alters softening and cell wall polymer metabolism during ripening. Plant Cell
ever, strawberry fruit firmness was significantly improved 11, 2203-2216
Bustamante CA, Rosli HG, Anon MC, Civello PM, Martínez GA (2006) -
by the silencing of pectinase genes (Jiménez-Bermúdez et xylosidase in strawberry fruit: Isolation of a full-length gene and analysis of
al. 2002; Quesada et al. 2009a). Moreover, transcriptomic its expression and enzymatic activity in cultivars with contrasting firmness.
analysis of FaPG1 down-regulated fruits showed minor Plant Science 171, 497-504
changes in the expression of many other ripening genes, al- Bustamante CA, Civello PM, Martínez GA (2009) Cloning of the promoter
though a consistent increase in fruit firmness was obtained region of -xylosidase (FaXyl1) gene and effect of plant growth regulators on
in these transgenic fruit (Quesada et al. 2009a). These the expression of FaXyl1 in strawberry fruit. Plant Science 177, 49-56
results indicate that the transgenic manipulation of key cell Carpita NC, Gibeaut DM (1993) Structural models of primary cell walls in
wall genes has a potential interest to improve fruit texture. flowering plants: consistency of molecular structure with the physical
At present, transgenic studies of fruit softening in properties of the walls during growth. Plant Journal 3, 1-30
Castillejo C, de la Fuente JI, Iannetta P, Botella MA, Valpuesta V (2004)
strawberry have been restricted to few members of the main Pectin esterase gene family in strawberry fruit: study of FaPE1, a ripening-
cell wall gene families, i.e. endo-E-glucanase, polygalactu- specific isoform. Journal of Experimental Botany 398, 909-918
ronase, pectin methyl esterase, expansin. Interestingly, xylo- Chourasia A, Sane VA, Nath P (2006) Differential expression of pectate lyase
glucan-endotransglycosilase/hydrolase (XTH) genes, which during ethylene-induced postharvest softening of mango (Mangifera indica
have an important role in xyloglucan metabolism (Goulão var. Dashehari). Physiologia Plantarum 128, 546-555
and Oliveira 2008), have not been reported yet in strawberry. Civello PM, Powell ALT, Sabehat A, Bennett AB (1999) An expansin gene
46
expressed in ripening strawberry fruit. Plant Physiology 121, 1273-1279 1310-1315

Cosgrove DJ (2000) Expansive growth of plant cell walls. Plant Physiology Jiménez-Bermúdez S, Redondo-Nevado J, Muñoz-Blanco J, Caballero JL,
and Biochemistry 38, 109-124 López-Aranda JM, Valpuesta V, Pliego-Alfaro F, Quesada MA, Mercado
Davis KR, Lyon GD, Darvill AG, Albersheim P (1984) Host-pathogen inter- JA (2002) Manipulation of strawberry fruit softening by antisense expression
actions. XXV Endopolygalacturonic acid lyase from Erwinia carotovora of a pectate lyase gene. Plant Physiology 128, 751-759
elicits phytoalexin accumulation by releasing plant cell wall fragments. Plant Knee M, Sargent JA, Osborne DJ (1977) Cell wall metabolism in developing
Physiology 74, 52-60 strawberry fruits. Journal of Experimental Botany 28, 377-396
Dotto MC, Martínez GA, Civello PM (2006) Expression of expansin genes in Koh TH, Melton LD (2002) Ripening-related changes in cell wall polysac-
strawberry varieties with contrasting fruit firmness. Plant Physiology and charides of strawberry cortical and pith tissues. Postharvest Biology and
Biochemistry 44, 301-307 Technology 26, 23-33
Draye M, Van Cutsem P (2008) Pectin methylesterases induce an abrupt in- Koh TH, Melton LD, Newman RH (1997) Solid-state 13C NMR characteriza-
crease of acidic pectin during strawberry fruit ripening. Journal of Plant Phy- tion of cell walls of ripening strawberries. Canadian Journal of Botany –
siology 165, 1152-1160 Revue Canadienne de Botanique 75, 1957-1964
Dumville JC, Fry SC (2000) Uronic acid-containing oligosaccharins: their bio- Kramer M, Sanders R, Bolkan H, Waters C, Sheehy RE, Hiatt WR (1992)
synthesis, degradation and signalling roles in non-diseased plant tissues. Postharvest evaluation of transgenic tomatoes with reduced levels of poly-
Plant Physiology and Biochemistry 38, 125-140 galacturonase: Processing, firmness and disease resistance. Postharvest Biol-
Duvetter T, Fraeye I, Van Hoang T, Van Buggenhout S, Verlent I, Smout C, ogy and Technology 1, 241-255
Van Loey A, Hendrickx M (2005) Effect of pectinmethylesterase infusion Lefever G, Vieuille M, Delage N, D´Harlingue A, de Monteclerc J, Bompeix
methods and processing techniques on strawberry firmness. Journal of Food G (2004) Characterization of cell wall enzyme activities, pectin composition,
Science 70, 383-388 and technological criteria of strawberry cultivars (Fragaria x ananassa
El-Zoghbi M (1994) Biochemical changes in some tropical fruits during ripen- Duch). Journal of Food Science 69, 221-226
ing. Food Chemistry 49, 33-37 Llop-Tous I, Domínguez-Puigjaner E, Palomer X, Vendrell M (1999) Cha-
Faedi W, Mourgues F, Rosati C (2002) Strawberry breeding and varieties: racterization of two divergent endo--1,4-glucanase cDNA clones highly ex-
situation and perspectives. Acta Horticulturae 567, 51-59 pressed in the nonclimateric strawberry fruit. Plant Physiology 119, 1415-
FAOSTAT (2009) Available online: http://faostat.fao.org 1421
Figueroa CR, Pimentel P, Gaete-Eastman C, Moya M, Herrera R, Caligari Manning K (1994) Changes in gene expression during strawberry fruit ripening
PDS, Moya-León MA (2008) Softening rate of the Chilean strawberry (Fra- and their regulation by auxin. Planta 194, 62-68
garia chiloensis) fruit reflects the expression of polygalacturonase and pec- Manning K, Tor M, Poole M, Hong Y, Thompson AJ, King GJ, Giovannoni
tate lyase genes. Postharvest Biology and Technology 49, 210-220 JJ, Seymour GB (2006) A naturally occurring epigenetic mutation in a gene
Figueroa CR, Pimentel P, Dotto MC, Civello PM, Martínez GA, Herrera R, encoding an SBP-box transcription factor inhibits tomato fruit ripening.
Moya-León MA (2009) Expression of five expansin genes during softening Nature Genetics 38, 948-952
of Fragaria chiloensis fruit: Effect of auxin treatment. Postharvest Biology Marín-Rodríguez MC, Orchard J, Seymour GB (2002) Pectate lyases, cell
and Technology 53, 51-57 wall degradation and fruit softening. Journal of Experimental Botany 53,
Figueroa CR, Rosli HG, Civello PM, Martínez GA, Herrera R, Moya-León 2115-2119
MA (2010) Changes in cell wall polysaccharides and cell wall degrading en- Marín-Rodríguez MC, Smith DL, Manning K, Orchard J, Seymour GB
zymes during ripening of Fragaria chiloensis and Fragaria × ananassa fruits. (2003) Pectate lyase gene expression and enzyme activity in ripening banana
Scientia Horticulturae 124, 454-462 fruit. Plant Molecular Biology 51, 851-857
Fischer RL, Bennet AB (1991) Role of cell wall hydrolases in fruit ripening. Martínez GA, Chaves AR, Civello PM (2004) -xylosidase activity and ex-
Annual Review of Plant Physiology 42, 675-703 pression of a -xylosidase gene during strawberry fruit ripening. Plant Physi-
Fry SC (2004) Primary cell wall metabolism: Tracking the careers of wall poly- ology and Biochemistry 42, 89-96
mers in living plant cells. New Phytologist 161, 641-675 Matas AJ, Gapper NE, Chung MY, Giovannoni JJ, Rose JKC (2009) Biol-
Gaffe J, Tieman DM, Handa AK (1994) Pectin methylesterase isoforms in ogy and genetic engineering of fruit maturation for enhanced quality and
tomato (Lycopersicon esculentum) tissues: Effects of expression of a pectin shelf-life. Current Opinion in Biotechnology 20, 197-203
methylesterase antisense gene. Plant Physiology 105, 199-203 McQueen-Mason SJ, Cosgrove DJ (1994) Disruption of hydrogen bonding
García-Gago JA, López-Aranda JM, Muñoz-Blanco J, Toro FJ, Quesada between plant cell wall polymers by proteins that induce wall extension. Pro-
MA, Pliego-Alfaro F, Mercado JA (2009a) Postharvest behaviour of trans- ceedings of the National Academy of Sciences USA 91, 6574-6578
genic strawberry with polygalacturonase or pectate lyase genes silenced. Acta Medina-Escobar N, Cárdenas J, Moyano E, Caballero JL, Muñoz-Blanco J
Horticulturae 842, 573-576 (1997) Cloning, molecular characterization and expression pattern of a straw-
García-Gago JA, Posé S, Muñoz-Blanco J, Quesada MA, Mercado JA berry ripening-specific cDNA with sequence homology to pectate lyase from
(2009b) The polygalacturonase FaPG1 gene plays a key role in strawberry higher plants. Plant Molecular Biology 34, 867-877
fruit softening. Plant Signaling and Behavior 4, 1-3 Meli VS, Ghosh S, Prabha TN, Chakraborty N, Chakraborty S, Datta A
Giovannoni J (2001) Molecular biology of fruit maturation and ripening. An- (2010) Enhancement of fruit shelf life by suppresing N-glycan processing
nual Review of Plant Physiology and Plant Molecular Biology 52, 725-749 enzymes. Proceedings of the National Academy of Sciences USA 107, 2413-
Graham J (2005) Fragaria strawberry. In: Litz RE (Ed) Biotechnology of Fruit 2418
and Nut Crops, CABI Publishing, Wallingford, Oxfordshire, pp 456-474 Mercado JA, Pliego-Alfaro F, Quesada MA (2007) Strawberry. In: Pua EC,
Goulão LF, Oliveira CM (2008) Cell wall modification during fruit ripening: Davey MR (Eds) Biotechnology in Agriculture and Forestry (Vol 60) Trans-
when a fruit is not the fruit. Trends in Food Science and Technology 19, 4-25 genic Crops V, Springer-Verlag, Berlin, pp 309-328
Gross KC, Sams CE (1984) Changes in cell wall neutral sugar composition Mercado JA, Trainotti L, Jiménez-Bermúdez L, Santiago-Doménech N,
during fruit ripening: a species survey. Phytochemistry 23, 2457-2461 Posé S, Donolli R, Barceló M, Casadoro G, Pliego-Alfaro F, Quesada MA
Hadfield KA, Bennett AB (1998) Polygalacturonase: many genes in search of (2010) Evaluation of the role of the endo-E-(1,4)-glucanase gene FaEG3 in
a function. Plant Physiology 117, 337-343 strawberry fruit softening. Postharvest Biology and Technology 55, 8-14
Hamilton AJ, Lycett GW, Grierson D (1990) Antisense gene that inhibits syn- Micheli F (2001) Pectin methylesterases: cell wall enzymes with important
thesis of the hormone ethylene in transgenic plants. Nature 346, 284-287 roles in plant physiology. Trends in Plant Science 6, 414-429
Hannum SM (2004) Potential impact of strawberries on human health: A re- Neal GE (1965) Changes occurring in the cell walls of strawberries during
view of the science. Critical Reviews in Food Science and Nutrition 44, 1-17 ripening. Journal of Science Food and Agriculture 16, 604-611
Harker FR, Redgwell RJ, Hallett IC, Murray SH, Carter G (1997) Texture Nogata Y, Ohta H, Voragen AGJ (1993) Polygalacturonase in strawberry fruit.
of fresh fruit. Horticultural Review 20, 121-224 Phytochemistry 34, 617-620
Harpster MH, Brummell DA, Dunsmuir P (1998) Expression analysis of a Nogata Y, Yoza K, Kusumoto K, Ohta H (1996) Changes in molecular weight
ripening-specific, auxin-repressed endo-1,4--glucanase gene in strawberry. and carbohydrate composition of cell wall polyuronide and hemicellulose
Plant Physiology 118, 1307-1316 during ripening in strawberry fruit. In: Visser J, Voragen AGJ (Eds) Pectins
Harpster MH, Brummell DA, Dunsmuir P (2002a) Suppression of a ripen- and Pectinases, Elsevier Science, Amsterdam, pp 591-596
ing-related endo-1,4-E-glucanase in transgenic pepper fruit does not prevent Oeller PW, Wong LM, Taylor LP, Pike DA, Theologis A (1991) Reversible
depolymerization of cell wall polysaccharides during ripening. Plant Molecu- inhibition of tomato fruit senescence by antisense RNA. Science 254, 437-
lar Biology 50, 345-355 439
Harpster MH, Dawson DM, Nevins DJ, Dunsmuir P, Brummell DA (2002b) O’Neill MA, Ishii T, Albersheim P, Darvill AG (2004) Rhamnogalacturonan
Constitutive overexpression of a ripening related pepper endo-1,4-E-gluca- II: Structure and function of a borate cross-linked cell wall pectic polysac-
nase in transgenic tomato fruit does not increase xyloglucan depolymeriza- charide. Annual Review of Plant Biology 55, 109-139
tion or fruit softening. Plant Molecular Biology 50, 357-369 Osorio S, Castillejo C, Quesada MA, Medina-Escobar N, Brownsey GJ,
Harrison EP, McQueen Mason SJ, Manning K (2001) Expression of six ex- Suau R, Heredia A, Botella MA, Valpuesta V (2008) Partial demethylation
pansin genes in relation to extension activity in developing strawberry fruit. of oligogalacturonides by pectin methyl esterase 1 is required for eliciting
Journal of Experimental Botany 52, 1437-1446 defence responses in wild strawberry (Fragaria vesca). Plant Journal 54, 43-
Huber DJ (1984) Strawberry (Fragaria x ananassa) fruit softening, the poten- 55
tial roles of polyuronides and hemicelluloses. Journal of Food Science 49, Palomer X, Llop-Tous I, Vendrell M, Krens FA, Schaart JG, Boone MJ, van
47
der Valk E, Salentijn EMJ (2006) Antisense down-regulation of strawberry Sheehy RE, Kramer MK, Hiatt WR (1988) Reduction of polygalacturonase
endo--(1,4)-glucanase genes does not prevent fruit softening during ripening. activity in tomato fruit by antisense RNA. Proceedings of the National Aca-
Plant Science 171, 640-646 demy of Sciences USA 85, 8805-8809
Pauly M, Albersheim P, Darvill A, York WS (1999) Molecular domains of the Smith CJS, Watson CF, Ray J, Bird CR, Morris PC, Schuch W, Grierson D
cellulose/xyloglucan network in the cell walls of higher plants. The Plant (1988) Antisense RNA inhibition of polygalacturonase gene expression in
Journal 20, 629-639 transgenic tomatoes. Nature 334, 724-726
Payasi A, Sanwal GG (2003) Pectate lyase activity during ripening of banana Smith CJS, Watson CF, Morris PC, Bird CR, Seymour GB, Gray JE,
fruit. Phytochemistry 63, 243-248 Arnold C, Tucker GA, Schuch W, Harding S, Grierson D (1990) Inheri-
Pelloux J, Rustérucci C, Mellerowicz EJ (2007) New insights into pectin tance and effect on ripening of antisense polygalacturonase genes in trans-
methylesterase structure and function. Trends in Plant Science 12, 267-277 genic tomatoes. Plant Molecular Biology 14, 369-379
Perkins-Veazie P (1995) Growth and ripening of strawberry fruit. Horticultural Suutarinen J, Heiska K, Moss P, Autio K (2000) The effects of calcium chlo-
Reviews 17, 267-297 ride and sucrose prefreezing treatments on the structure of strawberry tissues.
Prasanna V, Prabha TN, Tharanathan RN (2007) Fruit ripening phenomena- Lebensmittel Wissenschaft und Technologie 33, 89-102
An overview. Critical Reviews in Food Science and Nutrition 47, 1-19 Taylor NG (2008) Cellulose biosynthesis and deposition in higher plants. New
Quesada MA, Blanco-Portales R, Posé S, García-Gago JA, Jiménez-Ber- Phytologist 178, 239-252
múdez S, Muñoz-Serrano A, Caballero JL, Pliego-Alfaro F, Mercado JA, Tieman DM, Handa AK (1994) Reduction in pectin methylesterase activity
Muñoz-Blanco J (2009a) Antisense down-regulation of the FaPG1 gene modifies tissue integrity and cation levels in ripening tomato (Lycopersicon
reveals an unexpected central role for polygalacturonase in strawberry fruit esculentum Mill.) fruits. Plant Physiology 106, 429-436
softening. Plant Physiology 150, 1022-1032 Tieman DM, Harriman RW, Ramamohan G, Handa AK (1992). An anti-
Quesada MA, Posé S, Santiago-Doménech N, Sesmero R, Molina MC, sense pectin methylesterase gene alters pectin chemistry and soluble solids in
Mousa S, Pliego-Alfaro F, Mercado JA, Caballero JL, Muñoz-Blanco J, tomato fruit. Plant Cell 4, 667-679
Trainotti L, Casadoro G, García-Gago JA, López-Aranda JM (2009b) Trainotti L, Ferrarese L, la Vecchia F, Rascio N, Casadoro G (1999a) Two
Effect of silencing of cell wall degrading enzymes on strawberry fruit sof- different endo-E-1,4-glucanases contribute to the softening of the strawberry
tening. Acta Horticulturae 842, 931-934 fruits. Journal of Plant Physiology 154, 355-362
Redgwell RJ, MacRae EA, Hallett I, Fischer M, Perry J, Harker R (1997a) Trainotti L, Spolaore S, Pavanello A, Baldan B, Casadoro G (1999b) A
In vivo and in vitro swelling of cell walls during fruit ripening. Planta 203, novel E-type endo-E-1,4-glucanase with a putative cellulose-binding domain
162-173 is highly expressed in ripening strawberry fruits. Plant Molecular Biology 40,
Redgwell RJ, Fischer M, Kendall E, MacRae EA Perry J, Harker R (1997b) 323-332
Galactose loss and fruit ripening: High-molecular-weight arabinogalactans in Trainotti L, Spinello R, Piovan A, Spolaore S, Casadoro G (2001) E-galacto-
the pectic polysaccharides of fruit cell walls. Planta 203, 174-181 sidases with a lectin-like domain are expressed in strawberry. Journal of
Redondo-Nevado J, Moyano E, Medina-Escobar N, Caballero JL, Muñoz- Experimental Botany 52, 1635-1645
Blanco J (2001) A fruit-specific and developmentally regulated endopoly- Van Buren JP (1991) Function of pectin in plant tissue structure and firmness.
galacturonase gene from strawberry (Fragaria × ananassa cv. Chandler). In: Walter R (Ed) The Chemistry and Technology of Pectin, Academic Press,
Journal of Experimental Botany 52, 1941-1945 New York, pp 1-22
Rommens CM (2004) All-native DNA transformation: a new approach to plant Villarreal NM, Rosli HG, Martínez GA, Civello PM (2008) Polygalactu-
genetic engineering. Trends in Plant Science 9, 457-464 ronase activity and expression of related genes during ripening of strawberry
Rose JKC, Catalá C, Gonzalez-Carranza ZH, Roberts JA (2003) Cell wall cultivars with contrasting fruit firmness. Postharvest Biology and Technology
disassembly. In: Rose JKC (Ed) The Plant Cell Wall, Blackwell publishing, 47, 141-150
Oxford pp 264-324 Villarreal NM, Martínez GA, Civello PM (2009) Influence of plant growth
Rosli HG, Civello PM, Martínez GA (2004) Changes in cell wall composition regulators on polygalacturonase expression in strawberry fruit. Plant Science
of three Fragaria x ananassa cultivars with different softening rate during 176, 749-757
ripening. Plant Physiology and Biochemistry 42, 823-831 Vincken JP, Schols HA, Oomen RJFJ, McCann MC, Ulvskov P, Voragen
Rosli HG, Civello PM, Martínez GA (2009) -L-Arabinofuranosidase from AGJ, Visser RGF (2003) If homogalacturonan were a side chain of rhamno-
strawberry fruit: Cloning of three cDNAs, characterization of their expres- galacturonan I. Implications for cell wall architecture. Plant Physiology 132,
sion and analysis of enzymatic activity in cultivars with contrasting firmness. 1781-1789
Plant Physiology and Biochemistry 47, 272-281 Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R,
Salentijn EMJ, Aharoni A, Schaart JG, Boone MJ, Krens FA (2003) Dif- Schuch W, Giovannoni J (2002) A MADS-box gene necessary for fruit
ferential gene expression analysis of strawberry cultivars that differ in fruit- ripening at the tomato Ripening-inhibitor (Rin) locus. Science 296, 343-346
firmness. Physiologia Plantarum 118, 571-578 Willats WGT, McCartney L, Mackie W, Knox P (2001) Pectin: Cell biology
Santiago-Doménech N, Jiménez-Bermúdez S, Matas AJ, Rose JKC, and prospects for functional analysis. Plant Molecular Biology 47, 9-27
Muñoz-Blanco J, Mercado JA, Quesada MA (2008) Antisense inhibition Wong D (2008) Enzymatic deconstruction of backbone structures of the rami-
of a pectate lyase gene supports a role for pectin depolymerization in straw- fied regions in pectins. Protein Journal 27, 30-42
berry fruit softening. Journal of Experimental Botany 59, 2769-2779 Woolley LC, James DJ, Manning K (2001) Purification and properties of an
Schouten HJ, Krens FA, Jacobsen E (2006) Cisgenic plants are similar to endo--1,4-glucanase from strawberry and down-regulation of the correspon-
traditionally bred plants. EMBO Reports 7, 750-753 ding gene, cel1. Planta 214, 11-21
Sesmero R, Quesada MA, Mercado JA (2007) Antisense inhibition of pectate Youssef SM, Jiménez-Bermúdez S, Bellido ML, Martín-Pizarro C, Barceló
lyase gene expression in strawberry fruit: Characteristics of fruits processed M, Abdal-Aziz SA, Caballero JL, López-Aranda JM, Pliego-Alfaro F,
into jam. Journal of Food Engineering 79, 194-199 Muñoz J, Quesada MA, Mercado JA (2009) Fruit yield and quality of
Sesmero R, Mitchell JR, Mercado JA, Quesada MA (2009) Rheological cha- strawberry plants transformed with a fruit specific strawberry pectate lyase
racterisation of juices obtained from transgenic pectate lyase-silenced straw- gene. Scientia Horticulturae 119, 120-125
berry fruits. Food Chemistry 116, 426-432
48
Could an Understanding of the

Strawberry Softening Process Benefit from Aquaporins?
Karina Alleva1 • Mercedes Marquez1 • Jorge Bellati1 • Natalia Villarreal2 •
Claudia Bustamante2 • Gustavo Martínez2 • Marcos Civello2 • Gabriela Amodeo1*
1 Departamento de Biodiversidad y Biología Experimental, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Argentina
2 IIB-INTECH, UNSAM-CONICET, Chascomús, Argentina
Corresponding author: * amodeo@bg.fcen.uba.ar
ABSTRACT
The Major Intrinsic Protein (MIP) family includes a main group of key channels known as aquaporins (AQPs), described for sharing a
very conservative structure with a pore that facilitates water and/or solute permeation. Since its first member was functionally reported in
1992, AQPs were found to be abundantly expressed in all kingdoms. Although many roles have been attributed to these small integral
proteins, it is becoming evident that the number and type of AQPs within a membrane are major determinants of its water transport
capacity. Thus, their presence is opening new perspectives to understand the role of plant cell membrane water transport in physiological
and developmental processes. Strawberry is a fleshy fruit characterized by a rapid loss of firmness during ripening, limiting the shelf-life
of these fruit. Even though fruit texture is influenced by various factors like structural integrity of primary cell wall, sugar accumulation,
and the turgor pressure generated within cells by osmosis, main attention has been focused on degradation of cell wall polysaccharides.
Turgor pressure, in spite of long being mentioned as a possible player in softening during fruit development, has not received proper
consideration. In the light of AQP outbreak, it is worth questioning how these channels could contribute to strawberry fruit softening. In
an attempt to answer this question, this review summarizes the current available information on plant AQPs, extending the knowledge to
those specifically expressed in fruits to finally discuss the recent reported findings in strawberry, particularly those associated with
ripening and softening processes.
_____________________________________________________________________________________________________________
Keywords: Fragaria x ananassa, water channel, turgor, ripening

Abbreviations: AQP, aquaporin; ER, endoplasmic reticulum; Lp hydraulic conductivity; MIP, major intrinsic protein; NAA, indole-3-
acetic acid; NIP, nodulin26-like intrinsic protein; PIP, plasma membrane intrinsic protein; Pf, osmotic water permeability; SIP, small
basic intrinsic protein; TIP, tonoplast membrane intrinsic protein
FRUIT RIPENING AND SOFTENING ........................................................................................................................................................ 1

Strawberry fruit ripening ........................................................................................................................................................................... 1
Cell wall metabolism ................................................................................................................................................................................. 2
Changes in water status ............................................................................................................................................................................. 2
THE CELL WATER PATHWAY AND THE RIPENING EVENTS .............................................................................................................. 2
The multifaceted water channels ............................................................................................................................................................... 2
Controlling water transfer through the cell pathway.................................................................................................................................. 3
Fruit aquaporins......................................................................................................................................................................................... 4
FINAL REMARKS........................................................................................................................................................................................ 5
ACKNOWLEDGEMENTS ........................................................................................................................................................................... 5
REFERENCES............................................................................................................................................................................................... 5
_____________________________________________________________________________________________________________
FRUIT RIPENING AND SOFTENING Strawberry fruit ripening
Fleshy fruit ripening can be defined as a set of physiolo- Strawberry is considered a non-climacteric fruit, being
gical and biochemical events leading to changes in fruit auxins produced by the achenes the main hormones that
color, flavor, aroma and texture. In the case of fruits like regulate the receptacle ripening process (Given et al. 1988).
strawberry, the division between development and ripening It has been reported that the expression of some genes asso-
is not well defined, and ripening is considered as part of a ciated with strawberry fruit ripening is down-regulated by
continuous developmental process in which several physio- auxins (Manning 1994; Aharoni et al. 2002a). At the present
logical phases can be overlapped (Manning 1993). Straw- time, the role of ethylene in strawberry fruit ripening is not
berry fruit are very sensitive to postharvest decay, making clear and several works have considered a revision of the
storage difficult and leading to important economic losses. possible role of this hormone (Bower et al. 2003; Iannetta et
For these reasons the understanding of molecular mecha- al. 2006). A number of observations have suggested that the
nisms that regulate soft fruit ripening would be very useful. low levels of ethylene produced by strawberry could be
In the present revision, the aspects which contribute to enough to regulate some ripening aspects (Tian et al. 1997;
the final texture of ripe strawberry fruit will be revised with Trainotti et al. 2005; Villarreal et al. 2009).
particular emphasis in water status and the role of the As in other species, strawberry fruit development distin-
transcellular water pathway. guishes several phases: fruit set, fruit growth associated in a
first step to cell division and later to cell volume increase,
Received: 10 February, 2010. Accepted: 10 August, 2010.

Genomics, Transgenics, Molecular Breeding and Biotechnology of Strawberry. Husaini AM and Mercado JA (Eds) Global Science Books, UK Invited Mini-Review
and finally, the ripening phase, which overlaps with the last negatively affect cell turgor. This is the case of the last
growth phase (Gillaspy et al. 1993). It was reported that phases of maturation of a fleshy fruit where solutes ac-
receptacle growth follows either a single or a double sig- cumulate in the apoplast as ripening progress (Wada et al.
moid curve, depending on the cultivar (Havis 1943; Cheng 2009; Pomper and Breen 1995; Shackel et al. 1991). One of
and Breen 1992), while softening occurs continuously the earliest explanations for the loss of turgor in the ripe
during fruit ripening, being the extension of this process fruit was proposed by the compartmentation breakdown
cultivar-dependent (Salentijn et al. 2003; Rosli et al. 2004). theory. This theory establishes that in the cell occurs a loss
Loss of firmness in fleshy fruits has been mainly asso- of compartmentation with the consequent solute leakage
ciated to solubilization and depolymerization of cell wall and loss of cell pressure turgor (Lang and Düring 1991).
polysaccharides (Rose et al. 1998; Brummell and Harpster However, accumulating evidence of measurable cell pres-
2001; Brummell et al. 2004). The nature and extension of sure turgor during ripening (Thomas et al. 2006; Wada et al.
these processes vary between different species and even 2009) and the expression of many genes including integral
among cultivars of the same species. In the particular case membrane proteins such as sugar transporters and aqua-
of strawberry, the total amount of cell wall decreases during porins (AQPs) (Davies et al. 1999; Ageorges et al. 2000;
ripening, but no clear correlation was found between cell Fillion et al. 1999; Picaud et al. 2003; Mut et al. 2008),
wall content and softening rate of cultivars with contrasting have strongly lead to abandon this theory. Moreover, Tho-
fruit firmness (Rosli et al. 2004). mas et al. (2008) speculated that the cell turgor could play a
Although cell wall loosening contributes greatly to tex- role as a signal for gene expression and metabolic changes
ture variations during ripening, it is not the only factor that that occur at the onset of ripening in grape berry.
rules this process. Fruit softening is characterized by the It is important to remark that a reduction in cell turgor
loss of cell adhesion, which is produced by the degradation has been shown to stimulate sugar uptake in several plant
of the middle lamella. In addition, other aspects as cuticle sink tissues as a strategy to maintain this turgor (Daie and
integrity (Saladié et al. 2007) and cell turgor should be con- Wyse 1985; Wyse et al. 1986; Oparka and Wright 1988a,
sidered (Shackel et al. 1991; Shiota et al. 2006). 1988b). In strawberry, solute levels in the apoplast in-
creased as fruit developed from green-white to red while
Cell wall metabolism reaching, for instance, concentrations of approximately 50
mM of both glucose and sucrose, and the cell turgor values
Cell wall disassembly has been traditionally considered as were shown to decline from 250 to 50 KPa for the green to
the principal process that leads to fruit softening (Fischer pink fruit stage transition (Pomper and Breen 1995). This
and Bennett 1991). Studies made mainly in climacteric solute accumulation coexists with the progress of fruit sof-
fruits have shown that modification of cell wall polymers is tening. However, it was demonstrated that strawberry fruit
a consequence of the coordinated action of cell wall-modi- cells do not have a sugar uptake system stimulated by a
fying proteins (expansins) and enzymes that catalyze the reduction in turgor (Pomper and Breen 1996). Therefore it
degradation of hemicelluloses: endo-1,4--D-glucanases, - would seem unlikely that strawberry fruit cells are able to
xyloxidases, endo-xylanases, xyloglucan endotransglycosy- respond to, or regulate, the levels of apoplastic solutes
lases, etc.; and enzymes that act on pectins: pectate lyases, through sugar transport. This experimental observation suits
polygalacturonases, pectin methylesterases, etc. (Brummell with the loss of turgor reported for ripening fruits and sup-
and Harpster 2001). ports the hypothesis that a fruit that softens does not main-
In strawberry fruit, softening has been suggested to be tain cell turgor pressure, not as an aberrant process but as a
related to pectin solubilization (Rosli et al. 2004). Fruit with key physiological event.
antisense suppression of a putative pectate lyase gene In conclusion, it is accepted that the softening process is
showed a significant reduction in pectin solubilization and complex and involves, at the cellular level, cell wall dis-
softening (Jiménez-Bermúdez et al. 2002). In addition, assembly as well as loss of cell turgor pressure. These
polygalacturonase activity and gene expression have been events, that are juxtaposed and no yet clearly distinguished
associated to differences in the rate of softening observed by biophysical parameters or gene expression profiles,
between cultivars (Villarreal et al. 2008). Also, antisense would contribute to fruit softening.
down-regulation of a polygalacturonase gene (FaPG1) in
transgenic strawberry plants leads to a diminution in post- THE CELL WATER PATHWAY AND THE RIPENING
harvest softening in comparison to wild type fruit (Quesada EVENTS
et al. 2009). Regarding hemicellulose metabolism, although
strawberry lines with down-regulated expression of cel1, The multifaceted water channels
which encodes for an endo-(1,4)-E-glucanase, showed no
appreciable reduction of ripening-related fruit softening In certain mammalian organs, biophysical evidences for the
(Woolley et al. 2001), it has been reported a correlation regulatory properties of the water pathway through mem-
between -xylosidase activity, FaXyl1 mRNA, protein branes were strongly supporting the idea of a pore-mediated
accumulation and firmness loss in two cultivars with water transport (Parisi et al. 1983, 1984a, 1984b) even dec-
contrasting firmness suggesting a role for -xylosidases in ades before the discovery of the first water channel (Preston
strawberry fruit softening (Bustamante et al. 2006). et al. 1992). In the particular case of fruit development and
The main firmness reduction in strawberry fruit occurs ripening, water movements are crucial in every phase since
between the large green and 25% red stages in different cell division, cell growth and loss of turgor require a strict
cultivars (Rosli et al. 2004; Villarreal et al. 2008). For control of water transport across membranes. However, the
example, ‘Toyonoka’ cultivar shows an intense softening, plant cell water pathway was never considered as crucial.
being its fruit very soft at 100% red stage. On the contrary, This was probably due to the combination of two features:
fruit from ‘Camarosa’ and ‘Selva’ cultivars are firm even at i) the water permeability of the lipid bilayer was considered
the end of ripening, which turn these varieties particularly enough and not a limiting factor to meet the cellular water
apt for commercialization. As the modification pattern of movements requirements, ii) the apoplastic pathway was
cell wall polymers can vary among species, it is expected considered to govern water transport. Consequently, the role
that the set of genes which are responsible for fruit sof- of water channels during fruit development received little
tening might also differ. attention. At the present times, awareness about the partici-
pation of water movements in fruit ripening events explains
Changes in water status the growing interest to analyze the possible role of AQPs in
this process (Hu et al. 2003; Picaud et al. 2003; Chervin et
It is well known that cell turgor is function of the difference al. 2008; Fouquet et al. 2008; Mut et al. 2008; Alleva et al.
between apoplast total water potential and cell osmotic 2010).
potential, therefore any increase in apoplastic solutes will Why should AQPs be considered? The Major Intrinsic
50
Aquaporins and strawberry ripening. Alleva et al.
Proteins (MIP) are a large ancient family of 28-30 kDa or hydraulic conductivity (Lp) to the membranes.
transmembrane protein channels (~800 members; http:// The presence of AQPs should not be considered as
mipdb.genouest.org) that are grouped together on the basis relevant only for single cells, since at the tissue and organ
of sequence similarities. Functional data allows MIP divi- levels many non-steady-state physiological processes in-
sion in at least two subfamilies: the AQPs, which mainly volve water transport through membranes. As explained by
conduct water, and aquaglyceroporins, facilitating the pas- Tyerman et al. (1999) time constants might involve longer
sage not only of water but also of small uncharged mole- periods if AQPs do not contribute to transmembrane water
cules like polyols, urea, ammonia, boric acid, etc. flow.
The movement of water and other solutes through AQPs Beyond the accumulated evidence, the contribution of
is a passive mechanism driven by the concentration gradient AQPs to water transport is still under study because of the
of the transported molecule. Thus, these channels facilitate complexity of the picture: a large number of isoforms, the
water and/or small neutral solute movements across biolo- expression control of each of them, and their short or long
gical membranes in a wide range of organisms. AQPs are term regulatory mechanisms.
abundant not only in plasma membrane but also in intra-
cellular membranes (Jauh et al. 1998; Ishikawa et al. 2005; Controlling water transfer through the cell
Uehlein et al. 2007) and evidences indicate that they can pathway
change the cell hydraulic conductance in a fast and rever-
sible way by modulating membrane water permeability. All The osmotic water permeability (Pf) of a cell membrane is a
these features turn these channels relevant for all physiolo- parameter that reflects water transport capacity, i.e. the abil-
gical cell processes where water movements must be rigo- ity to conduct water across the membrane in response to a
rously controlled. concentration gradient. Thus, the simple diffusion of water
In plants, AQPs are traditionally classified into homol- through the lipidic membrane is characterized by much
ogy subclasses associated with the most common subcel- lower Pf values when compared to the pore-mediated fast
lular localization of each type of water channel (Johanson et water exchange of AQPs (usually reflected in higher Pf val-
al. 2001). The larger subclass includes the plasma mem- ues).
brane intrinsic proteins (PIP), which can be further divided Regulation of water flow through cells can be achieved
into two clusters: PIP1 and PIP2. A second subclass is by either i) a rapid control of the protein itself, regulating its
formed by the tonoplast membrane intrinsic proteins (TIP), activity, gating or amount (e.g. modifying the pore aperture
while others are NIP (Nodulin26-like intrinsic proteins), or or by changing the number and/or the type of channel loca-
SIP (small basic intrinsic proteins, described as ER chan- lized in the membrane); ii) a slower adaptive/developmental
nels). However, the panorama cannot be straightforwardly response, through the regulation of AQP gene expression.
analyzed, as accumulating evidence about unexpected sub- A rapid way to control membrane water permeability is
cellular localization of different type of AQPs is challenging by regulating the activity of the AQP constitutively ex-
this AQP classification originally based on sequence homol- pressed. As far as from now, it is well known that plasma
ogy data (Wudick et al. 2009). Moreover, a new AQP sub- membrane water channel closure is achieved by dephos-
family has recently been reported, the XIP AQPs, with yet phorylation and modification of cell parameters such as
an unclear evidence for their localization (Danielson and cytosolic pH and divalent cation concentration, mainly cal-
Johanson 2008). Still, PIP and TIP remain as the most abun- cium (Gerbeau et al. 2002; Alleva et al. 2006; Verdoucq et
dant plant AQPs. al. 2008). This reversible phenomenon, usually referred as
All groups of AQPs are present in a same plant and each gating, has been extensively studied by means of cytosolic
of them presents several members. This implies that a plant acidification in PIP. The pH gating of PIP is dependent of
can express more than 30 AQPs in different tissues and the protonation state of a conserved histidine located in loop
organs, e.g. there are 35, 33 and 31 AQP homologs in D (Tournaire-Roux et al. 2003). Structure-function analyses
Arabidopsis, rice and maize respectively (Chaumont et al. have also strongly contributed to elucidate this mechanism,
2001; Johanson et al. 2001; Sakurai et al. 2005) and 28 based on the X-ray structures of the closed and open con-
were identified in the grapevine genome (Fouquet et al. formations of a plant AQP (Törnroth-Horsefield et al. 2006).
2008). Moreover, co-expression of several AQP types can These studies suggested that phosphorylation of two serine
occur in a single membrane. This high number of AQPs per residues lying in consensus phosphorylation sites, one in
plant species is probably reflecting tissue and cell specific loop B and the other in the C-termini might be involved in
regulation for water transport under different signals detec- channel gating.
ted by the cell. Recent evidence supports the idea that a fast water flow
Despite this multifaceted character of plant AQPs, modulation could be accomplished by expression of dif-
structural characteristics of water channels and its transport ferent AQPs in a same membrane. This was particularly in-
biophysics are shared between most of the members of the vestigated in plasma membrane AQPs (PIP). In addition,
family, including AQPs of other kingdoms. the positive cooperation, i.e. an increase in the Pf, is ob-
AQPs present six transmembrane helices linked by five tained if more than one subgroup of PIP interacts physically
loops (A-E). The N- and C-termini are cytosolic and the within a single membrane.
loops B and E have the conserved motives Asp-Pro-Ala Analysis using affinity-copurification and co-immuno-
(NPA) that form the channel pore. This structure, together purification techniques provided the first biochemical evi-
with an aromatic/Arg (ar/R) motif determines its substrate dence that PIP1 and PIP2 physically interact in oocytes
specificity. (Fetter et al. 2004). FRET imaging in living maize proto-
In addition, it has been established that water channels plasts co-expressing PIP1 and PIP2 further supports a
present a tetrameric assembly being each monomer an indi- model in which AQPs of the two classes directly interact to
vidual pore. In plants, this structure has been reported for facilitate PIP1 trafficking (Zelazny et al. 2007). This co-
PvTIP3;1 and SoPIP2;1 crystals (Daniels et al. 1999; Foti- operative effect in AQP activity could be the result of an
adis et al. 2002; Kukulskia et al. 2005; Törnroth-Horsefield enhanced plasma-membrane targeting of PIP1 promoted by
et al. 2006). PIP1-PIP2 interaction. However, the functionality of PIPs
Undoubtedly, the discovery of water channels opened becomes more complex if we considered that interaction
new research fields due to the skill of cells to control and between isoforms is not restricted to PIP1-PIP2, since phy-
regulate the diffusional water flow through membranes. As sical contact was also detected among different PIP1 or
mentioned before, water (or solute) transport carried out by different PIP2 forming therefore PIP1-PIP1 and PIP2-PIP2
AQPs is bidirectional and follows the osmotic gradient complexes (Fetter et al. 2004; Cavez et al. 2009).
through the membrane. However, as other channels, AQPs Although much progress on plant AQP activity was
are subjected to regulatory processes. Consequently, AQPs achieved, is still unclear the functional relevance of these
confer a high and adjustable osmotic water permeability (Pf) mechanisms. The above-mentioned report about protein-
51
protein interaction as determinant of AQP targeting is a step 2010). Although this kind of AQP regulatory mechanism
in the elucidation of these issues. There are evidences of was reported in other species and organisms, this was the
protein modifications – e.g. glycosylation – that makes pos- first evidence in fruit PIPs. Functional characterization of
sible the relocalization of water channels after osmotic or isolated plasma membrane vesicles from red stage fruit
salt stress (Vera-Estrella et al. 2004; Boursiac et al. 2008a, demonstrated the presence of active water channels. As both
2008b). Membrane proteomics is also assisting in a tho- PIP1 and PIP2 are expressed in PM vesicles, the results are
rough description of the co- and post-translational modifica- in agreement with the reported water activity in FaPIPs co-
tion pattern of AQPs, including the first report of a methyl- expressed in Xenopus oocytes (Mut et al. 2008; Alleva et al.
ated membrane protein – dimethylation and monomethyla- 2010).
tion – in plants (Santoni et al. 2006). AQPs during strawberry ripening were also identified
Finally, gene expression is undoubtedly the longer-term by microarray multigenic expression analysis (Aharoni et al.
way for the cell to answer to external and/or internal stimu- 2002b). In this report, four genes annotated as AQPs (or
lus by adjusting the amount of available protein in the membrane intrinsic proteins according to the putative func-
membrane. AQP gene expression is regulated developmen- tion of its closest NCBI database homologues) have been
tally – e.g. via hormones – and by environmental conditions, detected as expressed preferentially in fruit receptacles.
e.g. biotic and abiotic stress. As far as from now evidences Three of these putative water channel genes seemed to have
are showing clearly the absence of a unique expression a barely higher expression in red stage in comparison with
pattern, e.g. different AQP isoforms can be either up- or green stage. The fourth, in contrast, presented very different
down-regulated depending on the stimulus and/or the organ expression pattern, since it expresses at higher level in tur-
studied. Difference in transcriptional regulation suggests ning or white stage than in red stage.
that each isoform has a distinctive role, and this enhances Studies performed on other non-climacteric fruits have
the versatility to control water movements. reported also different expression patterns for each AQP
isoform during ripening. For instance, AQP gene expression
Fruit aquaporins investigated by means of microarrays during grape berry
development indicates a heterogeneous profile: i- VvPIP1;1
As far as from now, most of the AQP research in plants has showed no variation in expression during berry develop-
been performed in Arabidopsis thaliana, Zea mays and ment, ii- VvPIP1;2, and VvPIP2;2 decreased their expres-
Oryza sativa, predominantly in root or leaf systems, un- sion beginning at the veraison stage, iii- VvPIP1;3 showed a
doubtedly excellent organs not only to elucidate the role of decrease in the amount of transcripts occurring after verai-
these proteins in the hydraulic conductivity but also to study son, and iv- VvPIP2;1 and VvPIP2;3 genes showed an in-
their contribution under physiological challenges (Forrest crease of expression at the veraison stage followed by a
and Bhave 2007). stabilization (VvPIP2;3) or a decrease of expression
In recent years several laboratories have focused their (VvPIP2;1) after veraison (Fouquet et al. 2008). Moreover,
work in identifying fruit AQPs seeking for their role in the another report based on microarray experiments with vari-
physiology of the fruit. In tomato, it was reported that trans- ous stages of berry development detected two groups of
genic lines generated with reduced TRAMP mRNA, a genes involved: cell wall structure and water exchange
membrane protein related to AQPs, showed increased or- genes organized in three categories: i- those that remain
ganic acids and reduced sugar levels during fruit ripening high during the phase of berry diameter growth, where
(Chen et al. 2001). More recently, it was reported that the AQPs might be involved (AQUA1), ii- those that reach the
expression of genes encoding tomato PIPs changes during maximum amount at the beginning of the second phase of
fruit development (Shiota et al. 2006). Moreover, a putative diameter growth, and iii- genes whose expression was high
PIP1 AQP gene was related to fruit development and os- over both expansion phases of berries, again involving here
motic stress in apple (Hu et al. 2003). In those cases, the an AQP (AQUA2) (Chervin et al. 2008).
authors did not perform a functional characterization of the As mentioned previously, in the case of apple AQPs,
reported AQPs. only a PIP1 was studied, MdPIP1, whose increased expres-
Strawberry and grape berry AQPs have also been repor- sion is in accordance with the volume increase during fruit
ted as proteins involved in ripening and some of these development (Hu et al. 2003).
AQPs have been functionally studied by heterologous ex- Another important study relating AQPs to fruit develop-
pression in Xenopus oocytes (Picaud et al. 2003; Chervin et ment was reported on tomato PIPs (Shiota et al. 2006). As
al. 2008; Fouquet et al. 2008; Mut et al. 2008; Alleva et al. in the other cases, eight AQPs showed distinct expression
2010). patterns: LePIP1-1, LePIP1-2 and LePIP2-2 present stron-
In strawberry, two full length cDNAs encoding a PIP1 ger expression during the earlier phase of development,
and a PIP2 subtype AQPs were cloned: FaPIP1;1 while LePIP1-5, LePIP2-1 and LePIP2-3 had higher ex-
(GQ390798) and FaPIP2;1 (GQ390799). pression level in the later phase; the expression of LePIP1-3
The expression of FaPIP1;1 was detected in fruit and and LePIP1-4 was constant through tomato fruit develop-
ovaries, while no expression was found in other tissues and ment.
organs (Mut et al. 2008). The accumulation of FaPIP1;1 AQP expression was also analyzed in terms of hormone
mRNA increases during strawberry fruit ripening, particu- regulation. In the case of strawberry, auxins were reported
larly in the case of cultivars that produce firm fruits. For as the hormones that mediate signals for the onset of fruit
example in firm cultivars as Selva and Camarosa, the ex- ripening. These hormones present maximum level at both
pression level was low in green fruit, increased in white or the receptacle and achenes previous to the white stage, and
25% red stage and remained high until the end of ripening then decline (Given et al. 1988). Interestingly, FaPIP1;1, as
(Mut et al. 2008; Alleva et al. 2010). In the case of well as other ripening-related strawberry genes, presented
FaPIP2;1, the higher expression was detected early in an expression pattern repressed by the presence of auxins
ripening (white and 25% red stages), both in a firm and a (Mut et al. 2008). In that work, endogenous auxins level
soft cultivar. However, the expression level of FaPIP2;1 was reduced by removing the achenes, which are the main
was markedly higher in the firm cultivar along ripening source of strawberry fruit auxins. FaPIP1;1 mRNA expres-
(Alleva et al. 2010). sion was very high in fruits three days after the elimination
The water transport activity of FaPIP1;1 and FaPIP2;1 of the achenes. By contrast, FaPIP1;1 mRNA levels were
was assayed by overexpression of both clones in Xenopus lower in the tissue where achenes were still present. Fur-
oocytes. The overexpression of FaPIP2;1 enhanced greatly thermore, exogenous application of NAA, a synthetic auxin,
water transport activity, while, FaPIP1;1 failed to contribute caused a decrease of FaPIP1;1 expression. Other AQPs
to water transport through the plasma membrane unless it were also described as proteins modulated by hormones
was co-expressed with FaPIP2;1, suggesting that both AQP during fruit development. For example: i- five AQP genes
subtypes might require a functional interaction (Alleva et al. putatively involved in the regulation of berry ripening have
52
been detected as abscisic acid responsive proteins (Pilati et ACKNOWLEDGEMENTS

al. 2007) and, ii- also in grape berries, it was demonstrated
that an ethylene treatment performed eight weeks after Our research is supported by grants from PICT07-655,
flowering generated changes in the expression pattern of UBACyT0810 and CONICET PIP5154 (all grants to GA),
various AQPs among other genes including those related to PICT06 01804 (KA), and PICT 2006-01140 (MC). KA, GM, MC
the establishment of the cell wall structure (Chervin et al. and GA are Career Research Members of CONICET.
2008).
The presence of precise patterns of AQP expression REFERENCES
during fruit ripening suggests that water channels might be
participating in specific processes during ripening. For Ageorges A, Issaly N, Picaud S, Delrot S, Romieu C (2000) Identification and
example, water channels might be associated with the main functional expression in yeast of a grape berry sucrose carrier. Plant Physiol-
mechanisms involved in cell division and cell expansion ogy Biochemistry 38, 177-185
(Fouquet et al. 2008; Maurel et al. 2009) as in these events Aharoni A, Keizer LCP, Van Den Broeck HC, Blanco-Portales R, Muñoz-
water must flow into cells to increase their volume. How- Blanco J, Bois G, Smit P, De Vos RCH, O'Connell AP (2002) Novel insight
ever, fruit softening involves the reduction of cell turgor, a into vascular, stress, and auxin-dependent and -independent gene expression
process subjected to cell water efflux capacity that could programs in strawberry, a nonclimacteric fruit. Plant Physiology 129, 1019-
include the participation of AQPs. 1031
Aharoni A, O'Connell AP (2002) Gene expression analysis of strawberry
Brummell and Harpster (2001) have carried out an
achene and receptacle maturation using DNA microarrays. Journal of Experi-
interesting comparison between fruit softening and fruit mental Botany 53 (377), 2073-2087
growth, as both events strongly require cell wall dis- Alleva K, Niemietz CM, Sutka M, Maurel C, Parisi M, Tyerman SD, Amo-
assembly: in growth, to expand the cells and then to recons- deo G (2006) Plasma membrane vesicles of Beta vulgaris storage root show
truct the cell wall; in softening, to achieve the final fruit high water channel activity that is regulated by cytoplasmic pH, and a dual
texture. However, while a progressive disassembly of the range of calcium concentrations. Journal of Experimental Botany 57, 609-
cell wall network occurs during softening and cell growth, 621
changes in the cell wall are not equally achieved in both Alleva K, Marquez M, Villarreal N, Mut P, Bustamante C, Bellati J, Martì-
processes. For example, there are ripening-related expan- nez G, Civello M, Amodeo G (2010) Cloning, functional characterization,
sins and expansion-related expansins, suggesting that each and co-expression studies of a novel aquaporin (FaPIP2;1) of strawberry fruit.
expansin isoform would be strictly involved in one of the Journal of Experimental Botany 14, 3935-3945
wall modifying mechanisms. Boursiac Y, Prak S, Boudet J, Postaire O, Luu DT, Tournaire-Roux C, San-
toni V, Maurel C (2008) The response of Arabidopsis root water transport to
A similar scenario seems to occur in the case of AQPs; a a challenging environment implicates reactive oxygen species- and phos-
multigenic protein family including multiple isoforms, phorylation-dependent internalization of aquaporins. Plant Signaling and
which play different roles and can interact to achieve a final Behavior 3, 1096-1098
physiological status in the fruit. Boursiac Y, Boudet J, Postaire O, Luu DT, Tournaire-Roux C, Maurel C
(2008) Stimulus-induced downregulation of root water transport involves re-
FINAL REMARKS active oxygen species-activated cell signalling and plasma membrane intrin-
sic protein internalization. Plant Journal 56, 207-218
The complexity of the softening process arises from the Bower JH, Biasi WV, Mitcham EJ (2003) Effects of ethylene and 1-MCP on
variety of metabolic events occurring at the same time or at the quality and storage life of strawberries. Postharvest Biology and Technol-
least as a very sophisticated temporal-organized process. ogy 28, 417-423
Many enzymatic activities capable of cell wall disassembly Brummell DA, Harpster MH (2001) Cell wall metabolism in fruit softening
and quality and its manipulation in transgenic plants. Plant Molecular Biol-
have been investigated as responsible for the softening of
ogy 47, 311-340
fleshy fruits (Brummell and Harpster 2001). The enzymes Brummell DA, Dal Cin V, Crisosto CH, Labavitch JM (2004) Cell wall
known to be involved in this process are encoded, as also metabolism during maturation, ripening and senescence of peach fruit. Jour-
seems to be the case of AQPs, by multi-gene families nal of Experimental Botany 55, 2019-2039
(White 2002). This undoubtedly contributes to the difficulty Bustamante CA, Rosli HG, Añón MC, Civello PM, Martínez GA (2006) -
of elucidating the molecular basis of softening. Xylosidase in strawberry fruit: Isolation of a full-length gene and analysis of
Although much progress in the understanding of straw- its expression and enzymatic activity in cultivars with contrasting firmness.
berry softening has been made, this interesting and impor- Plant Science 171, 497-504
tant process is still poorly understood and remains an active Cavez D, Hachez C, Chaumont F (2009) Maize black Mexican sweet suspen-
research area. As it is evident from the reports up to date sion cultured cells are a convenient tool for studying aquaporin activity and
about AQPs in ripening, the pattern of expression of these regulation. Plant Signalling and Behaviour 4 (9), 890-892
channels is complex. Additionally, it is not clear yet if all Chaumont F, Barrieu F, Wojcik E, Chrispeels MJ, Jung R (2001) Aqua-
porins constitute a large and highly divergent protein family in maize. Plant
AQP isoforms act as water channels or solute transporters. Physiology 125, 1206-1215
It is also important to consider that every fruit presents its Cheng GW, Breen PJ (1992) Cell count and size in relation to fruit size among
own developmental phases. Taken all these aspects into ac- strawberry cultivars. Journal of the American Society of Horticultural Scien-
count it is not straightforward that AQPs are channels ces 117, 946-950
involved in water transport only for cell expansion. As Chen GP, Wilson ID, Kim SH, Grierson D (2001) Inhibiting expression of a
noted by Fouquet et al. (2008), spatio-temporal regulation tomato ripening-associated membrane protein increases organic acids and
along fruit development may be linked to particular phy- reduces sugar levels of fruit. Planta 212, 799-807
siological events which could involve specialized and dif- Chervin C, Tira-Umphon A, Terrier N, Zouine M, Severac D, Roustan JP
ferent functions for some AQPs. Functional analysis of each (2008) Stimulation of the grape berry expansion by ethylene and effects on
isoform and real tissue location of them by – for instance, in related gene transcripts, over the ripening phase. Physiologia Plantarum 134,
situ hybridization techniques – are still needed to under- 534-546
Daie J, Wyse RE (1985) Evidence on the mechanism of enhanced sucrose up-
stand the role played by single AQPs in the whole process
take at low cell turgor in leaf discs of Phaseolus coccinius. Physiologia Plan-
of ripening. Our proposal is to consider that AQPs could be tarum 64, 547-552
key participants in the softening events since loss of turgor Daniels MJ, Chrispeels MJ, Yeager M (1999) Projection structure of a plant
reported needs water and solute mobilization besides cell vacuole membrane aquaporin by electron cryo-crystallography. Journal of
wall disassembly. AQPs provide a molecular basis for trans- Molecular Biology 17, 1337-1349
membrane water transport, thus not only they broaden water Danielson JA, Johanson U (2008) Unexpected complexity of the aquaporin
transport capacity through the membrane but also introduce gene family in the moss Physcomitrella patens. BMC Plant Biology 8, 45-57
its versatility through their regulatory mechanisms. The Davies C, Wolf T, Robinson SP (1999) Three putative sucrose transporters are
availability of strawberry cultivars with different softening differentially expressed in grapevine tissues. Plant Science 147, 93-100
rate turns as a very useful tool to understand the partici- Fetter K, Van Wilder V, Moshelion M, Chaumont F (2004) Interactions bet-
pation of AQPs and other softening-related proteins. ween plasma membrane aquaporins modulate their water channel activity.
Plant Cell 16, 215-228
53
Fillion L, Ageorges A, Picaud S, Coutos-Thévenot P, Lemoine R, Romieu C, lated during three seasons and the occurrence of an oxidative burst at vèrai-
Delrot S (1999) Cloning and expression of a hexose transporter gene ex- son. BMC Genomics 8, 428-450
pressed during the ripening of grape berry. Plant Physiology 120, 1083-1093 Pomper K, Breen P (1995) Levels of apoplastic solutes in developing straw-
Fischer LR, Bennett AB (1991) Role of cell wall hydrolases in fruit ripening. berry fruit. Journal of Experimental Botany 46, 743-752
Annual Review of Plant Physiology and Plant Molecular Biology 42, 675- Pomper K, Breen P (1996) The effect of cell turgor on sugar uptake in deve-
703 loping strawberry fruit. Physiologia Plantarum 96, 324-332
Forrest KL, Bhave M (2007) Major intrinsic proteins (MIPs) in plants: a com- Preston GM, Carroll TP, Guggino WB, Agre P (1992) Appearance of water
plex gene family with major impacts on plant phenotype. Functional and channels in Xenopus oocytes expressing red cell CHIP28 protein. Science
Integrative Genomics 7, 263-289 256, 385-387
Fotiadis D, Suda K, Tittmann P, Jeno P, Philippsen A, Muller DJ, Gross H, Quesada MA, Blanco-Portales R, Pose S, Gracía-Gago JA, Jiménez-Ber-
Engel A (2002) Identification and structure of a putative Ca2+-binding múdez S, Muñóz-Serrano A, Caballero JL, Pliego-Alfaro F, Mercado JA,
domain at the C terminus of AQP1. Journal of Molecular Biology 318, 1381- Muñóz-Blanco J (2009) Antisense down-regulation of the FaPG1 gene
1394 reveals an unexpected central role for polygalacturonase in strawberry fruit
Fouquet R, Léon C, Ollat N, Barrieu F (2008) Identification of grapevine softening. Plant Physiology 150, 1022-1032
aquaporins and expression. Plant Cell Reports 27, 1541-1550 Rose JKC, Hadfield KA, Labavitch JM, Bennett AB (1998) Temporal se-
Gerbeau P, Amodeo G, Henzler T, Santoni V, Ripoche P, Maurel C (2002) quence of cell wall disassembly in rapidly ripening melon fruit. Plant Physi-
The water permeability of Arabidopsis plasma membrane is regulated by ology 117, 345-361
divalent cations and pH. Plant Journal 30, 71-81 Rosli HG, Civello PM, Martínez GA (2004) Changes in cell wall composition
Gillaspy G, Ben-David H, Gruissem W (1993) Fruits: A developmental pers- of three Fragaria x ananassa cultivars with different softening rate during
pective. Plant Cell 5, 1439-1451 ripening. Plant Physiology and Biochemistry 42, 823-831
Given NK, Venis MA, Grierson D (1988) Hormonal regulation of ripening in Sakurai J, Ishikawa F, Yamaguchi T, Uemura M, Maeshima M (2005)
strawberry, a non-climacteric fruit. Planta 174, 402-406 Identification of 33 rice aquaporin genes and analysis of their expression and
Havis AL (1943) A developmental analysis of the strawberry fruit. American function. Plant Cell Physiology 46, 1568-1577
Journal of Botany 30, 311-314 Saladié M, Matas AJ, Isaacson T, Jenks MA, Goodwin SM, Niklas KJ,
Hu CG, Hao YJ, Honda C, Kita M, Moriguchi T (2003) Putative PIP1 genes Xiaolin R, Labavitch JM, Shackel KA, Fernie AR, Lytovchenko A,
isolated from apple: expression analyses during fruit development and under O’Neill MA, Watkins CB, Rose JKC (2007) A re-evaluation of the key fac-
osmotic stress. Journal of Experimental Botany 54, 2193-2194 tors that influence tomato fruit softening and integrity. Plant Physiology 144,
Iannetta PPM, Laarhoven LJ, Medina-Escobar N, James EK, McManus 1012-1028
MT, Davies HV, Harren FJM (2006) Ethylene and carbon dioxide produc- Salentijn EMJ, Aharoni A, Schaart JG, Boone MJ, Krens FA (2003) Dif-
tion by developing strawberries show a correlative pattern that is indicative ferential gene expression analysis of strawberry cultivars that differ in fruit-
of ripening climacteric fruit. Physiologia Plantarum 127, 247-259 firmness. Physiologia Plantarum 118, 571-578
Ishikawa F, Suga S, Uemura T, Sato MH, Maeshima M (2005) Novel type Santoni V, Verdoucq L, Sommerer N, Vinh J, Pflieger D, Maurel C (2006)
aquaporin SIPs are mainly localized to the ER membrane and show cell- Methylation of aquaporins in plant plasma membrane. Biochemical Journal
specific expression in Arabidopsis thaliana. FEBS Letters 579, 5814-5820 400, 189-197
Jauh GY, Fischer AM, Grimes HD, Ryan CA Jr., Rogers JC (1998) delta- Shackel KA, Greve C, Labavitch JM, Ahmadi H (1991) Cell turgor changes
Tonoplast intrinsic protein defines unique plant vacuole functions. Proceed- associated with ripening in tomato pericarp tissue. Plant Physiology 97, 814-
ings of the National Academy of Science USA 27, 12995-12999 816
Jiménez-Bermúdez S, Redondo-Nevado J, Muñoz-Blanco J, Caballero JL, Shiota H, Sudoh T, Tanaka I (2006) Expression analysis of genes encoding
López-Aranda JM, Valpuesta V, Pliego-Alfaro F, Quesada MA, Mercado plasma membrane aquaporins during seed and fruit development in tomato.
JA (2002) Manipulation of strawberry fruit softening by antisense expression Plant Science 171, 277-285
of a pectate lyase gene. Plant Physiology 128, 751-759 Thomas TR, Matthews MA, Shackel KA (2006) Direct in situ measurement
Johanson U, Karlsson M, Johansson I, Gustavsson S, Sjövall S, Fraysse L, of cell turgor in grape (Vitis vinifera L.) berries during development and in
Weig AR, Kjellbom P (2001) The complete set of genes encoding major in- response to plant water deficits. Plant, Cell and Environment 29 (5), 993-
trinsic proteins in Arabidopsis provides a framework for a new nomenclature 1001
for major intrinsic proteins in plants. Plant Physiology 126, 1358-1369 Thomas TR, Shackel KA, Matthews MA (2008) Mesocarp cell turgor in Vitis
Kukulskia W, Schenka AD, Johansonb U, Brauna T, de Grootc LB, Fotia- vinifera L. berries throughout development and its relation to firmness,
disa D, Kjellbomb P, Engel A (2005) The 5 Å structure of heterologously growth, and the onset of ripening. Planta 228 (6), 1067-1076
expressed plant aquaporin SoPIP2;1. Journal of Molecular Biology 4, 611- Tian MS, Gong Y, Bauchot AD (1997) Ethylene biosynthesis and respiration
616 in strawberry fruit treated with diazocyclopentadiene and IAA. Plant Growth
Lang A, Düring H (1991) Partitioning control by water potential gradient: Evi- Regulation 23, 195-200
dence for compartmentation breakdown in grape berries. Journal of Experi- Tornroth-Horsefield S, Wang Y, Hedfalk K, Johanson U, Karlsson M, Tajk-
mental Botany 42, 1117-1122 horshid E, Neutze R, Kjellbom P (2006) Structural mechanism of plant
Manning K, (1993) Soft fruit. In: Seymour G, Taylor J Tucker G (Eds) Bioche- aquaporin gating. Nature 439, 688-694
mistry of Fruit Ripening, Chapman and Hall, London, pp 346-377 Tournaire-Roux C, Sutka M, Javot H, Gout E, Gerbeau P, Luu DT, Bligny
Manning K (1994) Changes in gene expression during strawberry fruit ripening R, Maurel C (2003) Cytosolic pH regulates root water transport during an-
and their regulation by auxin. Planta 194, 62- 68 oxic stress through gating of aquaporins. Nature 425, 393-397
Maurel C, Santoni V, Luu DT, Wudick MM, Verdoucq L (2009) The cellular Trainotti L, Pavanello A, Casadoro G (2005) Different ethylene receptors
dynamics of plant aquaporin expression and functions. Current Opinion in show an increased expression during the ripening of strawberries: does such
Plant Biology 12, 690-698 an increment imply a role for ethylene in the ripening of these non-climac-
Mut P, Bustamante C, Martínez G, Alleva K, Sutka M, Civello M, Amodeo teric fruits? Journal Experimental Botany 56, 2037-2046
G (2008) A fruit-specific plasma membrane aquaporin subtype PIP1;1 is Tyerman SD, Bohnert HJ, Maurel C, Steudle E, Smith JA (1999) Plant
regulated during strawberry (Fragaria x ananassa) fruit ripening. Physiolo- aquaporins: Their molecular biology, biophysics and significance for plant
gia Plantarum 132, 538-551 water relations. Journal Experimental Botany 50, 1055-1071
Oparka KJ, Wright KM (1988a) Osmotic regulation of starch synthesis in Uehlein N, Fileschi K, Eckert M, Bienert G, Bertl A, Kaldenhoff R (2007)
potato tubers? Planta 174, 123-126 Arbuscular mycorrhizal symbiosis and plant aquaporin expression. Phytoche-
Oparka KJ, Wright KM (1988b) Influence of cell turgor on sucrose partition- mistry 68, 122-129
ing in potato tuber storage tissues. Planta 175, 520-526 Vera-Estrella R, Barkla BJ, Bohnert HJ, Pantoja O (2004) Novel regulation
Parisi M, Wietzerbin J, Bourguet J (1983) Intracellular pH, transepithelial pH of aquaporins during osmotic stress. Plant Physiology 135, 2318-2329
gradients and ADH-induced water channels. American Journal of Physiology Verdoucq L, Grondin A, Maurel C (2008) Structure-function analysis of plant
244, F712-718 aquaporin AtPIP2;1 gating by divalent cations and protons. Biochemical
Parisi M, Bourguet J (1984) Effects of cellular acidification on ADH-induced Journal 415, 409-416
intramembrane particle aggregates. American Journal of Physiology 246, Villarreal NM, Rosli HG, Martínez GA, Civello PM (2008) Polygalacturo-
C157-159 nase activity and expression of related genes during ripening of strawberry
Parisi M, Wietzerbin J (1984) Cellular pH and the ADH-induced hydrosmotic cultivars with contrasting fruit firmness. Postharvest Biology and Technology
response in different ADH target epithelia. Pflügers Archives 402, 211-215 47, 141-150
Picaud S, Becq F, Dédaldéchamp F, Ageorges A, Delrot S (2003) Cloning and Villarreal NM, Bustamante CA, Civello PM, Martínez GA (2009) Effect of
expression of two plasma membrane aquaporins expressed during the ripen- ethylene and 1-MCP treatments on strawberry fruit ripening. Journal of the
ing of grape berry. Functional Plant Biology 30, 621-630 Science of Food and Agriculture 90 (4), 683-689
Pilati S, Perazzolli M, Malossini A, Cestaro A, Demattè L, Fontana P, Dal Wada H, Matthews M, Shackel K (2009) Seasonal pattern of apoplastic solute
Ri A, Viola R, Velasco R, Moser C (2007) Genome-wide transcriptional accumulation and loss of cell turgor during ripening of Vitis vinifera fruit
analysis of grapevine berry ripening reveals a set of genes similarly modu- under field conditions. Journal of Experimental Botany 60, 1773-1781
54
White P (2002) Recent advances in fruit development and ripening: an over- Wyse RE, Zamski E, Tomos AD (1986) Turgor regulation of sucrose transport
view. Journal of Experimental Botany 53, 1995-2000 in sugar beet taproot tissue. Plant Physiology 81, 478-481
Woolley LC, James DJ, Manning K (2001) Purification and properties of an Zelazny E, Borst JW, Muylaert M, Batoko H, Hemminga MA, Chaumont F
endo--1,4-glucanase from strawberry and downregulation of the correspon- (2007) FRET imaging in living maize cells reveals that plasma membrane
ding gene, cel. Planta 214, 11-21 aquaporins interact to regulate their subcellular localization. Proceedings of
Wudick MM, Luu DT, Maurel C (2009) A look inside: Localization patterns the National Academy of Sciences USA 104, 12359-12364
and functions of intracellular plant aquaporins. New Phytologist 184, 289-302
55
Genetic and Environmental Regulation

of Flowering and Runnering in Strawberry
Timo Hytönen* • Paula Elomaa
Department of Agricultural Sciences, P.O.Box 27, 00014 University of Helsinki, Finland

Corresponding author: * timo.hytonen@helsinki.fi
ABSTRACT
Cultivated strawberry (Fragaria × ananassa Duch.) is one of the most important berry crops worldwide. Its wild relative, woodland
strawberry (Fragaria vesca L.) is also scientifically important, since recent development of molecular tools including genetic transforma-
tion methods, genetic maps and genome sequence is making it as one of the leading perennial model plants. Environmental regulation of
strawberry reproductive development including flowering and vegetative reproduction through runners has been studied for almost
hundred years and is known quite in detail. Most strawberries require short photoperiod and/or low temperature for the induction of
flowering, whereas runnering is activated by opposite environmental signals. On the contrary, everbearing genotypes flower continu-ously
in long day conditions. Some groundwork on characterization of molecular pathways controlling runnering and the induction of flowering
has been done. In these studies, dozens of candidate flowering genes have been identified, the expression patterns for selected genes have
been analyzed, and a marker gene for the induction of flowering has been identified. However, reports on detailed functions of the
candidate genes are yet to come. Moreover, the role of gibberellin as a major signal regulating runnering, awaits further characteriza-tion.
Two gene loci in F. vesca may provide keys to understand underlying regulatory pathways and are therefore major targets of further
research. Runnering locus (RL) makes the difference between runnering/non-runnering phenotypes and different alleles of Seasonal
flowering locus (SFL) cause seasonal and everbearing flowering habits. This review aims at summarizing the recent progress on molecu-
lar control of flowering and runnering in strawberry.
_____________________________________________________________________________________________________________
Keywords: axillary bud, Fragaria, photoperiod, Rosaceae, Seasonal flowering locus, Runnering locus
Abbreviations: AP1, Apetala1; CO, Constans; EB, everbearing; EST, expressed sequence tag; FLC, Flowering locus C; FT, Flowering
locus T; GA, gibberellin; LD, long day; LFY, Leafy; QTL, quantitative trait locus; RL, Runnering locus; SD, short day; SFL, Seasonal
flowering locus; SOC1, Suppressor of the overexpression of Constans1; SVP, Short vegetative phase; TFL1, Terminal flower1
CONTENTS
INTRODUCTION........................................................................................................................................................................................ 56
ENVIRONMENTAL REGULATION OF STRAWBERRY GROWTH ...................................................................................................... 57
Photoperiodic and temperature regulation of flowering .......................................................................................................................... 57
Environmental regulation of runnering.................................................................................................................................................... 58
GENETICS OF FLOWERING AND RUNNERING .................................................................................................................................. 58
GIBBERELLIN REGULATES AXILLARY BUD DIFFERENTIATION................................................................................................... 59
MOLECULAR STUDIES ON ROSACEAE FLOWERING PATHWAYS ................................................................................................. 59
Major flowering pathways in Arabidopsis thaliana................................................................................................................................. 59
Characterization of Rosaceae flowering genes ........................................................................................................................................ 59
SFL is a major regulator of flowering in F. vesca .................................................................................................................................... 61
Towards high throughput functional studies in strawberry ...................................................................................................................... 62
CONCLUDING REMARKS ....................................................................................................................................................................... 62
REFERENCES............................................................................................................................................................................................. 63
_____________________________________________________________________________________________________________
INTRODUCTION son, to increase berry yields and to improve plant produc-

tion techniques.
Strawberries are perennial rosette plants with high econo- At the vegetative stage of strawberry growth, short
mic value worldwide. Thereby, understanding the regu- internodes produced from the apical meristem of the stem
latory mechanisms controlling strawberry development is of form the “crown”. One trifoliate leaf with a long petiole and
utmost importance to facilitate both breeding and produc- one axillary bud develops into each node. Axillary buds can
tion of this important crop. Recent progress in molecular differentiate either to runners that are elongated shoots or to
biological research has also raised academic interest in new leaf rosettes called “branch crowns”. Runner growth
strawberry and brought it among the most important new involves the formation of successive units of two long inter-
model crops as well as led to completely new possibilities nodes followed by a terminal daughter plant that can be
to solve many biological questions studied for decades. used for vegetative reproduction. Inflorescences and con-
Most importantly, molecular level studies are expected to sequently flowers are formed by the apical meristem of the
provide us new and efficient tools to extend cropping sea- crown while the uppermost axillary buds continue vege-
Received: 28 January, 2010. Accepted: 21 August, 2010.

A:PHENOTYPESOFEBANDSDFRAGARIAVESCA B:SEASONALTIMINGOFFLORALDEVELOPMENT
Floralinitiation
SD
EB
Flowering
SD
EB
SpringSummerAutumnWinter
C:FLORALINITIATION D:RUNNERING
SD SD
911qC 911qC
EB EB
SD SD
1518qC 1518qC
EB EB
SD SD
2127qC 2127qC
EB EB
8h16h24h 8h16h24h
Photoperiod Photoperiod
Fig. 1 Schematic illustration of flowering and runnering responses in diploid strawberry Fragaria vesca (L.). (A) Opposite phenotypes of
everbearing (EB) genotype ‘Baron Solemacher’ (left) and seasonally flowering Finnish short day (SD) genotype (right) grown in long day (LD) condi-
tions. Recessive alleles of a single gene, Seasonal flowering locus (SFL), cause continuous flowering in ‘Baron Solemacher’, whereas SD genotype stays
vegetative in LD. ‘Baron Solemacher’ is runner-less because of recessive alleles of another gene, Runnering locus (RL), whereas SD genotype as well as
some other EB genotypes, like Hawaii-4, are able to produce runners. (B) Seasonal timing of floral initiation and flowering in SD and EB genotypes of F.
vesca. In EB genotypes, floral initiation and flowering occurs at the same time, whereas in SD genotype, flower initials are formed only in autumn and
flowers emerge during next growing season. (C, D) Environmental regulation of floral initiation (C) and runnering (D) in SD and EB genotypes of F.
vesca. White colour confers to the lack of response and dark colour represents strongest response. The figure highlights the opposite environmental
responses of EB and SD genotypes as well as antagonism between flowering and runnering.
tative growth of the rosette by forming branch crowns. ENVIRONMENTAL REGULATION OF

Under flowering inducing conditions, also branch crowns STRAWBERRY GROWTH
may initiate terminal inflorescences that leads to further
crown branching. Thus the number of crown branches Photoperiodic and temperature regulation of
directly affects the berry yield. Some meristems always flowering
remain vegetative, since branch crowns containing less than
2–4 leaf initials are yet not competent to initiate flowers Environmental regulation of flowering in strawberry has
(Arney 1953) enabling successive growth cycles in the been extensively explored for several decades, and the early
perennial life history of Fragaria. studies focusing mostly on garden strawberry have been
The antagonism between vegetative and generative reviewed by Guttridge (1985). According to these studies,
development is a common feature in perennial life history seasonal flowering cultivars of the garden strawberry are
where environmental control, most importantly photoperiod facultative SD plants, in which temperature modifies the
and temperature, have a major role. Several studies on octo- photoperiod dependence of flowering. In general, SD is
ploid garden strawberry (Fragaria x ananassa) as well as obligatory for flowering induction in temperatures over
on diploid woodland strawberry (Fragaria vesca) geno- ~15°C, whereas at lower temperatures, flowering is induced
types have revealed that control of flowering induction and independently of photoperiod. However, large genetic vari-
runner formation are almost mutually exclusive although it ation is found between different cultivars; the critical day
has been shown that they are genetically separate processes length for flowering induction can vary between 11 to 16 h
(e.g. Brown and Wareign 1965; Konsin et al. 2001; Heide and the number of SD cycles needed for induction between
and Sønsteby 2007). Thereby, detailed molecular level ana- 7 and 23 (Guttridge 1985). Moreover, photoperiodic flower-
lysis is needed to reveal the control mechanisms. Moreover, ing induction is highly dependent on temperature in some
continuously flowering everbearing (EB) mutants known cultivars, but may be controlled only by photoperiod in
for both species provide unique material for comparative other cultivars (Heide 1977; Sønsteby and Heide 2006).
genetic studies (Fig 1A, 1B). As discussed below, most Still, according to several studies, temperatures over 24–
recent molecular studies have especially taken advantage of 30°C and under 9°C are inhibitory to flowering (Heide
the simple diploid model F. vesca where development of 1977; Guttridge 1985; Sønsteby and Heide 2006).
advanced genetic tools including the genome sequence are As in garden strawberry, photoperiod and temperature
fast progressing (Shulaev et al. 2008, 2011). control flowering induction in F. vesca, although the role of
57
Strawberry flowering and runnering. Hytönen and Elomaa
temperature is more pronounced (Fig. 1C). This was clearly was truly day-neutral in temperatures from 9 to 27qC (Søn-
shown in a recent study, in which the environmental control steby and Heide 2008c). In contrast, F. chiloensis genotypes
of flowering induction was tested in Norwegian F. vesca originating from different latitudes had obligatory SD re-
populations originating from different latitudes (Heide and quirement for flowering at temperatures of 15-21qC, and
Sønsteby 2007). The critical photoperiod for flowering genotypes collected from Alaska and Chile were day-neut-
induction did not correlate with the origin of the plants, but ral at 9qC (Sønsteby and Heide 2009), as shown also in
the photoperiodic flowering induction was strongly affected Norwegian F. vesca (Heide and Sønsteby 2007). Thus, SD
by temperature. At 9°C flowering was induced in all photo- and low temperature requirement of flowering induction in
periods, at 15–18°C in photoperiods shorter that 16 h, the garden strawberry is probably inherited from F. chilo-
whereas at 21°C flowering induction did not occur at all. ensis and LD response of EB cultivars originates from F.
The remarkable similarity in the environmental control of virginiana (Sønsteby and Heide 2009). The environmental
flowering induction in a diploid F. vesca and octoploid control of flowering in other Fragaria species remains to be
garden strawberry suggests that similar genetic mechanisms analysed, although Sargent et al. (2004) reported that two
are responsible for photoperiodic and temperature regula- diploid species out of eight species tested, Fragaria nubi-
tion of flowering in these species. cola and F. viridis, have remontant flowering habit. The
After the induction of flowering, the apical meristems environmental regulation of flowering in diploid species
of the main crown and branch crowns are turned to inflo- should be carefully characterized and analysed by crossing
rescence meristems and flower initials begin to develop. In with F. vesca.
garden strawberry cvs. ‘Korona’ and ‘Elsanta’, photoperiod
controls meristem identity (Hytönen et al. 2004), whereas Environmental regulation of runnering
the rate of flower initiation is mainly controlled by tempera-
ture with an optimum of 18–20°C (Le Mière et al. 1996; Environmental conditions also control the differentiation of
Sønsteby and Heide 2008a). However, Sønsteby and Heide strawberry axillary buds to either runners or branch crowns.
(2006) showed that also LD promotes floral development In SD genotypes of the garden strawberry, LD and high
after flowering induction in ‘Korona’ and ‘Elsanta’ and temperature promote runner formation, whereas in SD,
stated that at least these cultivars are actually SD-LD plants. axillary buds differentiate into branch crowns increasing the
The dynamic regulation of meristem determination was number of meristems capable to initiate inflorescences and,
shown in a study by Hytönen et al. (2004), in which plants consequently, enhancing the cropping potential of the plants
of ‘Korona’ were subjected to SD – LD – SD regime. In this (Heide 1977; Konsin et al. 2001; Hytönen et al. 2004).
study, the first 3-week SD treatment induced crown bran- Hytönen et al. (2009) have studied the control of axillary
ching, but floral development took place only in the main bud differentiation in detail by using runner axillary buds of
crown, probably because the meristems of the branch ‘Korona’ (axillary bud #2) as a model system. In this study,
crowns had not reached the competence for floral initiation the axillary buds differentiated into branch crowns after 8–
during the first SD period. Furthermore, the subsequent LD 12 SD cycles in a 12-h photoperiod. Moreover, runner for-
most likely removed the flowering inducing signals. When mation occurred when the photoperiod exceeded a critical
the plants were subjected to a second SD treatment 4 weeks value that is close/equal to the critical photoperiod for
later, floral initiation took place in the apices of branch flowering induction (Konsin et al. 2001; Hytönen et al.
crowns that were formed in response to the first SD treat- 2009). Also in seasonally flowering F. vesca, runner forma-
ment. Moreover, plants exposed to continuous SD produced tion is similarly controlled by photoperiod and temperature
continuously crown branches with flower initials. These (Fig. 1D), but the response is much slower (Battey et al.
data indicate that mobile floral activators and/or inhibitors 1998; Heide and Sønsteby 2007). High temperature increa-
proposed earlier (Hartmann 1947; Guttridge 1959) are ses the number of runners also in the EB cultivars of the
dynamically regulated in strawberry, and contribute to the garden strawberry, but the effect of photoperiod has been
typical seasonal flowering response. Whether similar variable in different experiments (Sønsteby and Heide
flowering responses can be induced by temperature fluctu- 2007a, 2007b). In EB F. vesca, the control of runnering is
ations remains to be shown. clear-cut. Many genotypes do not form runners at all, but
Although most strawberry genotypes flower seasonally, for example in Hawaii-4, SD strongly enhances runner for-
continuously flowering everbearing (EB) genotypes and mation (Hytönen 2009). In general, EB genotypes produce
cultivars are known. In most studies, these plants are called less runners than SD genotypes (Sønsteby and Heide
day-neutral, since the effect of photoperiod on flowering 2007b), probably as a consequence of early floral initiation
time has been negligible or totally absent (Durner et al. of shoot apices, which enforces the differentiation of upper-
1984; Guttridge 1985; Nicoll and Galletta 1987). This view most axillary buds to branch crowns. In conclusion, op-
is now changing after recent findings that show clear LD posite control of flowering induction and runner formation
and high temperature promotion of flowering in several EB in various Fragaria genotypes indicates that these processes
cultivars of the garden strawberry and EB genotypes of F. are almost mutually exclusive. However, detailed molecular
vesca (Nishiyama and Kanahama 2002; Sønsteby and Heide level analysis is needed to confirm this hypothesis.
2007b, 2008b; Hytönen 2009). For example, LD grown
seedlings of five different EB genotypes of F. vesca pro- GENETICS OF FLOWERING AND RUNNERING
duced only ~5–8 leaves in the main crown before terminal
inflorescence, indicating that flowering induction occurs Inheritance of EB flowering habit and the presence or ab-
soon after germination (Hytönen 2009). In contrast, flower- sence of runners has been studied in Fragaria. Although
ing was delayed in plants raised for 5 weeks in SD at 18qC; flowering and runnering seem to be antagonistic processes,
they produced 4–5 leaves more before flowering than those Brown and Wareign (1965) showed in their fundamental
grown under LD (Mouhu et al. 2009). Moreover, low tem- crossing experiments that they are controlled by different
perature of 11qC caused further delay in flowering in genetic loci in F. vesca. They crossed two runnerless EB
Hawaii-4 genotype. Taken together, these data clearly show genotypes with a runnering seasonally flowering genotype
that EB genotypes of the garden strawberry and F. vesca are and found that all F1 individuals were seasonally flowering
LD plants that show opposite flowering response both to and produced runners. Moreover, in F2 and F1 x EB back-
photoperiod and temperature than the SD genotypes (Fig. cross populations, four different phenotypes, EB runnering,
1C). EB non-runnering, seasonally flowering runnering and sea-
Environmental regulation of flowering has been charac- sonally flowering non-runnering, showed simple Mendelian
terized also in the parents of the garden strawberry, F. vir- inheritance. In conclusion, both seasonal flowering and run-
giniana and F. chiloensis. In F. virginiana flowering is pro- nering are controlled by separate, dominant single genes,
moted by SD especially in higher temperature, except in the Seasonal flowering locus (SFL) and Runnering locus (RL),
genotype originating from Wasatch mountains (Utah) that respectively, and their recessive alleles cause the EB and
58
non-runnering phenotypes. conclusion that GA is one of the key signals mediating the
Also another gene locus, Arborea (ARB), has been daylength controlled axillary bud differentiation in straw-
shown to control runnering in “strawberry tree” mutant, F. berry (Hytönen et al. 2009). However, major regulatory
vesca arborea Staudt. This mutant has long internodes, it genes of axillary bud differentiation including RL remain to
continuously produces runners, whereas branch crowns are be identified.
lacking. In crossing experiments with EB ‘Baron Sole-
macher’, arb mutation was found to be recessive and MOLECULAR STUDIES ON ROSACEAE
epistatic to RL (Guttridge 1973). Since the phenotype of arb FLOWERING PATHWAYS
mutant resembles GA treated plants of ‘Baron Solemacher’,
ARB gene may encode some negative regulator of the GA Identification of key genes and understanding the molecular
pathway. mechanisms regulating growth and development in straw-
In contrast to F. vesca, the inheritance of EB flowering berry or more generally in Rosaceae is needed to enhance
habit in octoploid Fragaria is more complex. In some stu- breeding of new cultivars and to improve cultivation prac-
dies, EB flowering has been proposed to be controlled by a tises of these important species. Thorough studies on Arabi-
single dominant gene, but most studies favour the multiple dopsis thaliana flowering pathways have facilitated flower-
gene model (Ahmadi et al. 1990; Sakin et al. 1997; Han- ing gene discovery in Rosaceae. However, strawberry as a
cock et al. 2001; Serce and Hancock 2005). For example perennial short day plant is fundamentally different from
Weebadde et al. (2007) found eight QTLs associated with Arabidopsis which is an annual, long day plant. To which
EB flowering habit in their breeding population. However, extend and how the molecular mechanism regulating
they also found considerable variation in the number of EB flowering in these species differ is currently not known.
progenies, when plants were grown in different locations in
USA showing that EB flowering was highly dependent on Major flowering pathways in Arabidopsis thaliana
climatic conditions. These data, as well as the presence of
several sources of EB genes (Powers et al. 1954; Ahmadi et Four major genetic pathways to flowering are known in
al. 1990; Hancock et al. 2001), support the multiple gene Arabidopsis thaliana. Photoperiodic and vernalization path-
model in the regulation of EB habit in octoploid Fragaria. ways respond to environmental signals and autonomous and
Thus, it is unlikely that EB flowering habit in octoploid GA pathways control floral development according to deve-
genotypes is controlled by recessive alleles of SFL. How- lopmental and hormonal cues (Putterill et al. 2004; Simpson
ever, it is tempting to speculate that major EB genes are 2004; Thomas 2006; Zhou at al. 2007; Turck et al. 2008;
located in the same genetic pathway with SFL in octoploid Kim et al. 2009). These signals are integrated by a few
Fragaria. In fact, involvement of a single genetic pathway genes including FT (Flowering locus T) and SOC1 (Sup-
is also supported by the finding that several EB cultivars pressor of overexpression of Constans1), often referred to as
with different origin of EB genes show similar flowering floral integrators (Parcy 2005). The floral integrators, in
response to photoperiod and temperature (Sønsteby and turn, activate the floral meristem identity genes AP1 (Ape-
Heide 2007a, 2007b). tala1), FUL (Fruitfull) and LFY (Leafy) thereby initiating
flowering (Liu et al. 2009). CO (Constans) is a key regu-
GIBBERELLIN REGULATES AXILLARY BUD lator in the photoperiodic pathway, since it performs sea-
DIFFERENTIATION sonal time measurement by integrating endogenous rhythm
controlled by the circadian clock and external light signals
The role of gibberellins (GA) as regulators of strawberry perceived by phytochrome and cryptochrome photorecep-
runner development was suggested by Guttridge and tors (Yanovsky and Kay 2002; Valverde et al. 2004). In LD,
Thompson already in 1960’s. They showed that exogenous CO activates the expression of FT in the phloem companion
GA application activated runner growth in SD conditions cells, and FT protein travels to the meristem and induces
and was able to initiate runner development even in non- flowering in Arabidopsis (Corbesier et al. 2007; Turck et al.
runnering strawberry genotypes (Thompson and Guttridge 2008). Both autonomous and vernalization pathways cul-
1959; Guttridge and Thompson 1963). The importance of minate in a flowering inhibitor FLC (Flowering locus C),
GA as a regulator of axillary bud differentiation has been which in turn represses FT and SOC1 (Searle et al. 2006; Li
shown also by growth regulator applications. For example, et al. 2008). In vernalization pathway, a few protein com-
the inhibitor of GA biosynthesis, prohexadione-calcium, en- plexes control the expression of FLC by chromatin modi-
hances the formation of branch crowns instead of runners fications, and a long period of cold (vernalization) is needed
and consequently increases strawberry flowering and yield to silence FLC and consequently to reach the competence to
(Black 2004; Hytönen et al. 2008). flower (He 2009; Kim et al. 2009). Also the genes of the
Recent studies by Hytönen et al. (2009) showed that the autonomous pathway are needed to silence FLC (Simpson
changes in the axillary bud fate caused by prohexadione- 2004). In addition, a specific thermosensory and light qua-
calcium were associated with a rapid decline in the level of lity pathways has been found (Cerdán and Chory 2003; Lee
active GA1. The causality of reduced GA level for changes et al. 2007).
in axillary bud differentiation was verified by GA3 applica-
tion that completely reversed the effect of prohexadione- Characterization of Rosaceae flowering genes
calcium. GA analyses in SD and LD grown buds revealed
that branch crown initiation in SD was associated with Mouhu et al. (2009) applied EST sequencing of substracted
about 50% reduction in GA1 concentration in SD buds com- cDNA libraries for identification of candidate genes in-
pared to LD grown buds. More evidence for GA regulation volved in regulation of flowering. The libraries were cons-
of axillary bud differentiation came from gene expression tructed from shoot apexes of the SD F. vesca and the EB
studies. It was found that several GA biosynthetic, signaling genotype ‘Baron Solemacher’ (grown under LD conditions)
and target genes including GA3ox (GA3-oxidase), GA2ox with suppression subtractive hybridization (SSH) method to
(GA2-oxidase), GAI (Gibberellic acid insensitive), RGA enrich transcripts that may either promote or inhibit flower-
(Repressor of ga1-3), GID1b, SLY1 (Sleepy1), GAST (Gib- ing. Altogether 970 SD enriched ESTs and 1184 EB en-
berellic acid stimulated transcript) and XERICO, were riched ESTs were sequenced. Some candidate genes such as
affected by reduced GA1 levels in prohexadione-calcium floral integrator genes SOC1 and LFY were isolated using
treated plants, the phenomenon called GA signaling homeo- PCR approaches and, in addition, the sequence search was
stasis (Schwechheimer 2008). These genes were used as extended to identify all Arabidopsis flowering gene homo-
markers for the activity of the GA pathway and it was found logs present in the GDR Rosaceae EST database (Jung et al.
that most of them were similarly affected by SD in the 2004; 2007). In total, 88 candidate flowering genes were
axillary buds, indicating that GA signaling was reduced in identified in Rosaceae and 66 genes specifically from Fra-
SD grown buds compared to LD. These findings led to the garia (Mouhu et al. 2009), some of which are presented in
59
Table 1 Putative flowering time gene homologs identified from straw- for other species (Yano et al. 2000; Suárez-López et al.
berry. Sequences corresponding to Arabidopsis genes of different flower- 2001). However, the function of this CO homolog as a flo-
ing pathways are grouped. Biological functions of the proteins are shown ral regulator remains to be shown.
and activators and repressors are indicated by + and –, respectively, In addition to strawberry, the high economical impact of
according to the function of Arabidopsis proteins. See Mouhu et al. (2009) Rosaceae has promoted studies on regulation of flowering
for more detailed list of genes and their accession numbers. For the genes also in other species, such as peach, apple and rose. The
of the GA pathway, see Hytönen et al. (2009). evergrowing mutant (evg) of peach (Prunus persica L.
Gene Biological function Activator/ Batsch) shows non-dormant growth pattern and is not res-
Repressor ponding to short photoperiod or cold temperatures. Map-
Photoperiodic pathway ping and sequencing of the corresponding genomic region
phyA Red light photoreceptor + has revealed six clustered MICK-type MADS box genes (so
cry2 Blue light photoreceptor + called dormancy-associated MADS-box genes or DAM
LHY Myb domain transcription factor - genes) as candidates for EVG (Bielenberg et al. 2008; Li et
TOC1 pseudo response regulator - al. 2009). The expression of three of these was temporally
CO putative zinc finger transcription factor + correlating with seasonal elongation cessation and bud set
FKF1 F-box protein/blue light photoreceptor + (Li et al. 2009). DAM genes are members of SVP/
Vernalization pathway StMADS11/AGL24 clade that have been proposed to func-
VIN3 PHD domain protein + tion as general regulators of development of bud structures
VRN1 DNA binding protein + in various perennial species under dormancy-inducing con-
SUF4 putative zinc finger containing TF - ditions (Horvath 2009). Also in another species of Rosaceae,
ATX1 putative SET domain protein - Japanese apricot (Prunus mume Sieb. et Zucc.), SVP/
ELF8 RNA polymerase 2 associated factor -like - AGL24-type MADS box transcription factor has been iden-
VIP3 RNA polymerase 2 associated factor -like - tified as a candidate regulator of bud endodormancy
Autonomous and thermosensory pathway (Yamane et al. 2008).
FLK KH-type RNA domain containing + Studies in apple (Malus domestica) have identified
FY mRNA 3’ end processing factor + many putative flowering genes and more importantly, first
LD DNA/RNA binding homeodomain protein + reports demonstrating modification of flowering time in
LDL1 histone H3 lysine 4 demetylase -like + transgenic apple indicate their functional conservation and
SVP MADS-box transcription factor - usability in cultivar improvement (Jeong et al. 1999; Yao et
FVE retinoblastoma associated + al. 1999; Sung et al. 2000; Kotoda et al. 2000; Wada et al.
Gibberellin pathway 2002; Kotoda and Wada 2005; Hättasch et al. 2008; Mimida
GA20ox GA 20-oxidase + et al. 2009). The two LFY/FLO homologs, AFL1 and AFL2
GA3ox GA 3-oxidase + as well as the AP1 homologs MdMADS5 and MdMADS2
GA2ox GA 2-oxidase - accelerated flowering by ectopic expression in either Arabi-
GID1a Gibberellin receptor + dopsis or tobacco (Sung et al. 1999; Wada et al. 2002;
RGA putative transcriptional repressor - Kotoda et al. 2002). In contrast to these, ectopic expression
SPY O-linked N-acetylglucosamine transf. - of the TERMINAL FLOWER 1 (TFL1) homolog MdTFL1
Light quality pathway delayed flowering in Arabidopsis showing that the function
PFT1 vWF-A domain protein + of TFL genes in repression of flowering and maintenance of
HRB1 ZZ type zinc finger protein + inflorescence meristem is conserved between these two spe-
Floral integrator and identity genes cies (Kotoda et al. 2005; Mimida et al. 2009). Consequently,
SOC1 MADS box transcription factor + Kotoda et al. (2006) were able to substantially promote
LFY Transcription factor + flowering in transgenic apple trees by suppressing the
AP1 MADS box transcription factor + MdTFL1 expression using antisense gene constructs. In
comparison with controls that did not flower after five years,
the juvenile phase in transgenic lines was reduced and they
initiated flowering 8-25 months after transfer to a green-
Table 1. This analysis still failed to identify some central house.
genes such as FT, GI (Gigantea) and FLC (Mouhu et al. Perpetual or recurrent blooming is also common among
2009). Also Folta et al. (2005) reported few EST sequences roses (genus Rosa). Recurrent roses have a short juvenile
corresponding to Arabidopsis flowering time genes. More- phase in contrast to non-recurrent ones, as well as deter-
over, Stewart (2007) identified several CO like sequences minate versus in-determinate inflorescences, respectively.
and homologs for Arabidopsis MADS box genes involved Using EST sequencing in combination with gene mining of
in floral development. The identified genes correspond to rose sequences available in public databases, Foucher et al.
all known Arabidopsis flowering pathways although their (2008) identified 4765 unigene sequences among which 13
functional roles may eventually be modified or completely flowering related genes were present. Additional candidate
different. However, the genome sequence of F. vesca will genes representing all major flowering pathways were iden-
reveal the presence or absence of missing regulators. It will tified by Remay et al. (2009) using degenerate primers re-
also uncover whether some of the identified candidate genes sulting in total of 26 flowering genes with those previously
are located close to flowering related QTLs in cultivated identified by Foucher et al. (2008). They only failed in
strawberry, since effectively complete co-linearity has been identification of FLC. Earlier studies by Roberts et al.
found between the maps of cultivated strawberry and dip- (1999) indicated a major role for GA in regulation of
loid Fragaria (Rousseau-Gueutin et al. 2008; Sargent et al. flowering as exogenously applied GA inhibited flowering in
2009). non-recurrent roses. Remay et al. (2009) showed that the
Comparison of 25 selected candidate genes in Fragaria GA signalling gene RoSPY was mapped in vicinity of the
SD and EB genotypes by Mouhu et al. (2009) did not reveal recessive RECURRENT BLOOMING (RB) locus. Moreover,
major differences at the expression level and thus revealed comparison of gene expression between non-recurrent rose
no hints for putative location of SFL. However, the expres- and its recurrent mutant showed differences in GA signal-
sion of AP1 and LFY was correlated with induction of ling gene homolog RoGID1. However, the exact functional
flowering in the meristems of the EB genotype while AP1 roles of environmental signals (such as photoperiod) and
expression was completely lacking from the non-induced GA are yet to be verified.
SD genotype. Thereby, AP1 provides a useful marker gene In conclusion, molecular studies and identification of
for floral induction (Mouhu et al. 2009). Stewart (2007) stu- flowering pathways in Rosaceae are under active research
died the expression rhythm of strawberry CO homolog and in various species and the results obtained so far strongly
found a peak in the morning instead of evening peak typical suggest that the basic flowering gene network is highly con-
60
SDgenotype EBgenotype
Shortday Shortday
Inhibitor Inhibitor
Temp.<15qC Temp.<15qC
Longday? Flowering Flowering Longday

Hightemp? Hightemp.
Fig. 2 A hypothetical model of flowering pathways in Fragaria vesca (L.). Short day (SD) genotype has a dominant allele(s) of the major inhibitor
gene Seasonal flowering locus. Short photoperiod or alternatively low temperature is needed to suppress the function of SFL and consequently to induce
flowering. EB genotype, in contrast, does not require SD or low temperature for flowering, since it has non-functional alleles of SFL. In EB genotype,
flowering is induced at 1 – 2 leaf stage through a genetic pathway activated by long day (LD) and high temperature conditions. This pathway is expected
to be present also in SD genotype, but its role in the induction of flowering is unclear.
served. Thereby, it is reasonable to anticipate that this infor- 2009; Hytönen et al. unpublished data), and FLC function
mation provides us tools for modification of flowering in a has been shown only in Brassicaceae family (Searle et al.
controlled way. On the other hand, further research is still 2006; Wang et al. 2009), argues against the hypothesis that
needed to reveal the detailed molecular mechanisms and to SFL could be FLC-like gene. Moreover, strawberry flower-
clone the key genes behind the major flowering loci such as ing is induced by cool temperatures above 9°C, whereas
SFL in strawberry, RB in rose and EVG in peach. lower temperatures (winter chilling) needed for vernaliza-
tion promote vegetative development and inhibit flowering
SFL is a major regulator of flowering in F. vesca probably through reactivation of the SFL repressor (Ito and
Saito 1962; Battey 2000; Sønsteby and Heide 2006). In
The data reported by Mouhu et al. (2009) suggest that all contrast, several SVP-like genes are present in Rosaceae and
known flowering pathways are present in strawberry. How- contribute at least to the regulation of dormancy in peach
ever, despite the sequence conservation, the functional roles (Bielenberg et al. 2008). SVP homologs have also been
of different pathways and/or single genes may vary in dif- identified in strawberry (Mouhu et al. 2009), and its func-
ferent species. In F. vesca, the yet unknown SFL is a famous tion as a floral repressor is currently being tested by trans-
gene locus that obviously has a novel function. Recessive genic approaches (Mouhu et al. unpublished data).
alleles of this gene cause continuous flowering habit at least Since photoperiod controls flowering in strawberry,
in ‘Baron Solemacher’, an old European EB cultivar (Brown genes belonging to photoperiodic pathway are also candi-
and Wareign 1965; Albani et al. 2004), in which flowering dates for SFL. The most obvious candidate is CO, the heart
is promoted by LD and increasing temperature (Figs. 1A, 2) of the photoperiodic pathway that in Arabidopsis activates
(Sønsteby and Heide 2008b; Mouhu et al. 2009). In contrast, flowering in LD (Suárez-López et al. 2001; Yanovsky and
seasonal flowering habit of SD genotypes is probably due to Kay 2002). In contrast, in SD plant rice, CO homolog Hd1
dynamic regulation of active SFL alleles (Battey et al. represses flowering in LD but activates it in SD (Yano et al.
1998; Battey 2000). In fall, SD or temperature of 9-15qC is 2000). In principal, similar function would match perfectly
needed to activate floral initiation probably by repressing with the photoperiodic control of flowering in strawberry.
SFL (Fig. 1). However, no further floral initiation takes However, strawberry CO homolog has been cloned and
place in spring (Fig. 2), since winter chilling is thought to mapped to the Fragaria reference map, but it is not located
reactivate SFL. In conclusion, SFL is considered as a major close to SFL (Stewart 2007), indicating that other candi-
floral repressor in Fragaria that makes the difference dates should be searched. Another possibility is that straw-
between opposite flowering responses between the EB and berry CO homolog is an activator of flowering, in which
SD genotypes of F. vesca and probably contributes to the case SFL could be transcriptional or post-transcriptional
regulation of perennial growth cycle in this species. As such repressor of CO.
major gene, SFL provides a key for understanding the gene- Floral initiation in the garden strawberry and F. vesca
tic control of flowering and perennial growth cycle in F. can be suppressed by GA application (Thompson and Gutt-
vesca and probably in other species of Rosaceae family. ridge 1959; Guttridge and Thompson 1963) suggesting that
Positional cloning effort of SFL was presented by Battey et SFL could lie in the GA pathway. However, the role of
al. (1998), and his group reported the development of three endogenous GA as an inhibitor of flowering has only been
SCAR markers located close to SFL. Although, one of these analyzed indirectly by GA biosynthetic inhibitor applica-
markers, SCAR2, was inseparable from SFL in the crossing tions. The rapid drop of active GA levels by prohexadione-
population consisting of 1049 individuals (Albani et al. calcium (Hytönen et al. 2009) does not induce flowering
2004), no advance in the cloning of SFL has been reported and does not have clear effect on flowering time in garden
so far, and the location of these markers in Fragaria ref- strawberry or F. vesca (Hytönen et al. 2008, unpublished
erence map (Sargent et al. 2006) has not been published. data). Thus, these results indicate that the function of SFL is
Environmental control of flowering by repressor pro- not connected to down-regulation of the GA biosynthetic
teins is a common mechanism in many plant species. The pathway. In fact, no clear differences in the expression of
most well-known repressor mechanism is associated to ver- GA biosynthetic gene GA3ox and catabolic gene GA2ox
nalization pathway that has been studied in cereals and were found in the shoot apices of SD and EB genotypes
characterized in detail in Arabidopsis (Kim et al. 2009). In before flowering induction, but both genes were clearly
winter-annual Arabidopsis, vernalization involves the rep- down-regulated later during floral development (Mouhu et
ressor complex with MADS box proteins FLC and SVP. al. 2009). Taken together, it is unlikely that SFL lies in the
Long period of cool temperatures below 8°C (vernalization) GA pathway, at least if SFL is a ubiquitous repressor gene.
is needed for the silencing of FLC, and consequent attain- To directly test this hypothesis, GA-inducible reporter gene
ment of competence to flower (Li et al. 2008; Kim et al. should be expressed in SD and EB genotypes, and local GA
2009). FLC has been proposed to be one candidate for SFL activity shown by the reporter should be compared with the
(Battey 2000). However, the fact that no FLC homologs expression of floral marker gene AP1 (Mouhu et al. 2009)
were found among ~650 000 Rosaceae ESTs (Mouhu et al. under various environmental conditions.
61
Towards high throughput functional studies in of genotypic variation. Moreover, the use of GFP as a selec-
strawberry table marker allows rapid screening of transgenic seeds
after imbibition (Slovin et al. 2009).
The octoploid genome of cultivated strawberry is com- Folta et al. (2006) identified and selected a new, rapid-
plicating functional studies for identified genes as well as cycling and transformable octoploid line LF9 (Laboratory
strawberry breeding. However, rapidly developing molecu- Festival #9) for high throughput gene function studies in
lar tools, such as high throughput sequencing technology garden strawberry. LF9 was selected from the segregating
and improved genetic maps are extending our knowledge progeny obtained by self-pollination of ‘Strawberry Festi-
on strawberry genomics and consequently facilitate and val’ cultivar based on its vigorous growth in vitro, for its
form the basis for the improvement of agronomically im- high regeneration capacity and transformability. This freely
portant traits valued by the growers and the consumers. In available experimental genotype is being used for activa-
this respect, molecular studies using more simple models, tion-tagging and functional studies but it can also be used to
such as diploid F. vesca are of utmost importance. These promote functional studies using heterologous genes from
studies are enhanced by the small genome size of F. vesca other important species in Rosaceae that are not easily
that was defined to be only 164 Mb (Akiyama et al. 2001), transformed themselves or their functional studies are hin-
only slightly larger than that of Arabidopsis thaliana (125 dered due to long juvenile phases (e.g. tree crops) (Folta et
Mb). In fact, genome sequencing of F. vesca genotype al. 2006). Hanhineva and Kärenlampi (2007) applied tem-
Hawaii-4 was initiated in the spring 2008 at Virginia Tech, porary immersion bioreactors for regeneration of transgenic
USA (http://strawberry.vbi.vt.edu/tiki-index.php) and re- octoploid strawberry plants after standard Agrobacterium
cently finalized (Shulaev et al. 2011). cocultivation on semi-solid media. However, transformation
Until now, candidate gene mining from EST sequence frequency and speed was still far from what is needed in a
databases and/or by monitoring transcriptional changes high throughput system. Furthermore, for more rapid func-
using microarrays has been logical approach for identifica- tional analyses agroinfiltration methods to introduce RNAi
tion of strawberry genes associated with given traits. Still, constructs for gene silencing in F. x ananassa fruits have
the total number of ESTs for strawberry in public sequence been developed (Hoffmann et al. 2006). In conclusion, re-
databases is relatively limited, in fact less than 60 000 cent advances in developing functional genomics tools are
(http://www.ncbi.nlm.nih.gov/dbEST/dbEST_summary.htm truly bringing strawberry among the key model crops both
l). This number combines information obtained from con- in basic and applied research.
ventional cDNA library sequencing of both F. x ananassa
(Folta et al. 2005) and F. vesca (Mouhu et al. 2009; Brese CONCLUDING REMARKS
R., Davis T., Slovin J., unpublished data). However, recent
sequencing efforts with efficient pyrosequencing approaches Our understanding on the physiology of flowering and run-
evidently will change the situation in future (Hytönen et al. nering in F. vesca as well as in octoploid species F. × ana-
unpublished data; Folta pers. comm.). The publicly avail- nassa, F. virginiana and F. chiloensis has significantly prog-
able EST data for the whole Rosaceae family including ressed during last years. Also dozens of putative flowering
apple, cherry, peach, pear, raspberry, rose and strawberry, is time genes have been identified in strawberry and other spe-
much larger and together with Rosaceae maps and markers, cies of Rosaceae, and correlation between some candidate
the sequence data is collectively gathered in the Genome genes and floral initiation has been found. Moreover, phy-
Database for Rosaceae (GDR) to promote genomics and siological and molecular studies have revealed that GA is
genetics research (Jung et al. 2004; 2007, http:// one of the signals mediating photoperiodic control of axil-
www.rosaceae.org). lary bud differentiation to runners and branch crowns.
Efficient gene transfer methods are essential for the Despite these advances, the knowledge on the molecular
functional analysis of candidate genes identified by high mechanisms controlling flowering and runnering is still in
throughput genomics methods. Since 1990 large number of its infancy, since neither functional characterization nor
reports on genetic transformation of both octoploid and dip- map based cloning of responsible genes have been reported
loid strawberry genotypes has been published. Four recent in strawberry. However, identification of candidate genes
reviews are summarizing this progress in detail (Folta and provides groundwork for detailed characterization of regu-
Dhingra 2006; Debnath and Teixeira da Silva 2007; Que- latory pathways that are expected to be complex and inter-
sada et al. 2007; Qin et al. 2008). Most recent advances twined.
were reported by Oosumi et al. (2006) who has adapted the Recent advances in developing molecular tools inclu-
Agrobacterium-mediated gene transfer method for the ding efficient transformation methods, a new inbred line,
diploid Fragaria vesca. The method by Oosumi et al. dense genetic maps and the genome sequence, are making F.
(2006) applies very stringent hygromycin selection, a more vesca as an attractive model plant for strawberry and for
aggressive strain of Agrobacterium as well as green fluo- Rosaceae in general. Moreover, short life cycle of F. vesca
rescent protein (GFP) as a visual, selectable marker. Several makes it as a transcendent model among most perennials.
F. vesca accessions showed up to 100% transformation fre- Combined use of new genetics tools and state-of-the-art
quency and especially the cv. Hawaii-4 (PI551572) turned sequencing technologies in F. vesca will exponentially in-
out to be most potential with high efficiency in transfor- crease our knowledge about the molecular mechanisms
mation, ease handle in tissue culture and ex vitro as well as behind important horticultural traits. Ultimately, this infor-
short life cycle. Such efficiency allows high throughput mation will enhance the cultivar breeding of strawberry and
functional studies using reverse genetic approaches but also other species of the Rosaceae family through genetic trans-
development of T-DNA tagged mutant collections for for- formation and marker assisted selection breeding.
ward genetics. Based on Oosumi et al. (2006) 255,000
independent T-DNA transformed lines would be needed to ACKNOWLEDGEMENTS
mutate any single gene with the probability of 95%.
Although EB F. vesca genotypes are self-fertile and We would like to acknowledge the small fruit group at the Depart-
expected to be highly homozygous, Slovin et al. (2009) ment of Agricultural Sciences (Pauliina Palonen, Katriina Mouhu,
showed that single self-pollinated plants of ‘Yellow Won- Marja Rantanen and Elli Koskela) for their contribution to this
der’ produced progeny that still showed phenotypic varia- work and for valuable discussions. The strawberry research is
tion under uniform growth conditions. Therefore, they financially supported by the Ministry of Agriculture and Forestry
developed an inbred line of F. vesca f. semperflorens ‘Yel- and Academy of Finland.
low Wonder’ (YW5AF7) that can also be readily trans-
formed. This line allows the propagation of uniform plant
material by self pollination and accurate phenotyping of
transgenic seedlings, since the genetic background is void
62
REFERENCES the control of flowering of latitudinal and altitudinal populations of wild

strawberry (Fragaria vesca). Physiologia Plantarum 130, 280-289
Ahmadi H, Bringhurst RS, Voth V (1990) Modes of inheritance of photo- Hoffman T, Kalinowski G, Schwab W (2006) RNAi-induced silencing of gene
periodism in Fragaria. Journal of the American Society for Horticultural Sci- expression in strawberry fruit (Fragaria × ananassa) by agroinfiltration: a
ence 115, 146-152 rapid assay for gene function analysis. The Plant Journal 48, 818-826
Akiyama Y, Yamamoto Y, Ohmido N, Oshima M, Fukui K (2001) Estima- Horvath D (2009) Common mechanisms regulate flowering and dormancy.
tion of the nuclear DNA content of strawberries (Fragaria spp.) compared Plant Science 177, 523-531
with Arabidopsis thaliana by using dual-stem flow cytometry. Cytologia 66, Hytönen T, Palonen P, Mouhu K, Junttila O (2004) Crown branching and
431-436 cropping potential in strawberry (Fragaria × ananassa Duch.) can be en-
Albani M, Battey NH, Wilkinson MJ (2004) The development of ISSR- hanced by daylength treatments. Journal of Horticultural Science and Bio-
derived SCAR markers around the SEASONAL FLOWERING LOCUS (SFL) technology 79, 466-471
in Fragaria. Theoretical and Applied Genetics 109, 571-579 Hytönen T, Mouhu K, Koivu I, Junttila O (2008) Planting year prohexa-
Arney SE (1953) Studies of the growth and development of the genus Fragaria. dione-calcium treatment increases the cropping potential and yield of straw-
II. The initiation, growth and emergence of leaf primordia in Fragaria. An- berry (Fragaria × ananassa Duch.). European Journal of Horticultural Sci-
nals of Botany 17, 477-492 ence 73, 210-215
Battey NH (2000) Aspects of seasonality. Journal of Experimental Botany 51, Hytönen T (2009) Regulation of strawberry growth and development. PhD the-
1769-1780 sis. Dissertationes bioscientiarum molecularium Universitatis Helsingiensis
Battey N, Le Mière P, Tehranifar A, Cekic C, Taylor S, Shrives K, Hadley P, in Viikki, 7/2009, University Press, Helsinki, Finland, 131 pp
Greenland A, Darby J, Wilkinson M (1998) Genetic and environmental Hytönen T, Elomaa P, Moritz T, Junttila O (2009) Gibberellin mediates day-
control of flowering in strawberry. In: Cockshull KE, Gray D, Seymour GB, length controlled differentiation of vegetative meristems in strawberry (Fra-
Thomas B (Eds) Genetic and Environmental Manipulation of Horticultural garia × ananassa Duch.). BMC Plant Biology 9, 18
Crops, CAB International, Wallingford, United Kingdom, pp 111-131 Hättasch C, Flachowsky H, Kapturska D, Hanke M-V (2008) Isolation of
Bielenberg DG, Wang Y, Li Z, Zhebentyayeva T, Fan S, Reighard GL, flowering genes and seasonal changes in their transcript levels related to
Scorza R, Abbott AG (2008) Sequencing and annotation of the evergrowing flower induction and initiation in apple (Malus domestica). Tree Physiology
locus in peach [Prunus persica (L.) Batsch] reveals a cluster of six MADS- 28, 1459-1466
box transcription factors as candidate genes for regulation of terminal bud Ito H, Saito T (1962) Studies on the flower formation in the strawberry plants. I.
formation. Tree Genetics and Genomes 4, 495-507 Effects of temperature and photoperiod on the flower formation. Tohoku
Black BL (2004) Prohexadione-calcium decreases fall runners and advances Journal of Agricultural Research 13, 191-203
branch crowns of ‘Chandler’ strawberry in a cold-climate annual production Jeong D-H, Sung SK, An G (1999) Molecular cloning and characterization of
system. Journal of the American Society for Horticultural Science 129, 479- Constans-like cDNA clones of the Fuji apple. Journal of Plant Biology 42,
485 23-31
Brown T, Wareign PF (1965) The genetic control of the everbearing habit and Jung S, Jesudurai C, Staton M, Du Z, Ficklin S, Cho I, Abbott A, Tomkins
three other characters in varieties of Fragaria vesca. Euphytica 14, 97-112 J, Main D (2004) GDR (Genome Database for Rosaceae): integrated web
Cerdán PD, Chory J (2003) Regulation of flowering time by light quality. resources for Rosaceae genomics and genetics research. BMC Bioinformatics
Nature 423, 881-885 5, 130
Corbesier L, Vincent C, Jang S, Fornara F, Fan Q, Searle I, Giakountis, A, Jung S, Staton M, Lee T, Blenda A, Svancara R, Abbott A, Main D (2008)
Farrona S, Gissot L, Turnbull C, Coupland G (2007) FT protein move- GDR (Genome Database for Rosaceae): integrated web-database for Rosa-
ment contributes to long-distance signalling in floral induction of Arabidop- ceae genomics and genetics data. Nucleic Acids Research 36, D1034-D1040
sis. Science 316, 1030-1033 Kim D-H, Doyle MR, Sung S, Amasino RM (2009) Vernalization: Winter and
Debnath S, Teixeira da Silva JA (2007) Strawberry culture in vitro: Ap- the timing of flowering in plants. Annual Review of Cell Developmental Biol-
plications in genetic transformation and biotechnology. Fruit, Vegetable and ogy 25, 277-299
Cereal Science and Biotechnology 1, 1-12 Konsin M, Voipio I, Palonen P (2001) Influence of photoperiod and duration
Durner EF, Barden JA, Himelrick DG, Poling EB (1984) Photoperiod and of short-day treatment on vegetative growth and flowering of strawberry
temperature effects on flower and runner development in day-neutral, june- (Fragaria × ananassa Duch.). Journal of Horticultural Science and Biotech-
bearing and everbearing strawberries. Journal of the American Society for nology 76, 77-82
Horticultural Science 109, 396-400 Kotoda N, Wada M, Komori S, Kidou S, Abe K, Masuda T, Soejima J
Folta KM, Staton M, Stewart PJ, Jung S, Bies DH, Jesudurai C, Main D (2000) Expression pattern of homologues of floral meristem identity genes
(2005) Expressed sequence tags (ESTs) and simple sequence repeat (SSR) LFY and AP1 during flower development in apple. Journal of the American
markers from octoploid strawberry (Fragaria x ananassa). BMC Plant Biol- Society for Horticultural Science 125, 398-403
ogy 5, 12 Kotoda N, Wada M, Kusaba S, Kano-Murakami Y, Masuda T, Soejima J
Folta KM, Dhingra A, Howard L, Stewart PJ, Chandler CK (2006) Charac- (2002) Overexpression of MdMADS5, an APETALA1-like gene of apple,
terization of LF9, an octoploid strawberry genotype selected for rapid regene- causes early flowering in transgenic Arabidopsis. Plant Science 162, 679-687
ration and transformation. Planta 224, 1058-1067 Kotoda N, Wada M (2005) MdTFL1, a TFL1-like gene of apple, retards the
Folta KM, Dhingra A (2006) Transformation of strawberry: The basis for transition from the vegetative to reproductive phase in transgenic Arabidopsis.
translational genomics in Rosaceae. In Vitro Cellular and Developmental Plant Science 168, 95-104
Biology – Plant 42, 482-490 Kotoda N, Iwanami H, Takahashi S, Abe K (2006) Antisense expression of
Foucher F, Chevalier M, Corre C, Soufflet-Freslon V, Legeai F, Hibrand- MdTFL1, a TFL1-like gene, reduces the juvenile phase in apple. Journal of
Saint Oyant L (2008) New resources for studying the rose flowering process. the American Society for Horticultural Science 131, 74-81
Genome 51, 827-837 Lee JH, Yoo SJ, Park SH, Hwang I, Lee JS, Ahn JH (2007) Role of SVP in
Guttridge CG (1959) Further evidence for a growth-promoting and flower- the control of flowering time by ambient temperature in Arabidopsis. Genes
inhibiting hormone in strawberry. Annals of Botany 23, 612-621 and Development 21, 397-402
Guttridge CG (1973) Stem elongation and runnering in the mutant strawberry, Le Mière P, Hadley P, Darby J, Battey N (1996) The effect of temperature
Fragaria vesca L. arborea Staudt. Euphytica 22, 357-361 and photoperiod on the rate of flower initiation and onset of dormancy in the
Guttridge CG (1985) Fragaria u ananassa. In: Halevy A (Ed) CRC Handbook strawberry (Fragaria x ananassa Duch.). Journal of Horticultural Science
of Flowering (Vol III), CRC Press, Boca Raton, pp 16-33 and Biotechnology 71, 361-371
Guttridge CG, Thompson PA (1963) The effects of gibberellins on growth and Li D, Liu C, Shen L, Wu Y, Chen H, Robertson M, Helliwell CA, Ito T,
flowering of Fragaria and Duchesnea. Journal of Experimental Botany 15, Meyerowitz E, Yu H (2008) A repressor complex governs the integration of
631-646 flowering signals in Arabidopsis. Developmental Cell 15, 110-120
Hancock JF, Luby JJ, Dale A, Callow PW, Serce S, El-Shiek A (2001) Utili- Li Z, Reighard GL, Abbott AG, Bielenberg DG (2009) Dormancy-associated
zing wild Fragaria virginiana in strawberry cultivar development: Inheri- MADS genes from the EVG locus of peach [Prunus persica (L.) Batsch]
tance of photoperiod sensitivity, fruit size, gender, female fertility and disease have distinct seasonal and photoperiodic expression patterns. Journal of
resistance. Euphytica 126, 177-184 Experimental Botany 60, 3521-3530
Hanhineva KJ, Kärenlampi SO (2007) Production of transgenic strawberries Liu C, Thong Z, Yu H (2009) Coming into bloom: The specification of floral
by temporary immersion bioreactor system and verification by TAIL-PCR. meristems. Development 136, 3379-3391
BMC Biotechnology 7, 11 Mimida N, Kotoda N, Ueda T, Igarashi M, Hatsuyama Y, Iwanami H,
Hartmann HT (1947) Some effects of temperature and photoperiod on flower Moriya S, Abe K (2009) Four TFL1/CEN-like genes on distinct linkage
formation and runner production in the strawberry. Plant Physiology 22, 407- groups show different expression patterns to regulate vegetative and repro-
420 ductive development in apple (Malus × domestica Borkh.). Plant and Cell
He Y (2009) Control of the transition to flowering by chromatin modifications. Physiology 50, 394-412
Molecular Plant 2, 554-564 Mouhu K, Hytönen T, Folta K, Rantanen M, Paulin L, Auvinen P, Elomaa
Heide OM (1977) Photoperiod and temperature interactions in growth and P (2009) Identification of flowering genes in strawberry, a perennial SD plant.
flowering of strawberry. Physiologia Plantarum 40, 21-26 BMC Plant Biology 9, 122
Heide OM, Sønsteby A (2007) Interactions of temperature and photoperiod in Nicoll MF, Galletta GJ (1987) Variation in growth and flowering habits of
63
junebearing and everbearing strawberries. Journal of the American Society tional gene regulation in the control of Arabidopsis thaliana flowering time.
for Horticultural Science 112, 872-880 Current Opinion Plant Biology 7, 570-574
Nishiyama M, Kanahama K (2002) Effects of temperature and photoperiod on Slovin JP, Schmitt K, Folta KM (2009) An inbred line of the diploid straw-
flower bud initiation of day-neutral and everbearing strawberries. Acta Horti- berry Fragaria vesca f. semperflorens for genomic and molecular genetic
culturae 567, 253-255 studies in the Rosaceae. Plant Methods 5, 15
Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL Stewart PJ (2007) Molecular characterization of photoperiodic flowering in
Veilleux RE, Shulaev V (2006) High-efficiency transformation of the diploid strawberry (Fragaria sp.). PhD thesis, University of Florida, USA, 151 pp
strawberry (Fragaria vesca) for functional genomics. Planta 223, 1219-1230 Suárez-López P, Wheatley K, Robson F, Onouchi H, Valverde F, Coupland
Parcy M (2005) Flowering: A time for integration. International Journal of G (2001) CONSTANS mediates between the circadian clock and the control
Developmental Biology 49, 585-593 of flowering in Arabidopsis. Nature 410, 1116-1120
Powers L (1954) Inheritance of period of blooming in progenies of strawberries. Sung S-K, Yu G-H, An G (1999) Characterization of MdMADS2, a member of
Proceedings of the American Society for Horticultural Science 64, 293-298 the SQUAMOSA subfamily of genes, in apple. Plant Physiology 120, 969-
Putterill J, Laurie R, Macknight R (2004) It's time to flower: The genetic 978
control of flowering time. Bioessays 26, 363-373 Sung S-K, Yu G-H, Nam J, Jeong DH, An G (2000) Developmentally regu-
Qin Y, Teixeira da Silva JA, Zhang L, Zhang S (2008) Transgenic strawberry: lated expression of two MADS-box genes, MdMADS3 and MdMADS4, in the
State of the art for improved traits. Biotechnology Advances 26, 219-232 morphogenesis of flower buds and fruits in apple. Planta 210, 519-528
Quesada MA, Martín-Pizarro C, García-Gago JA, Posé S, Santiago N, Ses- Sønsteby A, Heide OM (2006) Dormancy relations and flowering of the straw-
mero R, Pliego-Alfaro F, Mercado JA (2007) Transgenic strawberry: Cur- berry cultivars Korona and Elsanta as influenced by photoperiod and tem-
rent status and future perspectives. Transgenic Plant Journal 1, 280-288 perature. Scientia Horticulturae 110, 57-67
Remay A, Lalanne D, Thouroude T, Le Couviour F, Hibrand-Saint Oyant L, Sønsteby A, Heide OM (2007a) Quantitative long-day flowering response in
Foucher F (2009) A survey of flowering genes reveals the role of gibberel- the perpetual-flowering F1 strawberry cultivar Elan. Journal of Horticultural
lins in floral control in rose. Theoretical and Applied Genetics 119, 767-781 Science and Biotechnology 82, 266-274
Roberts AV, Blake PS, Lewis R, Taylor JM, Dunstan DI (1999) The effect of Sønsteby A, Heide OM (2007b) Long-day control of flowering in everbearing
gibberellins on flowering in roses. Journal of Plant Growth Regulation 18, strawberries. Journal of Horticultural Science and Biotechnology 82, 875-
113-119 884
Rousseau-Gueutin M, Lerceteau-Köhler E, Barrot L, Sargent DJ, Monfort Sønsteby A, Heide OM (2008a) Temperature responses, flowering and fruit
A, Simpson D, Arús P, Guérin G, Denoyes-Rothan B (2008) Comparative yield of the June-bearing strawberry cultivars Florence, Frida and Korona.
genetic mapping between octoploid and diploid Fragaria species reveals a Scientia Horticulturae 119, 49-54
high level of colinearity between their genomes and the essentially disomic Sønsteby A, Heide OM (2008b) Long-day rather than autonomous control of
behaviour of the cultivated octoploid strawberry. Genetics 179, 2045-2060 flowering in the diploid everbearing strawberry Fragaria vesca ssp. semper-
Sakin M, Hancock JF, Luby JJ (1997) Identifying new sources of genes that florens. Journal of Horticultural Science and Biotechnology 83, 360-366
determine cyclic flowering in Rocky Mountain populations of Fragaria vir- Sønsteby A, Heide OM (2008c) Flowering physiology of populations of Fra-
giniana ssp. glauca Staudt. Journal of the American Society for Horticultural garia virginiana. Journal of Horticultural Science and Biotechnology 83,
Science 122, 205-210 641-647
Sargent DJ, Clarke J, Simpson DW, Tobutt KR, Arús P, Monfort A, Vila- Sønsteby A, Heide OM (2009) Environmental control of flowering and run-
nova S, Denoyes-Rothan B, Rousseau M, Folta KM, Bassil NV, Battey nering in three contrasting populations of Fragaria chiloensis. Journal of
NH (2006) An enhanced microsatellite map of diploid Fragaria. Theoretical Horticultural Science and Biotechnology 84, 267-272
and Applied Genetics 112, 1349-1359 Thomas B (2006) Light signals and flowering. Journal of Experimental Botany
Sargent DJ, Fernandéz-Fernandéz F, Ruiz-Roja JJ, Sutherland BG, Passey 57, 3387-3393
A, Whitehouse AB, Simpson DW (2009) A genetic linkage map of the cul- Thompson PA, Guttridge CG (1959) Effect of gibberellic acid on the initia-
tivated strawberry (Fragaria × ananassa) and its comparison to the diploid tion of flowers and runners in the strawberry. Nature 184, 72-73
Fragaria reference map. Molecular Breeding 24, 293-303 Turck F, Fornara F, Coupland G (2008) Regulation and identity of florigen:
Sargent DJ, Geibel M, Hawakins JA, Wilkinson MJ, Battey NH, Simpson FLOWERING LOCUS T moves central stage. Annual Review in Plant Biol-
DW (2004) Quantitative and qualitative differences in morphological traits ogy 59, 573-594
revealed between diploid Fragaria species. Annals of Botany 94, 787-796 Valverde F, Mouradov A, Soppe W, Ravenscroft D, Samach A, Coupland G
Schwechheimer C (2008) Understanding gibberellic acid signalling – are we (2004) Photoreceptor regulation of CONSTANS protein in photoperiodic
there yet? Current Opinion in Plant Biology 11, 9-15 flowering. Science 303, 1003-1006
Searle I, He Y, Turck F, Vincent C, Fornara F, Krober S, Amasino RA, Wada M, Cao Q-F, Kotoda N, Soejima J-I, Masuda T (2002) Apple has two
Coupland G (2006) The transcription factor FLC confers a flowering res- orthologues of FLORICAULA/LEAFY involved in flowering. Plant Molecu-
ponse to vernalization be repressing meristem competence and systemic sig- lar Biology 49, 567-577
nalling in Arabidopsis. Genes and Development 20, 898-912 Wang R, Farrona S, Vincent C, Joecker A, Schoof H, Turck F, Alonso-
Serce S, Hancock JF (2005) Inheritance of day-neutrality in octoploid species Blanco C, Coupland G, Albani MC (2009) PEP1 regulates perennial
of Fragaria. Journal of the American Society for Horticultural Science 130, flowering in Arabis alpine. Nature 459, 423-427
580-584 Weebadde CK, Wang D, Finn CE, Lewers KS, Luby JJ, Bushakra J, Sjulin
Shulaev V, Korban SS, Sosinski B, Abbott AG, Aldwinckle HS, Folta KM, TM, Hancock JF (2007) Using a linkage mapping approach to identify QTL
Iezzoni A, Main D, Arús P, Dandekar AM, Lewers K, Brown SK, Davis for day-neutrality in the octoploid strawberry. Plant Breeding 127, 94-101
TM, Gardiner SE, Potter D, Veilleux RE (2008) Multiple models for Rosa- Yamane H, Yukinobu K, Tomomi O, Ryutaro T, Yonemori K (2008) Sup-
ceae genomics. Plant Physiology 147, 985-1003 pression subtractive hybridization and differential screening reveals endodor-
Shulaev V, Sargent DJ, Crowhurst RN, Mockler TC, Folkerts O, Delcher mancy-associated expression of an SVP/AGL24-type MADS-box gene in
AL, Jaiswal P, Mockaitis K, Liston A, Mane SP, Burns P, Davis TM, lateral vegetative buds of Japanese apricot. Journal of the American Society
Slovin JP, Bassil N, Hellens RP, Evans C, Harkins T, Kodira C, Desany B, for Horticultural Science 133, 708-716
Crasta OR, Jensen RV, Allan AC, Michael, Setubal JC, Celton J-M, Rees Yano M, Katayose Y, Ashikari M, Yamanouchi U, Monna L, Fuse T, Baba T,
DJG, Williams KP, Holt SH, Ruiz Rojas JJ, Chatterjee M, Liu B, Silva H, Yamamoto K, Umehara Y, Nagamura Y, Sasaki T (2000) Hd1, a major
Meisel L, Adato A, Filichkin SA, Troggio M, Viola R, Ashman T-L, Wang photoperiod sensitivity quantitative trait locus in rice, is closely related to the
H, Dharmawardhana P, Elser J, Raja R, Priest HD, Bryant Jr DW, Fox Arabidopsis flowering time gene CONSTANS. Plant Cell 12, 2473-2484
SE, Givan SA, Wilhelm LJ, Naithani S, Christoffels A, Salama DY, Yanovsky MJ, Kay SA (2002) Molecular basis of seasonal time measurement
Carter J, Lopez Girona E, Zdepski A, Wang W, Kerstetter RA, Schwab in Arabidopsis. Nature 419, 308-312
W, Korban SS, Davik J, Monfort A, Denoyes-Rothan B, Arus P, Mittler Yao J-L, Dong Y-H, Kvarnheden A, Morris B (1999) Seven MADS-box
R, Flinn B, Aharoni A, Bennetzen JL, Salzberg SL, Dickerman AW, genes in apple are expressed in different parts of the fruit. Journal of the
Velasco R, Borodovsky M, Veilleux RE, Folta KM (2011) The genome of American Society for Horticultural Science 124, 8-13
woodland strawberry (Fragaria vesca). Nature Genetics 43, 109-116 Zhou Y, Sun X, Ni M (2007) Timing of photoperiodic flowering: Light percep-
Simpson GG (2004) The autonomous pathway: epigenetic and post-transcription and circadian clock. Journal of Integrative Plant Biology 9, 28-34
64
Recent Advances in Strawberry Metabolomics
Kati Hanhineva1* • Sirpa O. Kärenlampi2 • Asaph Aharoni3
1 Institute of Public Health and Clinical Nutrition, Department of Clinical Nutrition, University of Eastern Finland, P. O. Box 1627, FI-70211 Kuopio, Finland
2 Department of Biosciences, University of Eastern Finland, P. O. Box 1627, FI-70211 Kuopio, Finland
3 Department of Plant Sciences, Weizmann Institute of Science, P. O. Box 26, Rehovot 76100, Israel
Corresponding author: * kati.hanhineva@uef.fi
ABSTRACT
The recent developments in metabolomics technologies have facilitated a comprehensive examination of the rich chemical composition of
plants. Both gas and liquid chromatography based separation combined to high mass accuracy mass spectrometry as well as structural
elucidation utilizing 2D NMR are currently frequently applied in metabolite profiling approaches for various plant species, including
strawberry. With these technologies, the knowledge of the metabolite composition of strawberry has been expanded to include numerous
different derivatives of well-known metabolites. Furthermore, metabolite classes previously unknown for this species have been identified.
As in other plants, the array of natural products generated in different organs and cell layers of strawberry forms the basis for the chemical
defense and interaction with the environment. The same compounds, when consumed in the diet are responsible for the bioactivity
mediating beneficial health effects in humans. Strawberry produces large amounts of commonly occurring phenolic compounds such as
phenolic acids, flavonols and anthocyanidins. The early developmental stages of strawberry fruit are characterized by abundant accumula-
tion of proanthocyanidin polymers that protect the developing fruit against pests, and give an astringent taste rendering it unappealing for
consumption. One of the most abundant metabolite classes of strawberry fruit is ellagitannins, group of compounds restricted to a small
number of plant species. Ellagitannins are likely to contribute to the beneficial health effects claimed for strawberry, as these compounds
show e.g. anticarcinogenic activity in vitro. In this review we discuss the phytochemicals produced in the vegetative and reproductive
organs of strawberry, both in terms of the plant's physiology and as a constituent of the human diet. The metabolome of strawberry is
described in light of recent developments and application of cutting-edge analytical chemistry-based approaches for metabolomics
analysis of complex plant matrices.
_____________________________________________________________________________________________________________
Keywords: strawberry, Fragaria × ananassa, phytochemical, metabolite profiling, metabolomics, phenolic compounds
CONTENTS
INTRODUCTION........................................................................................................................................................................................ 65
METHODS USED FOR STRAWBERRY METABOLITE ANALYSIS ..................................................................................................... 65
STRAWBERRY METABOLITE COMPOSITION ..................................................................................................................................... 66
DEVELOPMENTAL EFFECTS ON STRAWBERRY METABOLITES .................................................................................................... 70
INFLUENCE OF ENVIRONMENTAL FACTORS AND GENETIC MODIFICATION ON STRAWBERRY METABOLITE
PRODUCTION ............................................................................................................................................................................................ 72
STRAWBERRY METABOLITES AS BENEFICIAL COMPONENTS IN THE DIET.............................................................................. 72
CONCLUSIONS.......................................................................................................................................................................................... 73
REFERENCES............................................................................................................................................................................................. 74
_____________________________________________________________________________________________________________
INTRODUCTION in strawberry. Metabolites classified as micronutrients such

as vitamin C and folate have been analysed to determine the
Strawberry, along with other fruits of the Rosaceae family nutritional quality of strawberry. These phytochemical ana-
including apples, pears, plums, peaches and raspberries, has lyses have served to develop a database for the nutritional
a particularly rich secondary metabolite composition. The composition and health considerations but have also in-
chemical profiles include hundreds of non-volatile and creased the knowledge about strawberry physiology. Both
volatile compounds, the latter ones being responsible for the aspects will be reviewed here.
typical fruit aroma bouquet. These metabolites have been
the subject of intensive investigations for decades. The METHODS USED FOR STRAWBERRY
focus has been either on a wide-range non-targeted meta- METABOLITE ANALYSIS
bolite profiling, quantification of specific metabolite classes,
or structural characterization of single phytochemicals. The By far the most frequently applied method in the analysis of
metabolites most frequently analyzed from strawberry were strawberry metabolite composition is Liquid Chromatog-
phenolic compounds such as phenolic acids, flavonols raphy Mass Spectrometry (LC-MS) coupled with UV detec-
(kaempferol and quercetin derivatives), anthocyanins (cya- tion (Määttä-Riihinen et al. 2004; Seeram et al. 2006b;
nidin and pelargonidin derivatives), proanthocyanidins, Aaby et al. 2007a; Hukkanen et al. 2007). The most recent
galloylglucoses and ellagitannins. Additionally, compounds applications, which combine efficient separation by Ultra
of the terpenoid class, some nitrogen-containing metabolites, Performance LC (UPLC) and accurate mass measurement
as well as various volatile metabolites have been identified with high-resolution mass spectrometers, allow qualitative
Received: 10 May, 2010. Accepted: 25 January, 2011.

i.e. the hydroxylated derivatives of benzoic and cinnamic

acids, which are frequently conjugated with sugars. They
serve as precursors for a wide array of secondary meta-
bolites including benzoates, salicylates, coumarins, lignans,
lignin and flavonoids. In strawberry fruit, the predominant
phenolic acid is coumaric acid present as glycosides (Mat-
tila et al. 2006). It is also found in other organs including
leaves (Hukkanen et al. 2007; Hanhineva et al. 2009a) and
flowers (Hanhineva et al. 2008). It may also be present as a
substituent in other compounds such as flavonols and sper-
Fig. 1 Confocal microscopic examination of A. Whole strawberry midines (Hanhineva et al. 2008). Other phenolic acids fre-
flower, B. Mature stamen. The fluorescent images were obtained with an quently detected in strawberry, especially in the fruit, are
Ultraview® confocal scanner (Perkin Elmer Life Sciences, Wallac-LSR, glucose derivatives of cinnamic, caffeic, ferulic and sinapic
Oxford, UK), on a Nikon Eclipse TE300 microscope (Nikon, Tokyo, acids (Table 1).
Japan). The wavelengths were: Green: excitation 488 nm, emission 525 All strawberry flavonoids contain a flavonoid backbone
nm; red: excitation 568 nm, emission 607 nm; blue: excitation 647 nm, hydroxylated in positions 3’ and/or 4’of the B-ring (Fig. 2).
emission 700 nm. In A wavelengths for only green and red were used. Unlike in many other flavonoid-rich plants, enzymatic acti-
vity for the hydroxylation of the B-ring 5’ position has not
been reported in strawberry, and thus the main flavonoid
analysis of over hundred compounds in a single run (Fait et metabolites are derivatives of the flavonols kaempferol and
al. 2008; Hanhineva et al. 2008). Gas Chromatography-MS quercetin, the anthocyanidins, cyanidin and pelargonidin,
(GC-MS) is widely used in the analysis of polar metabolites and the flavan 3-ols (epi)catechin and (epi)epiafzalechin. In
in derivatized extracts (often primary/central metabolites; planta, flavonoids do not normally occur as free aglycones
Fait et al. 2008) and aroma (volatile) compounds (Zabetakis but are decorated e.g. with sugars and phenolic acids (Table
and Holden 1997; Aubert et al. 2005). Nuclear Magnetic 1).
Resonance (NMR) spectroscopy has mainly been employed The presence of two metabolite groups with large
for unambiguous structure elucidation of strawberry sec- macromolecular structures, i.e. the proanthocyanidins (con-
ondary metabolites, often in combination with LC-MS densed tannins) and ellagitannins (hydrolyzable tannins) are
analysis (Ishimaru et al. 1995; Hirai et al. 2000; Hilt et al. typical to strawberry. The proanthocyanidins occur as linear
2003; Hanhineva et al. 2009b). molecules of the flavan 3-ol units (epi)catechin and (epi)af-
Several less common metabolite analysis techniques zalechin linked via a C4C8 bond (B-type interlinkage).
such as Fourier Transform Ion Cyclotron-MS (FTICR-MS; They are typically present as oligomers (Gu et al. 2003),
Aharoni et al. 2002) and Colloidal Graphite-Assisted Laser but also polymers as large as decamers have been reported,
Desorption/Ionization MS (GALDI, Zhang et al. 2007) especially at the early developmental stages of strawberry
have also been applied for strawberry. Direct Infusion MS fruit (Fait et al. 2008). A recent analysis of proanthocyani-
(DIMS) analysis has been demonstrated to be useful parti- dins showed variation both in the degree of polymerization
cularly in a quick comparison of the rich tannin signals in a and the quantity among fifteen strawberry cultivars (Buen-
large set of samples (McDougall et al. 2008). Laser-Induced día et al. 2010).
Fluorescence Spectroscopy (LIFS) has been tested as a non- Ellagitannins occur in plants much less frequently than
destructive method to characterize phenolic compounds in do proanthocyanidins but they are often produced by spe-
the surface of strawberry fruit (Wulf et al. 2008). Finally, cies in the Rosaceae family (Okuda et al. 1992). Unlike the
the autofluorescence of phenolic compounds can be used majority of phenolic compounds generated via the phenyl-
for simple visualization of differences in the composition of propanoid pathway, ellagitannins are synthesized from gal-
this metabolite class (Fig. 1). lic acid units that are intermediates in the shikimate path-
way (Gross 1994). Ellagitannins occur as a myriad of dif-
STRAWBERRY METABOLITE COMPOSITION ferent combinations of sugar core units with several con-
jugated gallic acid moieties, which can be further inter-
The array of phenolic secondary metabolites found in linked to form hexahydroxydiphenyl (HHDP) units (Fig. 2).
strawberry is listed in Table 1. Several large-scale, non- Qualitative analysis of strawberry ellagitannins is in its
targeted metabolite profiling studies have been carried out early stages but recent reports indicate that several parts of
on strawberry fruit (Aharoni et al. 2002; Määttä-Riihinen et the strawberry plant are rich in ellagitannins (Fait et al.
al. 2004; Seeram et al. 2006b; Aaby et al. 2007a; Fait et al. 2008; Hanhineva et al. 2008). The most abundant macro-
2008), flowers (Hanhineva et al. 2008) and leaves (Huk- molecular ellagitannins identified in strawberry fruit in-
kanen et al. 2007; Hanhineva et al. 2009a) by using LC-MS. clude lambertianin C, sanguiin H-6 and galloyl-bis-HHDP-
A number of studies have focused on specific metabolite glucose (Seeram et al. 2006b; Aaby et al. 2007a; Buendía et
classes, e.g. phenolic acids (Mattila and Kumpulainen 2002; al. 2010). The HHDP units are easily released from ellagi-
Mattila et al. 2006), ellagitannins (Okuda et al. 1992; Cerda tannins, leading to the formation of ellagic acid, which is
et al. 2005), anthocyanins (Nyman and Kumpulainen 2001; found in strawberry fruit together with various precursors of
Lopes da Silva et al. 2002; Koponen et al. 2007), proantho- ellagitannins, i.e. galloyl glucoses (Table 1).
cyanidins (Gu et al. 2003; Buendía et al. 2009; Hellström et In addition to the commonly occurring phenolic com-
al. 2009) and flavonols (Häkkinen and Auriola 1998). Seve- pounds, strawberry contains some metabolites that have re-
ral strawberry secondary metabolites have been identified ceived little attention, such as the phenylethyl derivatives of
based on structural elucidation with 2D NMR. These in- phenylpropanoids (Hanhineva et al. 2009a, 2009b). One of
clude, the characterization of phenylpropanoid derivatives the most intensively studied natural products, resveratrol,
(Hanhineva et al. 2009b); phloridzin (Hilt et al. 2003); 1-O- has been rarely reported in strawberry fruit and achenes
trans-cinnamoyl--D-glucopyranose (Latza et al. 1996); E- (Ehala et al. 2005; Wang et al. 2007). Resveratrol has never
cinnamic acid derivatives in the progenitor of the garden been found in strawberry in profiling studies, as it is most
strawberry (Fragaria chiloensis) (Cheel et al. 2005); ellagic likely present in detectable quantities only after induction or
acid derivatives (Heur et al. 1992); valerophenone deriva- after specific purification. The lignans secoisolariciresinol
tive (Tsukamoto et al. 2004); 5-carboxypyranopelargonidin and matairesinol were found in strawberry some years ago
(Andersen et al. 2004); anthocyanin-flavan-3-ol metabolites when their metabolism to enterolactone and enterodiol (lig-
(Fossen et al. 2004); taxifolin 3-arabinoside in strawberry nan derivatives formed in mammals from plant lignans by
roots (Ishimaru et al. 1995); and triterpenes (Hirai et al. intestinal bacteria) was studied by GC-MS (Mazur et al.
2000). 2000). An interesting flavonoid known to occur in straw-
The structurally simplest phenolics are phenolic acids, berries but rarely reported in metabolomics studies is fisetin,
66
Strawberry metabolomics. Hanhineva et al.
Table 1 Aromatic and phenolic metabolites reported in strawberry plants.

COMPOUND MW max (nm) Plant part Analytics Reference
Benzoic acid derivatives
benzoic acid 122 fruit FTMS 6
hydroxybenzoylhexose 300 262 fruit LC-MS 2, 21
hydroxybenzoic acid 138 fruit FTMS 6
vanillic acid 168 fruit FTMS 6, 21
di-hydroxybenzoquinone 140 fruit FTMS 6
di-hydroxy benzoic acid hexose 316 fruit LC-MS 21
Cinnamic acid derivatives
p-coumaric acid glucoside 326 264, 293 fruit, flower, leaf LC-MS 1, 19, 20, 22
p-coumaroyl hexose 326 236, 300sh,310 fruit LC-MS 1, 2, 3, 5
p-coumaroylhexose-4-O-hexoside 488 312 fruit LC-MS 2
p-coumaroyl-ester 356 235, 330 fruit LC-MS, NMR 3, 18
di-coumaroyl hexose 472 flower, leaf LC-MS 19, 20
caffeoylglucose, caffeic acid hexose 342 264, 300sh, 330 fruit, flower LC-MS 1, 19, 22
caffeate 180 fruit FTMS 6
ethyl cinnamate 176 fruit FTMS 6
methyl cinnamate 162 fruit FTMS 6
hydroxyferulate 210 fruit FTMS 6
4-coumarate 164 fruit FTMS 6
sinapyl alcohol 210 fruit FTMS 6
cinnamate glucose 310 fruit FTMS 6
cinnamoyl-xylopyranoside 280 284 fruit NMR 10
cinnamoyl-rhamnopyranoside 294 284 fruit NMR 10
cinnamoyl-xylofuranosyl-glucopyranose 442 284 fruit NMR 10
cinnamoyl-glucopyranoside 287 fruit NMR 14
chlorogenic acid 354 sh-323 flower, leaf, fruit LC-MS 19, 20, 22
ferulic acid hexose 356 sh-328 Flower, fruit LC-MS 19, 22
galloyl caffeoyl hexose 494 252, 367 flower LC-MS 19
galloyl coumaroyl hexose 478 flower, leaf LC-MS 19, 20
coumaroyl quinic acid 338 flower LC-MS 19
Phenylethyl derivatives of phenylpropanoid glucosides
hydroxyphenylethyl coumaroyl glucopyranoside (Eutigoside A) 446 311 fruit, leaf LC-MS 21, 22
hydroxyphenylethyl feruoyl glucopyranoside (Grayanoside A) 476 320 fruit, leaf LC-MS 21, 22
hydroxyphenylethyl caffeoyl glucopyranoside 462 leaf LC-MS 21
Gallic acid and ellagic acid derivatives
ellagic acid 4-pentoside 435 252, 362 fruit LC-MS 1
ellagic acid pentoside 434 254, 360 fruit, leaf, flower LC-MS 2, 5, 19
ellagic acid 302 252, 368 fruit, leaf, flower FTMS, LC-MS 1, 2, 3, 5, 6, 12, 19, 22
ellagic acid acetylpentoside 476 254, 358 fruit, leaf LC-MS 1
ellagic acid deoxyhexoside 448 254, 362 fruit, leaf, flower LC-MS 2, 5, 19, 22
methyl-ellagic acid pentose 448 250, 370 fruit LC-MS 3
ellagic acid hexose 464 flower, leaf LC-MS 5, 19
glucogallin, galloylglucose 332 276 fruit, leaf, flower FTMS, LC-MS 6, 19, 20, 22
galloylquinic acid 344 270 fruit, flower, leaf LC-MS 19, 20, 22
di-galloylquinic acid 496 fruit, flower LC-MS 19, 22
di-galloylglucose 484 276 flower LC-MS 19
tri-galloylglucose 636 272 fruit, flower, leaf LC-MS 19, 20, 22
tetra-galloylglucose 788 278 fruit, flower LC-MS 19, 22
penta-galloylglucose 940 277 fruit, flower, leaf LC-MS 19, 20, 22
Ellagitannins
HHDP-glucose 482 slope fruit, flower LC-MS 19, 22
bis-HHDP-glucose 784 232, slope fruit, leaf, flower LC-MS 2, 19, 20, 22
galloyl-HHDP-glucose 634 232, slope fruit, leaf, flower LC-MS 2, 21, 20, 22
HHDP-galloyl-glucose 634 300sh, 284 fruit LC-MS 2
galloyl-bis-HHDP-glucose 936 234 fruit, leaf LC-MS 2, 20, 22
di-galloyl HHDP glucose 786 270 fruit, flower LC-MS 19, 22
sanguiin H6 1870 260, 345 fruit LC-MS 3
sanguiin H10, (bis HHDP glucose)-dimer 1568 230, 280sh fruit, leaf LC-MS 5, 22
tri-galloyl-HHDP glucose 938 fruit, flower, leaf LC-MS 19, 20, 22
di(HHDP-galloylglucose)-pentose 1416 225 leaf LC-MS 5
casuarictin 936 225, 280sh fruit, flower, leaf LC-MS 5, 19, 22
trigalloyl-triHHDP-diglucose 1718 230, 280sh leaf LC-MS 5
potentillin 936 230, 260sh, fruit, flower, leaf LC-MS 5, 19, 20, 22
280sh
agrimoniin 1870 230, 260sh, fruit, flower, leaf LC-MS 5, 19, 20, 22
280sh
lambertiain C 2804 fruit LC-MS 22
pedungulagin root NMR 7
Chalcones
phloretin 274 fruit LC-MS, NMR 15
phloridzin 436 fruit LC-MS, NMR 15
naringenin/naringenin chalcone hexose 434 fruit LC-MS 22
67
Table 1 (Cont.)
Flavanones
dihydrokaempferol (aromadendrin) 288 fruit FTMS 6
dihydroquercetin (taxifolin) 304 fruit FTMS 6
taxifolin 3-arabinofuranoside 436 root NMR 7
eriodictyol hexose 450 fruit LC-MS 22
Flavones
apigenin 270 fruit GALDI-MS 16
apigenin glucoside 432 fruit GALDI-MS 16
Flavan-3-ols, proanthocyanidin
(+)-catechin 290 278/280 fruit, flower, leaf, FTMS, LC- 1, 2, 3, 6, 7, 19, 20, 22
root MS, NMR
(-)-epicatechin 290 278 fruit LC-MS 1, 22
(+)-afzelechin-catechin root NMR 7
dimer B2 578 278 fruit, leaf, flower LC-MS 1, 5, 19, 20, 22
proanthocyanidin B1 578 310,286 fruit LC-MS 2
proanthocyanidin B3 578 312sh, 284 fruit, root LC-MS, NMR 2, 7
procyanidin tetramer 1154 277 fruit, flower LC-MS 19, 22
procyanidin pentamer 1442 277 fruit, flower LC-MS 19, 22
proanthocyanidin trimer(EC-4,8-EC-4,8-C) 866 284 fruit, leaf, flower LC-MS 2, 19, 20, 22
procyanidin B6 root NMR 7
propelargonidin dimer (afz-cat) 562 277 fruit, flower LC-MS 17, 19, 22
propelargonidin trimer (afz-cat-cat) 850 276 fruit, flower LC-MS 17, 19, 22
propelargonidin tetramer (afz-cat-cat-cat) 1138 fruit LC-MS 22
propelargonidin trimer (afz-afz-cat) 834 fruit LC-MS 22
Flavonols
quercetin 3-glucoside (quercetin hexose) 464 354, 285 fruit, flower LC-MS, FTMS 1, 3, 6, 19
quercetin di-hexose 626 flower LC-MS 19
quercetin hexose glucuronide 640 260, 353 flower LC-MS 19
quercetin pentose glucuronide 610 255, 353 flower, leaf LC-MS 19, 20
quercetin 3-glucuronide 478 354, 258 fruit, leaf, flower LC-MS 1, 2, 3, 5, 19, 20, 22
quercetin 3-glucurone-deoxyhexoside 624 254, 300sh, 354 fruit LC-MS 1
quercetin-3-malonylglucoside, (quercetin malonylhexose) 550 256, 354 fruit, flower LC-MS 2, 19
quercetin-rutinoside (rutin) 610 255, 355 fruit LC-MS 3, 22
quercetin-deoxyhexose-hexose (not rutin) 610 255, 295sh, 350 leaf LC-MS 5
kaempferol 3-glucuronide 462 348, 265 fruit, leaf, flower LC-MS 1, 3, 5, 19, 20, 22
kaempferol-3-glucoside, kaempferol hexose 448 266, 348 fruit, flower LC-MS 2, 19, 22
kaempferol 3-malonylglucoside, kaempferol malonylhexose 534 266, 346 fruit, flower LC-MS 2, 5, 19, 22
kaempferol 3-coumaroylglucoside (tiliroside) 594 268, 314/250 fruit, leaf, flower LC-MS, NMR 2, 3, 11, 18, 19, 20, 22
kaempferol acetylhexose 490 fruit LC-MS 22
kaempferol di-hexose glucuronide 786 264, 345 flower LC-MS 19
kaempferol di-pentose hexose glucuronide 888 265, 345 flower LC-MS 19
kaempferol di-hexose 610 flower LC-MS 19
kaempferol hexose glucuronide 624 264, 344 flower, leaf LC-MS 19, 20
kaempferol pentose glucuronide 594 265, 345 flower, leaf LC-MS 19, 20
isorhamnetin hexose 478 fruit LC-MS 22
isorhamnetin 3-glucuronide 492 254, 300sh, 354 fruit, flower LC-MS 19, 22
isorhamnetin sophorose hexose 802 flower LC-MS 19
isorhamnetin di-hexose 640 253, 362 flower LC-MS 19
isorhamnetin rutinose 624 flower LC-MS 19
isorhamnetin hexose malonylhexose 726 253, 360 flower LC-MS 19
leucocyanidin 306 fruit FTMS 6
Anthocyanins
cyanidin 3-glucoside, (cyanidin hexose) 449 280, 516 fruit LC-MS, NMR, 1, 2, 3, 4, 6, 18, 22
FTMS
cyanidin hexose- deoxyhexoside 595 280, 516 fruit LC-MS 1
cyanidin 3-sophoroside 611 280, 516 fruit LC-MS 1
cyanidin 3-(2G-glucosylrutinoside) 757 280, 516 fruit LC-MS 1
cyanidin 3-rutinoside 595 280, 516 fruit LC-MS 1, 4
cyanidin 3-malonylglucose-5-glucose 697 524 fruit LC-MS 4
pelargonidin 3-glucoside 433 276, 504, 428sh fruit LC-MS, NMR, 1, 2, 3, 4, 5, 6, 8, 9, 18,
FTMS 22
pelargonidin 3-rutinoside 579 276, 504 fruit LC-MS, NMR 1, 3, 4, 18, 22
pelargonidin 3-malonylglucoside 519 276, 504, 430sh fruit LC-MS 1, 2, 5, 22
pelargonidin 3-succinylglucoside 533 276, 504 fruit LC-MS 1
5-pyranopelargonidin-3-glucoside 501 492, 358, 262sh fruit LC-MS 2
pelargonidin 3-malonylrhamnoside or 3-succinylarabinoside 503 280, 430sh, 506 fruit LC-MS 2
pelargonidin diglucoside 594/ 275, 520/500 fruit LC-MS 3, 4
595
pelargonidin 3-malylglucoside 549 503 fruit LC-MS 4
pelargonidin hexose pentose acylated with acetic acid 607 503 fruit LC-MS 4
pelargonidin 3-acetylglucoside 475 504 fruit LC-MS 4
catechin-4,8-pelargonidin-3-glucoside 721 518, 438 fruit NMR 8
epicatechin-4,8-pelargonidin-3-glucoside 721 518, 433 fruit NMR 8
68
Table 1 (Cont.)
Anthocyanins (Cont.)
afzelechin-4,8-pelargonidin-3-glucoside 516, 434 fruit NMR 8
epiafzelechin-4,8-pelargonidin-3-glucoside 705 520, 432 fruit NMR, LC-MS 8, 22
5-carboxypyranopelargonidin-3-glucoside 501 360, 496 fruit LC-MS, NMR 9
5-carboxpyranocyanidin-3-glucoside 517 278, 351, 505 fruit LC-MS, NMR 9
Phenolic polyamine derivatives
di-caffeoyl coumaroyl spermidine 615 218, 292 Flower LC-MS 19
caffeoyl di-coumaroyl spermidine 599 218, 292 Flower LC-MS 19
caffeoyl coumaroyl feruoyl spermidine 629 225, 301 Flower LC-MS 19
tri-coumaroyl spermidine 583 290 Flower LC-MS 19
di-coumaroyl feruoyl spermidine 613 292 Flower LC-MS 19
coumaroyl di-feruoyl spermidine 643 292 Flower LC-MS 19
Others
L-(+)-ascorbic acid 176 244 fruit FTMS, LC-MS 6, 2
quinic acid 192 225, 270 fruit, leaf FTMS, LC-MS 5, 6
gentisic/protocatechuic acid 154 fruit FTMS 6
N-propyl carbazole 209 fruit FTMS 6
3-methylcatechol 124 fruit FTMS 6
1,4-benzoquinone 1008 fruit FTMS 6
2-glucopyranosyloxy-4,6,-dihydroxyisovalerophone 372 225, 286 fruit NMR 11
trans-resveratrol 228 320 fruit LC-MS 13
cis-resveratrol 228 288 fruit LC-MS 13
3,4,5-trihydroxyphenyl acrylic acid fruit LC-MS 18
MW, molecular weight; HHDP, hexa-hydroxyl di-phenyl; afz, afzelechin; cat, catechin
References: 1: Määttä-Riihinen et al. 2004; 2: Aaby et al. 2007a; 3: Seeram et al. 2006b; 4: Lopes da Silva et al. 2002; 5: Hukkanen et al. 2007; 6: Aharoni et al. 2002; 7:
Ishimaru et al. 1995; 8: Fossen et al. 2004; 9: Andersen et al. 2004; 10: Cheel et al. 2005; 11: Tsukamoto et al. 2004; 12: Heur et al. 1992; 13: Wang et al. 2007; 14: Latza et
al. 1996; 15: Hilt et al. 2003; 16: Zhang et al. 2007; 17: Gu et al. 2003; 18: Zhang et al. 2008; 19: Hanhineva et al. 2008; 20: Hanhineva et al. 2009a; 21: Hanhineva et al.
2009b; 22: Fait et al. 2008.
Fig. 2 Chemical structures of typical strawberry secondary metabolites.
shown in animal testing to be a memory-boosting meta- gical role in plants is not fully resolved but they are sug-
bolite (Maher et al. 2006). gested to serve as antimicrobials and antifeedants (Osbourn
Triterpenoid saponins (glycosylated triterpenoids) are a 2003; Sparg et al. 2004). The analysis of this class of meta-
structurally diverse class of natural products. Their biolo- bolites in strawberry has not been particularly intensive,
69
Fig. 3 Total ion chromatograms of strawberry flower (upper panel), mature green leaf (middle panel) and root (lower panel) obtained by UPLC-
qTOF-MS analysis with ES(-) ionization. Examples of metabolites are indicated with MS/MS spectrum in ES(-).
although a few reports showed that at least the triterpenoids the volatile aroma compounds of strawberry, including
and their glucose derivatives are found in several straw- acids, alcohols, aldehydes, ketones, esters, lactones, acetals,
berry organs (Hirai et al. 2000; Fait et al. 2008; Hanhineva furans, sulphur containing compounds and terpenes have
et al. 2008). Interestingly, visual comparison of total ion been reviewed by Zabetakis and Holden (1997). A more
chromatograms of different strawberry organs indicates that recent report deals with common aroma volatiles during
the last few minutes in the chromatogram, which is the ripening of wild strawberry fruit (Gonzalez et al. 2009).
region in which saponins (triterpenoid glucosides) are typic-
ally eluted, is particularly rich in the roots (Fig. 3). DEVELOPMENTAL EFFECTS ON STRAWBERRY
Polyamines are nitrogenous compounds which can be METABOLITES
conjugated with small molecules such as phenolic acids.
These conjugates have been studied particularly in the flow- The phytochemical composition of plants is highly respon-
ers (Martin-Tanguy 1997), and were shown to be present as sive to internal and external stimuli. Thus, metabolite com-
different sets of phenolic acid conjugates (Hanhineva et al. position varies with the developmental stage, in different
2008). organs as well as in response to environmental perturbations
Compounds that contribute to the flavor and aroma of such as UV radiation and disease. A clear difference in the
ripe strawberry fruit, and several enzymes involved in their metabolite profile of various parts of the strawberry plant is
biosynthesis are well characterized (Aharoni et al. 2000; shown in Figs. 3 and 4. Interestingly, strawberry root ap-
Lunkenbein et al. 2006a). Terpenoids are among the most pears to contain a wide array of secondary metabolites but
important contributors to the aroma, and in cultivated straw- this organ has not been extensively studied, as only few
berry the monoterpene linalool and the sesquiterpene nero- papers mention the analysis of secondary metabolites in
lidol are the most characteristic compounds (Aharoni et al. strawberry root (Ishimaru et al. 1995; Aharoni et al. 2004).
2004). Additionally, many other methylated volatile deriva- The roots clearly represent an almost unexplored resource
tives of phenolic acid precursors synthesized in a branch of for phytochemical research of strawberry, as the total ion
phenylpropanoid pathway contribute to the aroma (Zabeta- chromatograms indicate that they are rich in semi-polar
kis and Holden 1997). The primary metabolite content and compounds (Figs. 3 and 4). In contrast to the roots, the phy-
70
Fig. 4 Total ion chromatograms of immature white strawberry fruit (upper panel) and mature red fruit (lower panel) obtained by UPLC-qTOF-
MS analysis with ES(-) ionization. Examples of metabolites are indicated with MS/MS spectrum in ES(-).
Fig. 5 Distribution of metabolites belonging to different metabolite classes in A. Strawberry fruit tissues (receptacle and achenes) and B. Floral
organs. The blocks in the columns represent the sum of the average peak areas (Y-axis) of all identified metabolites in non-targeted metabolite profiling
analysis.
tochemicals present in strawberry fruit have been described quantitative differences among different cultivars and
extensively. More than a hundred metabolites have been organs (Table 1 and references therein).
reported in the literature, showing both qualitative and One of the most extensively studied topics is the dif-
71
ferential production of metabolites during fruit development. in the central phenylpropanoid pathway was observed.
Alterations in fruit secondary metabolism are well documen- Among the accumulating metabolites was also a group of
ted and demonstrate a shift from the accumulation of the compounds that could not be unambiguously identified by
astringent proanthocyanidin polymers to coloured anthocya- LC-MS. These compounds were subsequently subjected to
nins during maturation, as well as several other distinct 2D-NMR analysis that led to the discovery of a yet uncha-
compositional changes (Aharoni et al. 2002; Kosar et al. racterized metabolite class in strawberry, i.e. the phenyl-
2004; Halbwirth et al. 2006; Fait et al. 2008). The amount ethanol derivatives of phenylpropanoid glucosides (Hanhi-
of phenylalanine is very high at the early stages of develop- neva et al. 2009b). This metabolite class is not well-defined
ment as it serves as a precursor for proanthocyanidins, and in plants, and clearly deserves more attention in the future.
its amount rises again at the very last stage of maturation
enabling the development of anthocyanin colouration (Aha- STRAWBERRY METABOLITES AS BENEFICIAL
roni et al. 2002; Halbwirth et al. 2006). Changes also occur COMPONENTS IN THE DIET
in the content of primary metabolites (Fait et al. 2008) as
well as in volatile aroma and flavour components in garden The importance of polyphenol-rich food in human health
strawberry (Menager et al. 2004) and its progenitor F. chilo- and prevention of diseases is well acknowledged, including
ensis (Gonzalez et al. 2009). Maximal volatile (e.g. fura- anticarcinogenicity as well as lowering the risk of cardio-
nones) production (Menager et al. 2004) as well as increase vascular diseases and other aging-induced malfunctions.
in esters (Gonzalez et al. 2009) take place in fully ripe red Especially ellagitannins have gained much attention because
fruit. The phenolic composition of strawberry achenes has of their anticarcinogenicity (Kuo et al. 2007; Ross et al.
been analysed separately from the fruit flesh (receptacle). It 2007). Strawberries are among the most important poly-
appears that the achenes are extremely rich in phenolics phenol sources both as fresh fruit and processed products
both qualitatively and quantitatively (Aaby et al. 2005, and could have vital effects on human health if consumed
2007b; Fait et al. 2008). regularly as part of a healthy diet (Hannum 2004; Zafra-
Hanhineva et al (2008) recently published a detailed Stone et al. 2007; Tulipani et al. 2009). Estimations have
characterization of the metabolites in the floral organs of been made about the phenolic content and intake of various
strawberry, which demonstrates the spatial distribution of food components in the diet, including the Finnish (Ovas-
different phytochemical classes and diverse derivatives of kainen et al. 2008), French (Brat et al. 2006) and American
each metabolite class in the different parts of the flower diets (Chun et al. 2005). In the French diet, strawberries and
(Fig. 5; Hanhineva et al. 2008). An overall difference in the apples are the main sources of polyphenols (Brat et al.
phenolic composition of strawberry floral organs is illus- 2006). Besides ellagitannins, the minor flavonoids in straw-
trated in Fig. 1; the autofluorescence of phenolics is clearly berry such as the flavonols kaempferol and quercetin, as
visible under fluorescence confocal microscopy, pointing well as their precursor phenolic acids are targets of inten-
out the different distribution among the organs and even sive research in terms of assessing their bioactivity and
organ compartments (as shown by the different colours in bioavailability, and they most likely contribute to the heath-
the anther and filament of the stamen in Fig. 1b). Various beneficial characteristics of strawberry.
flavonols as well as their sugar conjugates showed both The contents of several classes of polyphenol family
qualitative and quantitative differences (Hanhineva et al. and also of individual metabolites in strawberry consuma-
2008), suggesting that they play distinct roles in the flower. bles (i.e. food products) and fresh fruit are summarized in
Flavonols are known to play a central role in plant fertility, Table 2. Different studies include slightly different combi-
being essential for pollen tube germination (Mo et al. 1992; nations of compounds, and the results may also vary depen-
Ylstra et al. 1994). ding on the analytical method. Most often the content of
total phenolics has been estimated (Kähkönen et al. 2001;
INFLUENCE OF ENVIRONMENTAL FACTORS AND Ovaskainen et al. 2008; Vasco et al. 2009). Studies on the
GENETIC MODIFICATION ON STRAWBERRY contents of different phenolic classes include ellagitannins
METABOLITE PRODUCTION (Koponen et al. 2007), anthocyanins (Nyman and Kumpu-
lainen 2001; Koponen et al. 2007; Tulipani et al. 2008;
Phytochemicals are important for the adaptation of sessile Buendía et al. 2009), phenolic acids (Mattila and Kumpu-
plants to their changing environmental conditions. One of lainen 2002; Mattila et al. 2006) and proanthocyanidins
the most important roles of phenolic compounds in planta is (Buendía et al. 2009; Hellström et al. 2009). Although the
the protection against fungal and bacterial infections and studies were typically focused on fruit, strawberry leaves
other harmful environmental conditions such as UV radia- are also a rich source of phytochemicals that could have
tion. This has been demonstrated by the increase in phenolic potential e.g. in the development of food supplements, and
compounds in the leaves after treatment of strawberry should thus not be overlooked (Mudnic et al. 2009).
plants with benzothiadiazole, which induces natural plant The phenolic content of strawberry fruit decreases
defence (Hukkanen et al. 2007). On the other hand, when during industrial (Hartmann et al. 2008) and domestic
flavonoid synthesis was down regulated by genetic modifi- (Häkkinen et al. 2000a, 2000b) processing. Processing of
cation (suppression of CHALCONE SYNTHASE), the straw- juices and purees is a significant source of variation in the
berries had increased susceptibility to fungal infection, anthocyanin content as these compounds may undergo
which was suggested to be due to the depletion of flavonols structural changes caused by pH, light and oxidating en-
and other flavonoids (Hanhineva et al. 2009a). Antifungal zymes (Aaby et al. 2007; Hartmann et al. 2008). Processing
metabolites have been found among the volatile compounds also usually removes the achenes, which are a rich source of
(Arroyo et al. 2007), triterpenes (Hirai et al. 2000; Terry et e.g. ellagitannins both quantitatively (Aaby et al. 2005) and
al. 2004) and phenolics (Terry et al. 2004) of strawberry qualitatively (Fait et al. 2008). Even though the achenes
fruit. Preharvest conditions and treatments clearly affect the constitute only 1% of strawberry fresh weight, they account
levels of phenolic metabolites in strawberry (Anttonen et al. for 11% of total phenolics and 14% of antioxidative capa-
2006; Hukkanen et al. 2007; Wang et al. 2007). city (Aaby et al. 2005) which is an important point of con-
Metabolomics has proven indispensable in the charac- sideration for strawberry processing. The achenes also help
terisation of strawberries with genetically modified phenyl- to preserve the phenolic content and antioxidative capacity
propanoid pathway (Lunkenbein et al. 2006b; Hanhineva et of strawberry purees during storage (Aaby et al. 2007b).
al. 2009). A non-targeted profiling method was used to While the exact mechanisms and contributing com-
identify the changes that occurred in secondary metabolites pounds have not been fully resolved (Crozier et al. 2009),
following the transfer of a stilbene synthase-encoding gene the health-beneficial effects of polyphenol-rich fruits are
(Hanhineva et al. 2009a). Unexpectedly introduction of the most often ascribed to their antioxidative activity. However,
gene did not result in the production of resveratrol, but in strawberry fruit, ascorbic acid is the most important
rather the accumulation of several phenolic acid derivatives single contributor to the antioxidative capacity while among
72
Table 2 Content of phenolic compounds in strawberry.

Compounds Reported values Reference
Polyphenols in total
Finnish FCDB 178 mg/100 g Ovaskainen et al. 2007
strawberry jam 59 mg/100 g Ovaskainen et al. 2007
French consumption 268 mg of GAE/100 g FEP Brat et al. 2006
Ecuadorian 531 mg/kg FW Vasco et al. 2009
Finnish FCDB 1600-2410 mg/100 g DW Kähkönen et al. 2001
Total anthocyanin
fruit, nine cultivars 99-296 μg/g FW Tulipani et al. 2008
comparison of several studies 15-75 mg/100 g edible portion Rev. Lotito and Frei 2006
fruit 32-52 mg/100 g FW Koponen et al. 2007
strawberry jam 3 mg/100 g FW Koponen et al. 2007
flesh and achenes, freeze dried and puree 11-68 mg/100 g FW Aaby et al. 2005
fruit, three cultivars 195-232 mg/100 g DW Kähkönen et al. 2001
fruit, 15 cultivars 20-47 mg/100 g FW Buendia et al. 2010
Ellagitannins
fruit and achenes separately, freeze dried and puree 9-833 mg/100 g FW Aaby et al. 2005
fruit 68-85 mg/100 g FW Koponen et al. 2007
strawberry jam 25 mg/100 g FW Koponen et al. 2007
fruit, 15 cultivars 10-23 mg/100g FW Buendia et al. 2010
Proanthocyanidins
fruit and achenes separately, freeze dried and puree 10-32 mg/100 g FW Aaby et al. 2005
fruit 34-57 mg/100 g FW Hellström et al. 2009
strawberry jam 12 mg/100 g FW Hellström et al. 2009
Flavonols
Phenolic acids
fruit, three cultivars (hydroxycinnamic acid) 47-63 mg/100 g DW Kähkönen et al. 2001
fruit, three cultivars (hydroxybenzoic acid) 11-55 mg/100 g DW Kähkönen et al. 2001
fruit, 15 cultivars (p-coumaroyl glucose) 1-7 mg/100 g FW Buendia et al. 2010
fruit 10-18 mg/100 g FW Mattila et al. 2006
strawberry jam 12 mg/100 g FW Mattila et al. 2006
Phytoestrogens
Secoisolariciresinol 15046 μg/kg DW Mazur et al. 2000
Matairesinol 781 μg/kg DW Mazur et al. 2000
Other
folate 13-96 μg/100 g FW Rev. Tulipani et al. 2009
FW, fresh weight; DW, dry weight; FCDB, Finnish national food compositin database; GAE, gallic acid equivalent; FEP, fersh edible portion
the polyphenols, ellagitannins and anthocyanins exhibit the tant chemical constituents, such as vitamins and amino
strongest antioxidative properties (Scalbert et al. 2000; Yu acids. Among the most promising nutrients is folate, the
et al. 2005; Mertens-Talcott et al. 2006; Aaby et al. 2007a, content of which in strawberry is 10 to 100 μg/100 g fresh
2007b). Although the conclusive proof for the mechanism weight (reviewed in Tulipani et al. 2009). There are thus
of the proposed health-beneficial effects is lacking, new several reasons to include strawberries in a healthy diet.
evidences are emerging from in vitro studies on cell lines
showing antiproliferative effects on cancer cells (Olsson et CONCLUSIONS
al. 2006; Seeram et al. 2006a; Zhang et al. 2008) and anti-
bacterial activity on intestinal pathogens (Puupponen-Pimiä The recent year’s outcome of metabolite analyses using
et al. 2005; Nohynek et al. 2006) exposed to strawberry ex- metabolomics technologies provided a significant addition
tracts. to the existing data generated through targeted, less compre-
Polyphenols have relatively low biavailability (Lotito hensive analyses. While in most cases, particularly with
and Frei 2006; Korkina 2007). Most studies focus on the MS-based methods, the identification of various metabolites
soluble phenolic compounds that are readily absorbed from is not unambiguous, it still provides very valuable informa-
the fruit. Very few reports describe the importance of human tion for biological studies. However, minor constituents
colonic microbiota in the modification and absorption of the may have bioactivity and/or they can act synergistically
dietary polyphenols, including those from strawberry (del with the more abundant metabolites and it is therefore
Rio et al. 2009). It is known, however, that a large propor- essential to examine those compounds in detail as well. As
tion of the polyphenols is bound to the matrix (e.g. fiber) described above, the repertoire of strawberry secondary
and is released only by the activity of colonic microbiota. metabolites is enormous, varying from organ to organ, in
The few studies on strawberry metabolites include an ana- different tissues, and even from cell layer to layer. It is not
lysis of the formation of urolithin from ellagitannin pre- clear at this stage if all of these chemicals are crucial for the
cursors in strawberry-rich diet (Cerda et al. 2005), and the plant life cycle. Therefore, a major future challenge will be
production of important bioactive molecules from straw- to understand the role of this metabolite diversity in plant
berry lignans as a result of the activity of colonic micro- growth and fitness. The increasing knowledge about the
biota, as well as their urinary excretion after consumption composition of strawberry and other fruit species is also ex-
of strawberries (Mazur et al. 2000). pected to inspire new discoveries regarding the value of
While the majority of studies focus on phenolic com- strawberry and related species to human health and nut-
pounds, strawberry fruit contains other nutritionally impor- rition.
73
ACKNOWLEDGEMENTS AR, Aharoni A (2008) Reconfiguration of the achene and receptacle meta-
bolic networks during strawberry fruit development. Plant Physiology 148,
730-750
Dr. Kirsi Rilla is acknowledged for her assistance in the confocal
Fossen T, Rayyan S, Andersen OM (2004) Dimeric anthocyanins from straw-
microscopy. This work has been supported by funds from the berry (Fragaria ananassa) consisting of pelargonidin 3-glucoside covalently
NordForsk Nordic Centres of Excellence program “Food, Nut- linked to four flavan-3-ols. Phytochemistry 65, 1421-1428
rition and Health” HELGA-project (KH). A.A. is the incumbent of Gonzalez M, Gaete-Eastman C, Valdenegro M, Figueroa CR, Fuentes L,
the Adolpho and Evelyn Blum Career Development Chair of Can- Herrera R, Moya-Leon MA (2009) Aroma development during ripening of
cer Research. The work in the Aharoni lab was supported by the Y. Fragaria chiloensis fruit and participation of an alcohol acyltransferase
Leon Benoziyo Institute for Molecular Medicine at the Weizmann (FcAAT1) gene. Journal of Agricultural and Food Chemistry 57, 9123-9132
Institute of Science and the European Research Council (ERC) Gross GG (1994) In vitro studies on the biosynthesis of gallotannins and ellagi-
project SAMIT (FP7 program). tannins. Acta Horticulturae 381, 74-80
Gu L, Kelm MA, Hammerstone JF, Beecher G, Holden J, Haytowitz D,
Prior RL (2003) Screening of foods containing proanthocyanidins and their
REFERENCES structural characterization using LC-MS/MS and thiolytic degradation. Jour-
nal of Agricultural and Food Chemistry 51, 7513-7521
Aaby K, Ekeberg D, Skrede G (2007a) Characterization of phenolic com- Häkkinen SH, Kärenlampi SO, Mykkänen HM, Heinonen IM, Törrönen
pounds in strawberry (Fragaria × ananassa) fruits by different HPLC detec- AR (2000) Ellagic acid content in berries: Influence of domestic processing
tors and contribution of individual compounds to total antioxidant capacity. and storage. European Food Research and Technology 212, 75-80
Journal of Agricultural and Food Chemistry 55, 4395-4406 Häkkinen SH, Kärenlampi SO, Mykkänen HM, Törrönen AR (2000) Influ-
Aaby K, Skrede G, Wrolstad RE (2005) Phenolic composition and antioxidant ence of domestic processing and storage on flavonol contents in berries.
activities in flesh and achenes of strawberries (Fragaria × ananassa). Jour- Journal of Agricultural and Food Chemistry 48, 2960-2965
nal of Agricultural and Food Chemistry 53, 4032-4040 Häkkinen S, Auriola S (1998) High-performance liquid chromatography with
Aaby K, Wrolstad RE, Ekeberg D, Skrede G (2007b) Polyphenol composi- electrospray ionization mass spectrometry and diode array ultraviolet detec-
tion and antioxidant activity in strawberry purees; impact of achene level and tion in the identification of flavonol aglycones and glycosides in berries.
storage. Journal of Agricultural and Food Chemistry 55, 5156-5166 Journal of Chromatography A 829, 91-100
Aharoni A, Keizer LC, Bouwmeester HJ, Sun Z, Alvarez-Huerta M, Ver- Halbwirth H, Puhl I, Haas U, Jezik K, Treutter D, Stich K (2006) Two-phase
hoeven HA, Blaas J, van Houwelingen AM, De Vos RC, van der Voet H, flavonoid formation in developing strawberry (Fragaria × ananassa) fruit.
Jansen RC, Guis M, Mol J, Davis RW, Schena M, van Tunen AJ, O'Con- Journal of Agricultural and Food Chemistry 54, 1479-1485
nell AP (2000) Identification of the SAAT gene involved in strawberry flavor Hanhineva K, Kokko H, Siljanen H, Rogachev I, Aharoni A, Kärenlampi
biogenesis by use of DNA microarrays. The Plant Cell 12, 647-662 SO (2009) Stilbene synthase gene transfer caused alterations in the phenyl-
Aharoni A, Ric de Vos CH, Verhoeven HA, Maliepaard CA, Kruppa G, propanoid metabolism of transgenic strawberry (Fragaria × ananassa). Jour-
Bino R, Goodenowe DB (2002) Nontargeted metabolome analysis by use of nal of Experimental Botany 60, 2093-2106
Fourier Transform Ion Cyclotron Mass Spectrometry. Omics: A Journal of Hanhineva K, Rogachev I, Kokko H, Mintz-Oron S, Venger I, Kärenlampi
Integrative Biology 6, 217-234 S, Aharoni A (2008) Non-targeted analysis of spatial metabolite composition
Aharoni A, Giri AP, Verstappen, FWA, Bertea CM, Sevenier R, Sun Z, in strawberry (Fragaria × ananassa) flowers. Phytochemistry 69, 2463-2481
Jongsma, MA, Schwab W, Bouwmeester HJ (2004) Gain and loss of fruit Hanhineva K, Soininen P, Anttonen MJ, Kokko H, Rogachev I, Aharoni A,
flavor compounds produced by wild and cultivated strawberry species. The Laatikainen R, Kärenlampi S (2009) NMR and UPLC-qTOF-MS/MS cha-
Plant Cell 16, 3110-3131 racterisation of novel phenylethanol derivatives of phenylpropanoid gluco-
Andersen OM, Fossen T, Torskangerpoll K, Fossen A, Hauge U (2004) sides from the leaves of strawberry (Fragaria × ananassa cv. Jonsok). Phyto-
Anthocyanin from strawberry (Fragaria × ananassa) with the novel aglycone, chemical Analysis 20, 353-364
5-carboxypyranopelargonidin. Phytochemistry 65, 405-410 Hannum SM (2004) Potential impact of strawberries on human health: A re-
Anttonen MJ, Hoppula KI, Nestby R, Verheul MJ, Karjalainen RO (2006) view of the science. Critical Reviews in Food Science and Nutrition 44, 1-17
Influence of fertilization, mulch color, early forcing, fruit order, planting date, Hartmann A, Patz CD, Andlauer W, Dietrich H, Ludwig M (2008) Influence
shading, growing Environment, and genotype on the contents of selected of processing on quality parameters of strawberries. Journal of Agricultural
phenolics in strawberry (Fragaria × ananassa Duch.) fruits. Journal of Agri- and Food Chemistry 56, 9484-9489
cultural and Food Chemistry 54, 2614-2620 Hellström JK, Törrönen AR, Mattila PH (2009) Proanthocyanidins in com-
Arroyo FT, Moreno J, Daza P, Boianova L, Romero F (2007) Antifungal mon food products of plant origin. Journal of Agricultural and Food Che-
activity of strawberry fruit volatile compounds against Colletotrichum acu- mistry 57, 7899-7906
tatum. Journal of Agricultural and Food Chemistry 55, 5701-5707 Heur YH, Zeng W, Stoner GD, Nemeth GA, Hilton B (1992) Synthesis of el-
Aubert C, Baumann S, Arguel H (2005) Optimization of the analysis of flavor lagic acid O-alkyl derivatives and isolation of ellagic acid as a tetrahexanoyl
volatile compounds by liquid-liquid microextraction (LLME). Application to derivative from Fragaria ananassa. Journal of Natural Products 55, 1402-
the aroma analysis of melons, peaches, grapes, strawberries, and tomatoes. 1407
Journal of Agricultural and Food Chemistry 53, 8881-8895 Hilt P, Schieber A, Yildirim C, Arnold G, Klaiber I, Conrad J, Beifuss U,
Brat P, George S, Bellamy A, Du Chaffaut L, Scalbert A, Mennen L, Ar- Carle R (2003) Detection of phloridzin in strawberries (Fragaria × ananassa
nault N, Amiot MJ (2006) Daily polyphenol intake in France from fruit and Duch.) by HPLC-PDA-MS/MS and NMR spectroscopy. Journal of Agricul-
vegetables. The Journal of Nutrition 136, 2368-2373 tural and Food Chemistry 51, 2896-2899
Buendía B, Gil MI, Tudela JA, Gady AL, Medina JJ, Soria C, López JM, Hirai N, Sugie M, Wada M, Lahlou EH, Kamo T, Yoshida R, Tsuda M, Ohi-
Tomás-Barberán FA (2010) HPLC-MS analysis of proanthocyanidin oligo- gashi H (2000) Triterpene phytoalexins from strawberry fruit. Bioscience,
mers and other phenolics in 15 strawberry cultivars. Journal of Agricultural Biotechnology, and Biochemistry 64, 1707-1712
and Food Chemistry 58, 3916-3926 Hukkanen AT, Kokko HI, Buchala AJ, McDougall GJ, Stewart D, Kären-
Cerda B, Tomas-Barberan FA, Espin JC (2005) Metabolism of antioxidant lampi SO, Karjalainen RO (2007) Benzothiadiazole induces the accumula-
and chemopreventive ellagitannins from strawberries, raspberries, walnuts, tion of phenolics and improves resistance to powdery mildew in strawberries.
and oak-aged wine in humans: Identification of biomarkers and individual Journal of Agricultural and Food Chemistry 55, 1862-1870
variability. Journal of Agricultural and Food Chemistry 53, 227-235 Ishimaru K, Omoto T, Asai I, Ezaki K, Shimomura K (1995) Taxifolin 3-
Cheel J, Theoduloz C, Rodriguez J, Saud G, Caligari PD, Schmeda-Hirsch- arabinoside from Fragaria × ananassa. Phytochemistry 40, 345-347
mann G (2005) E-cinnamic acid derivatives and phenolics from Chilean Kähkönen MP, Hopia AI, Heinonen M (2001) Berry phenolics and their anti-
strawberry fruits, Fragaria chiloensis ssp. chiloensis. Journal of Agricultural oxidant activity. Journal of Agricultural and Food Chemistry 49, 4076-4082
and Food Chemistry 53, 8512-8518 Koponen JM, Happonen AM, Mattila PH, Törrönen AR (2007) Contents of
Chun OK, Kim D, Smith N, Schroeder D, Han JT, Lee CY (2005) Daily anthocyanins and ellagitannins in selected foods consumed in Finland. Jour-
consumption of phenolics and total antioxidant capacity from fruit and vege- nal of Agricultural and Food Chemistry 55, 1612-1619
tables in the American diet. Journal of the Science of Food and Agriculture Korkina LG (2007) Phenylpropanoids as naturally occurring antioxidants:
85, 1715-1724 From plant defense to human health. Cellular and Molecular Biology (Noisy-
Crozier A, Jaganath IB, Clifford MN (2009) Dietary phenolics: Chemistry, le-Grand, France) 53, 15-25
bioavailability and effects on health. Natural Product Reports 26, 1001-1043 Kosar M, Kafkas E, Paydas S, Baser KH (2004) Phenolic composition of
del Río D, Costa LG, Lean ME, Crozier A (2010) Polyphenols and health: strawberry genotypes at different maturation stages. Journal of Agricultural
What compounds are involved? Nutrition, Metabolism, and Cardiovascular and Food Chemistry 52, 1586-1589
Diseases 20, 1-6 Kuo PL, Hsu YL, Lin TC, Tzeng WS, Chen YY, Lin CC (2007) Rugosin E,
Ehala S, Vaher M, Kaljurand M (2005) Characterization of phenolic profiles an ellagitannin, inhibits MDA-MB-231 human breast cancer cell proliferation
of Northern European berries by capillary electrophoresis and determination and induces apoptosis by inhibiting nuclear factor-kappaB signaling pathway.
of their antioxidant activity. Journal of Agricultural and Food Chemistry 53, Cancer Letters 248, 280-291
6484-6490 Latza S, Gansser D, Berger RG (1996) Identification and accumulation of 1-
Fait A, Hanhineva K, Beleggia R, Dai N, Rogachev I, Nikiforova VJ, Fernie O-trans-cinnamoyl--D-glucopyranose in developing strawberry fruit (Fra-
74
garia ananassa Duch. cv. Kent). Journal of Agricultural and Food Chemistry by extracts from organically and conventionally cultivated strawberries. Jour-
44, 1367-1370 nal of Agricultural and Food Chemistry 54, 1248-1255
Lopes da Silva F, de Pascual TS, Rivas-Gonzalo J, Santos-Buelga C (2002) Osbourn AE (2003) Saponins in cereals. Phytochemistry 62, 1-4
Identification of anthocyanin pigments in strawberry (cv. Camarosa) by LC Ovaskainen ML, Törrönen R, Koponen JM, Sinkko H, Hellström J, Rei-
using DAD and ESI-MS detection. European Food Research and Technology nivuo H, Mattila P (2008) Dietary intake and major food sources of poly-
214, 248-253 phenols in Finnish adults. The Journal of Nutrition 138, 562-566
Lotito SB, Frei B (2006) Consumption of flavonoid-rich foods and increased Puupponen-Pimiä R, Nohynek L, Hartmann-Schmidlin S, Kähkönen M,
plasma antioxidant capacity in humans: Cause, consequence, or epiphenome- Heinonen M, Määttä-Riihinen K, Oksman-Caldentey KM (2005) Berry
non? Free Radical Biology and Medicine 41, 1727-1746 phenolics selectively inhibit the growth of intestinal pathogens. Journal of
Lunkenbein S, Bellido M, Aharoni A, Salentijn EM, Kaldenhoff R, Coiner Applied Microbiology 98, 991-1000
HA, Munoz-Blanco J, Schwab W (2006a) Cinnamate metabolism in ripen- Ross HA, McDougall GJ, Stewart D (2007) Antiproliferative activity is pre-
ing fruit. Characterization of a UDP-glucose:cinnamate glucosyltransferase dominantly associated with ellagitannins in raspberry extracts. Phytoche-
from strawberry. Plant Physiology 140, 1047-1058 mistry 68, 218-228
Lunkenbein S, Coiner H, de Vos CH, Schaart JG, Boone MJ, Krens FA, Scalbert A, Deprez S, Mila I, Albrecht AM, Huneau JF, Rabot S (2000) Pro-
Schwab W, Salentijn EM (2006b) Molecular characterization of a stable anthocyanidins and human health: Systemic effects and local effects in the
antisense chalcone synthase phenotype in strawberry (Fragaria × ananassa). gut. BioFactors (Oxford, England) 13, 115-120
Journal of Agricultural and Food Chemistry 54, 2145-2153 Seeram NP, Adams LS, Zhang Y, Lee R, Sand D, Scheuller HS, Heber D
Määttä-Riihinen KR, Kamal-Eldin A, Törrönen AR (2004) Identification (2006a) Blackberry, black raspberry, blueberry, cranberry, red raspberry, and
and quantification of phenolic compounds in berries of Fragaria and Rubus strawberry extracts inhibit growth and stimulate apoptosis of human cancer
species (family Rosaceae). Journal of Agricultural and Food Chemistry 52, cells in vitro. Journal of Agricultural and Food Chemistry 54, 9329-9339
6178-6187 Seeram NP, Lee R, Scheuller HS, Heber D (2006b) Identification of phenolic
Maher P, Akaishi T, Abe K (2006) Flavonoid fisetin promotes ERK-dependent compounds in strawberries by liquid chromatography electrospray ionization
long-term potentiation and enhances memory. Proceedings of the National mass spectroscopy. Food Chemistry 97, 1-11
Academy of Sciences USA 103, 16568-16573 Sparg SG, Light ME, van Staden J (2004) Biological activities and distribu-
Martin-Tanguy J (1997) Conjugated polyamines and reproductive develop- tion of plant saponins. Journal of Ethnopharmacology 94, 219-243
ment: Biochemical, molecular and physiological approaches. Physiologia Terry LA, Joyce DC, Adikaram NKB, Khambay BPS (2004) Preformed anti-
Plantarum 100, 675-688 fungal compounds in strawberry fruit and flower tissues. Postharvest Biology
Mattila P, Hellström J, Törrönen R (2006) Phenolic acids in berries, fruits, and Technology 31, 201-212
and beverages. Journal of Agricultural and Food Chemistry 54, 7193-7199 Tsukamoto S, Tomise K, Aburatani M, Onuki H, Hirorta H, Ishiharajima E,
Mattila P, Kumpulainen J (2002) Determination of free and total phenolic Ohta T (2004) Isolation of cytochrome P450 inhibitors from strawberry fruit,
acids in plant-derived foods by HPLC with diode-array detection. Journal of Fragaria ananassa. Journal of Natural Products 67, 1839-1841
Agricultural and Food Chemistry 50, 3660-3667 Tulipani S, Mezzetti B, Battino M (2009) Impact of strawberries on human
Mazur WM, Uehara M, Wahala K, Adlercreutz H (2000) Phyto-oestrogen health: Insight into marginally discussed bioactive compounds for the Medi-
content of berries, and plasma concentrations and urinary excretion of entero- terranean diet. Public Health Nutrition 12, 1656-1662
lactone after a single strawberry-meal in human subjects. The British Journal Tulipani S, Mezzetti B, Capocasa F, Bompadre S, Beekwilder J, de Vos CH,
of Nutrition 83, 381-387 Capanoglu E, Bovy A, Battino M (2008) Antioxidants, phenolic compounds,
McDougall G, Martinussen I, Stewart D (2008) Towards fruitful metabolo- and nutritional quality of different strawberry genotypes. Journal of Agricul-
mics: High throughput analyses of polyphenol composition in berries using tural and Food Chemistry 56, 696-704
direct infusion mass spectrometry. Journal of Chromatography B, Analytical Vasco C, Riihinen K, Ruales J, Kamal-Eldin A (2009) Phenolic compounds
Technologies in the Biomedical and Life Sciences 871, 362-369 in Rosaceae fruits from Ecuador. Journal of Agricultural and Food Chemis-
Menager I, Jost M, Aubert C (2004) Changes in physicochemical characteris- try 57, 1204-1212
tics and volatile constituents of strawberry (cv. Cigaline) during maturation. Wang SY, Chen CT, Wang CY, Chen P (2007) Resveratrol content in straw-
Journal of Agricultural and Food Chemistry 52, 1248-1254 berry fruit is affected by preharvest conditions. Journal of Agricultural and
Mertens-Talcott S, Jilma-Stohlawetz P, Rios J, Hingorani L, Derendorf H Food Chemistry 55, 8269-8274
(2006) Absorption, metabolism, and antioxidant effects of pomegranate Wulf JS, Ruhmann S, Rego I, Puhl I, Treutter D, Zude M (2008) Nondes-
(Punica granatum L.) polyphenols after ingestion of a standardized extract in tructive application of laser-induced fluorescence spectroscopy for quanti-
healthy human volunteers. Journal of Agricultural and Food Chemistry 54, tative analyses of phenolic compounds in strawberry fruits (Fragaria x ana-
8956-8961 nassa). Journal of Agricultural and Food Chemistry 56, 2875-2882
Mo Y, Nagel C, Taylor LP (1992) Biochemical complementation of chalcone Ylstra B, Busscher J, Franken J, Hollman PCH, Mol JNM, van Tunen AJ
synthase mutants defines a role for flavonols in functional pollen. Proceed- (1994) Flavonols and fertilization in Petunia hybrida: Localization and mode
ings of the National Academy of Sciences USA 89, 7213-7217 of action during pollen tube growth. The Plant Journal 6, 201-212
Mudnic I, Modun D, Brizic I, Vukovic J, Generalic I, Katalinic V, Bilusic T, Yu Y, Chang W, Wu C, Chiang S (2005) Reduction of oxidative stress and
Ljubenkov I, Boban M (2009) Cardiovascular effects in vitro of aqueous apoptosis in hyperlipidemic rabbits by ellagic acid. The Journal of Nut-
extract of wild strawberry (Fragaria vesca L.) leaves. Phytomedicine: Inter- ritional Biochemistry 16, 675-681
national Journal of Phytotherapy and Phytopharmacology 16, 462-469 Zabetakis I, Holden MA (1997) Strawberry flavour: Analysis and biosynthesis.
Nohynek LJ, Alakomi HL, Kähkönen MP, Heinonen M, Helander IM, Journal of the Science of Food and Agriculture 74, 421-434
Oksman-Caldentey KM, Puupponen-Pimiä RH (2006) Berry phenolics: Zafra-Stone S, Yasmin T, Bagchi M, Chatterjee A, Vinson JA, Bagchi D
Antimicrobial properties and mechanisms of action against severe human (2007) Berry anthocyanins as novel antioxidants in human health and disease
pathogens. Nutrition and Cancer 54, 18-32 prevention. Molecular Nutrition and Food Research 51, 675-683
Nyman NA, Kumpulainen JT (2001) Determination of anthocyanidins in ber- Zhang H, Cha S, Yeung ES (2007) Colloidal graphite-assisted laser desorp-
ries and red wine by high-performance liquid chromatography. Journal of tion/ionization MS and MS(n) of small molecules. 2. Direct profiling and MS
Agricultural and Food Chemistry 49, 4183-4187 imaging of small metabolites from fruits. Analytical Chemistry 79, 6575-
Okuda T, Yoshida T, Hatano T, Iwasaki M, Kubo M, Orime T, Yoshizaki M, 6584
Naruhashi N (1992) Hydrolysable tannins as chemotaxonomic markers in Zhang Y, Seeram NP, Lee R, Feng L, Heber D (2008) Isolation and identi-
the Rosaceae. Phytochemistry 31, 3091-3096 fication of strawberry phenolics with antioxidant and human cancer cell anti-
Olsson ME, Andersson CS, Oredsson S, Berglund RH, Gustavsson KE proliferative properties. Journal of Agricultural and Food Chemistry 56, 670-
(2006) Antioxidant levels and inhibition of cancer cell proliferation in vitro 675
75
Structural Genomic Resources in Fragaria Genus
Julio Bonet • Amparo Monfort*
IRTA, Centre de Recerca en Agrigenomica (CSIC-IRTA-UAB). Campus UAB, Edifici CRAG. Bellaterra 08193- (Barcelona), Spain
Corresponding author: * amparo.monfort@irta.es
ABSTRACT
Strawberry is the most widely grown of the berries, and the most economically important soft fruit. It has an interesting history. Fragaria
vesca, known as the wood strawberry, a diploid species (2n=14) with hermaphrodite flowers, has small, aromatic fruit and is found in
localised markets in Europe, northern Asia, northern Africa and North America. Additionally, many species of Fragaria L. (Rosaceae)
occur throughout northern temperate regions with one species extending into South America. A range of ploidy levels is observed within
the genus, with naturally occurring diploid, tetraploid, hexaploid and octoploid species and natural hybrids. The strawberry cultivated
worldwide, F. x ananassa, is derived from the chance hybridisation between two octoploid (2n=56) native American species, F. virginiana,
and F. chiloensis, both usually dioecious, in European botanic gardens. There is a well characterised collection of molecular markers in
Fragaria species, used principally to develop a saturated genetic linkage map of diploid Fragaria. The map has over 600 transferable
molecular loci from an interspecific cross between F. vesca and another closely-related diploid species, F. bucharica (FV×FB) and
includes microsatellites (SSRs), T-DNA insertion site markers, gene-specific and STS markers, RFLPs and SCAR markers and single
nucleotide polymorphism (SNP) markers. Comparative mapping studies have shown a high level of macrosynteny between the diploid
and octoploid Fragaria genomes.
_____________________________________________________________________________________________________________
Keywords: diploid, maps, molecular markers, octoploid, SSRs
CONTENTS
INTRODUCTION........................................................................................................................................................................................ 76
ISOENZYMES ............................................................................................................................................................................................ 76
RFLP (RESTRICTION FRAGMENT LENGTH POLYMORPHISM) ....................................................................................................... 77
ARBITRARILY-PRIMED MARKERS ....................................................................................................................................................... 77
SCAR ........................................................................................................................................................................................................... 77
CAPS ........................................................................................................................................................................................................... 78
MICROSATELLITES.................................................................................................................................................................................. 78
GENE-SPECIFIC MARKERS..................................................................................................................................................................... 78
LINKAGE MAPPING IN Fragaria ............................................................................................................................................................ 80
THE Fragaria REFERENCE MAP FVxFB ................................................................................................................................................ 80
BIN MAPING IN Fragaria ......................................................................................................................................................................... 80
OCTOPLOID MAPPING ............................................................................................................................................................................ 81
COMPARATIVE MAPPING....................................................................................................................................................................... 82
FUTURE PERSPECTIVES ......................................................................................................................................................................... 82
REFERENCES............................................................................................................................................................................................. 83
_____________________________________________________________________________________________________________
INTRODUCTION genome, critically determines the polymorphism rates. As

EST-derived markers are usually well conserved in different
Since 1981, advances in structural genomics in Fragaria taxa, they are a good choice for syntenic or phylogenetic
has been largely due to the improvement and availability of studies, while genomic-derived markers offer more poly-
different types of molecular markers in Fragaria species, as morphic loci between closely related individuals within a
well as markers developed in other Rosaceae species and species. Genomic data or the in silico genomic resources of
transferred to Fragaria. Molecular markers arise from DNA the species, accessing high technology, are crucial for the
mutations generated spontaneously, usually located in non- election of a marker, and while no sequence knowledge is
coding regions, and their pattern of inheritance is valuable necessary for arbitrarily-primed markers, it is needed for
for applications such as breeding, fingerprinting and genome SSR, SNP, CAPS and STS markers.
annotation. Substitutions on a single position, larger rear-
rangements (insertions or deletions) or number variations ISOENZYMES
on tandem-repeated DNA sequences generate marks or
labels that can be easily identified and tracked by DNA Isoenzymes are different molecular forms of a particular
visualization assays. enzyme. They can be electrophoretically separated due to
To select an appropriate marker, their different features the specific migration pattern generated by the different
should be taken into account. The stability of the mutation, electric charge and molecular weight. Hancock and Bring-
as the euchromatic/heterochromatic position within the hurst (1978, 1979) published the first studies of variation in
Received: 16 June, 2010. Accepted: 16 April, 2011.

phosphoglucoisomerase (PGI) and peroxidase (PX) enzymes sam 1996) and randomly amplified DNA fingerprinting
in natural populations of F. vesca, F. chiloensis and F. vir- (RAF) (Waldron et al. 2002) techniques, with higher an-
giniana. PGI, leucine aminopeptidase (LAP) and phospho- nealing temperatures used in the PCR, seem to be more
glucomutase (PGM) variation were first employed in the reproducible and transferable than RAPDs.
characterization of diploid and cultivated strawberry culti- Despite these difficulties, RAPD markers were the
vars (Arulsekar and Bringhurst 1981; Bringhurst et al. method of choice for the identification of strawberry vari-
1981). In their study on the inheritance pattern of PGI and eties (Congiu et al. 2000), germplasm characterization
LAP enzymes in cultivated strawberry, Arulsekar et al. (Kuras et al. 2004) and construction of linkage maps in
(1981) showed for the first time that four active Pgi loci diploid and octoploid species of Fragaria (Davis and Yu
segregate following a disomic Mendelian pattern. Apart 1997; Sugimoto et al. 2005; Sargent et al. 2009b). Linkage
from some controversial studies, the diploidized nature of between RAPD markers and a trait in the cultivated straw-
the octoploid Fragaria genome has been accepted by the berry was first reported using bulked-segregant analysis
scientific community (Ahmadi et al. 1990; Lerceteau-Köh- (BSA) of individuals resistant and susceptible to Phytoph-
ler et al. 2003; Sargent et al. 2009b). thora fragariae (Haymes et al. 1997). The authors identi-
The association of a particular trait and an isoenzyme fied seven RAPD markers linked to the Rpf1 locus, which is
locus has never been observed in cultivated strawberry. Wil- one of the major sources of genetic resistance to red stele
liamson et al. (1995) reported the inheritance of the yellow root rot, caused by the soil-born fungus P. fragariae. Two
fruit colour and its linkage to the Sdh (shikimate dehydro- RAPD markers were also found to be linked to the ever-
genase) locus in an intraspecific F2 population of F. vesca bearing locus in octoploid strawberry in the first map-based
Baron Solemancher x F. vesca Yellow Wonder, where SDH association study in F x ananassa (Sugimoto et al. 2005).
segregated in a 1: 2: 1 ratio, and fruit colour segregated 3 The major advantage of AFLP over the earlier arbit-
red/1 yellow. A few months later, Yu and Davis (1995) iden- rarily-primed PCR protocols is that they generate a large
tified an isozyme locus weakly linked to the non-runnering number of segregating markers (Vos et al. 1995) mostly
trait using the same diploid varieties as Williamson et al. corresponding to unique positions on the genome so they
(1995) as parental lines for several F2 and F3 offspring. Both can be exploited as landmarks in genetic and physical map-
traits were mapped by Davis and Yu (1997) in the first lin- ping. AFLP analysis is usually preferred for increasing
kage map of the diploid strawberry genome. marker density or to identify additional markers linked to
specific chromosomal regions by BSA (Capomaccio et al.
RFLP (RESTRICTION FRAGMENT LENGTH 2009; Kamei et al. 2010). This technique was applied for
POLYMORPHISM) the first time in Fragaria by Lerceteau et al. in 2003 during
the construction of the first public linkage map on the cul-
With the advent of restriction enzyme technology (Smith tivated strawberry Fragaria x ananassa, and subsequently
1970), nucleotide sequence specific systems were developed in related studies (Rousseau-Gueutin et al. 2008; Weebadde
worldwide. The first report on genetic linkage of restriction et al. 2008; Sargent et al. 2009b).
fragments in plants was done by Polans et al. in 1985. A ISSR (inter-simple sequence repeat) is a general term
robust, reliable and transferable technique, restriction frag- for a genome region between two adjacent microsatellite
ment length polymorphism (RFLP) provides mostly co- loci. These regions are often polymorphic between different
dominant polymorphisms. It is not commonly used today, species or varieties, and have been used to generate arbit-
as it is time consuming, involves expensive, radioactive or rary primers. These primers are designed containing dif-
toxic reagents and requires large quantity of high quality ferent SSR motifs, and PCR products result from the varia-
genomic DNA (Agarwal et al. 2008). Hybridization-based ble amplified region. The result is a mix of a variety of am-
markers such as RFLP, have the advantage of being highly plified DNA strands which are generally short but variable
transferable between distantly related species. in length. The small genome size of the diploid Fragaria
No RFLP probes have been developed in the Fragaria has led to the identification of variable ISSR regions (Kor-
nuclear genome so far, but Prunus derived probes have bin et al. 2002; Albani et al. 2004).
been shown to be a valuable tool for mapping in Fragaria
(Viruel et al. 2002). Vilanova et al. (2008) mapped 40 poly- SCAR
morphic Prunus EST-derived RFLP markers in the diploid
Fragaria reference population when comparing strawberry Arbitrary markers closely linked to agronomically interes-
and peach genomic structure. This comparison comprised ting traits can be converted to sequence characterised am-
71 common markers and revealed that only 24% of the plified regions (SCAR) for large scale use (Paran and
probes gave poor or no hybridization in the Fragaria Michaelmore 1993). To date, only three economically im-
genome, suggesting that Prunus coding sequences are es- portant traits have been successfully linked to a SCAR
sentially conserved in the strawberry genome. marker in Fragaria; SCAR markers are difficult to develop.
However, published functional SCAR markers designed on
ARBITRARILY-PRIMED MARKERS gene sequences coding for different enzymes in other spe-
cies are being transferred to Fragaria (Palmieri et al. 2008).
With the establishment of PCR procedures in the late 1980s, Haymes et al. (2000) successfully converted a RAPD mar-
PCR-derived techniques dramatically increased the avail- ker into two SCARs, both linked in coupling phase to the
ability of molecular markers, largely due to the simplicity of Rpf1 gene. This association was shown to be highly con-
the procedures; nanogram (rather than microgram) quanti- served among 133 Fragaria European and North American
ties of DNA are required. Arbitrarily-primed marker sys- cultivars. Lerceteau-Köhller et al. (2005) studied the inhe-
tems such as random amplified polymorphic DNA (RAPD) ritance of resistance to one of the infectious agents causing
and amplified fragment length polymorphisms (AFLP) anthracnose, Colletotrichum acutatum in 43 strawberry cul-
normally generate a large number of dominant markers. tivars. They obtained two AFLP-derived SCAR markers,
They are based on different amplification patterns of small closely linked to the Rca2 gene, which correctly predicted
PCR fragments generated by short primer pair combinations. most of the resistant/susceptible genotypes (81.4% of the
No knowledge of the DNA sequence for the targeted gene cultivars for STS-Rca2_417). In diploid Fragaria, three
or genomic region is required, as the primers bind some- SCARs linked to the SFL locus (seasonal flowering locus)
where in the sequence, and therefore markers can be have been reported in F. vesca by Albani et al. (2004) using
quickly amplified and detected in any organism. However, a BC1 progeny of 1,049 individuals. This locus is con-
reproducibility is sometimes a problem with these markers, sidered to be a floral repressor that is inactivated by short
in particular RAPDs (Jones et al. 1997), and they are ex- days and cool temperatures in the autumn but reactivated by
tremely difficult to transfer between different populations. winter cold (Battey et al. 1998).
DNA amplification fingerprinting (DAF) (Bentley and Bas-
77
Genomics in Fragaria. Bonet and Monfort
Table 1 Microsatellite markers developed in Fragaria species.

Species Name No. SSRs Reference
F. vesca EMFv 31 James et al. 2003; Hadonou et al. 2004
F. vesca UDF 68 Cipriani and Testolin 2004; Cipriani et al. 2006
F. vesca CFVCT 35 Monfort et al. 2006
F. vesca ChFvM 22 Zorrilla-Fontanesi et al. 2011
F. vesca fvp 6 Rousseau-Gueutin et al. 2011
F. viridis EMFvi 22 Sargent et al. 2003
F. bucharica (F. nubicola) EMFn 31 Sargent et al. 2006
F. virginiana Fvi 7 Ashley et al. 2003
F. x ananassa ARSFL, FAC 14.4 Lewers et al. 2005
F. x ananassa UFFxa 14 Sargent et al. 2006
F. x ananassa CFACT, CFA, EMFxa 24,5,8 Sargent et al. 2008
F. x ananassa UAFv 14 Bassil et al. 2006
F. x ananassa ChFaM 108 Gil-Ariza et al. 2006; Zorrilla-Fontanesi et al. 2011
F. x ananassa Fa 4 Shimomura and Hirashima 2006
F. x ananassa PBCESSRFXA 14 Keniry et al. 2006
F. x ananassa fap 5 Rousseau-Gueutin et al. 2011
CAPS MICROSATELLITES
Cleaved amplified polymorphic sequences (CAPS) are Simple sequence repeats (SSR) or microsatellites are tan-
usually amplified from known gene sequences and digested demly arranged short sequence motifs, which occur as inter-
with an appropriate restriction enzyme (RE). CAPS reveal spersed repetitive elements in all eukaryotic genomes
the restriction fragment length polymorphisms caused by (Tautz and Renz 1984). Microsatellites are among the most
single base changes of SNPs, insertions/deletions, which variable types of DNA sequence in the genome (Weber
modify restriction endonuclease recognition sites in PCR 1990), as the polymorphisms derive mainly from variability
amplicons (Konieczny and Ausubel 1993). The technique is in length rather than in the primary sequence. Given their
limited by mutations, which create or disrupt a restriction extensive polymorphisms, transferability between popula-
enzyme recognition site. To overcome this limitation, tions and species and their technical simplicity, they became
Michaels and Amasino (1998) proposed a variant of the the marker of choice in Fragaria mapping during the last
CAPS method called dCAPS (derived cleaved amplified decade and subsequently in population genetics studies and
polymorphic sequence). In dCAPS analysis, a restriction cultivar identification.
enzyme recognition site which includes the SNP is intro- A set of more than 200 primer pairs amplifying poly-
duced into the PCR product by a primer containing one or morphic SSRs have been developed for Fragaria species
more mismatches to template DNA (Neff et al. 1998). The (Table 1). Most of them have been reported in the diploid
modified PCR product is then digested with a restriction species such as F. vesca, F. viridis and F. bucharica (for-
enzyme, with the resulting restriction pattern showing the merly F. nubicola; Sargent et al. 2006) and also in the octo-
presence or absence of the mutation. ploid species F. virginiana, the cultivated strawberry F. x
CAPS and dCAPS analyses are fast and simple for SNP ananassa, and in other rosaceous species. Whilst SSRs are
genotyping compared to more expensive techniques such as excellent markers for providing a linkage framework, they
resequencing or high resolution melting analysis (HRM). are primarily developed from non-coding regions of the
HRM analysis discriminates two homozygous PCR ampli- genome and are generally not tightly linked to genes of
cons containing a nucleotide variation, as well as their hete- known function or to traits of economic importance.
rozygote, using fluorescence dyes which can bind to the In contrast to genomic SSRs, EST-derived microsatel-
double stranded DNA without inhibiting PCR (Herrmann et lites potentially represent functional markers (Varshney et
al. 2006). This approach has been used in other Rosaceae al. 2005; Zorrilla-Fontanesi et al. 2011) as they are present
crops as almond (Wu et al. 2008, 2009) and apple (Chagné in expressed regions of the genome. Around 30% of the
et al. 2008), but no studies have been reported in strawberry. reported SSRs in Fragaria belongs to expressed regions,
Kunihisa et al. (2005, 2009) used cluster-specific ampli- being especially valuable for germplasm characterization
fication with a set of 34 CAPS markers in F. x ananassa, (Varshney et al. 2005) taking into account that EST-SSRs
corresponding to alleles of single diploid loci, and correctly are not as efficient as genomic SSRs for distinguishing
identified 63 different cultivars using a minimum of nine closely related genotypes (Gupta and Varshney 2000).
CAPS markers. These markers are especially valuable, as Besides genetic mapping and diversity studies, Fragaria
markers detecting only a single locus are rare in F. x ana- microsatellites have been used for transferability and com-
nassa. These CAPS are cluster-specific markers, as they parative mapping in the Rosaceae (Lewers et al. 2005),
were developed by allele-specific amplification based on characterization of a high molecular weight DNA BAC lib-
the nucleotide sequence specificity, allowing the amplifica- rary (Bonet et al. 2009) and the ongoing scaffold anchoring
tion of only one of the four clusters or subgenomes in the for the Fragaria genome sequence annotation project (Shu-
whole F. x ananassa genome. laev et al. pers. comm.).
A set of new CAPS and dCAPS have recently been re-
ported in the diploid strawberry F. vesca Hawaii 4 (Ruiz- GENE-SPECIFIC MARKERS
Rojas et al. 2010). Seventy four SNPs were identified and
mapped on the Fragaria reference map, in order to locate In spite of the availability of expressed sequences in public
the T-DNA insertions generated by Agrobacterium-medi- databases, no gene-specific markers have yet been mapped
ated mutagenesis. When a single dose transgenic plant was in cultivated Fragaria. This is probably due to the octoploid
identified, thermal asymmetric interlaced PCR (hiTAIL- nature of the genome, as the gene dose can interfere during
PCR) was used to obtain the insertion flanking regions. the characterization of an expressed, and subsequently,
These regions were used to design primers for the identifi- highly conserved locus. For this reason, the intron-exon
cation of polymorphic SNPs in the parents of the Fragaria border structure, based on sequence similarity with the most
reference population and subsequently mapped in the popu- highly conserved homolog gene in a model species, can be
lation using a CAPS-dCAPS approach. taken into account. Coding regions flanked by introns are a
good choice for primer design of polymorphic sequence-
78
Table 2 Locus, gene annotation and map position of mapped genes in the Fragaria genome.
Map Locus Gene annotation Position
FV x FB (Ruiz-Rojas et al. 2010) ABP1 Auxin-binding protein LG2 21,5
ACO1 1-Aminocyclopropane-1-Carboxylate oxidase LG6 58,2
ADH2 alcohol dehydrogenase LG2 16,9
AKR1 Aldo-keto reductase superfamily member LG4 61
ANS1,3 Anthocyanidin synthase LG5 9,2
APX1 Cytosolic ascorbate peroxidase LG3 42,3
ARP1 Auxin-repressed mRNA LG3 28
BG-11 Beta-1,3-glucanase-1 LG4 60,4
BG-21 Beta-1,3-glucanase-2 LG3 39,8
CAD-11 Cinnamyl alcohol dehydrogenase-1 LG7 17
CAD-21 Cinnamyl alcohol dehydrogenase-2 LG1 31,1
CAD-31 Cinnamyl alcohol dehydrogenase-3 LG1 54,2
CEL-11 Cellulase-1 LG4 75,3
CEL-21 Cellulase-2 LG5 20,3
CHI3 chalcone isomerase LG7 25,7
CHS3 chalcone synthase LG7 17,3
DFR1,3 Dihydroflavonol 4-reductase LG2 59,1
DHAR5 DeHydro Ascorbate Reductase LG7 0*
EKO1 Ent-kaurene oxidase LG2 14,8
EXP-11 Expansin-1 LG4 19,0*
F3H3 flavanone-3-hydroxylase LG1 43,1
FvNES14 Nerolidol Synthase 1 LG3 12,5
GAST1 GAST-like gene product LG2 52,5*
LEAFY1 Leafy protein LG3 16,1*
LOX1 Lipoxygenase LG4 27,8
MET1 Metallothionein-like protein LG6 42
MSR1 Methionine sulfoxide reductase LG5 27,5*
MYB1 Transcription factor LG5 38
PDC1 Pyruvate decarboxylase LG6 43,8
PES1 Pectinesterase LG1 37,3*
PGLM1 Phosphoglyceromutase LG6 28,4
QR1 Quinone oxidoreductase LG6 76,1
RAN3 Del-like regulatory gene LG5 14,8
S Locus6 S-RNase LG1 36
T Locus6 T-Rnase LG6 (7,3-15,2)
ZIP1 Zinc transporter protein LG6 52,4
Ever Berry x Toyonoka (Sugimoto et al. 2005) EV7 Everbearing (OPE07-1-OPB05-1)
Md683 x Senga Sengana (Haymes et al. 1997) Rpf18 Phytophthora fragariae resistance (OPO-08A-OPO-16A)
Redgauntlet x Hapil (Sargent et al. 2009) ACO9 1-Aminocyclopropane-1-Carboxylate oxidase RG6-D 22, HA6-D
ACP9 Acyl carrier protein HA6-D
DFR9 Dihydroflavonol 4-reductase RG2-B
bEXP-2049 Expansin HA3-A
EXP-1859 Expansin RG4-D
aEXP-1779 Expansin RG5-A, HA5-A
b-EXP-2359 Expansin HA7-C
EXP-2489 Expansin HA7-D, RG7-D
aEXP-2459 Expansin RG7-C
aLOX-374/3859 Lipoxygenase RG4-B
bLOX-376/3799 Lipoxygenase HA4-B
Gene locations are given in cM with respect to the origin of the linkage group for FV x FB genes, and linkage group or flanking markers are reported for octoploid Fragaria
genes
* The position is from a previous version of the map.
1
Sargent et al. 2007. 2 Davis and Yu 1997. 3 Deng and Davis 2001. 4 Sargent et al. 2004. 5 Rousseau-Gueutin et al. 2009. 6 Boškovic et al. 2009. 7 Sugimoto et al. 2005.
8
Haymes et al. 1997. 9 Sargent et al. 2009.
specific tags (STS), as the mutation rates are higher in the phic markers for 5 candidate genes and a transcription fac-
introns than in the exons. Because cultivated strawberries tor involved in anthocyanin biosynthesis pathways, using
are octoploid, the fragments amplified by one primer pair two diploid Fragaria populations. Sargent et al. (2007)
can contain various sequences derived from up to eight located 29 loci for 24 genes in the diploid Fragaria genome
chromosomes (Kim et al. 2001). Therefore, it is necessary using public EST databases, predominantly from Fragaria
to consider several sequences from each target gene to mRNA sequences, as a source for primer design. Many of
correctly predict polymorphisms from the sequence data their primer pairs were shown to be highly transferable,
(Kunihisa et al. 2005). amplifying orthologous genes in other genera (Malus and
Most studies on gene discovery have used the diploid Prunus). EST-derived markers have also been useful in syn-
species Fragaria vesca. The first gene specific marker in teny analysis between Prunus and Fragaria, where 21 new
Fragaria, ADH, was developed by Davis and Yu (1997) markers have been developed from Prunus EST sequences,
from the alcohol dehydrogenase gene. They used an intron and mapped in the diploid reference Fragaria linkage map
length polymorphism segregating in their mapping popula- (Vilanova et al. 2008).
tion. Deng and Davis (2001) developed a candidate-gene Four more STS markers were mapped by Sargent et al.
approach to determine the molecular identity of the F. vesca (2008) during the development of a bin mapping strategy.
c (yellow fruit) locus. They mapped intron-length polymor- With the addition of two unlinked RNase loci (loci S and T)
79
to the Fragaria linkage groups FG1 and FG6, both involved previously designated as FVxFN, was renamed FVxFB. In
in the Fragaria RNase-based self-incompatibility system its initial version, this map had 68 SSR, one SCAR, six STS
(Boškovi et al. 2010), the total number of genes of known markers and three morphological traits: seasonal/perpetual
function in the Fragaria genome has been brought to 38 flowering, runner development and pale/dark-green leaf
(Table 2). colour.
Following a variant methodology, Davis et al. (2007) Even considering the high level of distorted segregation
developed a new molecular marker type in Fragaria, called ratios (54%, where 80% of skewed loci were biased towards
gene pair marker. As the genome size of the diploid straw- an excess of alleles from the paternal crossing parent, F.
berry is small (about 200 Mbp), genes are closely spaced: bucharica), the map was adopted as a framework for ad-
about 1 gene per 5.7 kb (Pontaroli et al. 2009). As a conse- ditional marker incorporation for map coverage of the dip-
quence of the small intergenic distances, PCR primers tar- loid Fragaria genome. In a collaboration of several labo-
geted to conserved exon sequences in two adjacent genes ratories, a new set of 109 genomic and EST-derived SSR
(the gene pair) can be exploited as a source of polymor- markers, developed in both diploid and cultivated straw-
phisms, by amplifying an entire intergenic region flanked berries, were located in this map by Sargent et al. in 2006,
by gene-defining exon sequences. The authors used this increasing the number of molecular markers to 182 (175
strategy to amplify the CDPK1-BHLH1 strawberry gene SSR, 6 STS and one SCAR) to provide a comprehensive
pair locus in other taxa, suggesting that gene pair markers coverage of the diploid Fragaria genome with an average
can be especially useful in intergenic synteny studies or density of one marker every 2.3 cM. In 2007, Sargent et al.
comparative linkage mapping in the Rosaceae family (Sar- developed and mapped 29 functional markers from 24 gene
gent 2009a). sequences, greatly increasing the number of genes of known
function mapped in the genus. Seventeen STS were mapped
LINKAGE MAPPING IN Fragaria using the FVxFB population, and the remaining 12 were
mapped in a BC1 population derived from a cross between
The construction of linkage maps in polyploids has several F. vesca 815 and F. viridis 903 (Nier et al. 2006).
limitations: There are a large number of possible genotypes In 2008, 40 RFLP and 29 EST-derived markers were
for each polymorphism expected in a segregating popula- located in the FVxFB map, in a comparative study of Pru-
tion, and these genotypes cannot always be identified nus and Fragaria genomes (Vilanova et al. 2008) and a new
readily by their banding phenotypes due to possible co-mig- SSR, located in an uncovered region of linkage group four,
ration of fragments on gel electrophoresis. Furthermore, the was added to the reference map during the development of
genome constitutions (allopolyploidy versus autopoly- a ‘bin mapping’ strategy for Fragaria (Sargent et al. 2008).
ploidy) in many polyploids are not clearly understood, In a phylogenetic study on the relationships among Fra-
making it difficult to determine the patterns of inheritance. garia species, Rousseau-Gueutin et al. (2008) described a
Despite evidence that F. x ananassa behaves as an allopoly- new STS marker for the DHAR gene. Rouseau-Gueutin et
ploid, the evolutionary history of the genus still remains al. (2009) added four new SSR loci to the reference map
unclear (Bringhurst 1990; Rousseau-Gueutin et al. 2008). and included some rearrangements in the relative position
The development of genetic maps in octoploid Fragaria of several markers from four linkage groups during the
species has lagged behind that of diploid species, where assessment of the synteny relationships between diploid and
meiotic recombination events can be easily characterized octoploid genomes.
and, consequently, the order of segregating loci can be Two loci encoding RNases (S and T) involved in the
clearly established. self-incompatibility mechanism have been described and
In the framework of the assessment of the synteny and mapped in the FVxFB map (Boškovi et al. 2009). This
colinearity between both diploid and octoploid genomes, mechanism includes at least two RNases and a complemen-
more genetic maps have been developed using diploid spe- tary SFB pollen-expressed component. The authors showed
cies, since Davis and Yu (1997) developed the first genetic that the presence of one of the active alleles at either RNase
map for Fragaria. This study, using an F2 mapping popula- loci is sufficient to confer self-incompatibility in an ap-
tion derived from a cross between an alpine (F. vesca ssp. propriate genetic background and that a non-RNase factor,
vesca ‘Baron Solemancher’) and a non-alpine (F. vesca ssp which segregates independently, is necessary for self-in-
americana ‘WC6’) parent, provided the position of 80 loci, compatibility.
most of them RAPD markers, in a 445 cM genetic map Recently, a set of 74 CAPS and dCAPS markers derived
covering seven linkage groups. In the map there is also one from a T-DNA mutant insertion collection has been deve-
morphological marker (the runnering locus, r), one STS loped and incorporated in the FVxFB map (Ruiz-Rojas et al.
marker for the ADH gene and the isoenzymes Pgi-2 and 2010). With the inclusion of these markers, the Fragaria
Sdh-1. Some of the markers developed in this work were reference map (see Fig. 1) coverage has been brought to
used by Deng and Davis (2001) to anchor five genes and 529 cM, 18% more than that of Davis and Yu (1997), with
one transcription factor involved in anthocyanin biosynthe- 310 molecular markers (172 SSR, 16 gene-specific STS, 40
sis pathways to their hosting linkage group, using two F2 RFLP, 74 CAPS-dCAPS, seven EST and one SCAR) and
populations of 40 individuals each, derived from two crosses three morphological traits distributed in seven linkage
of F. vesca ssp. vesca, var. ‘Yellow Wonder’ with F. nubi- groups.
cola, and F. vesca ssp. bracteata with F. vesca ssp. vesca,
var. ‘Yellow Wonder’. BIN MAPING IN Fragaria
THE Fragaria REFERENCE MAP FVxFB Normally, linkage mapping populations consist of randomly
selected individuals of a large progeny, where the dis-
With the advances in the production of transferable mole- tribution of the meiotic crossover sites (breakpoints) in the
cular markers for map-based studies of the genus, such as genome of the different individuals of the population pro-
SSR, in both diploid and octoploid species, Sargent et al. vides a framework for the assessment of the molecular mar-
(2004a) constructed a reference linkage map for the genus, ker positions. However, when a typical mapping population
from a cross between F. vesca ssp. vesca f. semperflorens is well characterized, it is possible to add new markers by
(FDP815) and F. bucharica (FDP601). The latter accession, selecting a few plants of the population (the most infor-
commonly referred to as F. nubicola FDP601 (Lin and mative set of breakpoints), minimizing time and effort over
Davis 2000; Potter et al. 2000; Deng and Davis 2001; Sar- conventional mapping strategy (Vision et al. 2000; Howad
gent et al. 2004a, 2004b; Davis et al. 2006; Monfort et al. et al. 2005). This ‘selective’ or ‘bin mapping’ approach was
2006; Sargent et al. 2006, 2007, 2008; Vilanova et al. 2008), recently adapted to the FVxFB map by Sargent et al. (2008).
was recently reclassified as F. bucharica, a closely related The defined bin set, with 6 F2 individuals plus one parental
species, probably of hybrid origin (Staudt 2006). The map, line and the F1 individual, was shown to be sufficiently
80
Fig. 1 The diploid Fragaria reference linkage map (FVxFB) derived from an F2 population obtained in an interspecific F. vesca 815 x F. bucharica
cross.
robust to locate 103 new markers (99 genomic and EST- In the first linkage map of the cultivated strawberry,
derived SSRs and four gene-specific markers originally des- derived from an F1 population of 113 individuals from the
cribed as Prunus ripening genes) in one of the 46 mapping cross of the variety ‘Capitola’ and the clone CF1116
bins spanning the Fragaria genome, with an average length [‘Pajaro’ x (‘Earliglow’ x ‘Chandler’)], using AFLP analy-
of 12.6 cM per bin. ses, Lerceteau-Köller et al. (2003) applied a two-step map-
ping procedure, previously reported by Grivet et al. (1996),
OCTOPLOID MAPPING to assign the linkage between the coupling- and repulsion-
phase markers. The authors identified a large cluster of mar-
Breeding for many traits in the cultivated strawberry could kers segregating only in the coupling phase, and deduced
be enhanced through the use of molecular markers, but the that the meiotic behaviour of the octoploid Fragaria
octoploid nature of the genome provides a challenge to the genome may not be as completely diploidized as assumed
development of traditional molecular breeding tools. Until by several authors (Arulsekar and Bringhurst 1981; Ahmadi
2008, the absence of a public consensus linkage map meant et al. 1990; Ashley et al. 2003). Their maternal map had
marker assisted selection in strawberry was delayed with 235 markers distributed among 30 linkage groups covering
respect to other crops, with only reports of partial maps or 1,604 cM and the paternal map was built with 280 markers
markers linked to single traits. With meiotic behaviour assigned to 28 linkage groups, yielding a map size of 1,496
clearly established and multi-allelic transferrable markers cM.
anchored to the octoploid and diploid Fragaria genome Transferable markers and new individuals were later
(Rousseau-Gueutin et al. 2008; Spigler et al. 2008; Sargent added to this map (Rousseau-Gueutin et al. 2008), allowing
et al. 2009b), the assessment of accurate trait-marker lin- the integration of most of the paternal and maternal linkage
kage relationships should be feasible in the near future. groups of Lerceteau-Köller et al. (2003) and demonstrating
The first map-based association study in cultivated that the meiotic behaviour of the strawberry genome is
strawberry was carried out to identify markers for the ever- mainly disomic. However, the absence of repulsion-phase
bearing locus in the octoploid strawberry (Sugimoto et al. markers in some linkage groups can only be explained by
2005). An F1 progeny from a cross between ‘Ever Berry’ (a the existence of residual polysomic pairing that may still
Japanese everbearing variety) and ‘Toyonoka’ (a June- occur within the F x ananassa genome (Sargent et al.
bearing variety) was used to identify the locus governing 2009a). In this version, this map covers a genetic distance
the flowering pattern. The flowering test gave the expected of 5,017 cM, defined by 162 transferable loci across both
1: 1 ratio for everbears to Junebears, suggesting that the in- maps, 23 of which, shared between the two maps, were
heritance of the trait is controlled by a monogenic dominant used for map integration.
gene. In order to locate this gene, the authors used 175 To identify the genetic control of day-neutrality in the
RAPD primer pairs. With five out of 89 polymorphic frag- commercial strawberry, an AFLP-based map was construc-
ments relating to the everbearing locus, a 39.7 cM long lin- ted from a cross between ‘Tribute’, a day-neutral, and
kage group was constructed, with two markers flanking the ‘Honeoye’, a short-day variety. In an F1 population of 127
everbearing gene, at 11.8 and 15.8 cM. individuals, 429 single dose restriction fragments (SDRFs)
81
were located on an integrated map of 1,541 cM with 43 lin- ments, occurring since divergence of the two genera, sepa-
kage groups. SDRFs are particularly useful for constructing rate the Fragaria and Prunus genomes, supporting their
genetic maps of polyploids when meiosis behaviour is distant position within the Rosaceae family. However, there
unclear (Wu et al. 1992). Eight significant QTLs were iden- is sufficient synteny between the genomes to allow the in-
tified, none of which explained more than 36% of the vari- formation on marker, gene or quantitative trait locus (QTL)
ation, as expected for a polygenic-inherited trait (Weebadde position from one species to be used in studies in the other
et al. 2008). (Vilanova et al. 2008). Further comparisons between dif-
The genetic mechanisms involved in sex determination ferent Rosaceae genus is being carried out (Illa E, pers.
were also investigated by a map-based association approach comm.), and new DNA sequence data from high-throughput
in the wild octoploid F. virginiana (Spigler et al. 2008). sequencing will permit a next generation of microsynteny
Using SSRs, the authors mapped sex determination as two studies in the Rosaceae very soon.
qualitative traits, male and female function, both located in Using transferrable markers for mapping purposes en-
linkage group 41, separated by 6 cM. The existence of ables the identification of homologous linkage groups
recombination events between the sex-determining loci, an between maps, allowing the selection of further markers
important hallmark of incipient sex chromosomes, sug- from any other study to enrich the existing maps in areas
gested F. virginiana as a novel model system for the study not covered. Recently, the synteny relationship between the
of sex chromosome evolution. Their map covered a total diploid and octoploid Fragaria genome has been estab-
distance of 2,373 cM on 42 linkage groups, much higher lished by Rousseau-Gueutin et al. (2008) and Sargent et al.
than the 28 expected linkage groups, including 212 trans- (2009b). Anchoring syntenic regions with transferable mar-
ferable markers, 39 of which segregate in both the maternal kers (most of them SSR), all the octoploid Fragaria linkage
and paternal maps, and were used for map integration. groups were identified on the diploid Fragaria reference
Skewed segregation was apparent in almost a third of the map, according to their homologous groups, and the home-
mapped markers, and many of the primer pairs used in this ologous groups within the octoploid genome were identified
study produced alleles that mapped to more than one locus by mapping marker loci derived from the same primer pair
on the same linkage group. The authors suggested that this to different linkage groups on each of the parental maps.
may have been due to changes within and between genomes The authors observed almost complete conservation of mar-
of the highly heterozygous, polyploid genome of F. virgini- ker order between the octoploid and diploid genetic maps.
ana, so representing alleles from the same genetic locus. Except for an apparent duplication of the Fvi6b locus on
This would reduce the number of transferable markers of homologues of diploid Fragaria linkage groups one and six,
the map to 161 (Sargent et al. 2009b). which may indicate an ancient chromosomal duplication or
A new integrated octoploid-diploid Fragaria genome translocation event in Fragaria (Sargent et al. 2009b), no
map was developed by Sargent et al. (2009b) from an F1 evidence of any chromosomal rearrangements between the
population of 174 seedlings derived from a cross between diploid and octoploid maps has been reported.
two F. x ananassa cultivars, ‘Redgauntlet’ x ‘Hapil’, seg-
regating for interesting agronomic traits. The resultant map FUTURE PERSPECTIVES
has 315 molecular markers (218 SSR, 11 gene-specific mar-
kers and 86 AFLP and RAPD markers) spanning 3,116 cM Although the architecture of the strawberry genome has
in 69 different linkage groups that could be associated to been investigated over the last thirty years, the amount of
one of the 56 theoretical scaffolds by at least one anchor genomic data has dramatically increased since 2005, with
marker. It contains 230 transferable markers, 28 of which the advent of the High Throughput Sequencing Technology.
are shared between the two parental maps and were used for It has been used for the construction of the first draft of the
map integration. strawberry genome, which was released recently (Shulaev
et al. 2011), marking another milestone in the extraordi-
COMPARATIVE MAPPING narily fast moving field of plant genomics. Despite all the
sequencing advances, very little is known about how to read
Genome comparisons based on the map position of homolo- the “book of life that is opening before us”, says Michael
gous sequences between closely related species can be used Egholm, one of the people responsible for next generation
to construct robust phylogenies (Rokas et al. 2003) or to sequencing technology (Wadman 2008).
identify changes in genome structure (Deleu et al. 2007). New genomic resources in Fragaria are being construc-
When well-characterized sequence data are available, the ted worldwide: a collection of near isogenic lines (NILs) in
conservation of synteny between different plant species can diploid strawberry is coming out soon (Bonet J, PhD thesis
be detected even comparing members of different families. 2010); a collection of T-DNA insertional mutants is avail-
Genome comparisons based on the map position of homolo- able (Ruiz-Rojas et al. 2010); transgenic lines for many in-
gous markers between distantly related species is quite teresting traits are being investigated in different labora-
limited (Rong et al. 2005), but this approach has been used tories (Qin et al. 2008). The new resources are unexplored
to identify genome rearrangements and syntenic and exten- sources of phenotypic variation. Information on genome-
sive colinear chromosomal regions in different plant species wide and transcriptome-wide variation in diverse germ-
within a family (McClean et al. 2010; Wu and Tanksley plasms can be used in different studies, ranging from map-
2010). These comparisons can be very useful for breeding ping interesting mutations to studying genome structure and
purposes. function. Identification of alleles (including QTLs and
Diploid Fragaria species seem to be essentially colinear eQTLs (expression QTLs) controlling phenotypes, genetic
at the macrosynteny level when comparing the available mechanisms such as genome-wide patterns of recombina-
maps constructed by interspecific crosses, such as F. vesca tion, will benefit from the availability of saturate marker
x F. bucharica or F. vesca x F. viridis (Nier et al. 2006). maps, to give a sound basis for marker-assisted selection
Sargent et al. (2007) used PCR-based methods for com- procedures in strawberry production.
parative mapping between Fragaria, Malus and Prunus,
indicating that DFR and EKO are orthologous genes and ACKNOWLEDGEMENTS
that their hosting linkage group (LG2) could be homeolo-
gous to Malus LG15 and Prunus LG1. This relationship has This work was supported by funds from the Spanish Ministry of
been confirmed for Fragaria and Prunus genus by hybridi- Science and Innovation, project RTA2007-00063-00-00 (INIA), by
zation methods. Prunus and Fragaria reference maps were the Consolider-Ingenio 2010 Programme of the Spanish Ministerio
compared by analyzing the position of 71 anchor markers de Ciencia e Innovación (CSD2007-00036 "Center for Research in
covering both genomes, and it was found that, in spite of Agrigenomics") and the Department of Innovation, Universities
the conservation of large chromosomal fragments as expec- and Enterprise of Catalonia.
ted for confamilial species, many chromosomal rearrange-
82
REFERENCES cies. Molecular Ecology Notes 6, 1195-1197

Grivet L, D’Hont A, Roques D, Feldmann P, Lanaud C, Glaszmann JC
Agarwal M, Shrivastava N, Padh H (2008) Advances in molecular marker (1996) RFLP mapping in cultivated sugarcane (Saccharum spp.): Genome or-
techniques and their applications in plant sciences. Plant Cell Reports 27, ganization in a highly polyploid and aneuploid interspecific hybrid. Genetics
617-631 142, 987-1000
Ahmadi H, Bringhurst RS, Voth V (1990) Modes of inheritance of photo- Gupta PK, Varshney RK (2000) The development and use of microsatellite
periodism in Fragaria. Journal of the American Society for Horticultural Sci- markers for genetic analysis and plant breeding with emphasis on bread
ence 115, 146-152 wheat. Euphytica 113, 163-185
Albani MC, Battey NH, Wilkinson MJ (2004) The development of ISSR- Hadonou AM, Sargent DJ, Wilson F, James CM, Simpson DW (2004) Deve-
derived SCAR markers around the SEASONAL FLOWERING LOCUS (SFL) lopment of microsatellite markers in Fragaria, their use in genetic diversity
in Fragaria vesca. Theoretical and Applied Genetics 109, 571-579 analysis and their potential for genetic linkage mapping. Genome 47, 429-
Arulsekar S, Bringhurst RS (1981) Genetic model for the enzyme marker PGI 438
in diploid California Fragaria vesca its variability and use in elucidating the Hancock JF, Bringhurst RS (1978) Inter-populational differentiation and
mating system. Journal of Heredity 72, 117-120 adaptation in perennial, diploid species Fragaria-vesca L. American Journal
Arulsekar S, Bringhurst RS, Voth V (1981) Inheritance of PGI and LAP iso- of Botany 65, 795-803
zymes in octoploid cultivated strawberries. Journal of the American Society Hancock JF, Bringhurst RS (1979) Ecological differentiation in perennial,
for Horticultural Science 106, 679-683 octoploid species of Fragaria. American Journal of Botany 66, 367-375
Ashley MV, Wilk JA, Styan SMN, Craft KJ, Jones KL, Feldheim KA, Haymes KM, Henken B, Davis TM, van de Weg WE (1997) Identification of
Lewers KS, Ashman TL (2003) High variability and disomic segregation of RAPD markers linked to a Phytophthora fragariae resistance gene (Rpf1) in
microsatellites in the octoploid Fragaria virginiana Mill. (Rosaceae). Theo- the cultivated strawberry. Theoretical and Applied Genetics 94, 1097-1101
retical and Applied Genetics 107, 1201-1207 Haymes KM, van de Weg WE, Arens P, Maas JL, Vosman B, Den Nijs
Bassil NV, Gunn M, Folta K, Lewers K (2006) Microsatellite markers for APM (2000) Development of SCAR markers linked to a Phytophthora Fra-
Fragaria from ‘Strawberry Festival’ expressed sequence tags. Molecular gariae resistance gene and their assessment in European and North American
Ecology Notes 6, 473-476 strawberry genotypes. Journal of the American Society for Horticultural Sci-
Battey NH, Le Miere P, Tehranifar A, Cekic C, Taylor S, Shrives KJ, Had- ence 125, 330-339
ley P, Greenland AJ, Darby J, Wilkinson MJ (1998) Genetic and environ- Herrmann MG, Durtschi JD, Voelkerding KV, Wittwer CT (2006) Instru-
mental control of flowering in strawberry. In: Cockshull KE, Gray D, Sey- ment comparison for DNA genotyping by amplicon melting. Journal of the
mour GB, Thomas B (Eds) Genetic and Environmental Manipulation of Hor- Association for Laboratory Automation 11, 273-277
ticultural Crops, CAB International, Wallingford, pp 111-131 Howad W, Yamamoto T, Dirlewanger E, Testolin R, Cosson P, Cipriani G,
Bentley S, Bassam BJ (1996) A robust DNA amplification fingerprinting sys- Monforte AJ, Georgi L, Abbott AG, Arús P (2005) Mapping with a few
tem applied to analysis of genetic variation within Fusarium oxysporum fsp plants: Using selective mapping for microsatellite saturation of the Prunus
cubense. Journal of Phytopathology 144, 207-213 reference map. Genetics 171, 1305-1309
Bonet GJ (2010) Desarrollo y Caracterización de herramientas genómicas en James CM, Wilson F, Hadonou AM, Tobutt KR (2003) Isolation and charac-
Fragaria diploide para la mejora del cultivo de fresa. PhD thesis, Universi- terization of polymorphic microsatellites in diploid strawberry (F. vesca L.)
dad Autonoma de Barcelona. Barcelona, Spain for mapping, diversity studies and clone identification. Molecular Ecology
Bonet J, Lopez-Girona E, Sargent DJ, Muñoz-Torres MC, Monfort A, Notes 3, 171-173.
Abbott AG, Arús P, Simpson DW, Davik J (2009) The development and Jones CJ, Edwards KJ, Castaglione S, Winfield MO, Sala F, van de Weil C,
characterisation of a bacterial artificial chromosome library for Fragaria Bredemeijer G, Vosman B, Matthes M, Daly A, Brettschnieder R, Bettini
vesca. BMC Research Notes 2, 188 P, Buiatti M, Maestri E, Malcevschi A, Marmiroli N, Aert R, Volckaert G,
Boškovi RI, Sargent DJ, Tobutt KR (2010) Genetic evidence that two inde- Rueda J, Linacero R, Vazquez A, Karp A (1997) Reproducibility testing of
pendent S-loci control RNase-based self-incompatibility in diploid strawberry. RAPD, AFLP and SSR markers in plants by a network of European labora-
Journal of Experimental Botany 61 (3), 755-763 tories. Molecular Breeding 3, 381-390
Bringhurst RS, Arulsekar S, Hancock JF, Voth V (1981) Electrophoretic cha- Kamei A, Tsuro M, Kubo N (2010) QTL mapping of clubroot resistance in
racterization of strawberry cultivars. Journal of the American Society for radish (Raphanus sativus L.). Theoretical and Applied Genetics 120, 1021-
Horticultural Science 106, 684-687 1027
Bringhurst RS (1990) Cytogenetics and evolution in American Fragaria. Andrew K, Hopkins CJ, Jewell E, Morrison B, Spangenberg GC, Edwards
HortScience 25, 879-881 D, Batley J (2006) Identification and characterization of simple sequence
Capomaccio S, Barone P, Reale L, Veronesi F, Rosellini D (2009) Isolation of repeat (SSR) markers from Fragaria×ananassa expressed sequences. Mole-
genes from female sterile flowers in Medicago sativa. Sex Plant Reproduc- cular Ecology Notes 6, 319-322
tion 22, 97-107 Kim IJ, Lee BH, Jo J, Chung WI (2001) Sequence variability of nine cytoso-
Chagné D, Gasic K, Crowhurst RN, Han Y, Bassett HC, Bowatte DR, Law- lic ascorbate peroxidases in polyploid strawberry. Mitochondrial DNA 11,
rence TJ, Rikkerink EH, Gardiner SE, Korban SS (2008) Development of 475-484
a set of SNP markers present in expressed genes of the apple. Genomics 92 Konieczny A, Ausubel FM (1993) Procedure for mapping Arabidopsis muta-
(5), 353-358 tions using co-dominant ecotype-specific PCR-based markers. Plant Journal
Cipriani G, Testolin R (2004) Isolation and characterization of microsatellite 4, 403-410
loci in Fragaria. Molecular Ecology Notes 4, 366-368 Korbin M, Kuras A, Zurawicz E (2002) Fruit plant germplasm characterisa-
Cipriani G, Pinosa F, Bonoli M, Faedi W (2006) A new set of microsatellite tion using molecular markers generated in RAPD and ISSR-PCR. Cellular
markers for Fragaria species and their application in linkage analysis. Jour- and Molecular Biology Letters 7 (2B), 785-794
nal of Horticultural Science and Biotechnology 81, 668-675 Kunihisa M, Fukino N, Matsumoto S (2005) CAPS markers improved by
Congiu L, Chicca M, Cella R, Rossi R, Bernacchia G (2000) The use of cluster-specific amplification for identification of octoploid strawberry (Fra-
random amplified polymorphic DNA (RAPD) markers to identify strawberry garia x ananassa Duch.) cultivars, and their disomic inheritance. Theoretical
varieties: A forensic application. Molecular Ecology 9, 229-232 and Applied Genetics 110, 1410-1418
Davis TM, Yu H (1997) A linkage map of the diploid strawberry, Fragaria Kunihisa M, Ueda H, Fukino N, Matsumoto S (2009) Genotyping of straw-
vesca. Journal of Heredity 88, 215-221 berry (Fragaria x ananassa Duch.) cultivars by DNA markers: Interlabora-
Davis TM, DiMeglio LM, Yang RH, Styan SMN, Lewers KS (2006) Assess- tory study. Journal of AOAC International 92 (3), 896-906
ment of SSR transfer from the cultivated strawberry to diploid strawberry Kuras A, Korbin M, Zurawicz E (2004) Comparison of suitability of RAPD
species: Functionality, linkage group assignment, and use in diversity analy- and ISSR techniques for determination of strawberry (Fragaria × ananassa
sis. Journal of the American Society for Horticultural Science 131, 506-512 Duch.) relationship. Plant Cell, Tissue and Organ Culture 79, 189-193
Deleu W, González V, Monfort A, Bendahmane A, Puigdomènech P, Arús P, Lerceteau-Köhler E, Guerin G, Laigret F, Denoyes-Rothan B (2003) Charac-
García-Mas J (2007) Structure of two melon regions reveals high microsyn- terization of mixed disomic and polysomic inheritance in the octoploid straw-
teny with sequenced plant species. Molecular Genetics and Genomics 278, berry (Fragaria×ananassa) using AFLP mapping. Theoretical and Applied
611-622 Genetics 107, 619-628
Deng C, Davis TM (2001) Molecular identification of the yellow fruit color (c) Lerceteau-Köhler E, Guerin G, Denoyes-Rothan B (2005) Identification of
locus in diploid strawberry: A candidate gene approach. Theoretical and Ap- SCAR markers linked to Rca2 anthracnose resistance gene and their assess-
plied Genetics 103, 316-322 ment in strawberry germplasm. Theoretical and Applied Genetics 111, 862-
Folta KM, Staton M, Stewart PJ, Jung S, Bies DH, Jesdurai C, Main D 870
(2005) Expressed sequence tags (ESTs) and simple sequence repeat (SSR) Lewers KS, Styan SMN, Hokanson SC, Bassil NV (2005) Strawberry
markers from octoploid strawberry (Fragaria × ananassa). BCM Plant Biol- GenBank-derived and genomic simple sequence repeat (SSR) markers and
ogy 5, 12-23 their utility with strawberry, blackberry, and red and black raspberry. Journal
Gil-Ariza DJ, Amaya I, Botella MA, Muñoz Blanco J, Caballero JL, López- of the American Society for Horticultural Science 130, 102-115
Aranda JM, Valpuesta V, Sánchez-Sevilla F (2006) EST-derived polymor- Lin J, Davis TM (2000) S1 analysis of long PCR heteroduplexes: Detection of
phic microsatellites from cultivated strawberry (Fragaria x ananassa) are chloroplast InDel polymorphisms in Fragaria. Theoretical and Applied
useful for diversity studies and varietal identification among Fragaria spe- Genetics 101, 415-420
83
McClean PE, Mamidi S, McConnell M, Chikara S, Lee R (2010) Synteny structural genomics. In: Folta KM, Gardiner SE (Eds) Genetics and Geno-
mapping between common bean and soybean reveals extensive blocks of mics of Rosaceae, Springer, New York, NY, pp 437-456
shared loci. BMC Genomics 11, 184 Sargent DJ, Fernández-Fernández F, Ruiz-Rojas JJ, Southerland BG, Pas-
Michaels SD, Amasino RMA (1998) A robust method for detecting single nuc- sey A, Whitehouse AB, Simpson DW (2009b) A genetic linkage map of the
leotide changes as polymorphic markers by PCR. Plant Journal 14, 381-385 cultivated strawberry (Fragaria x ananassa) and its comparison to the dip-
Monfort A, Vilanova S, Davis TM, Arus P (2006) A new set of polymorphic loid Fragaria reference map. Molecular Breeding 24, 293-303
simple sequence repeat (SSR) markers from a wild strawberry (Fragaria Shimomura K, Hirashima K (2006) Development and characterization of sim-
vesca) are transferable to other diploid Fragaria species and to Fragaria × ple sequence repeats (SSR) as markers to identify strawberry cultivars (Fra-
ananassa. Molecular Ecology Notes 6, 197-200 garia x ananassa Duch.). Journal of the Japanese Society for Horticultural
Neff MM, Neff JD, Chory J, Pepper AE (1998) dCAPS, a simple technique Science 75, 399-402
for the genetic analysis of single nucleotide polymorphisms: Experimental Shulaev V, Sargent DJ, Crowhurst RN, Mockler TC, Folkerts O, Delcher
applications in Arabidopsis thaliana genetics. Plant Journal 14, 387-392 AL, Jaiswal P, Mockaitis K, Liston A, Mane SP, Burns P, Davis TM,
Nier S, Simpson DW, Tobutt KR, Sargent DJ (2006) Construction of a Slovin JP, Bassil N, Hellens RP, Evans C, Harkins T, Kodira C, Desany B,
genetic linkage map of an interspecific diploid Fragaria BC1 mapping popu- Crasta OR, Jensen RV, Allan AC, Michael, Setubal JC, Celton J-M, Rees
lation (F. vesca 815 x [F. vesca 815 x F. viridis 903]) and its comparison to DJG, Williams KP, Holt SH, Ruiz Rojas JJ, Chatterjee M, Liu B, Silva
the Fragaria reference map (FVxFN). Journal of Horticultural Science and H, Meisel L, Adato A, Filichkin SA, Troggio M, Viola R, Ashman T-L,
Biotechnology 81, 645-650 Wang H, Dharmawardhana P, Elser J, Raja R, Priest HD, Bryant Jr DW,
Palmieri L, Saviane A, Sordo M, Virzi A, Grando MS, Giongo L (2008) Fox SE, Givan SA, Wilhelm LJ, Naithani S, Christoffels A, Salama DY,
Characterization of Fragaria vesca L. genotypes and through the use of SSR, Carter J, Lopez Girona E, Zdepski A, Wang W, Kerstetter RA, Schwab
SCAR and SNP markers. In: Book of Abstracts. VI International Strawberry W, Korban SS, Davik J, Monfort A, Denoyes-Rothan B, Arus P, Mittler
Symposium ISHS. Huelva, Spain, 3-7 March 2008. CAP Junta de Andalucía. R, Flinn B, Aharoni A, Bennetzen JL, Salzberg SL, Dickerman AW,
2008, 1079 pp 173 Velasco R, Borodovsky M, Veilleux RE, Folta KM (2011) The genome of
Paran I, Michelmore RW (1993) Development of reliable PCR-based markers woodland strawberry (Fragaria vesca). Nature Genetics 43, 109-116
linked to downy mildew resistance genes in lettuce. Theoretical and Applied Smith HO (1970) Nucleotide sequence specificity of restriction endonucleases.
Genetics 85, 985-993 Science 205, 455-462
Polans NO, Weeden NF, Thompson WF (1985) Inheritance, organization and Spigler RB, Lewers KS, Main DS, Ashman TL (2008) Genetic mapping of
mapping of rbcS and cab multigene families in pea. Proceedings of the sex determination in a wild strawberry, Fragaria virginiana, reveals earliest
National Academy of Sciences USA 82, 5083-5087 form of sex chromosome. Heredity 101, 507-517
Pontaroli AC, Rogers RL, Zhang Q, Shields ME, Davis TM, Folta KM, Staudt G (2006) Himalayan species of Fragaria (Rosaceae). Botanische Jahr-
SanMiguel P, Bennetzen JL (2009) Gene content and distribution in the bucher für Systematik 126, 483-508
nuclear genome of Fragaria vesca. The Plant Genome 2 (1), 93-101 Sugimoto T, Tamaki K, Matsumoto J, Yamamoto Y, Shiwaku K, Watanabe
Potter D, Luby JJ, Harrison RE (2000) Phylogenetic relationships among K (2005) Detection of RAPD markers linked to the everbearing gene in Japa-
species of Fragaria (Rosaceae) inferred from non-coding nuclear and chloro- nese cultivated strawberry. Plant Breeding 124, 498-501
plast DNA sequences. Systematic Botany 25, 337-348 Tautz D, Renz M (1984) Simple sequences are ubiquitous repetitive compo-
Qin Y, Teixeira da Silva JA, Zhang L, Zhang Z-L (2008) Transgenic straw- nents of eukaryotic genomes. Nucleic Acids Research 12, 4127-4138
berry: State of the art for improved traits. Biotechnology Advances 26, 219- Varshney RK, Graner A, Sorrells ME (2005) Genic microsatellite markers in
232 plants: Features and applications. Trends in Biotechnology 23, 48-55
Rokas A, Williams B, King N, Carroll S (2003) Genome-scale approaches to Vilanova S, Arús P, Sargent DJ, Monfort A (2008) Synteny conservation
resolving incongruence in molecular phylogenies. Nature 425, 798-804 between two distantly-related Rosaceae genomes: Prunus (the stone fruits)
Rong J, Bowers JE, Schulze SR, Waghmare VN, Rogers CJ, Pierce GJ, and Fragaria (the strawberry). BMC Plant Biology 8, 67
Zhang H, Estill JC, Paterson AH (2005) Comparative genomics of Gossy- Viruel MA, Sánchez D, Arús P (2002) An SSR and RFLP linkage map for the
pium and Arabidopsis: Unraveling the consequences of both ancient and octoploid strawberry (Fragaria × ananassa). In: Plant, Animal and Microbe
recent polyploidy. Genome Research 15, 1198-1210 Genomes. 10th Conference, San Diego, California, USA. Available online:
Rousseau-Gueutin M, Lerceteau-Köhler E, Barrot L, Sargent DJ, Monfort http://www.intl-pag.org/10/abstracts/PAGX_P660.html
A, Simpson DW, Arús P, Guérin G, Denoyes-Rothan B (2008) Compara- Vision TJ, Brown DG, Shmoys DB, Durrett RT, Tanksley SD (2000) Selec-
tive genetic mapping between octoploid and diploid Fragaria species reveals tive mapping: A strategy for optimizing the construction of high-density lin-
a high level of colinearity between their genomes and the essentially disomic kage maps. Genetics 155, 407-420
behavior of the cultivated octoploid strawberry. Genetics 179, 2045-2060 Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A,
Rousseau-Gueutin M, Gaston A, Aïnouche A, Aïnouche ML, Olbricht K, Pot J, Peleman J, Kuiper M, Zabeau M (1995) AFLP: A new technique for
Staudt G, Richard L, Denoyes-Rothan B (2009) Tracking the evolutionary DNA fingerprinting. Nucleic Acids Research 23 (21), 4407-4414
history of polyploidy in Fragaria L. (strawberry): 3 New insights from phy- Wadman M (2008) James Watson’s genome sequenced at high speed. Nature
logenetic analyses of low-copy nuclear genes. Molecular Phylogenetics and 452, 788
Evolution 51, 515-530 Waldron J, Peace CP, Searle IR, Furtado A, Wade N, Graham MW, Carroll
Rousseau-Gueutin M, Richard L, Le Dantec L, Caron H, Denoyes-Rothan BJ (2002) Randomly amplified DNA fingerprinting (RAF): A culmination of
B (2011) Development, mapping and transferability of Fragaria EST-SSRs DNA marker protocols based on arbitrarily primed PCR. Journal of Bio-
within the Rosodae supertribe. Plant Breeding 13, 248-255 medicine and Biotechnology 2, 141-150
Ruiz-Rojas JJ, Sargent DJ, Shulaev V, Dickerman AW, Pattison J, Holt SH, Weber JL (1990) Informativeness of human (dC-dA)n. (dG-dT)n polymor-
Ciordia A, Veilleux RE (2010) SNP discovery and genetic mapping of T- phisms. Genomics 7, 524-530
DNA insertional mutants in Fragaria vesca L. Theoretical and Applied Gene- Weebadde CK, Wang D, Finn CE, Lewers KS, Luby JJ, Bushakra J, Sjulin
tics 121, 449-463 TM, Hancock JF (2008) Using a linkage mapping approach to identify QTL
Sargent DJ, Hadonou AM, Simpson DW (2003) Development and characteri- for day-neutrality in the octoploid strawberry. Plant Breeding 127, 94-101
sation of polymorphic microsatellite markers from Fragaria viridis, a wild Williamson SC, Yu H, Davis TM (1995) Shikamate deshydrogenase allo-
diploid strawberry. Molecular Ecology Notes 3, 550-552 zymes: Inheritance and close linkage to fruit color in the diploid strawberry.
Sargent DJ, Davis TM, Tobutt KR, Wilkinson MJ, Battey NH, Simpson Journal of Heredity 86, 74-76
DW (2004a) A genetic linkage map of microsatellite, gene-specific and mor- Wu F, Tanksley SD (2010) Chromosomal evolution in the plant family Solana-
phological markers in diploid Fragaria. Theoretical and Applied Genetics ceae. BMC Genomics 11, 182
109, 1385-1391 Wu KK, Burnquist W, Sorrells ME, Tew TL, Moore PH, Tanksley SD
Sargent DJ, Geibel M, Hawkins JA, Wilkinson MJ, Battey NH, Simpson (1992) The detection and estimation of linkage in polyploids using single-
DW (2004b) Quantitative and qualitative differences in morphological traits dose restriction fragments. Theoretical and Applied Genetics 83, 294-300
re-vealed between diploid Fragaria species. Annals of Botany 94, 787-796 Wu SB, Tavassolian I, Rabiei G, Hunt P, Wirthensohn M, Gibson JP, Ford
Sargent DJ, Clarke J, Simpson DW, Tobutt KR, Arús P, Monfort A, Vila- CM, Sedgley M (2009) Mapping SNP-anchored genes using high-resolution
nova S, Denoyes-Rothan B, Rousseau M, Folta KM, Bassil NV, Battey melting analysis in almond. Molecular Genetics and Genomics 282, 273-281
NH (2006) An enhanced microsatellite map of diploid Fragaria. Theoretical Wu SB, Wirthensohn MG, Hunt P, Gibson JP, Sedgley M (2008) High reso-
and Applied Genetics 112, 1347-1359 lution melting analysis of almond SNPs derived from ESTs. Theoretical and
Sargent DJ, Rys A, Nier S, Simpson DW, Tobutt KR (2007) The develop- Applied Genetics 118, 1-14
ment and mapping of functional markers in Fragaria and their transferability Yu H, Davis TM (1995) Genetic linkage between runnering and phosphogluco-
and potential for mapping in other genera. Theoretical and Applied Genetics isomerase allozymes, and systematic distortion of monogenic segregation
114, 373-384 ratios in diploid strawberry. Journal of American Horticultural Sciences 120,
Sargent DJ, Cipriani G, Vilanova S, Gil-Ariza D, Arús P, Simpson DW, 687-690
Tobutt KR, Monfort A (2008) The development of a bin mapping popula- Zorrilla-Fontanesi Y, Cabeza A, Torres A, Botella MA, Valpuesta V, Mon-
tion and the selective mapping of 103 markers in the diploid Fragaria ref- fort A, Sánchez-Sevilla JF, Amaya I (2011) Development and bin mapping
erence map. Genome 51, 120-127 of strawberry genic-SSRs in diploid Fragaria and their transferability across
Sargent DJ, Davis TM, Simpson DW (2009a) Strawberry (Fragaria spp.) the Rosoideae subfamily. Molecular Breeding 27, 137-156
84
Chemistry of the Chilean Strawberry

(Fragaria chiloensis spp. chiloensis)
Guillermo Schmeda-Hirschmann1* • Mario Simirgiotis2 • José Cheel3,4
1 Laboratorio de Química de Productos Naturales, Instituto de Química de Recursos Naturales, Universidad de Talca, Casilla 747, Talca, Chile
2 Laboratorio de Productos Naturales, Facultad de Ciencias Básicas, Universidad de Antofagasta, Casilla 170, Antofagasta, Chile
3 Department of Pharmacognosy, Faculty of Pharmacy, Charles University, Heyrovského 1203, 500 05 Hradec Králové, Czech Republic
4 Department of Research and Development, CPN Ltd., Dolní Dobrou 401, 56102 Dolní Dobrou, Czech Republic
Corresponding author: * schmeda@utalca.cl
ABSTRACT
The Chilean strawberry (Fragaria chiloensis spp. chiloensis) is one of the progenitors of the cultivated strawberry, Fragaria × ananassa.
Recent studies have started to disclose the chemical composition of the native fruit, the secondary metabolite occurrence and distribution
in different plant parts as well as the biological activity of the main fruit constituents. This article revises the chemistry of the Chilean
strawberry and compares some of the most characteristic constituents with that of the highly cultivated and worldwide known F. ×
ananassa. The main phenolic in the white strawberry are ellagic acid or hexahydroxydiphenolic acid-based hydrolysable tannins and pro-
cyanidins as well as flavonoid glycosides from quercetin and kaempferol. The general trend in the plant is the accumulation of condensed
tannins of increasing molecular weight in the rhizomes while the leaf contains mainly hydrolysable tannins and flavonoids.
_____________________________________________________________________________________________________________
Keywords: HPLC-DAD-MS, leaf, phenolics, rhizome, secondary metabolites

Abbreviations: DAD, diode array detector; DPPH, diphenylpicrylhydrazyl radical; ESI, electron spray ionization; HHDP, hexahydroxy-
diphenolic acid; HPLC, high performance liquid chromatography; LC, liquid chromatography; MS, mass spectrometry; MS/MS and
MSn, mass spectrometry-mass spectrometry analysis; MW, molecular weight; UV-vis, ultraviolet visible
CONTENTS
INTRODUCTION........................................................................................................................................................................................ 85
The chemistry of Fragaria chiloensis (L.) Duch. .................................................................................................................................... 86
Early studies of the fruits......................................................................................................................................................................... 86
HPLC comparison of phenolics in receptacles (thalamus) and achenes. Total content of polyphenols and antioxidant activity............. 86
Full HPLC-DAD-ESI-MSn analysis ........................................................................................................................................................ 87
Antioxidant properties and HPLC-DAD-ESI-MSn analysis of leaves and rhizomes ............................................................................... 87
CONCLUSION ............................................................................................................................................................................................ 89
REFERENCES............................................................................................................................................................................................. 89
_____________________________________________________________________________________________________________
INTRODUCTION as astringent, to treat dysentery and chronic diarrhea as well

as a diuretic. The root infusion was also recommended as
Gathering of wild fruits and berries for food was a relevant eye drops for sore eyes. The fruits were gathered as a sea-
activity for the hunter-gatherer societies that can be traced sonal food by the already extinct ethnic groups of the
back to prehistoric times all over the world. In Chile, col- Kawashkar (“Alacalufes”) and Selknam (“Onas”) in the
lection of wild fruits, berries and mushrooms was common southernmost part of America. At present, only the fruits are
in pre-Colombian times and provided essential nutrients considered of interest and peasants in the coastal region of
during the summer and food reserves for the winter time. central Chile have selected the white variety as a crop for
In Southern Chile and the southern Andean region of several positive agronomic traits. F. chiloensis is charac-
Argentina, the sweet and aromatic fruits from the native terized for having an intense aroma, and a remarkable pest
strawberry (Fig. 1) known under the Mapuche name Kellén and disease resistance spectrum, along with other charac-
or Llahuén were appreciated as food and medicine (de Mös- teristics that makes it an attractive species for plant research,
bach 1992; Ladio et al. 2007). The Mapuche aborigines such as, manipulation tolerance and long post-harvest life
consumed the fresh fruits during the summer time and dried (Potter and Dale 1994; Hancock et al. 1999). Indeed, re-
the berries for the winter season. The fruits were also fer- search on this species has been focused on its development
mented to prepare “chicha”, a very popular alcoholic beve- as a new exotic berry, as well as for genetic improvement of
rage, which is still consumed. All parts of the plant were F. × ananassa (Hancock et al. 2001; Retamales et al. 2005).
considered to have medicinal properties. The leaves’ infu- The Chilean native strawberry Fragaria chiloensis ssp.
sion was used as a digestive, to stop bleeding and diarrhea chiloensis (L.) Mill. (Rosaceae) occurs in two different
as well as to treat eye complaints (Murillo 1889); de Mös- botanical forms, namely f. patagonica and f. chiloensis. The
bach (1992) refers to the use of the flower calyx in infusion patagonica form has red-coloured fruits and grows in the
to treat indigestion and diarrhea. The roots were indicated wild at latitudes from 35º to 45º, while the chiloensis form
Received: 20 August, 2010. Accepted: 15 January, 2011.

has white fruits and is cultivated by peasants in a small

A coastal area in central Chile, between latitudes 35º and 39º.
F. chiloensis is one of the progenitors of the cultivated
strawberry Fragaria × ananassa Duch, originated by hyb-
ridization of the North American F. virginiana Mill. and F.
chiloensis (L.) Mill. (Retamales et al. 2005).
The chemistry of Fragaria chiloensis (L.) Duch.
Studies on chemical composition of the Chilean strawberry

were first focused on the fruit constituents using antioxidant
tests, some comparison by HPLC-UV-vis detection and bio-
assay-guided isolation of the bioactive compounds sear-
ching for differences in the antioxidant activity and phe-
nolic composition with the commercial and worldwide used
strawberry F. × ananassa. The ripe fruits of Fragaria chilo-
B ensis subsp. chiloensis used for the studies were obtained
from commercial plantations located in the Province of
Arauco, VIII Region, Chile.
Early studies of the fruits
Cheel et al. (2005) reported the isolation and identification

of E-cinnamic acid glycosides, cyanidin-3-O-glucoside and
the amino acid tryptophan from the fruits of the “white”-
coloured F. chiloensis ssp. chiloensis. The free radical sca-
venging effect of the extracts and isolated compounds was
assessed by the bleaching of the diphenylpicrylhydrazyl
radical (DPPH), scavenging of the superoxide anion and
lipoperoxidation in human erythrocytes. The compounds
were also investigated for cytotoxicity on human lung fibro-
blasts (MRC-5, ATTC CCL-171). Most of the antioxidant
compounds were polar constituents with ellagic acid as the
most active product, followed by cyanidin-3-O-glucoside.
C The E-cinnamic acid glycosides presented low antioxidant
effect and comprised 1-O-E-cinnamoyl--D-rhamnopyrano-
side, 1-O-E-cinnamoyl--xylofuranosyl-(16)--D-gluco-
pyranose and 1-O-E-cinnamoyl--D-xylopyranoside (Cheel
et al. 2005).
HPLC comparison of phenolics in receptacles

(thalamus) and achenes. Total content of
polyphenols and antioxidant activity
An HPLC comparison of the compounds’ distribution in the

fruit indicated that the red coloured cyanidin-3-O-glucoside
and free ellagic acid occurs mainly in the achenes while the
E-cinnamic acid glycosides and tryptophane in the thalamus
(Cheel et al. 2005). Further indication on the presence of
hydrolysable tannins in the thalamus was provided by the
identification of gallic acid from the hydrolyzed extract.
The total content of phenolics, anthocyanins and flavonoids
of the receptacles (thalamus) and the achenes from both
D forms of F. chiloensis ssp. chiloensis (f. patagonica and f.
chiloensis) was compared with a commercial accession of F
× ananassa and F. vesca (Cheel et al. 2007). Differences in
the phenolic contents were positively correlated with the
superoxide anion scavenging effect and antioxidant activity
measured by the DPPH discoloration assay. The total phe-
nolic, flavonoid and anthocyanin content in fruits of Fraga-
ria chiloensis ssp. chiloensis form chiloensis and the com-
mercial strawberry F. × ananassa is compared in Table 1.
The cultivars of F. × ananassa and the wild growing F.
chiloensis ssp. chiloensis f. patagonica contains 7-15 times
more anthocyanins than the f. chiloensis fruits. A clear com-
partmentalization can be observed for the different phenolic
antioxidants in the fruits, with most of the total anthocya-
nins (85%) and total flavonoids (77.2%) found in the
achenes of the f. chiloensis. For F. × ananassa and the f.
patagonica of the Chilean strawberry, most of the anthocya-
Fig. 1 (A) White strawberry culture in Contulmo, Region del Bio-Bio, nins (99 and 81.6%) and flavonoids (74.7 and 66.5%), res-
Chile. (B) Fruiting white strawberry. (C) Fragaria chiloensis ssp. chiloen- pectively, occurs in the thalamus (Cheel et al. 2007).
sis f. chiloensis (white strawberry) fruit. (D) Flowering Fragaria chiloen-
sis ssp. chiloensis f. patagonica plant growing at the Andean slopes of
Chillan. A-C: Rudy Montenegro, D: Cristina Theoduloz.
86
Chemistry of the Chilean strawberry. Schmeda-Hirschmann et al.
Table 1 Phenolic, flavonoid and anthocyanin content in fruits of Fragaria chiloensis ssp. chiloensis form chiloensis and the commercial strawberry F. ×
ananassa. Data are presented as mg equivalent/100 g of fresh fruit.
F. chiloensis ssp. chiloensis F. × ananassa
form chiloensis
Phenolic 106.3 mg gallic acid 159-289 mg catechin equivalents (Cordenunsi et al. 2002)
equivalents (Cheel et al. 2007) 161-330 mg gallic acid equivalents (Heinonen et al. 1998; Proteggente et al. 2002; Scalzo et al. 2005)
Flavonoid 30.0 mg quercetin equivalents 46.2 - 78.0 mg catechin equivalents (Meyers et al. 2003)
(Cheel et al. 2007) 123.2 mg quercetin equivalents for F. × ananassa cv. ‘Chandler’ (Cheel et al. 2007)
Anthocyanin 2.3 mg cyanidin-3-glucoside 22.0 - 80.0 mg cyanidin 3-glucoside equivalents (Woodward 1972; Montero et al. 1996; Meyers et al.
equivalents (Cheel et al. 2007) 2003; Skupien and Oszmianski 2004; Cheel et al. 2007; Lopes da Silva et al. 2007)
13.0 - 55.0 mg pelargonidin 3-glucoside equivalents (Cordenunsi et al. 2002)
n
Full HPLC-DAD-ESI-MS analysis potentillin, sanguiin H-6/lambertianin A and agrimoniin iso-
mers. Ellagic acid also occurred in the leaves and this oc-
High performance liquid chromatography with diode-array currence can also be a consequence of hydrolysis during the
detector hyphenated with electrospray ionization mass spec- work-up of the samples. Two quercetins and a kaempferol
trometry detector has been used and resulted an excellent coumaroyl hexoside were also found in the leaves. The
method for analysis and fast fingerprinting of red straw- quercetin (pentoside and glucuronide) derivatives occurring
berry (Seeram et al. 2006; Aaby et al. 2007; Lopes da Silva in leaves and fruits were different from the derivatives
et al. 2007) and white strawberry polyphenols (Simirgiotis detected in the rhizomes (pentoside). However, kaempferol
et al. 2009, 2010). A comparison of the constituents of fruit coumaroyl hexosides were found in the three plant parts
extracts from the forms chiloensis and patagonica of F. studied, leaves, fruits and rhizomes. The total phenolic con-
chiloensis ssp. chiloensis was undertaken by HPLC-DAD tent of Chilean strawberry leaves was similar to that of cul-
and HPLC-ESI-MSn (Simirgiotis et al. 2009, 2010). The tivars of Fragaria × ananassa Duch. (Skupien and Oszmi-
fruits of both forms of the Chilean strawberry contained fla- anski 2004).
vonoid glycosides, tannins (hydrolizable and condensed) The rhizomes presented mainly condensed tannins
and ellagic acid derivatives (Table 2). The flavonoids were based on cyanidin/procyanidin. Sixteen out of the nineteen
identified as glycosides of kaempferol and quercetin. The compounds identified in rhizomes were procyanidins. Three
sugars moieties were identified as pentoses and hexoses but procyanidin trimers, eight tetramers, a pentamer and four
also coumaroyl derivatives of kaempferol were identified hexamers were tentatively identified by HPLC MS-MS
(Simirgiotis et al. 2009). A methyl quercetin glucuronide (Simirgiotis et al. 2010). A quercetin pentoside and a
and two quercetin glycosides were found only in the chilo- kaempferol coumaroyl hexoside are the flavonoid deriva-
ensis form. Anthocyanins found in both strawberry forms tives identified from the rhizomes, the latter also occurring
included glycosides of cyanidine and pelargonidin as well in leaves and fruits. The general trend is the accumulation
as the corresponding malonyl glucosides. Catechin occurred of condensed tannins of increasing molecular weight in the
in the chiloensis form while ellagic acid, its rhamnoside and rhizomes (Table 3). Molecular weights (deprotonated mole-
a pentoside were present in both forms. The hydrolysable cules) and MSn ions can be found in our previous work
tannins in the fruit included several compounds based on (Simirgiotis et al. 2010). Several tannins have been iden-
ellagic acid as well as on HHDP (hexahydroxydiphenolic tified in red strawberry fruits (Seeram et al. 2006; Aaby et
acid, the ellagic acid precursor), the number of compounds al. 2007) and red strawberry leaves (Oertel et al. 2001;
detected were higher for the red coloured fruits of the Hukkanen et al. 2007) including agrimoniin, sanguiin H-6,
patagonica form. Condensed tannins including polymers of and small ellagic acid derivatives.
flavan 3-ol monomeric units were present mainly in the Tannin-containing plants have been traditionally used to
patagonica form. Overall, the main phenolic constituents of cure diarrhea, relieve gastric complains and as astringent.
the white fruits were ellagic acid and quercetin glucuronide. Ferreira et al. (2005), Haslam (2007), Yoshida et al. (2000)
The phenolics occurring in the fruits of the white and red and Yoshida et al. (2005) revised relevant chemical and bio-
Chilean strawberries are summarized in Table 2 (Simirgi- logical aspects of this group of natural products. The chemi-
otis et al. 2009, 2010) Molecular weights (deprotonated cal compounds found in the leaves and rhizomes of the
molecules) and diagnostic daughter ions obtained by MS- Chilean strawberry can, at least in part, explain the tradi-
MS can be found in our previous work (Simirgiotis et al. tional use of the herb infusion to treat indigestion, diarrhea
2009, 2010). Relevant information on HPLC analysis of and dysentery. As further studies with the infusions and
phenolic compounds in berries can be found in Määtä- proper biological assays should be undertaken to clearly
Riihinen et al. (2003) and Määtä-Riihinen et al. (2004). The confirm the traditional indications of use, the association
phenolic constituents of the white strawberry leaf and rhi- with the tannin constituents should be considered a working
zomes are summarized in Table 3 (Simirgiotis et al. 2010). hypothesis.
n
The antioxidant properties of several cultivars of red
Antioxidant properties and HPLC-DAD-ESI-MS strawberries are well known (Asami et al. 2003; Skupien
analysis of leaves and rhizomes and Oszmianski 2004). A comparison of the antioxidant
activity between the red strawberry cultivar Chandler and
The composition of polyphenols in rhizomes and leaves of the white strawberry growing in the same location in Chile
the wild growing F. chiloensis ssp. chiloensis was carried was reported (Simirgiotis et al. 2009). In different straw-
out with samples collected in the western Andean slopes at berry cultivars, Tulipani et al. (2008) reported that the main
Las Trancas, Termas de Chillán, VIII Región, Chile, in the antioxidant compounds were derivatives of ellagic acid.
distribution area of the plant. Flavonoids based on quercetin and kaempferol were also
The chemistry of the Chilean strawberry leaves was detected, but they showed a moderate antioxidant effect.
determined by HPLC-DAD-ESI-MSn and comprised seve- Recently, newer approaches for the treatment of obesity
ral condensed and hydrolizable tannins. Four condensed have involved inhibition of dietary triglyceride absorption
tannins, corresponding to procyanidin tetramers were iden- via inhibition of pancreatic lipase as this is the major source
tified in the leaves, one of them also occurring in rhizomes. of excess calories (Birari and Bhutani 2007). The activity of
Procyanidin tetramers were the most frequent procyanidins extracts from different berries as inhibitors of pancreatic
found in the rhizomes. The hydrolysable tannins occurring lipase in vitro was recently published (McDougall et al.
in the leaves were ellagic acid or HHDP-based compounds 2009). The tannin-rich strawberry extracts tested were rich
and include isomers of castalagin/vescalagin, casuarictin/ in polyphenols composed of ellagitannis and proanthocy-
87
Table 2 Phenolic compounds identified in Fragaria chiloensis ssp. Table 3 Compounds identified in Fragaria chiloensis ssp. chiloensis
chiloensis (f. chiloensis and f. patagonica) fruits by HPLC-DAD, LC- leaves and rhizomes by HPLC-DAD, LC-MS and LC-MS/MS data. x:
MS and LC-MS/MS data. x: Presence Presence
Tentative identification f. f. Tentative compound identification Leaves Rhizomes
chiloensis patagonica Tetragalloylglucose (MW = 964) x
Ellagitannin isomer 1 (MW = 784) x x Procyanidin trimer isomer 1 (MW = 866) x
Ellagitannin isomer 2 (MW = 784) x x Procyanidin trimer isomer 2 (MW = 866) x
Procyanidin tetramer isomer 1 (MW = 1154) x Bis-HHDP-glucose isomer 1 (MW = 784) x
Procyanidin tetramer isomer 2 (MW = 1154) x Procyanidin tetramer isomer 1 (MW = 1154) x
Cyanidin-3-O glucoside* (MW = 449) x x Procyanidin tetramer isomer 2 (MW = 1156) x
Ellagitannin isomer 3 (MW = 934) x Procyanidin tetramer isomer 3 (MW = 1154) x
Ellagitannin isomer 4 (MW = 934) x Bis-HHDP-glucose isomer 2 (MW = 784) x
Pelargonidin-3-O glucoside* (MW = 433) x x Procyanidin tetramer isomer 4 (MW = 1154) x
Catechin* (MW = 290) x Procyanidin tetramer isomer 5 (MW = 1154) x
Ellagitannin isomer 5 (MW = 934) x Procyanidin trimer isomer 3 (MW = 866) x
Cyanidin-malonyl-glucoside (MW = 534) x x Castalagin or vescalagin (MW = 934) x
Pelargonidin-malonylglucoside (MW = 518) x x Procyanidin tetramer isomer 7 (MW = 1154) x
Ellagitannin isomer 7 (MW = 936) x Procyanidin tetramer isomer 8 (MW = 1154) x x
Ellagitannin isomer 8 (MW = 936) x Vescalagin or Castalagin (MW = 934) x
Ellagitannin isomer 9 (MW = 936) x Procyanidin tetramer isomer 9 (MW =1154) x
Ellagic acid pentoside (MW = 434) x x Casuarictin or potentillin (MW = 936) x
Ellagic acid rhamnoside (MW = 448) x x Procyanidin tetramer isomer 11 (MW = 1154) x
Ellagic acid* (MW = 302) x x Sanguiin H-6 or lambertianin A (MW = 1870) x
Quercetin hexoside (MW = 464) x Procyanidin pentamer isomer 1 (MW = 1442) x
Quercetin glucuronide* (MW = 478) x x Agriimoniin isomer 1 (MW = 1870) x
Quercetin pentoside (MW = 436) x x Procyanidin hexamer isomer 1 (MW = 1730) x
Ellagitannin isomer 11 (MW = 934) x x Procyanidin pentamer isomer 2 (MW = 1442) x
Quercetin pentoside (MW = 434) x Agriimoniin isomer 2 (MW = 1870) x
Kaempferol glucuronide (MW = 462) x x Procyanidin hexamer isomer 2 (MW = 1730) x
Methyl-quercetin-glucuronide (MW = 492) x Agriimoniin isomer 3 (MW = 1870) x
Kaempferol coumaroyl-hexoside (MW = 594) x x Procyanidin hexamer isomer 3 (MW = 1730) x
Kaempferol coumaroyl-hexoside (MW = 594) x x Quercetin pentoside (MW = 434) x
*Identified by spectroscopic means and comparison with standard compounds. Quercetin glucuronide (MW = 462) x
Quercetin pentoside (MW = 434) x
Kaempferol coumaroyl-hexoside (MW = 594) x x
anidins. Polyphenols contained in the diet plays a preven-

tive role against infections and improves oral health (Petti
and Scully 2009). However, studies on humans are needed The safety and efficacy properties of this formulation were
to confirm the studies published so far, including the posi- demonstrated using standard toxicology and whole-body
tive impacts against periodontal diseases (Petti and Scully antioxidant status procedures (Yasmin et al. 2003; Bagchi et
2009). In a revision on the biological implications of ellagi- al. 2006). The benefit of Chilean strawberry on skin health
tannins, Clifford and Scalbert (2000) critically examined the remains to be explored.
evidence on absorption, bioavailability and effect of this Oxidation of exogenous flavonoids by laccases secreted
group of compounds in animals. As the hydrolysis product by the roots can play a role in allelophatic plant interactions
of ellagitannins is usually ellagic acid, several effects as- (Pourcel et al. 2007). The autooxidation of quercetin can
cribed to those hydrolizable tannins may have some rela- led to the antifungal compound 3,4-dihydroxybenzoic acid
tionship with this particular compound or its metabolites. (Pourcel et al. 2007).
The main sources of ellagitannins in our diet are berries, In the Rosaceae family, several ellagitannins are usually
including strawberries. However, it is noteworthy that the based on a primary unit of bis-HHDP glucopyranose and
polyphenols that are the most common in the human diet gallotannins on galloyl-bis-HHDP glucopyranose (Okuda et
are not necessarily the most active within the body, either al. 1992; Okuda 2005; Hager et al. 2008). As in the Chilean
because they have a lower intrinsic activity or because they strawberry, Hager et al. (2008) found in blackberries a
are poorly absorbed from the intestine, highly metabolized, series of tannins including castalagin/vescalagin, lamberti-
or rapidly eliminated (Manach et al. 2004). Extensive anin A/sanguiin H-6 but also pedunculagin, casuarictin/
knowledge of the bioavailability of polyphenols and the potentillin, and most of the compounds were found in the
effects of the food matrix of Chilean strawberry is thus seed tissues. In the roots of medicinal Rosaceae plants,
essential if their health effects are to be understood. Clifford Oszmianski et al. (2007) found large amounts of procyani-
and Scalbert (2000) reported the occurrence of casuarictin dins based either on (+) catechin or (-) epicatechin after
in strawberry fruits while other ellagitannins have been thioacidolysis of polymers of proanthocyanidins and ellagic
found in the leaves, as sanguiin H-6, casuarictin, potentillin acid after acid hydrolysis of the plant material. A correlation
and pedunculagin. The information available does not allow of the oxidative changes in hydrolysable tannins and the
a clear conclusion about the possible benefits, risks or harm plant evolution was published by Okuda et al. (2000) with
for human beings due to ellagitannins contained in food. special emphasis in the subclass Rosidae.
The beneficial effect of dietary flavonoids, however, is One of the most important postharvest problems in
better known. The antioxidant and chemopreventive effects commercially cultivated strawberry is gray mold, caused by
of anthocyanins is well documented and was recently re- the fungus Botrytis cinerea Pers (González et al. 2009). The
vised by Wang and Stoner (2008). antifungal activity against B. cinerea declines with advan-
The potential benefit of strawberry extracts as ingredi- cing strawberry fruit maturity (Terry et al. 2004). Schaefer
ents in functional foods and cosmetics was considered to et al. (2008) reported that grape varieties infected with B.
develop a formulation of a synergistic blend (OptiBerry) cinerea decreased fungal damage with increasing anthocya-
containing wild blueberry, bilberry, cranberry, elderberry, nin content. Moreover, anthocyanin-enriched extracts
strawberry, and raspberry seed extracts (Lau et al. 2009). directly inhibited growth rates of nine fruit-rot fungi on agar
88
Chemistry of the Chilean strawberry. Schmeda-Hirschmann et al.
plates. Anthocyanins reduced fungal growth by 50% in the REFERENCES

concentrations that typically characterise unripe black-
berries and by 95% in the concentrations that typify ripe Aaby K, Ekeberg D, Skrede G (2007) Characterization of phenolic com-
blackberries. Current control of Botrytis cinerea by pre-har- pounds in strawberry (Fragaria × ananassa) fruits by different HPLC detec-
tors and contribution of individual compounds to total antioxidant capacity.
vest fungicide application present some practical disadvan-
Journal of Agricultural and Food Chemistry 55, 4395-4406
tages due to fungicide resistance and difficulties to target Asami DK, Hong Y J, Barrett DM, Mitchell AE (2003) Comparison of the
the infection at the point of harvest (Wurms et al. 1999). An total phenolic and ascorbic acid content of freeze-dried and air-dried marion-
alternative approach is to improve host resistance, but re- berry, strawberry, and corn grown using conventional, organic, and sustain-
quires further research to realise its potential. able agricultural practices. Journal of Agricultural and Food Chemistry 51
Studies on the enzymes involved in tannin biosynthesis (5), 1237-1241
have shown the different steps in the formation of complex Bagchi D, Roy S, Patel V, He G, Khanna S, Ojha N, Phillips C, Ghosh S,
molecules including gallotannins and ellagitannins (Grund- Bagchi M, Sen CK (2006) Safety and whole-body antioxidant potential of a
höfer et al. 2001; Niemetz and Gross 2005; Gross 2008). novel anthocyanin-rich formulation of edible berries. Molecular and Cellular
Biochemistry 281, 197-209
The proposed starting compound for the biosynthesis, –
Birari RB, Bhutani KK (2007) Pancreatic lipase inhibitors from natural sour-
glucogallin (1-O-galloyl--D-glucopyranose) led after spe- ces: Unexplored potential. Drug Discovery Today 12, 879-889
cific galloylation steps to the different mono- to penta- Cheel J, Theoduloz C, Rodríguez J, Saud G, Caligari PDS, Schmeda-
galloylglucoses. Enzyme studies with cell-free leaf extracts Hirschmann G (2005) E-cinnamic acid derivatives and phenolics from Chi-
from different tannin-rich plants and immunohistochemical lean strawberry fruits, Fragaria chiloensis ssp. chiloensis. Journal of Agri-
studies with antibodies allowed a much more complete cultural and Food Chemistry 53, 8512-8518
picture of the hydrolysable tannin biosynthesis. According Cheel J, Theoduloz C, Rodríguez J, Caligari P, Schmeda-Hirschmann G
to Grundhöfer et al. (2001), hydrolysable tannins are (2007) Free radical scavenging activity and phenolic content in achenes and
formed in the walls of leaf mesophyll cells and the tannins thalamus from Fragaria chiloensis ssp. chiloensis, F. vesca and F. × ana-
nassa cv. Chandler. Food Chemistry 102, 36-44
are deposited in these cells. In vitro acylation of glucose to
Cordenunsi B, Oliveira do Nascimento JR, Genovese MI, Lajolo FM (2002)
yield pentagalloylglucose is carried out by four galloyl- Influence of cultivar on quality parameters and chemical composition of
transferases to derivatives with higher galloyl substitution. strawberry fruits grown in Brazil. Journal of Agricultural and Food Chemis-
For ellagitannins, Niemetz and Gross (2005) proved that a try 50, 2581-2586
partially purified enzyme fraction was able to catalyze the Clifford MN, Scalbert A (2000) Ellagitannins - nature, occurrence and dietary
oxidation of 1,2,3,4,6-pentagalloylglucose to tellimagrandin burden. Journal of the Science of Food and Agriculture 80, 1118-1125
II and the possible formation in vitro of casuarictin or de Mösbach EW (1992) Botánica Indígena de Chile (2nd Edn), Alfabeta,
peduncularin. The hydrolysable tannins identified so far in Santiago de Chile, 140 pp
the white strawberry and the recent advances in enzymol- Ferreira D, Gross GG, Kolodziej H, Yoshida T (2005) Tannins and related
polyphenols: Fascinating natural products with diverse implications for bio-
ogy of both groups of hydrolysable tannins (ellagitannin
logical systems, ecology, industrial applications and health protection. Phyto-
and gallotannin) opens new perspectives in molecular boil- chemistry 66 (18), 2124-2126
ogy studies looking for the genes regulating biosynthesis of González G, Moya M, Sandoval C, Herrera R (2009) Genetic diversity in
this group of compounds in strawberry. This approach was Chilean strawberry (Fragaria chiloensis): Differential response to Botrytis
applied to understand the flavonoid biosynthesis in F. chilo- cinerea infection. Spanish Journal of Agricultural Research 7, 886-895
ensis (Saud et al. 2009) and correlate the chemical pheno- Gross GG (2008) From lignins to tannins: Forty years of enzyme studies on the
type with the plant molecular background. biosynthesis of phenolic compounds. Phytochemistry 69, 3018-3031
Grundhöfer P, Niemetz R, Schilling G, Gross GG (2001) Biosynthesis and
CONCLUSION subcellular distribution of hydrolyzable tannins. Phytochemistry 57, 915-927
Hager TJ, Howard LR, Liyanage R, Lay JO, Prior RL (2008) Ellagitannin
composition of blackberry as determined by HPLC-ESI-MS and MALDI-
The information presented in this article can provide to che- TOF-MS. Journal of Agricultural and Food Chemistry 56, 661-669
mists, plant breeders and molecular biologists information Hancock JF, Lavin A, Retamales JB (1999) Our southern strawberry heritage:
on the secondary metabolism, antioxidant activity, chemical Fragaria chiloensis of Chile. HortScience 34, 814-816
diversity and distribution of different phenolic compounds Hancock JF, Callow PW, Dale A, Luby JJ, Finn CE, Hokanson SC, Hum-
in the native white strawberry, opening possibilities for mer KE (2001) From the Andes to the Rockies: Native strawberry collection
more accurate studies on the biosynthesis of selected com- and utilization. HortScience 36, 221-225
pounds with desirable biological properties. Knowing the Haslam E (2007) Vegetable tannins-lessons of a phytochemical lifetime. Phyto-
type and quantity of beneficial compounds in this local chemistry 68 (22), 2713-2721
Heinonen MI, Meyer AS, Frankel EN (1998) Antioxidant activity of berry
strawberry can be also a starting point for food and plant
phenolics on human low-density lipoprotein and liposome oxidation. Journal
biotechnologists, to produce a higher-antioxidant or high- of Agricultural and Food Chemistry 46, 4107-4112
yield polyphenolic strawberry, managing phenol contents Hukkanen AT, Kokko HI, Buchala AJ, McDougall, GJ, Stewart D, Karen-
by plant breeding and selection, to cope the local and par- lampi SO, Karjalainen RO (2007) Benzothiadiazole induces the accumula-
tially global demand for optimized levels of beneficial phe- tion of phenolics and improves resistance to powdery mildew in strawberries.
nolic compounds and nutraceutics in crop plants. However, Journal of Agricultural and Food Chemistry 55, 1862-1870
much more research work should be performed, including Ladio A, Lozada M, Weigandt M (2007) Comparison of traditional wild plant
fruits in different stages of development (immature, turning, knowledge between aboriginal communities inhabiting arid and forest envi-
ripe fruits), influence of geographical location, environ- ronments in Patagonia, Argentina. Journal of Arid Environments 69, 695-715
Lau FC, Bagchi M, Zafra-Stone S, Bagchp D (2009) The benefits of antioxi-
mental conditions and different agronomic practices to ob-
dant-rich fruits on skin health. In: Tabor A, Blair RM (Eds) Nutritional Cos-
tain a clear picture of the secondary metabolites variation metic, Beauty from Within, Elsevier Inc., pp 217-232
and content within the white strawberry. The difference in Lopes da Silva F, Escribano-Bailón MT, Pérez Alonso JJ, Rivas-Gonzalo
fruit colour between the two botanical forms of Fragaria JC, Santos-Buelga C (2007) Anthocyanin pigments in strawberry. LWT
chiloensis was recently shown to be coincident with dif- Food Science and Technology 40, 374-382
ferent transcriptional patterns in the anthocyanin-related Määtä-Riihinen KR, Kamal-Elin A, Törrönen AR (2003) High-performance
genes (Salvatierra et al. 2010). liquid chromatography (HPLC) analysis of phenolic compounds in berries
with diode array and electrospray ionization mass spectrometric (MS) detec-
ACKNOWLEDGEMENTS tion: Ribes species. Journal of Agricultural and Food Chemistry 51, 6736-
6744
Määtä-Riihinen KR, Kamal-Elin A, Törrönen AR (2004) Identification and
We are grateful to the Programa de Investigación en Productos quantification of phenolic compounds in berries of Fragaria and Rubus
Bioactivos, Universidad de Talca, for financial support. Mario species (Family Rosaceae). Journal of Agricultural and Food Chemistry 52,
Simirgiotis is a research member of CONICET. José Cheel thanks 6178-6187
the project MSM 0021620822. Manach C, Scalbert A, Morand C, Rémésy C, Jiménez L (2004) Polyphe-
nols: Food sources and bioavailability. American Journal of Clinical Nut-
rition 79, 727-747
McDougall GJ, Kulkarni NN, Stewart D (2009) Berry polyphenols inhibit
89
pancreatic lipase activity in vitro. Food Chemistry 115 (1), 193-199 noid pathway in the white-fruited Chilean strawberry, Fragaria chiloensis
Meyers KJ, Watkins CB, Pritts MP, Liu RH (2003) Antioxidant and antipro- (L.) Mill. Genetic Resources and Crop Evolution 56, 895-903
liferative activities of strawberries. Journal of Agricultural and Food Che- Scalzo J, Politi A, Pellegrini N, Mezzetti B, Battino M (2005) Plant genotype
mistry 51, 6887-6892 affects total antioxidant capacity and phenolic contents in fruit. Nutrition 21,
Montero TM, Mollá EM, Esteban RM, López-Andréu FJ (1996) Quality 207-213
attributes of strawberry during ripening. Scientia Horticulturae 65, 239-250 Schaefer HM, Rentzsch M, Breuer M (2008) Anthocyanins reduce fungal
Murillo A (1889) Plantes Médicinales du Chili. Exposition Universelle de growth in fruits. Natural Product Communications 3, 1267-1272
Paris, Section Chilienne, Biblioteca Nacional, Paris, 234 pp Seeram NP, Lee R, Scheuller HS, Heber D (2006) Identification of phenolic
Niemetz R, Gross GG (2005) Enzymology of gallotannin and ellagitannin bio- compounds in strawberries by liquid chromatography electrospray ionization
synthesis. Phytochemistry 66 (17), 2001-2011 mass spectroscopy. Food Chemistry 97, 1-11
Oertel B, Keutgen N, Lenz F (2001) Responses of strawberry to long-term ele- Simirgiotis MJ, Theoduloz C, Caligari PDS, Schmeda-Hirschmann G
vated atmospheric ozone concentrations II. Changes of soluble phenol con- (2009) Comparison of phenolic composition and antioxidant properties of
tents in leaves. Gartenbauwissenschaft 66, 164-171 two native Chilean and one domestic strawberry genotypes. Food Chemistry
Okuda T, Yoshida, T, Hatano T, Iwasaki M, Kubo M, Orime T, Yoshizaki M, 113, 377-385
Naruhashi N (1992) Hydrolysable tannins as chemotaxonomic markers in Simirgiotis MJ, Schmeda-Hirschmann G (2010) Determination of phenolic
the Rosaceae. Phytochemistry 31 (9), 3091-3096 composition and antioxidant activity in fruits, rhizomes and leaves of the
Okuda T (2005) Systematics and health effects of chemically distinct tannins in white strawberry (Fragaria chiloensis spp. chiloensis form chiloensis) using
medicinal plants. Phytochemistry 66, 2012-2031 HPLC-DAD-electrospray tandem mass spectrometry and free radical quen-
Okuda T, Yoshida T, Hatano T (2000) Correlation of oxidative transforma- ching techniques. Journal of Food Composition and Analysis 23, 545-553
tions of hydrolyzable tannins and plant evolution. Phytochemistry 55, 513- Skupien K, Oszmianski J (2004) Comparison of six cultivars of strawberries
529 (Fragaria × ananassa Duch.) grown in northwest Poland. European Food
Oszmianski J, Wojdylo A, Lamer-Zarawska E, Swiader K (2007) Antioxi- Research and Technology 219, 66-70
dant tannins from Rosaceae plant roots. Food Chemistry 100 (2), 579-583 Terry LA, Joyce DC, Adikaram NKB, Khambay BPS (2004) Preformed anti-
Petti S, Scully C (2009) Polyphenols, oral health and disease: A review. Jour- fungal compounds in strawberry fruit and flower tissues. Postharvest Biology
nal of Dentistry 37 (6), 413-423 and Technology 31, 201-212
Potter J, Dale A (1994) Wild and cultivated strawberry with tolerance or resis- Tulipani S, Mezzetti B, Capocasa F, Bompadre S, Beekwilder J, Ric de Vos
tance to root-lesion nematode. HortScience 29, 1074-1077 CH, Capanoglu E, Bovy A, Battino M (2008) Antioxidants, phenolic com-
Pourcel L, Routaboul JM, Cheynier V, Lepiniec L, Debeaujon I (2007) Fla- pounds, and nutritional quality of different strawberry genotypes. Journal of
vonoid oxidation in plants: From biochemical properties to physiological Agricultural and Food Chemistry 56, 696-704
functions. Trends in Plant Science 12 (1), 29-36 Wang LS, Stoner GD (2008) Anthocyanins and their role in cancer prevention.
Proteggente AR, Sekher Pannalaa A, Paganga GA, Van Buren L, Wagner E, Cancer Letters 269 (2), 281-290
Wiseman S (2002) The antioxidant activity of regularly consumed fruit and Woodward JR (1972) Physical and chemical changes in developing strawberry
vegetables reflects their phenolic and vitamin C composition. Free Radical fruits. Journal of the Science of Food and Agriculture 23, 465-473
Research 36, 217-233 Wurms KV, Long PG, Sharrock KR, Greenwood DR (1999) The potential
Retamales JB, Caligari PDS, Carrasco B, Saud G (2005) Current status of for resistance to Botrytis cinerea by kiwifruit. Crop Protection 18, 427-435
the Chilean native strawberry and the research needs to convert the species Yasmin T, Sen CK, Hazra S, Bagchi M, Bagchi D, Stohs SJ (2003) Antioxi-
into a commercial crop. HortScience 40, 1633-1634 dant capacity and safety of various anthocyanin berry extract formulations.
Salvatierra A, Pimentel P, Moya-Leon MA, Caligari PDS, Herrera R (2010) Research Communications in Pharmacology and Toxicology 2, 25-33
Comparison of transcriptional profiles of flavonoid genes and anthocyanin Yoshida T, Hatano T, Ito H (2005) High molecular weight plant polyphenols
contents during fruit development of two botanical forms of Fragaria chilo- (tannins): Prospective functions. Recent Advances in Phytochemistry 39, 163-
ensis ssp. chiloensis. Phytochemistry 71, 1839-1847 190
Saud G, Carbone F, Perrotta G, Figueroa CR, Moya M, Herrera R, Reta- Yoshida T, Hatano T, Ito H, Okuda T (2000) Chemical and biological pers-
males JB, Carrasco B, Cheel J, Schmeda-Hirschmann G, Caligari PDS pectives of ellagitannin oligomers from medicinal plants. Studies in Natural
(2009) Transcript profiling suggests transcriptional repression of the flavo- Products Chemistry 23, 395-453
90
Functional Genomics in Strawberry Fruit

through RNAi-mediated Silencing
Wilfried Schwab* • Thomas Hoffmann • Gregor Kalinowski • Anja Preuß
Biotechnology of Natural Products, Technical University München, Liesel-Beckmann-Str. 1, 85354 Freising, Germany
Corresponding author: * schwab@wzw.tum.de
ABSTRACT
Down-regulation of gene expression by RNA interference (RNAi) has become a powerful tool to investigate gene functions in vivo. In
this review we examine how RNAi has been used to assess gene function in strawberry fruit, including molecular mechanisms and
analysis of silenced phenotypes. The down-regulated genes include FaCHS, FaOMT, FaGT1, FaDFR, FaANS, and Fra encoding proteins
functioning in the flavonoid biosynthetic pathway. A comparison with stably transformed genotypes shows how spatial silencing of gene
expression in fruit may affect metabolite patterns.
_____________________________________________________________________________________________________________
Keywords: firmness, flavonoid pathway, fruit ripening, pigments, quality, RNA interference
CONTENTS
INTRODUCTION........................................................................................................................................................................................ 91
FORWARD AND REVERSE GENETICS .................................................................................................................................................. 91
RNAi ............................................................................................................................................................................................................ 92
TRANSIENT ASSAYS ................................................................................................................................................................................ 92
GENE FUNCTION ANALYSIS IN STRAWBERRY ................................................................................................................................. 92
FLAVONOID PATHWAY............................................................................................................................................................................ 95
FaCHS..................................................................................................................................................................................................... 95
FaOMT .................................................................................................................................................................................................... 95
FaGT1 ..................................................................................................................................................................................................... 96
FaDFR..................................................................................................................................................................................................... 96
FaANS ..................................................................................................................................................................................................... 97
Fra........................................................................................................................................................................................................... 97
CONCLUSION ............................................................................................................................................................................................ 97
REFERENCES............................................................................................................................................................................................. 98
_____________________________________________________________________________________________________________
INTRODUCTION several thousands from the cultivated octoploid strawberry

F. x ananassa have been deposited in GenBank. Besides,
Fruit are rich in essential nutrients and are an important part microarray experiments monitoring gene transcription acti-
of the human diet. Besides, they contain secondary plant vity during fruit development is available (Aharoni and
products that bring benefits to human health (Schreiner and O’Connell 2002).
Huyskens-Keil 2006). Strawberries, for example are an ex- But completely sequencing an organism’s genome is
cellent source of vitamin C and numerous health-promoting just the beginning of our understanding of that organism’s
metabolites (Agius et al. 2003; Szajdek and Borowska biology. All of the genes still need to be identified. The
2008). To fully exploit the nutritional value of strawberry, function of the gene products (functional RNAs and pro-
researchers need access to the entire genetic code (genome) teins) must be elucidated and the non-coding regulatory
of strawberries as well as research tools that will allow sequences need to be understood. Determination of the
them to study the roles of the numerous genes and to engi- gene’s role presents a tremendous challenge, not only
neer beneficial agronomic traits such as pathogen resistance, because of the large number of genes to be examined, but
drought tolerance, and fruit quality into strawberry crops also because defining what constitutes a ‘gene’ is itself a
(Yonekura-Sakakibara and Saito 2006). complex problem (Alonso and Ecker 2006).
An international consortium of researchers has already
sequenced the genome of the diploid woodland strawberry, FORWARD AND REVERSE GENETICS
Fragaria vesca, which has one of the smallest genomes of
economically significant plants. The 14 chromosomes of the Gene function analysis is currently performed by two fun-
genome comprise a total of 206 million base pairs of DNA damentally different approaches (Tisser and Bourgeois
(Shulaev et al. 2008, 2011). In addition to the published F. 2001). Forward genetics seeks to identify mutations that
vesca genome sequence, a large set of approximately produce a certain phenotype. Conversely, reverse genetics
50,000 expressed sequence tags (ESTs) from F. vesca and begins with a candidate gene and analyzes the mutant
Received: 22 December, 2009. Accepted: 19 April, 2011.

A pBI-Intron
control construct carrying the glucuronidase gene separated by an intron
35S GUS i nos
B pBI-(target gene)i
intron-containing construct encoding a self-complementary ‘hairpin’ RNA (ihpRNA)
of a partial sequence of the gene of interest
35S target gene i target gene nos
Fig. 1 Constructs used for RNAi-mediated transient gene silencing in ripening strawberry fruit. Control construct (A) and ihpRNA constructs (B).
phenotype that results upon its disruption. The advent of GENE FUNCTION ANALYSIS IN STRAWBERRY
whole genome sequencing has led to an increased interest in
reverse genetic methodologies (Alonso and Ecker 2006). A collection of characterized protein-coding genes of Fra-
Using reverse genetics, it is possible to investigate the func- garia, including genes involved in fruit softening, pigment
tion of all genes in a gene family, something not easily done and aroma formation shows that functional genomics in
with forward genetics. Further, one can study the function strawberry is mainly confined to in silico prediction and
of a gene found to be involved in a process of interest in gene expression analysis (Table 1). Although informative,
another organism, but for which no forward genetic mutants these types of data alone are typically not sufficient to
have yet been identified. Finally, the vast majority of genes define the function of a gene, as by its very nature this
have not yet been mutated in most organisms and reverse information is largely correlative. Only in a few cases more
genetics allows their study. The availability of complete reliable methods such as the testing of recombinant proteins
genome sequences combined with reverse genetics can for catalytic activity and reverse genetics approaches were
allow every gene to be studied.
RNAi
A
A key to the characterization of gene function by reverse
genetics is down-regulation of endogenous genes via post-
transcriptional gene silencing (PTGS). Among different
types of PTGS, RNA interference (RNAi) denotes a se-
quence-specific gene-silencing mechanism that is initiated
by the introduction of double-stranded RNA (dsRNA),
homologous in sequence to the silenced gene, which trig-
gers degradation of mRNA (Filipowicz et al. 2005). RNAi
utilizes the endonuclease Dicer to generate small interfering
RNAs (siRNAs) from dsRNA. The RNAi induced silencing
(RISC) complex then destroys specific target mRNAs based
on sequence complementarities with the siRNA. RNAi-
based silencing is an excellent strategy for reverse genetics
in plants (Small 2007). It has become a powerful tool to B
silence the expression of target genes and study their loss-
of-function phenotype, allowing analysis of gene function
when mutant alleles are not available.
TRANSIENT ASSAYS
Commonly, reverse genetics is carried out by generation

and evaluation of stable transgenic plants that show higher
or lower transcript levels for the gene of interest (Folta and
Dhingra 2006). This process is labor-intensive, time-con-
suming, and usually takes several months depending on the
plant species used. In addition, transgene expression in
transgenic plants often varies significantly due to insert
position and other effects, thus complicating data analysis.
Transient assays such as biolistic transient transformation,
polyethylene glycol mediated transformation and electro-
poration provide a convenient alternative to stable transfor-
mation. In plants, the most widely used method, commonly
named agroinfiltration, makes use of Agrobacterium tume-
faciens to deliver transgenes into cells (Hellens et al. 2005).
Compared to the generation of stably transformed plants,
agroinfiltration is more rapid, and samples can be analyzed
a few days after inoculation. Agroinfiltration has been used
successfully in many different applications, including the Fig. 2 Agroinfiltration of strawberry fruit and ripening of agroinfil-
analysis of disease resistance genes, plant promoters and trated fruits. Fruits are infiltrated with a suspension of Agrobacterium
transcription factors (Yang et al. 2000; Santos-Rosa et al. tumefaciens harboring ihpRNA-encoding constructs (A). After agroinfil-
2008). tration the fruits remain attached to the plant until full maturity (B).
92
Functional genomics in strawberry fruit. Schwab et al.
Table 1 Functionally characterized structural genes in Fragaria.

Gene Enzyme Putative function Method Reference
Enzyme coding genes
FaEG3 endo--(1,4)-glucanase softening, cellulose degradation antisense Mercado et al. 2010
Facel1/2 endo--(1,4)-glucanase no effect on firmness antisense Palomer et al. 2006
Facel1/2 endo--(1,4)-glucanase softening, cellulose degradation antisense Woolley et al. 2001
Facel1/2 endo--(1,4)-glucanase softening, cellulose degradation expression analysis Harpster et al. 1998; Llop-Tous et al.
1999
FaEG1/3 endo--(1,4)-glucanase softening, cellulose degradation expression analysis Trainotti et al. 1999
FaBG2-1/2/3 -1,3-glucanase pathogenesis-related expression analysis Khan et al. 2003; Shi et al. 2006
FaXyl1 -xylosidase softening, hemicellulose expression analysis Martinez et al. 2004; Bustamante et
degradation al. 2009
FaXyl1 -xylosidase softening, hemicellulose expression analysis; Bustamante et al. 2006
degradation recombinant protein testing
FaAra1/2/3 -L-arabinofuranosidase softening, hemicellulose expression analysis Rosli et al. 2009
degradation
FaPE1 to 4 pectin methyl esterase softening, pectin degradation expression analysis Castillejo et al. 2004
FaPE1 to 4 pectin methyl esterase elicitation of defense responses overexpression Osorio et al. 2008
FaplA/B pectate lyase softening, pectin degradation expression analysis Medina-Escobar et al. 1997;
Benitez-Burraco et al. 2003
Fapl pectate lyase softening, pectin degradation antisense Jimenez-Bermudez et al. 2002;
Sesmero et al. 2007; Santiago-
Domenech et al. 2008; Sesmero et
al. 2009
FaplC pectate lyase softening, pectin degradation cosuppression Youssef et al. 2009
FcPG1, FcPL1 polygalacturonase, pectate lyase softening, pectin degradation expression analysis Figueroa et al. 2008
FaPG polygalacturonase softening, pectin degradation antisense Garcia-Gago et al. 2009, Quesada et
al. 2009
SpG, FaPG polygalacturonase softening, pectin degradation expression analysis Redondo-Nevado et al. 2001;
Villarreal et al. 2008; Villarreal et al.
2009
FaChi2-1/2-2 chitinase pathogenesis-related expression analysis Khan and Shih 2004
Faßgal1/2/3 -galactosidase softening expression analysis, Trainotti et al. 2001
recombinant protein testing
FaCCR cinnamoyl CoA reductase firmness expression analysis Salentijn et al. 2003
FaCAD cinnamyl alcohol dehydrogenase firmness expression analysis Salentijn et al. 2003
FaCAD1/2 cinnamyl alcohol dehydrogenase firmness expression analysis, Blanco-Portales et al. 2002
GalUR D-galacturonic acid reductase L-ascorbate biosynthesis overexpression Agius et al. 2003; Hemavathi et al.
2009
FaGLDH L-galactono-1,4-lactone L-ascorbate biosynthesis expression analysis Oliveira do Nascimento et al. 2005
SAAT alcohol acyl-CoA transferase aroma, fruit ester formation expression analysis, Aharoni et al. 2000
FcAAT1 alcohol acyl-CoA transferase aroma, fruit ester formation expression analysis Gonzalez et al. 2009
FvAAT alcohol acyl-CoA transferase aroma, fruit ester formation recombinant protein testing, Beekwilder et al. 2004
overexpression
FaAAT alcohol acyl-CoA transferase aroma, fruit ester formation expression analysis Carbone et al. 2006
FaNES1 S-nerolidol/S-linalool synthase aroma, mono- and sesquiterpene recombinant protein testing Aharoni et al. 2004
formation
FaNES1 S-nerolidol/S-linalool synthase aroma, mono- and sesquiterpene overexpression Aharoni et al. 2004; Yang et al. 2008
formation
FaPIN pinene synthase aroma, monoterpene formation recombinant protein testing Aharoni et al. 2004
FaPHy pinene hydroxylase aroma, monoterpene formation recombinant protein testing Aharoni et al. 2004
Fapdc1/3 pyruvate decarboxylase aroma expression analysis Moyano et al. 2004
FaADH alcohol dehydrogenase aroma sequence similarity Wolyn and Jelenkovic 1990
FaOMT O-methyltransferase aroma, furanone formation antisense Lunkenbein et al. 2006c
FaOMT O-methyltransferase aroma, furanone formation expression analysis, Wein et al. 2002
FaQR quinone (enone) oxidoreductase aroma, furanone formation expression analysis, Raab et al. 2006; Klein et al. 2007
FaSDH sorbitol dehydrogenase sugar metabolism expression analysis Sutsawat et al. 2008; Duangsrisai et
al. 2007
FaS6PDH sorbitol-6-phosphate sugar metabolism expression analysis Duangsrisai et al. 2007
dehydrogenase
FagpS, ADP-glucose pyrophosphorylase starch biosynthesis expression analysis Park and Kim 2007
FagpL1/2
FagpS ADP-glucose pyrophosphorylase starch biosynthesis antisense Park et al. 2006
FaCHS chalcone synthase pigment formation antisense Lunkenbein et al. 2006b
FaCHS chalcone synthase pigment formation transient RNAi Hoffmann et al. 2006
FaCHS, chalcone synthase, pigment formation expression analysis Li et al. 2003
FaDFR dihydroflavonol 4- reductase
FaDFR dihydroflavonol 4-reductase pigment formation expression analysis Moyano et al. 1998
FaDFR dihydroflavonol 4-reductase pigment formation expression analysis, Almeida et al. 2007
93
Table 1 (Cont.)
Enzyme coding genes
FaF3h flavanone 3-hydroxylase pigment formation candidate gene approach Deng and Davis 2001
FaFHT flavanone 3-hydroxylase pigment formation expression analysis, Almeida et al. 2007
FaFLS flavonol synthase pigment formation expression analysis, Almeida et al. 2007
FaANS anthocyanidine synthase pigment formation expression analysis, Almeida et al. 2007
FaLAR leucoanthocyanidin reductase pigment formation expression analysis, Almeida et al. 2007
FaANR anthocyanidin reductase pigment formation expression analysis, Almeida et al. 2007
FaFGT anthocyanidin glucosyltransferase pigment formation expression analysis, Almeida et al. 2007
FaGT1 anthocyanidin glucosyltransferase pigment formation expression analysis, Griesser et al. 2008a
recombinant protein testing,
transient RNAi
FaGT2 UDP-glucose:cinnamate phenlypropanoid metabolism expression analysis, Lunkenbein et al. 2006a
glucosyltransferase recombinant protein testing,
antisense
FaGT6/7 flavonol glucosyltransferases flavonoid metabolism expression analysis, Griesser et al. 2008b
FaCDPK1 calcium-dependent protein kinase fruit development expression analysis Llop-Tous et al. 2002
FaACO1/2 1-aminocyclopropane-1- ethylene biosynthesis expression study Trainotti et al. 2005
carboxylic acid oxidase
FaCGS cystathionine -synthase methionine biosynthesis expression analysis Marty et al. 2000
Fapmsr methionine sulfoxide reductase repair of proteins and peptides expression analysis, Lopez et al. 2006
FaCCD1 carotenoid cleavage dioxygenase lutein degradation expression analysis, Garcia-Limones et al. 2008
APxSC cyctosolic ascorbate peroxidase gluthathione-ascorbate cycle expression analysis Kim and Chung 1998a, 1998b; Kim
et al. 2001
FacpFBP chloroplastic fructose-1,6- photosynthesis complementation assay Serrato et al. 2009
diphosphate
FaPLD phospholipase D alpha membrane deterioration recombinant protein testing Yuan et al. 2005
FaSTK serine-threonine kinases protein modification sequence similarity Martinez Zamora et al. 2008
Other protein coding genes
FaCyf1 phytocystatin cystein protease inhibitor, recombinant protein testing Martinez et al. 2005
antifungal
FaEtr1/2, ethylene resistant, ethylene ethylene receptor expression analysis Trainotti et al. 2005
FaErs1 response sensor
FaTCTP translationally controlled tumor fruit ripening expression analysis Lopez and Franco, 2006
protein
FaPGIP polygalacturonase-inhibiting defense expression analysis Mehli et al. 2004
protein
FaWRKY1 transcription factor regulator of defense overexpression Encinas-Villarejo et al. 2009
FaOLP osmotin-like protein pathogenesis-related, stress expression analysis Wu et al. 2001; Zhang and Shih 2007
Fxaltp non-specfic lipid transfer protein stress expression analysis Yubero-Serrano et al. 2003
FaNBS nucleotide binding site protein resistance sequence similarity Xu et al. 2007
FaRB7 tonoplast intrinsic protein resistance expression analysis Vaughan et al. 2006
FaCBF1 cold-induced transcription factor cold acclimation response overexpression Owens et al. 2002
STAG1 MADS box, AGAMOUS vegetative, floral, fruit expression analysis Rosin et al. 2003
homolog development
FaAP1, APETALA1, LEAFY floral identity, floral integrator expression analysis Mouhu et al. 2009
FaLFY
FaH4 histone H4 flowering process expression analysis Kurokura et al. 2006
Fanjjs4 low molecular weight heat shock seed maturation, fruit ripening expression analysis Medina-Escobar et al. 1998
protein
FaExp1 to 6 expansin cell wall proteins softening, cell wall disassembly expression analysis Civello et al. 1999; Dotto et al. 2006;
Figueroa et al. 2009
Fcor1/2/3 cold-regulated protein cold acclimation response expression analysis Ndong et al. 1997; Zalunskaite et al.
2008
FABP1 auxin-binding protein auxin perception expression analysis Lazarus et al. 1996
FapPCM1 plant calmodulin tuberization process, signal expression analysis Jena et al. 1989
transduction
FaPIP1 plasma membrane intrinsic aquaporin, water channel expression analysis, Mut et al. 2008
protein overexpression
FaGAST small protein with 12 cysteine arresting cell elongation expression analysis, de la Fuente 2006
residues overexpression
FaZIP Zn- and Fe-regulated transporter mineral uptake expression analysis Shi and Shih 2006
94
Table 1 (Cont.)
Other protein coding genes
FaMET, DNA methyltransferases methylation of cytosine residues expression analysis Chang et al. 2009
FaDRM in DNA
Fra pathogenesis-related protein, flavonoid biosynthesis expression analysis, Muñoz et al. 2010
allergen transient RNAi
FaMYB1 transcription factor regulation of pigment overexpression Aharoni et al. 2001
biosynthesis
FaHyprp hybrid proline-rich protein polyphenol anchoring expression analysis Blanco-Portales et al. 2004
used to assign gene functions. Only recently, a fast and easy tor with the GUS gene. Agroinfiltration of pBI-Intron gave
to perform RNAi-based approach has been presented to test the best results when the injection occurred at least 10 days
hypotheses about specific gene functions in strawberry post-pollination. Even after 2 days GUS activity was detec-
(Hoffmann et al. 2006). In this transient assay, an Agrobac- table (Hoffmann et al. 2006). Reproducible and efficient
terium strain carrying a T-DNA expressing an intron-con- silencing of the Fragaria x ananassa CHS (FaCHS) gene
taining construct encoding a self-complementary ‘hairpin’ was achieved with the vector pBI-CHSi that was generated
RNA (ihpRNA) transgene (pBI-(target gene)i) is injected by inserting a 303-bp fragment of FaCHS in the sense and
with a syringe into receptacles of growing strawberry fruits antisense orientation interrupted by an intron in the pBI-
still attached to the plant (Figs. 1, 2). The RNA-mediated Intron to replace GUS (Fig. 1). Agroinfiltration of pBI-
regulation process generally results in sequence-specific in- CHSi resulted in strawberry fruit with white regions, a clear
hibition of gene expression such as the degradation of com- sign of impaired anthocyanin accumulation (Fig. 4). Fruits
plementary endogenous mRNAs. A vector carrying the glu- infiltrated with Agrobacterium carrying the pBI-Intron con-
curonidase gene (GUS) separated by an intron (pBI-Intron) trol vector turned completely red like the untreated fruit.
serves as a control (Fig. 1). The general applicability of the Suppression of FaCHS was confirmed by semiquantitative
transient RNAi method has been demonstrated by the RT-PCR, enzyme activity assays and metabolite analyses
downregulation of flavonoid biosynthesis genes (Griesser et (Fig. 5; Hoffmann et al. 2006). FaCHS-silenced receptacles
al. 2008a; Muñoz et al. 2010). produced statistically lower levels of downstream (pelargo-
nidin derivatives) but higher levels of upstream metabolites
FLAVONOID PATHWAY (phenylpropanoid derivatives) than the receptacles agroin-
filtrated with the pBI-Intron control vector. Thus, FaCHS
Flavonoids are a major class of plant secondary metabolites was successfully downregulated by agroinfitration of pBI-
that serves a multitude of functions. They have key roles in FaCHSi and led to a redirection of the intermediates of the
signaling between plants and microbes, in male fertility of flavonoid to the phenylpropanoid pathway.
some species, in defense as antimicrobial agents and as
feeding deterrents, and in UV protection (Winkel-Shirley FaOMT
2001). Flavonoids are synthesized from phenylpropanoid
derivatives by condensation with malonyl-CoA (Fig. 3). In an study to clarify the biosynthesis of the aroma com-
The reaction is catalyzed by chalcone synthase (CHS) and pound 2,5-dimethyl-4-methoxy-3(2H)-furanone (DMMF)
yields naringenin chalcone. In higher plants six major sub- from 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF) an
groups are derived from this first intermediate: the chal- O-methyltransferase (FaOMT) cDNA was obtained by
cones, flavones, flavonols, flavandiols, anthocyanins, and screening a strawberry cDNA library, cloned, and heterolo-
condensed tannins (or proanthocyanidins). A seventh group, gously expressed in Escherichia coli. The FaOMT protein
the aurones, is widespread, but not ubiquitous. Much effort catalysed the transfer of the methyl group from S-adenosyl-
has been directed at elucidating the flavonoid biosynthetic L-methionine (SAM), not only to HDMF but also to caffeic
pathway from a molecular genetic point of view and thus it acid, thereby forming the corresponding O-methyl ethers
has been one of the most intensively studied metabolic sys- DMMF and ferulic acid (Wein et al. 2002). Stable transfor-
tems in plants. The majority of the enzymes of flavonoid mation of strawberry with the FaOMT sequence in sense
biosynthesis are members of three classes of enzymes found and antisense orientation, under the control of the cauli-
in all organisms: the oxoglutarate-dependent dioxygenases, flower mosaic virus 35S promoter, resulted in a near total
NADPH-dependent reductases, and cytochrome P450 loss of DMMF, whereas the levels of the other volatiles
hydroxylases. CHS and chalcone isomerase appear to have remained unchanged. FaOMT repression also affected the
a more limited ancestry. In addition to its flavor, much of ratio of feruloyl 1-O-glucose and caffeoyl 1-O-glucose, in-
the popularity of strawberry is due to the attractive red color dicating a dual function of the enzyme in planta (Lunken-
caused by anthocyanin pigments. The major pigment is bein et al. 2006c). To confirm the results obtained with the
pelargonidin 3-O-glucoside followed by cyanidin 3-O-glu- stably transformed strawberry plants and to validate the
coside whereas quercetin and kaempferol 3-O-glucosides transient RNAi method an ihpRNA-encoding construct of
are the major flavonols (Griesser et al. 2008a). The chemi- FaOMT (pBI-FaOMTi) was agroinfiltrated into ripening
cal composition of the strawberry flavonoids has been stu- strawberry fruits. Although, the phenotypes of the pBI-
died in detail, but genetic and biochemical information FaOMTi and pBI-Intron infiltrated fruits were indistingui-
about the numerous steps in anthocyanin biosynthesis and shable (Fig. 4), metabolite analysis showed that the levels
its regulation is still limited (Almeida et al. 2007). of DMMF in relation to HDMF was significantly reduced in
the pBI-FaOMTi injected fruits when compared with the
FaCHS fruits injected with the control vector (Fig. 5). Since woun-
ding of the fruit by agroinfiltration resulted in an upregula-
CHS, the first gene in the flavonoid pathway, was chosen as tion of phenylpropanoyl glucose esters (data not shown),
a reporter gene to test the RNAi-induced silencing of gene changes in the levels of feruloyl 1-O-glucose in relation to
expression in strawberry fruit by agroinfiltration. Reduction caffeoyl 1-O-glucose were not observed after silencing of
of the CHS function using antisense technology has led FaOMT by the transient RNAi approach.
immediately to the loss of pigmentation in strawberry fruit
and is thus easily detectable (Lunkenbein et al. 2006b). To
find an efficient method for transfection of strawberry fruit
different procedures were studied using the pBI-Intron vec-
95
OH OH OH
OH OCH3
PAL OMT
NH2
COOH COOH COSCoA COSCoA COSCoA

Phenylalanine Cinnamic acid Coumaroyl-CoA Caffeoyl-CoA Feruloyl-CoA
malonyl-
CHS CoA R1
Feruloyl 1-O-glucose
OH Caffeoyl 1-O-glucose
HO OH Coumaroyl 1-O-glucose
R1 = H: Tetrahydroxychalcone
R1 = OH: Pentahydroxychalcone
OH O
Chalcones
Flavonols
R1
DFR
OH
HO O
R1 = H: Leucopelargonidin
R1 = OH: Leucocyanidin OH Proanthocyanidine
OH OH
Leucoanthocyanidins
R1
ANS OH
HO O
R1 = H: Pelargonidin
R1 = OH: Cyanidin OH
OH
Anthocyanidins
R1
GT1 OH
HO O
R1 = H: Pelargonidin 3-O-glucoside
R1 = OH: Cyanidin 3-O-glucoside O-glucose
OH
Anthocyanins
Fig. 3 Schematic view of the phenylpropanoid, flavonoid and anthocyanidin pathway. ANS anthocyanidin synthase, CHS chalcone synthase, DFR
dihydroflavonol 4-reductase, GT1 anthocyanidin glucosyltransferase 1, PAL phenylalanine ammonia lyase.
FaGT1 anthocyanidin reductase (ANR) from pelargonidin, were

identified in FaGT1-silenced fruits (Griesser et al. 2008a).
Anthocyanidin 3-O-glucosyltransferase (GT1) is the en- The result indicates competition of FaGT1 and FaANR for
zyme that catalyzes the formation of the first stable inter- the common anthocyanidin substrate and shows that FaGT1
mediate in the anthocyanin pathway (Fig. 3). A putative represents an important branching-point enzyme because it
glycosyltransferase sequence (FaGT1) was recently cloned is channeling the flavonoid pathway to anthocyanins.
from strawberry fruit cDNA (Griesser et al. 2008a). In vitro
assays showed that the recombinant FaGT1 transferred glu- FaDFR
cose from the donor UDP-glucose to anthocyanidins and, to
a lesser extent, to flavonols, generating 3-O-glucosides. To Dihydroflavonol 4-reductase (DFR) catalyzes the last com-
elucidate the in planta function of FaGT1, A. tumefaciens mon step in the flavonoid biosynthesis pathway leading to
cells carrying an ihpRNA-encoding construct of a partial anthocyanins and proanthocyanidins (Fig. 3; Almeida et al.
FaGT1 sequence (pBI-FaGT1i) were injected into ripening 2007). A putative FaDFR gene was cloned from strawberry
strawberry fruits. This led to significant downregulation of cDNA and studied by combining biochemical and molecu-
FaGT1 mRNA levels that correspond to reduced concentra- lar approaches (Moyano et al. 1998; Almeida et al. 2007).
tions of pelargonidin-derived pigments in ripe fruits (Fig. 5). To test the in vivo function of FaDFR by reverse genetics a
The color of the pBI-FaGT1i injected fruit was generally pBI-FaDFRi construct was agroinfiltrated into strawberry
less intense and of a different hue compared to the bright fruits. The pBI-FaDFRi vector consisted of an ihpRNA en-
red fruits of the controls (Fig. 4). Fruits with white regions coding construct of a partial FaDFR sequence. Fruits infil-
as detected after the infiltration of pBI-FaCHSi were not trated with pBI-FaDFRi showed a less intense color than
obtained. Significant levels of epiafzelechin, formed by the color fruits and produced significantly lower levels of
96
pBI-Intron pBI-FaCHSi pBI-FaOMTi pBI-FaGT1i pBI-DFRi pBI-FaANSi pBI-Fra a1ei

(control)
Fig. 4 Collection of phenotypes. Fruits were agroinfiltrated with the constructs referred to in the first line and remained attached to the plants until
harvest. The color change in comparison to the fruits injected with the control vector pBI-Intron indicate impaired pigment formation, except for pBI-
FaOMTi.
pelargonidin derivatives as determined by metabolite analy- in strawberry fruit was downregulated by RNAi targeted to
sis (Figs. 4, 5). Surprisingly, the concentrations of cyanidin Fra a. Fruits infiltrated with pBI-Fraa1ei and pBI-Fraa3i,
derivatives were not affected. Chimeric fruits with white representing two isoforms of Fra a, consistently showed
regions were not detected. white regions similar to the chimeric pBI-FaCHSi pheno-
type (Fig. 4). However, metabolite analysis revealed that in
FaANS fruits infiltrated with pBI-Fraa1ei and pBI-Fraa3i cons-
tructs, all metabolites of the anthocyanin biosynthesis path-
Anthocyanidin synthase (ANS) catalyzes the 2-oxoglutarate way showed lower levels than the controls (Muñoz et al.
dependent oxidation of leucoanthocyanidins to the colored 2010). Quantitative PCR (qPCR) analysis confirmed the
anthocyanidins (Fig. 3; Nakajima et al. 2001). A FaANS efficient downregulation of Fra a isoforms (Fig. 6). Besides,
gene was cloned from red fruit cDNA with gene specific Fra a seems to have a regulatory function because the
primers designed from published ESTs (Almeida et al. FaCHS and phenylalanine ammonia lyase (FaPAL) expres-
2007). Functional characterization of the recombinant sion levels were significantly reduced in the pBI-Fraa1ei
FaANS protein showed a preference for the substrate leuco- and pBI-Fraa3i-injected fruits. The results demonstrate a
pelargonidin. The in vivo preference was studied after tran- clear link between Fra a expression and flavonoid forma-
sient downregulation of the FaANS transcripts by agroinfil- tion. The study clearly shows that the Fra a allergen has a
tration of a pBI-FaANSi vector into ripening strawberry functional role in the flavonoid pathway.
fruits. The pBI-FaANSi fruits showed a similar phenotype
as the pBI-FaDFRi injected fruits (Fig. 4). Metabolite ana- CONCLUSION
lysis confirmed the significant downregulation of the levels
of pelargonidin and cyanidin derivatives (Fig. 5). Thus, The large amount of sequence information that has been
FaANS catalyzes the formation of both anthocanidins in generated for Fragaria, and the implementation of high-
planta. throughput gene expression analyses have resulted in an in-
creased interest in reverse genetic methodologies. One ap-
Fra proach to generate an impaired phenotype is the down-
regulation of target genes and even gene families by RNAi
The strawberry fruit allergen Fra a is a member of the Bet which is triggered by dsRNA. The dsRNA can be delivered
v1 superfamily named after the major birch pollen allergen to plants either transiently or stable by integrating dsRNA-
and is ranked among a subfamily of pathogenesis-related producing transgenes. The transient RNAi approach permits
proteins (PR-10, Muñoz et al. 2010). Although the aller- rapid and highly efficient gene function discovery and
genic properties of Bet v1 and related PR-10 proteins have validation and can be carried out in a high-throughput mode
been extensively studied, their biological role in plants with thousands of individual plants. The recently developed
remained elusive. In a search for strawberry genotypes with transient RNAi method in Fragaria is suitable for analyzing
low Fra a allergen levels it was found that total allergen genes that are highly expressed during strawberry fruit
content was always lower in colorless (white) strawberry development as was demonstrated for FaCHS, FaOMT,
varieties than in red ones (Hjernø et al. 2006). The ripe FaGT1, FaDFR, FaANS and Fra.
colorless fruits that were tolerated by individuals affected
by allergy were found to be virtually free from the straw- ACKNOWLEDGEMENTS
berry allergen. Interestingly, several catalytically active pro-
teins of the flavonoid pathway like FaCHS, flavanone 3- This work has been supported by funds from DFG SCHW 634/10-
hydroxylase (F3H), and DFR were also reduced. To study 2 and DAAD D/07/13484.
whether there is a direct link between Fra a expression and
flavonoid and anthocyanin formation Fra a gene expression
97
Pelargonidin 3-O-glucoside Cyanidin 3-O-glucoside
rel. conc
rel. conc
pBI-FaCHSi
pBI-FaCHSi pBI-Intron pBI-FaCHSi pBI-Intron
rel. conc
rel. conc
pBI-FaGT1i
pBI-FaGT1i pBI-Intron pBI-FaGT1i pBI-Intron
rel. conc
rel. conc
pBI-FaANSi
pBI-FaANSi pBI-Intron pBI-ANSi pBI-Intron

rel. conc
rel. conc
pBI-FaDFRi
pBI-FaDFRi pBI-Intron pBI-DFRi pBI-Intron
Caffeoyl/feruloyl
HDMf/DMMF 1-O-glucose ratio
DMMF ratio Feruloyl 1-O-glucose
rel. conc
rel. conc
pBI-FaOMTi
pBI-FaOMTi pBI-Intron pBI-FaOMTi pBI-Intron
Fig. 5 Effect of gene silencing. Effects caused by various ihpRNA encoding constructs (pBI-FaCHSi, pBI-FaGT1i, pBI-FaANSi, pBI-FaDFRi, and pBI-
FaOMTi) on selected metabolite levels (pelargonidin 3-O-glucoside, cyanidin-3-O-glucoside, 4-hydroxy-2,5-dimethyl-3(2H)-furanone/2,5-dimethyl-4-
methoxy-3(2H)-furanone (HDMF/DMMF ratio) and caffeoyl 1-O-glucose/feruloyl 1-O-glucose ratio). Box plot graphs were designed for the peak areas
of selected compounds. A horizontal line in the boxes indicates the medians and boxes the interquartile range. Whiskers extend to 10th and 90th percentiles.
Outliers are displayed by black dots. Wilcoxon–Mann–Whitney U-test was used for non-parametric analysis of intergroup comparison.
REFERENCES (Fragaria x ananassa). Archives of Biochemistry and Biophysics 465, 61-71

Alonso JM, Ecker JR (2006) Moving forward in reverse: genetic technologies
Agius F, Gonzalez-Lamothe R, Caballero JL, Muñoz-Blanco J, Botella MA, to enable genome-wide phenomic screens in Arabidopsis. Nature Reviews
Valpuesta V (2003) Engineering increased vitamin C levels in plants by Genetics 7, 524-536
overexpression of a D-galacturonic acid reductase. Nature Biotechnology 21, Beekwilder J, Alvarez-Huerta M, Neef E, Verstappen FWA, Bouwmeester
177-181 HJ, Aharoni A (2004) Functional characterization of enzymes forming vola-
Aharoni A, De Vos CHR, Wein M, Sun Z, Greco R, Kroon A, Mol JNM, tile esters from strawberry and banana. Plant Physiology 135, 1865-1878
O'Connell AP (2001) The strawberry FaMYB1 transcription factor sup- Benitez-Burraco A, Blanco-Portales R, Redondo-Nevado J, Bellido ML,
presses anthocyanin and flavonol accumulation in transgenic tobacco. Plant Moyano E, Caballero JL, Muñoz-Blanco J (2003) Cloning and characteri-
Journal 28, 319-332 zation of two ripening-related strawberry (Fragaria x ananassa cv. chandler)
Aharoni A, Giri AP, Verstappen FWA, Bertea CM, Sevenier R, Sun Z, pectate Iyase genes. Journal of Experimental Botany 54, 633-645
Jongsma MA, Schwab W, Bouwmeester HJ (2004) Gain and loss of fruit Blanco-Portales R, Lopez-Raez JA, Bellido ML, Moyano E, Dorado G,
flavor compound produced by wild and cultivated strawberry species. Plant Gonzalez-Reyes JA, Caballero JL, Muñoz-Blanco J (2004) A strawberry
Cell 16, 3110-3131 fruit-specific and ripening-related gene codes for a HyPRP protein involved
Aharoni A, Keizer LCP, Bouwmeester HJ, Sun Z, Alvarez-Huerta M, Ver- in polyphenol anchoring. Plant Molecular Biology 55, 763-780
hoeven HA, Blaas J, Van Houwelingen AMML, De Vos RCH, Van der Blanco-Portales R, Medina-Escobar N, Lopez-Raez JA, Gonzalez-Reyes JA,
Voet H, Jansen RC, Guis M, Mol J, Davis RW, Schena M, Van Tunen AJ, Villalba JM, Moyano E, Caballero JL, Muñoz-Blanco J (2002) Cloning,
O'Connell AP (2000) Identification of the SAAT gene involved in straw- expression and immunolocalization pattern of a cinnamyl alcohol dehydro-
berry flavor biogenesis by use of DNA microarrays. Plant Cell 12, 647-661 genase gene from strawberry (Fragaria x ananassa cv. Chandler). Journal of
Aharoni A, O’Connell AP (2002) Gene expression analysis of strawberry Experimental Botany 53, 1723-1734
achene and receptacle maturation using DNA microarrays. Journal of Experi- Bustamante CA, Civello PM, Martínez GA (2009) Cloning of the promoter
mental Botany 53, 2073-2087 region of ß-xylosidase (FaXyl1) gene and effect of plant growth regulators on
Almeida JRM, D’Amico E, Preuss A, Carbone F, de Vos CHR, Deiml B, the expression of FaXyl1 in strawberry fruit. Plant Science 177, 49-56
Mourgues F, Perrotta G, Fischer TC, Bovy AG, Martens S, Rosati C Bustamante CA, Rosli HG, Anon MC, Civello PM, Martinez GA (2006) -
(2007) Characterization of major enzymes and genes involved in flavonoid Xylosidase in strawberry fruit: Isolation of a full-length gene and analysis of
and proanthocyanidin biosynthesis during fruit development in strawberry its expression and enzymatic activity in cultivars with contrasting firmness.
98
20 translational genomics in Rosaceae. In Vitro Cellular and Developmental

Biology – Plant 42, 482-490
Garcia-Gago JA, Pose S, Muñoz-Blanco J, Quesada MA, Mercado JA
15 Fra a 1e (2009) The polygalacturonase FaPG1 gene plays a key role in strawberry
fruit softening. Plant Signaling and Behavior 4, 766-768
expression
10 Garcia-Limones C, Schnabele K, Blanco-Portales R, Luz Bellido M, Cabal-
lero JL, Schwab W, Muñoz-Blanco J (2008) Functional characterization of
FaCCD1: A carotenoid cleavage dioxygenase from strawberry involved in
5
* * *
lutein degradation during fruit ripening. Journal of Agricultural and Food
Chemistry 56, 9277-9285
Gonzalez M, Gaete-Eastman C, Valdenegro M, Figueroa CR, Fuentes L,
0 Herrera R, Moya-Leon MA (2009) Aroma development during ripening of
5 Fragaria chiloensis fruit and participation of an alcohol acyltransferase
(FcAAT1) gene. Journal of Agricultural and Food Chemistry 57, 9123-9132
4 Griesser M, Hoffmann T, Bellido ML, Rosati C, Fink B, Kurtzer R,
Aharoni A, Muñoz-Blanco J, Schwab W (2008a) Redirection of flavonoid
3
*
FaPAL biosynthesis through the down-regulation of an anthocyanidin glucosyltrans-
ferase in ripening strawberry fruit. Plant Physiology 146, 1528-1539
2
*
expression
Griesser M, Vitzthum F, Fink B, Bellido ML, Raasch C, Muñoz-Blanco J,
Schwab W (2008b) Multi-substrate flavonol O-glucosyltransferases from
1 strawberry (Fragaria x ananassa) achene and receptacle. Journal of Expe-
rimental Botany 59, 2611-2625
0 Harpster MH, Brummeil DA, Dunsmuir P (1998) Expression analysis of a
pB
pB
pB
pB
ripening-specific, auxin-repressed endo-1,4--glucanase gene in strawberry.

I-I
I-F
I-F
I- F
Plant Physiology 118, 1307-1316

nt
ra
aC
ra
ro
a3
Hellens R, Allan AC, Friel EN, Bolitho K, Grafton K, Templeton MD,

a1
n
H
i
Si
ei
Karunairetnam S, Gleave AP, Laing WA (2005) Transient expression

vectors for functional genomics, quantification of promoter activity and RNA
Fig. 6 Relative gene expression levels determined by qPCR. Relative silencing in plants. Plant Methods 1, 13
transcription levels of Fra a 1e and FaPAL normalized to the interspacer Hemavathi, Upadhyaya CP, Young KE, Akula N, Kim Hs, Heung JJ, Oh
gene were determined in fruits agroinfiltrated with pBI–Intron, pBI– OM, Aswath CR, Chun SC, Kim DH, Park SW (2009) Over-expression of
Fraa1ei, pBI–Fraa3i, and pBI–CHSi (adapted from Muñoz et al. 2010). strawberry D-galacturonic acid reductase in potato leads to accumulation of
Statistically significant values in comparison with the values for pBI– vitamin C with enhanced abiotic stress tolerance. Plant Science 177, 659-667
Introns are marked with an asterisk (P = 0.05). The statistical analysis was Hoffmann, T, Kalinowski G, Schwab W (2006) RNAi-induced silencing of
performed by paired t-test function. gene expression in strawberry fruit (Fragaria x ananassa) by agroinfiltration:
a rapid assay for gene function analysis. Plant Journal 48, 818-826
Hjernø K, Alm R, Canbäck B, Matthiesen R, Trajkovski K, Björk L,
Roepstorff P, Emanuelsson C (2006) Down-regulation of the strawberry
Plant Science 171, 497-504 Bet v 1-homologous allergen in concert with the flavonoid biosynthesis path-
Carbone F, Mourgues F, Biasioli F, Gasperi F, Maerk TD, Rosati C, Per- way in colorless strawberry mutant. Proteomics 6, 1574-1587
rotta G (2006) Development of molecular and biochemical tools to inves- Jena PK, Reddy ASN, Poovaiah BW (1989) Molecular cloning and sequen-
tigate fruit quality traits in strawberry elite genotypes. Molecular Breeding 18, cing of a cDNA for plant calmodulin: signal-induced changes in the expres-
127-142 sion of calmodulin. Proceedings of the National Academy of Sciences USA
Castillejo C, de la Fuente JI, lannetta P, Botella MA, Valpuesta V (2004) 86, 3644-3648
Pectin esterase gene family in strawberry fruit: Study of FaPE1, a ripening- Jimenez-Bermudez S, Redondo-Nevado J, Muñoz-Blanco J, Caballero JL,
specific isoform. Journal of Experimental Botany 55, 909-918 Lopez-Aranda JM, Valpuesta V, Pliego-Alfaro F, Quesada MA, Mercado
Chang L, Zhang Z, Han B, Li H, Dai H, He P, Tian H (2009) Isolation of JA (2002) Manipulation of strawberry fruit softening by antisense expression
DNA-methyltransferase genes from strawberry (Fragaria x ananassa Duch.) of a pectate Iyase gene. Plant Physiology 128, 751-759
and their expression in relation to micropropagation. Plant Cell Reports 28, Khan AA, Shi Y, Shih DS (2003) Cloning and partial characterization of a -
1373-1384 1,3-glucanase gene from strawberry. DNA Sequence 14, 406-412
Civello PM, Powell ALT, Sabehat A, Bennett AB (1999) An expansin gene Khan AA, Shih DS (2004) Molecular cloning, characterization, and expression
expressed in ripening strawberry fruit. Plant Physiology 121, 1273-1279 analysis of two class II chitinase genes from the strawberry plant. Plant Sci-
de la Fuente JI, Amaya I, Castillejo C, Sanchez-Sevilla JF, Quesada MA, ence 166, 753-762
Botella MA, Valpuesta V (2006) The strawberry gene FaGAST affects plant Kim I-J, Chung W-II (1998a) Isolation of genomic DNA containing a cyto-
growth through inhibition of cell elongation. Journal of Experimental Botany solic ascorbate peroxidase gene (ApxSC) from the strawberry (Fragaria x
57, 2401-2411 ananassa). Bioscience, Biotechnology, and Biochemistry 62, 1358-1363
Deng C, Davis TM (2001) Molecular identification of the yellow fruit color (c) Kim I-J, Chung W-II (1998b) Molecular characterization of a cytosolic ascor-
locus in diploid strawberry: a candidate gene approach. Theoretical and Ap- bate peroxidase in strawberry fruit. Plant Science 133, 69-77
plied Genetics 103, 316-322 Kim I-J, LeeB-H, Jo J, Chung W-II (2001) Sequence variability of nine cyto-
Dotto MC, Martinez GA Civello PM (2006) Expression of expansin genes in solic ascorbate peroxidases in polyploid strawberry. DNA Sequence 11, 475-
strawberry varieties with contrasting fruit firmness. Plant Physiology and 484
Biochemistry 44, 301-307 Klein D, Klein D, Fink B, Arold B, Eisenreich W, Schwab W (2007) Func-
Duangsrisai S, Yamada K, Bantog NA, Shiratake K, Kanayama Y, Yamaki tional characterization of enone oxidoreductases from strawberry and tomato
S (2007) Presence and expression of NAD+-dependent sorbitol dehydro- fruit. Journal of Agricultural and Food Chemistry 55, 6705-6711
genase and sorbitol-6-phosphate dehydrogenase genes in strawberry. Journal Kurokura T, Inaba Y, Sugiyama N (2006) Histone H4 gene expression and
of Horticultural Science and Biotechnology 82, 191-198 morphological changes on shoot apices of strawberry (Fragaria x ananassa
Encinas-Villarejo S, Maldonado AM, Amil-Ruiz F, de los Santos B, Romero Duch.) during floral induction. Scientia Horticulturae 110, 192-197
F, Pliego-Alfaro F, Muñoz-Blanco J, Caballero JL (2009) Evidence for a Lazarus CM, Macdonald H (1996) Characterization of a strawberry gene for
positive regulatory role of strawberry (Fragaria x ananassa) Fa WRKY1 and auxin-binding protein, and its expression in insect cells. Plant Molecular
Arabidopsis At WRKY75 proteins in resistance. Journal of Experimental Biology 31, 267-277
Botany 60, 3043-3065 Li Y, Yan H, Zhou B, Kawabata S, Sakiyama R (2003) Role of chalcone syn-
Figueroa CR, Pimentel P, Dotto MC, Civello PM, Martinez GA, Herrera R, thase and dihydroflavonol reductase in light dependent accumulation of an-
Moya-Leon MA (2009) Expression of five expansin genes during softening thocyanins in "Toyonoka" strawberry fruits. Acta Horticulturae 626, 353-358
of Fragaria chiloensis fruit: Effect of auxin treatment. Postharvest Biology Llop- Tous I, Dominguez-Puigianer E, Vendrell M (2002) Characterization of
and Technology 53, 51-57 a strawberry cDNA clone homologous to calcium-dependent protein kinases
Figueroa CR, Pimentel P, Gaete-Eastman C, Moya M, Herrera R, Caligari that is expressed during fruit ripening and affected by low temperature. Jour-
PDS, Moya-Leon MA (2008) Softening rate of the Chilean strawberry (Fra- nal of Experimental Botany 53, 2283-2285
garia chiloensis) fruit reflects the expression of polygalacturonase and pec- Llop-Tous I, Dominguez-Puigjaner E, Palomer X, Vendrell M (1999) Cha-
tate Iyase genes. Postharvest Biology and Technology 49, 210-220 racterization of two divergent endo--1,4-glucanase cDNA clones highly ex-
Filipowicz W, Jaskiewicz L, Kolb FA, Pillai RS (2005) Post-transcriptional pressed in the nonclimacteric strawberry fruit. Plant Physiology 119, 1415-
gene silencing by siRNAs and miRNAs. Current Opinion in Structural Biol- 1421
ogy 15, 331-341 Lopez AP, Franco AR (2006) Cloning and expression of cDNA encoding trans-
Folta KM, Dhingra A (2006) Transformation of strawberry: The basis for lationally controlled tumor protein from strawberry fruits. Biologia Planta-
99
rum 50, 447-449 Palomer X, Llop-Tous I, Vendrell M, Krens FA, Schaart JG, Boone MJ, van
Lopez AP, Portales RB, Lopez-Raez JA, Medina-Escobar N, Blancom JM, der Valk H, Salentijn EMJ (2006) Antisense down-regulation of strawberry
Franco AR (2006) Characterization of a strawberry late-expressed and fruit- endo--(1,4)-glucanase genes does not prevent fruit softening during ripening.
specific peptide methionine sulphoxide reductase. Physiologia Plantarum Plant Science 171, 640-646
126, 129-139 Park J-II, Kim I-J (2007) Changes in the expression of ADP-glucose pyro-
Lunkenbein S, Bellido M, Aharoni A, Salentijn EMJ, Kaidenhoff R, Coiner phosphorylase genes during fruit ripening in strawberry. Food Science and
HA, Muñoz-Blanco J, Schwab W (2006a) Cinnamate metabolism in ripen- Biotechnology 16, 343-348
ing fruit. Characterization of a UDP-glucose:cinnamate glucosyltransferase Park J-II, Lee Y-K, Chung W-II, Lee I-H, Choi J-H, Lee W-M, Ezura H,
from strawberry. Plant Physiology 140, 1047-1058 Lee S-P, Kim I-J (2006) Modification of sugar composition in strawberry
Lunkenbein S, Coiner H, de Vos CHR, Schaart JG, Boone MJ, Krens FA, fruit by antisense suppression of an ADP-glucose pyrophosphorylase. Mole-
Schwab W, Salentijn EMJ (2006b) Molecular characterization of a stable cular Breeding 17, 269-279
antisense chalcone synthase phenotype in strawberry (Fragaria x ananassa). Quesada MA, Blanco-Portales R, Pose S, Garcia-Gago JA, Jiménez-Ber-
Journal of Agricultural and Food Chemistry 54, 2145-2153 múdez S, Muñoz-Serrano A, Caballero JL, Pliego-Alfaro F, Mercado JA,
Lunkenbein S, Salentijn EMJ, Coiner HA, Boone MJ, Krens FA, Schwab Muñoz-Blanco J (2009) Antisense down-regulation of the FaPG1 gene
W (2006c) Up- and down-regulation of Fragaria x ananassa O-methyltrans- reveals an unexpected central role for polygalacturonase in strawberry fruit
ferase: Impacts on furanone and phenylpropanoid metabolism. Journal of softening. Plant Physiology 150, 1022-1032
Experimental Botany 57, 2445-2453 Raab T, Lopez-Raez JA, Klein D, Caballero JL, Moyano E, Schwab W,
Martinez GA, Chaves AR, Civello PM (2004) -xylosidase activity and ex- Muñoz-Blanco J (2006) FaQR, required for the biosynthesis of the straw-
pression of a ß-xylosidase gene during strawberry fruit ripening. Plant Phy- berry flavor compound 4-hydroxy-2,5-dimethyl-3(2H)-furanone, encodes an
siology and Biochemistry 42, 89-96 enone oxidoreductase. Plant Cell 18, 1023-1037
Martinez M, Abraham Z, Gambardella M, Echaide M, Carbonero P, Diaz I Redondo-Nevado J, Moyano E, Medina-Escobar N, Caballero JL, Muñoz-
(2005) The strawberry gene Cyf1 encodes a phytocystatin with antifungal Blanco J (2001) A fruit-specific and developmentally regulated endopoly-
properties. Journal of Experimental Botany 56, 1821-1829 galacturonase gene from strawberry (Fragaria x ananassa cv. Chandler).
Martinez Zamora MG, Castagnaro AP, Diaz Ricci JC (2008) Genetic diver- Journal of Experimental Botany 52, 1941-1945
sity of Pto-like serine/threonine kinase disease resistance genes in cultivated Rosin FA, Aharoni A, Salentijn EMJ, Schaart JG, Boone MJ, Hannapel DJ
and wild Strawberries. Journal of Molecular Evolution 67, 211-221 (2003) Expression patterns of a putative homolog of AGAMOUS, STAG1,
Marty I, Douat C, Tichit L, Jungsup K, Leustek T, Albagnac G (2000) The from strawberry. Plant Science 165, 959-968
cystathionine-y-synthase gene involved in methionine biosynthesis is highly Rosli HG, Civello, Pedro M, Martinez GA (2009) -L-Arabinofuranosidase
expressed and auxin-repressed during wild strawberry (Fragaria vesca L.) from strawberry fruit: Cloning of three cDNAs, characterization of their ex-
fruit ripening. Theoretical and Applied Genetics 100, 1129-1136 pression and analysis of enzymatic activity in cultivars with contrasting firm-
Medina-Escobar N, Cardenas J, Moyano E, Caballero JL, Muñoz-Blanco J ness. Plant Physiology and Biochemistry 47, 272-281
(1997) Cloning, molecular characterization and expression pattern of a straw- Salentijn EMJ, Aharoni A, Schaart JG, Boone MJ, Krens FA (2003) Dif-
berry ripening-specific cDNA with sequence homology to pectate lyase from ferential gene expression analysis of strawberry cultivars that differ in fruit-
higher plants. Plant Molecular Biology 34, 867-877 firmness. Physiologia Plantarum 118, 571-578
Medina-Escobar N, Cardenas J, Muñoz-Blanco J, Caballero JL (1998) Clo- Santiago-Domenech N, Jimenez-Bemudez S, Matas AJ, Rose JKC, Muñoz-
ning and molecular characterization of a strawberry fruit ripening-related Blanco J, Mercado JA, Quesada MA (2008) Antisense inhibition of a pec-
cDNA corresponding to a mRNA for a low-molecular-weight heat-shock pro- tate lyase gene supports a role for pectin depolymerization in strawberry fruit
tein. Plant Molecular Biology 36, 33-42 softening. Journal of Experimental Botany 59, 2769-2779
Mehli L, Schaart JG, Kjellsen TD, Tran DH, Salentijn EMJ, Schouten HJ, Santos-Rosa M, Poutaraud A, Merdinoglu D, Mestre P (2008) Development
Iversen T-H (2004) A gene encoding a polygalacturonase-inhibiting protein of a transient expression system in grapevine via agro-infiltration. Plant Cell
(PGIP) shows developmental regulation and pathogen-induced expression in Reports 27, 1053-1063
strawberry. New Phytologist 163, 99-110 Schreiner M, Huyskens-Keil S (2006) Phytochemicals in fruit and vegetables:
Mercado JA, Trainotti L, Jiménez-Bermúdez L, Santiago-Domenech N, health promotion and postharvest elicitors. Critical Reviews in Plant Sciences
Pose S, Donolli R, Barcelo M, Casadoro G, Pliego-Alfaro F, Quesada MA 25, 267-278
(2010) Evaluation of the role of the endo--(1,4)-glucanase gene FaEG3 in Serrato AJ, Yubero-Serrano EM, Sandalio LM, Muñoz-Blanco J, Chueca A,
strawberry fruit softening. Postharvest Biology and Technology 55, 8-14 Caballero JL, Sahrawy M (2009) cpFBPasell, a novel redox-independent
Mouhu K, Hytonen T, Folta K, Rantanen M, Paulin L, Auvinen P, Elomaa chloroplastic isoform of fructose-1,6-bisphosphatase. Plant, Cell and Envi-
P (2009) Identification of flowering genes in strawberry, a perennial SD plant. ronment 32, 811-827
BMC Plant Biology 9, 122 Sesmero R, Mitchell JR, Mercado JA, Quesada MA (2009) Rheological
Moyano E, Encinas-Villarejo S, Lopez-Raez JA, Redondo-Nevado J, characterisation of juices obtained from transgenic pectate Iyase-silenced
Blanco-Portales R, Bellido ML, Sanz C, Caballero JL, Muñoz-Blanco J strawberry fruits. Food Chemistry 116, 426-432
(2004) Comparative study between two strawberry pyruvate decarboxylase Sesmero R, Quesada MA, Mercado JA (2007) Antisense inhibition of pectate
genes along fruit development and ripening, post-harvest and stress condi- lyase gene expression in strawberry fruit: Characteristics of fruits processed
tions. Plant Science 166, 835-845 into jam. Journal of Food Engineering 79, 194-199
Moyano E, Portero-Robles I, Medina-Escobar N, Valpuesta V, Muñoz- Shi Y, Shih DS (2006) Identification of a zinc transporter gene in strawberry.
Blanco J, Caballero JL (1998) A fruit-specific putative dihydroflavonol 4- DNA Sequence 17, 15-23
reductase gene is differentially expressed in strawberry during the ripening Shi Y, Zhang Y, Shih DS (2006) Cloning and expression analysis of two -1,3-
process. Plant Physiology 117, 711-716 glucanase genes from strawberry. Journal of Plant Physiology 163, 956-967
Muñoz C, Hoffmann T, Medina Escobar N, Ludemann F, Botella MA, Val- Shulaev V, Korban SS, Sosinski B, Abbott AG, Aldwinckle HS, Folta KM,
puesta V, Schwab W (2010) The strawberry fruit Fra a allergen functions in Iezzoni A, Main D, Arus P, Dandekar AM, Lewers K, Brown SK, Davis
flavonoid biosynthesis. Molecular Plant 3, 113-124 TM, Gardiner SE, Potter D, Veilleux RE (2008) Multiple models for Rosa-
Mut P, Bustamante C, Martinez G, Alleva K, Sutka M, Civello M, Amodeo ceae genomics. Plant Physiology 147, 985-1003
G (2008) A fruit-specific plasma membrane aquaporin subtype PIP1;1 is Shulaev V, Sargent DJ, Crowhurst RN, Mockler TC, Folkerts O, Delcher
regulated during strawberry (Fragaria x ananassa) fruit ripening. Physiolo- AL, Jaiswal P, Mockaitis K, Liston A, Mane SP, Burns P, Davis TM,
gia Plantarum 132, 538-551 Slovin JP, Bassil N, Hellens RP, Evans C, Harkins T, Kodira C, Desany B,
Nakajima J, Tanaka Y, Yamazaki M, Saito K (2001) Reaction mechanism Crasta OR, Jensen RV, Allan AC, Michael TP, Setubal JC, Celton JM,
from leucoanthocyanidin to anthocyanidin 3-glucoside, a key reaction for Rees DJG, Williams KP, Holt SH, Ruiz Rojas JJ, Chatterjee M, Liu B,
coloring in anthocyanin biosynthesis. Journal of Biological Chemistry 276, Silva H, Meisel L, Adato A, Filichkin SA, Troggio M, Viola R, Lynn Ash-
25797-25803 man T, Wang H, Dharmawardhana P, Elser J, Raja R, Priest HD, Bryant
Ndong C, Ouellet F, Houde M, Sarhan F (1997) Gene expression during cold Jr DW, Fox SE, Givan SA, Wilhelm LJ, Naithani S, Christoffels A,
acclimation in strawberry. Plant and Cell Physiology 38, 863-870 Salama DY, Carter J, Lopez Girona E, Zdepski A, Wang W, Kerstetter
Oliveira do Nascimento JR, Higuchi BK, Gomez MLPA, Oshiro RA, Lajolo RA, Schwab W, Korban SS, Davik J, Monfort A, Denoyes-Rothan B,
FM (2005) L-ascorbate biosynthesis in strawberries: L-Galactono-1,4-lac- Arus P, Mittler R, Flinn B, Aharoni A, Bennetzen JL, Salzberg SL,
tone dehydrogenase expression during fruit development and ripening. Post- Dickerman AW, Velasco R, Borodovsky M, Veilleux RE, Folta KM (2011)
harvest Biology and Technology 38, 34-42 The genome of woodland strawberry (Fragaria vesca). Nature Genetics 43
Osorio S, Castillejo C, Quesada MA, Medina-Escobar N, Brownsey GJ, 109-118
Suau R, Heredia A, Botella MA, Valpuesta V (2008) Partial demethylation Small I (2007) RNAi for revealing and engineering plant gene functions. Cur-
of oligogalacturonides by pectin methyl esterase 1 is required for eliciting de- rent Opinion in Biotechnology 18, 148-153
fence responses in wild strawberry (Fragaria vesca). Plant Journal 54, 43-55 Sutsawat D, Yamada K, Shiratake K, Kanayama Y, Yamaki S (2008)
Owens CL, Thomashow MF, Hancock JF, lezzoni AF (2002) CBF1 Ortho- Properties of sorbitol dehydrogenase in strawberry fruit and enhancement of
logs in sour cherry and strawberry and the heterologous expression of CBF1 the activity by fructose and auxin. Journal of the Japanese Society for Horti-
in strawberry. Journal of the American Society for Horticultural Science 127, cultural Science 77, 318-323
489-494 Szajdek A, Borowska EJ (2008) Bioactive compounds and health-promoting
100
properties of berry fruits: A review. Plant Foods for Human Nutrition 63, endo--1,4-glucanase from strawberry and down-regulation of the correspon-
147-156 ding gene, cel1. Planta 214, 11-21
Tisser A, Bourgeois P (2001) Reverse genetics in plants. Current Genomics 2, Wu J, Khan AA, Shih C-YT, Shih DS (2001) Cloning and sequence deter-
269-284 mination of a gene encoding an osmotin-like protein from strawberry (Fraga-
Trainotti L, Spinello R, Piovan A, Spolaore S, Casadoro G (2001) -galac- ria x ananassa Duch.). DNA Sequence 12, 447-453
tosidases with a lectin-like domain are expressed in strawberry. Journal of Xu Q, Wen X, Deng X (2007) Phylogenetic and evolutionary analysis of NBS-
Experimental Botany 52, 1635-1645 encoding genes in Rosaceae fruit crops. Molecular Phylogenetics and Evolu-
Trainotti L, Spolaore S, Pavanello A, Baidan B, Casadoro G (1999) A novel tion 44, 315-324
E-type endo--1,4-glucanase with a putative cellulose-binding domain is Yang L-M, Mercke P, van Loon JJA, Fang Z-Y, Dicke M, Jongsma MA
highly expressed in ripening strawberry fruits. Plant Molecular Biology 40, (2008) Expression in Arabidopsis of a strawberry linalool synthase gene
323-332 under the control of the inducible potato PI2 promoter. Agricultural Sciences
Trainotti L, Pavanello A, Casadoro G (2005) Different ethylene receptors in China 7, 521-534
show an increased expression during the ripening of strawberries: does such Yang Y, Li R, Qi M (2000) In vivo analysis of plant promoters and transcription
an increment imply a role for ethylene in the ripening of these non-climac- factors by agroinfiltration of tobacco leaves. Plant Journal 22, 543-551
teric fruits? Journal of Experimental Botany 56, 2037-2046 Yonekura-Sakakibara K, Saito K (2006) Genetically modified plants for the
Vaughan SP, James DJ, Lindsey K, Massiah AJ (2006) Characterization of promotion of human health. Biotechnology Letters 28, 1983-1991
FaRB7, a near root-specific gene from strawberry (Fragaria x ananassa Youssef SM, Jimenez-Bermudez S, Bellido ML, Martin-Pizarro C, Barcelo
Duch.) and promoter activity analysis in homologous and heterologous hosts. M, Abdal-Aziz SA, Caballero JL, Lopez-Aranda JM, Pliego-Alfaro F,
Journal of Experimental Botany 57, 3901-3910 Muñoz J, Quesada MA, Mercado JA (2009) Fruit yield and quality of
Villarreal NM, Martínez GA, Civello PM (2009) Influence of plant growth strawberry plants transformed with a fruit specific strawberry pectate Iyase
regulators on polygalacturonase expression in strawberry fruit. Plant Science gene. Scientia Horticulturae 119, 120-125
176, 749-757 Yuan H, Chen L, Paliyath G, Sullivan A, Murr DP (2005) Characterization of
Villarreal NM, Rosli HG, Martínez GA, Civello PM (2008) Polygalacturo- microsomal and mitochondrial phospholipase D activities and cloning of a
nase activity and expression of related genes during ripening of strawberry phospholipase D alpha cDNA from strawberry fruits. Plant Physiology and
cultivars with contrasting fruit firmness. Postharvest Biology and Technology Biochemistry 43, 535-547
47, 141-150 Yubero-Serrano E-M, Moyano E, Medina-Escobar N, Muñoz-Blanco J,
Wein M, Lavid N, Lunkenbein S, Lewinsohn E, Schwab W, Kaldenhoff R Caballero J-L (2003) Identification of a strawberry gene encoding a non-
(2002) Isolation, cloning and expression of a multifunctional O-methyltrans- specific lipid transfer protein that responds to ABA, wounding and cold stress.
ferase capable forming 2,5-dimethyl-4-methoxy-3(2H)-furanone, one of the Journal of Experimental Botany 54, 1865-1877
key aroma compounds in strawberry fruits. Plant Journal 31, 755-765 Zalunskaite I, Rugienius R, Vinskiene J, Bendokas V, Gelvonauskiene D,
Winkel-Shirley B (2001) Flavonoid biosynthesis. A colorful model for genetics, Stanys V (2008) Expression of GOR gene homologues in different plants
biochemistry, cell biology, and biotechnology. Plant Physiology 126, 485-493 during cold acclimation. Biologija 54, 33-35
Wolyn DJ, Jelenkovic G (1990) Nucleotide sequence of an alcohol dehydro- Zhang Y, Shih DS (2007) Isolation of an osmotin-like protein gene from straw-
genase gene in octoploid strawberry (Fragaria x ananassa Duch.). Plant berry and analysis of the response of this gene to abiotic stresses. Journal of
Molecular Biology 14, 855-857 Plant Physiology 164, 68-77
Woolley LC, James DJ, Manning K (2001) Purification and properties of an
101
Towards the Production of Genetically Modified

Strawberries which are Acceptable to Consumers
Jan G. Schaart1* • Trygve D. Kjellsen2 • Lisbeth Mehli3 • Reidun Heggem4 •
Tor-Henning Iversen5 • Henk J. Schouten1 • Frans A. Krens1
1 Wageningen UR Plant Breeding, Wageningen University and Research Centre. P.O. Box 16, 6700 AA Wageningen, the Netherlands
2 Department of Biotechnology, Norwegian University of Science and Technology, 7491 Trondheim, Norway
3 Faculty of Technology, Sør-Trøndelag University College, 7004 Trondheim, Norway
4 Centre for Rural Research, 7491 Trondheim, Norway
5 Department of Biology, Norwegian University of Science and Technology, 7491 Trondheim, Norway
Corresponding author: * jan.schaart@wur.nl
ABSTRACT
This manuscript discusses different aspects that are relevant to genetically modified strawberry plants with improved characteristics and
‘acceptable’ to consumers and growers of strawberry. It starts with a consumer acceptance survey, held in Norway, Denmark and the UK,
studying public perception of genetic modification in general and specifically of genetically modified strawberries with altered properties.
This study revealed that genetically modified plants are better accepted by consumers if only genes from the species itself are used for the
genetic modification. Subsequently, the results of a functional analysis of the strawberry polygalacturonase inhibiting protein gene
(FaPGIP) are described. This indicates that this gene is a possible candidate to induce resistance to Botrytis cinerea when upregulated in
strawberry fruits. For this analysis, the FaPGIP gene was overexpressed in transgenic strawberry plants using the cauliflower mosaic
virus 35S (CaMV35S) promoter. This showed that FaPGIP overexpression led to resistance to Botrytis in transgenic leaves. For the
generation of intragenic (i.e. genetically modification using native genetic elements only) strawberry plants, a transformation vector was
constructed in which FaPGIP was combined with a strawberry fruit-specific promoter and terminator that were isolated from a strawberry
expansin gene (FaExp2). This vector also included elements that allow the elimination of (foreign) selectable marker genes after
genetically modified plant lines have been established. Using this vector, genetically modified strawberry plants were produced that
contained only genes from the species itself, and therefore these plants were called intragenic, rather than transgenic. Unfortunately,
further evaluations of the intragenic strawberry plants could not demonstrate any enhanced level of resistance to Botrytis in fruits.
_____________________________________________________________________________________________________________
Keywords: genetic modification, intragenic, consumer acceptance, polygalacturonase inhibiting protein gene (FaPGIP), soft rot
resistance, Botrytis cinerea
Abbreviations: FaPGIP, strawberry polygalacturonase inhibiting protein gene; FaExp2, strawberry expansin gene; CaMV35S, cauli-
flower mosaic virus 35S
INTRODUCTION portant strawberry cultivars, for example, by the introduc-

tion of disease resistance genes. However, the availability
Breeding for improvement of strawberry is difficult. Many of suitable genes and specific regulatory sequences that will
traits, such as disease resistances, firmness and vulnerability result in desired improvements has been the rate-limiting
of the fruit, productivity and of course its taste, have to be step until recently. Identification and isolation of such genes
considered in the selection of a successful strawberry culti- and sequences still requires specific investments, but comes
var. In addition, genetic variation in Fragaria. x ananassa more and more within our reach with the ever increasing
is very limited, while genetic variation is a prerequisite for power of DNA sequencing techniques. Furthermore, the
progress in conventional breeding. Furthermore, breeding is public attitude toward genetically modified crops in general
hampered because strawberry is an octoploid, hybrid spe- is, at least in Europe, still sceptic, hampering the introduc-
cies, originating from a rather recent cross between two tion of genetically modified strawberries in the immediate
wild octoploid Fragaria species, F. virginiana and F. chilo- future. In addition to this, strict regulations, like the EU
ensis (Darrow 1966). The complicated genetic constitution Directive 2001/18/EC, require very expensive testing to
of the strawberry genome has kept most researchers from warrant environmental and food safety, and thereby limit
investing in the development of methods that could improve the use of this modern technology by small and medium-
breeding of strawberry. Only a few years ago, the first re- sized enterprises. Nevertheless, for many important crops
sults towards the production of a genetic map for strawberry transformation methods have been developed, many
have been published (Haymes et al. 2000; Lerceteau-Kohler genetically improved lines have been produced and several
et al. 2003), opening up possibilities for molecular marker- transgenic crops have been commercialized and are grown
assisted breeding. on a world-wide scale (ISAAA 2008).
Another example of modern breeding technologies is
genetic modification. In strawberry, the first genetic modi- CONSUMER ACCEPTANCE OF INTRAGENIC
fication protocols were developed in the early 90ties (James CROPS
et al. 1990; Nehra et al. 1990a, 1990b) and this approach
has gained increasing interest over the last decade (Debnath In the multidisciplinary EU-project entitled ‘Sustainable
and Teixeira da Silva 2007). In principle, genetic modifica- production of transgenic strawberry plants. Ethical conse-
tion allows a relatively quick improvement of existing im- quences and potential effect on producers, environment and
Received: 27 February, 2010. Accepted: 21 August, 2010.

Genomics, Transgenics, Molecular Breeding and Biotechnology of Strawberry. Husaini AM and Mercado JA (Eds) Global Science Books, UK Original Research Paper
A Consumers’ attitudes towards genetic modification in general

50%
40%
30%
20%
10%
0%
Will lead to No effect Make things Do not know
improvements worse
B Would you buy genetically modified strawberries rather than

conventional strawberries if the modified strawberries were....
100%
80%
60% Would not buy
Would buy
40%
20%
0%
r
r
er
er
es
t
tte
pe
en
de
ng
dd
pl
be
ea
m
ici
ci
lo
r
re
on
ie
ch
st
in
e
st
lth
d
st
pe
pr
vir
an
La
Ta
ea
en
ic
ss
20
er
H
an
Le
r
gg
fo
rg
Bi
O
k
is
R
C Statement: It is more acceptable that one moves genes inside a

species rather than moving them between different species
50%
40%
30%
20%
10%
0%
Completely Partly agree Partly Completely Do not know
agree disagree disagree
Fig. 1 Sociological inquiry among 720 consumers in Norway, Denmark and the UK.
consumers’ (QLK5-CT-1999-01479) one of the aims was to towards genetically modified strawberries, was monitored
produce genetically modified strawberry plants with en- (study performed in 2002-2003). In this survey it was
hanced levels of resistance towards B. cinerea. This would shown that the attitude of consumers in Norway, Denmark
be attained by enhancing the expression level of the PGIP and the UK towards genetic modification in general was
(polygalacturonase inhibiting protein) gene which was rather negative (Fig. 1A), but in more specific cases, regar-
known to give resistance towards Botrytis in transgenic ding genetically modified strawberry plants that had under-
tomato plants in which a PGIP gene from pear was intro- gone different hypothetical modifications, consumer accep-
duced (Powell et al. 2000). To enhance consumer and pro- tance increased when traits beneficial to consumers could
ducer acceptance of genetically modified strawberry plants, be introduced (Fig. 1B). Furthermore, it was shown that
it was considered desirable that only genes and regulatory modifications involving the use of strawberry-own DNA
elements from strawberry itself were used for the improve- exclusively (Fig. 1C). This latter finding was confirmed by
ment and that the ultimate genetically modified strawberry a consumer’s survey in the USA, which showed that the
plants were completely free of any foreign regulatory and majority of the respondents would eat vegetables with an
coding DNA sequences. Nielsen (2003) introduced the term extra gene from the same species or from another vegetable
intragenesis for this condition. In case solely species-own species, while this was only a minority in case viral genes
DNA is used for the genetic modification of a plant, he pro- had been used (Lusk and Sullivan 2002; Lusk and Rozan
posed to call such plants intragenic rather than transgenic. 2006).
Rommens (2004) and Rommens et al. (2004, 2007) elabo-
rated on this topic in several articles in which they reviewed GENETIC MODIFICATION USING SPECIES-OWN
crop improvement using the plants own DNA only. In the DNA SEQUENCES
EU-project mentioned above, also the attitude of consumers
toward genetic modification in general, and particularly The above mentioned sociological studies suggested rela-
103
Intragenic strawberries. Schaart et al.
tively high levels of public acceptance of genetically modi- water

fied crop plants that have only genes from the species itself A spores
or from a cross-compatible species. In such genetically

modified crop plants the introduction of native DNA se-
quences is referred to as intragenesis or cisgenesis. In cis-
genesis the newly introduced DNA is a natural genome
fragment, containing a gene of interest together with its
own introns, 5- and 3-untranslated regions and regulatory NT 1-21
elements (promoter and terminator) (Schouten et al. 2006).
Like cisgenesis, intragenesis also uses donor gene sequen-
ces from the species itself or from a natural crossable donor
species, but in intragenesis new genes can be created by
combining functional genetic elements such as promoters,
coding parts (with or without introns) and terminators of
different natural genes, and insert this new chimeric gene
1-27 1-28
into existing varieties (Rommens 2004; Rommens et al.
2004; Rommens 2007; Schouten and Jacobsen 2008). B 2
compared to water inoculation

ISOLATION AND CHARACTERISATION OF
after B. cinerea inoculation,

Increased lesion size (mm)
1.5
STRAWBERRY PGIP
1
For the ultimate production of intragenic or cisgenic crops
the availability of specific genes and regulatory sequences
within a species is a prerequisite. Up to date, for a number 0.5
of plant species the complete genome sequence is available
or will become available soon, which facilitates identifica- 0
tion and isolation of the required gene and promoter se-
1-28
1-29
2-02
2-04
2-08
2-22
2-23
1-21
1-24
2-27
1-04
1-07
1-08
1-23
1-27
NT
quences. However, for most crop species up till now, only -0.5
limited information on genes and regulatory sequences is
available and approaches like amplification using degene- * * ** * *
rated primers for the isolation of new genes and genome Fig. 2 B. cinerea colonisation test on detached leaves of non-transgenic
walking for the isolation of desired promoter and terminator control (NT) and genetically modified strawberry plants transformed
sequences have to be employed (Agius et al. 2005). After with a construct containing FaPGIP under the regulation of the
isolation of species-specific gene and regulatory sequences, CaMV 35S promoter. Detached leaves were wounded with a needle,
accurate functional characterisation of the sequences needs giving an approximately 1 mm diameter lesion. Two μl (105 spores/ml) of
to be performed, in order to be able to anticipate the effects germinating B. cinerea spores (line BCNL) were pipetted on each wound.
of the envisaged modification. The left half of the leaf was inoculated with spores, while the right half
For the aimed introduction of B. cinerea resistance in was inoculated with water. For each transgenic line 3 leaves were inocu-
strawberry, we focussed on the FaPGIP gene sequences lated at six positions per inoculum (spores vs. water) per leaf. Leaves were
from strawberry. Plant-pathogenic fungi, like Botrytis, pro- incubated in separate containers for 7 days, after which the diameter of
duce cell wall degrading enzymes with which they attack each lesion was measured. (A) Example of B. cinerea-inoculated leaves, 7
the plant. Studies have shown that PGIP from a variety of days after inoculation. NT = non-transgenic control; 1-21, 1-27 and 1-28
origins is able to inhibit B. cinerea polygalacturonase (a cell are leaves from three different transgenic lines. (B) Average differences in
wall degrading enzyme) activity in vitro (Sharrock and lesion size (mm) of non-transgenic control (NT) and several transgenic
Labavitch 1994; Yao et al. 1995). It was also shown that lines. Difference is calculated with respect to the average of all water con-
introduction of a PGIP from pear into transgenic tomato trol lesion diameters (1.95 mm; SD= 0.54). Statistical analysis was done
plants resulted in an enhanced level of resistance towards B. with two-way ANOVA. Transgenic lines marked with an asterisk differ
cinerea (Powell et al. 2000). Richter et al. (2006) and Janni significantly from the non-transgenic control at P-values < 0.05.
et al. (2008) also showed that overexpression from PGIP of
raspberry or bean in transgenic pea and wheat, respectively,
increased resistance to infections by fungal pathogens.
Finally, the important role of PGIP in conferring resistance was overexpressed using the constitutive CaMV35S promo-
to Botrytis was demonstrated by antisense expression of ter. Because this promoter provides strong expression in
PGIP in Arabidopsis, which reduced accumulation of PGIP strawberry leaf tissue (Schaart et al. 2011), its use allows
and subsequently resulted in an enhanced susceptibility to early screening of B. cinerea resistance in transgenic straw-
Botrytis (Ferrari et al. 2006). This information suggested berry leaf tissue. Inoculation of detached leaves of straw-
that for strawberry, overexpression of the PGIP gene would berry plants with B. cinerea showed that for a certain num-
be a suitable option to achieve an enhanced Botrytis resis- ber of these transgenic plants, inoculation did not result in a
tance level. significantly different reaction as compared to control
We isolated and characterised a PGIP gene from straw- (water) inoculations on the same leaf (Fig. 2), indicative for
berry (Mehli et al. 2004; Schaart et al. 2005) and showed enhanced resistance. For non-transgenic control plants as
that in the natural situation this FaPGIP was expressed at well as for some of the transgenic plants, inoculation with B.
relatively low level in leaves and immature fruit tissue, but cinerea resulted in a clear destruction of leaf tissue giving
that it was upregulated during strawberry fruit ripening. significantly larger lesions than the control (water) inocu-
Inoculation of fruits with B. cinerea spores led to a rapid lations. These results indicated that overexpression of
upregulation of FaPGIP expression to a level that, depen- FaPGIP was able to confer resistance to B. cinerea in trans-
ding on the strawberry cultivar tested, was 4-40 times genic strawberry plants, at least in leaf tissue. The cor-
higher than found for the control red fruits. This upregula- relation between the level of resistance to B. cinerea and ex-
tion was however transient and FaPGIP was downregulated pression pattern and levels of FaPGIP was not investigated
again two days after inoculation. These observations in these plants.
prompted us to aim at modifying FaPGIP gene expression Because our ultimate aim was to achieve intragenic
in such a way that sufficient FaPGIP activity would be pre- rather than transgenic strawberry lines, we did not induce
sent in B. cinerea susceptible tissues and stay present. flowering and fruiting of the transgenic plants in which the
For functional analysis of FaPGIP in strawberry, we CaMV35S promoter was used to drive FaPGIP expression.
produced transgenic strawberry plants in which FaPGIP
104
SELECTION OF SUITABLE STRAWBERRY GENE PRODUCTION OF INTRAGENIC STRAWBERRY

PROMOTER PLANTS
In strawberry, primary B. cinerea infections take place In the end, the combined use of all aspects described above,
through the flower after which the fungus remains latent in the strawberry PGIP gene to confer resistance to Botrytis,
immature fruits. Once the strawberry fruit ripens, B. cinerea the strawberry fruit-specific promoter from the FaExp2
causes fruit rot which subsequently can lead to secondary gene to direct gene expression to high levels in strawberry
infections of the so far unaffected other ripe and unripe fruits and a marker-removal system for elimination of for-
fruits. In order to restrain B. cinerea in an effective way, eign DNA sequences from the predestined intragenic plants,
FaPGIP upregulated expression should be extended at least enables the production of genetically modified plants which
into the ripe fruit stage, but preferentially also in flowers contain only gene and promoter sequences from strawberry
and immature fruits. In order to achieve an effective itself. To demonstrate the possibility of producing such
FaPGIP expression pattern, specific promoter sequences intragenic plants, we constructed a transformation vector in
had to be identified. Initially, for a transgenic approach we which FaPGIP was combined with regulatory sequences of
focussed on the heterologous CaMV35S and the petunia FaExp2. For this, next to the 1.6 kb promoter also a 500 bp
fbp7-promoter sequences that were already available, and sequence fragment which is flanking the 3-end of FaExp2
we tested these promoter sequences for their expression was isolated and was used as terminator sequence (tExp2).
pattern in transgenic strawberry plants (Schaart et al. 2002). The 1.6pFaExp2-FaPGIP-tFaExp2 chimeric gene was then
Both promoter sequences seemed to be able to direct ex- introduced in the binary vector pMF1 for production of
pression of the -glucuronidase reporter gene in flowers as marker-free genetically modified plants (Schaart et al.
well in different developmental fruit stages, and are, there- 2011) (Fig. 3). In this binary vector an inducible recom-
fore, suitable to induce the intended upregulation of binase gene and the bifunctional selectable marker gene are
FaPGIP. However, to follow the intragenic approach, suita- flanked by recombination sites. Chemical induction of re-
ble promoter sequences have to be isolated from strawberry combinase activity enables recombination mediated remo-
itself. For this purpose, a strawberry expansin gene, FaExp2, val of undesired gene sequences at the desired point in time.
that showed fruit ripening-specific expression (Civello et al. For a detailed description of the pMF1 vector and of the
1999; Aharoni et al. 2002; Salentijn et al. 2003) was selec- marker removal protocol, see Schaart et al. (2004, 2010).
ted and its promoter was isolated and characterized using Using this vector for transformation of strawberry and for
transgenic plants in which the promoter was fused to a gus successive removal of the selectable marker and recom-
reporter gene (Schaart et al. 2011). It was shown that the binase gene from the transgenic plants that were obtained,
FaExp2 promoter fragments regulated gus expression in a resulted in 14 putative intragenic strawberry plants. PCR
fruit-specific way, which was in agreement with the des- analysis showed that in 11 out of 14 of these plants the new
cribed FaExp2 expression pattern. Interestingly, plants with 1.6pFaExp2-FaPGIP-tFaExp2 gene combination was pre-
the 1.6 Kb FaExp2-promoter fragment showed a much sent and that the selectable marker gene was successfully
higher gus expression than a shorter 0.7 Kb FaExp2-pro- removed (data not shown) and that these plants could be
moter fragment. In order to achieve high levels of FaPGIP labelled as intragenic. The presence of binary vector DNA
expression for inhibition of B. cinerea in the ultimate intra- (which is of foreign origin) was not checked in these puta-
genic strawberry plants, the 1.6pFaExp2-fragment was con- tive intragenic plants. In similar experiments using a pMF1-
sidered to be most suitable and was subsequently chosen for based vector in strawberry transformation demonstrated
further experimentation. however, that in a considerable number of transformed
plants (up to 50%) pMF1 vector backbone sequences were
USE OF SELECTABLE MARKER-REMOVAL
SYSTEM
RB
For the efficient production of genetically modified plants RK2
the use of selectable marker genes is a prerequisite. In many
transformation protocols either herbicide or antibiotic resis- ColE1
tance genes have been shown to act as very effective selec-
table markers for genetically modified tissue and they have p1.6FaExp2
found wide application. However, public debate concerning
health and environmental risks has focused particularly on nptIII
such resistance genes, which make them undesirable in the FaPGIP pMF1-
final products. The public concerns have resulted in the pFaExp2-FaPGIP-tFaExp2
development of selection methods which make use of alter- tFaExp2
trfA
native, less objectionable selectable marker genes. Such 17147 bps
RS
genes are mostly genes of bacterial origin, like the phospho- tNos
mannose-isomerase gene which enables transgenic plants to
proliferate on mannose, which cannot be metabolised by LB
many plant species (Joersbo et al. 1998). pCaMV35S
Recombinase R-LBD RS
Next to the use of alternative selectable marker genes,
systems have been developed which allow the elimination CodA-
of selectable marker genes after they have been used. Such pCaMV35S NptII
a marker removal system is especially valuable for vege- tNos
tatively propagated crops, like strawberry, and for crops
with long reproductive cycles. In view of the higher level of
acceptance of genetically modified plants which are devoid Fig. 3 pMF1 binary vector with the intragene 1.6pFaExp2-FaPGIP-
of foreign gene sequences, the use of elimination systems is tFaExp2 for obtaining marker-free GM plants that overexpress
preferable to the use of alternative selectable marker genes. FaPGIP in a fruit-specific way. White boxed sequences are located on
We therefore developed and tested a recombinase based the binary vector backbone. The black and grey boxed sequences are
system for elimination of undesired DNA sequences in located on the T-DNA, which is flanked by RB and LB (right and left T-
strawberry (Schaart et al. 2005, 2010). We demonstrated DNA border sequences, respectively) and which is transferred to the
that this method could be applied effectively using our stan- plants cell and incorporated into the plant genome. The grey boxed se-
dard strawberry transformation protocol and that by marker quences are flanked by RS, Recombination sites, and these sequences will
removal, marker-free plants could effectively be produced. be removed after induction of recombinase activity (see Schaart et al.
2011 for detailed explanation).
105
Intragenic strawberries. Schaart et al.
may lead to a new way of sustainable crop production prac-

tices.
REFERENCES
Agius F, Amaya I, Botella MA, Valpuesta V (2005) Functional anaysis of
homologous and heterologous promoters in strawberry fruits using transient
expression. Journal of Experimental Botany 56, 37-46
Aharoni A, Keizer LCP, van den Broeck HC, Blanco Portales R, Munoz
Blanco J, Bois G, Smit P, De Vos RCH, O’Connell AP (2002) Novel insight
into vascular, stress, and auxin-dependent and -independent gene expression
programs in strawberry, a non-climacteric fruit. Plant Physiology 129, 1019-
1031
Civello PM, Powell ALT, Sabehat A, Bennett AB (1999) An expansin gene
expressed in ripening strawberry fruit. Plant Physiology 121, 1273-1279
Darrow GM (1966) The Strawberry History, Breeding and Physiology, Holt,
Rinehart and Winston, New York, 447 pp
De Buck S, De Wilde C, Van Montagu M, Depicker A (2000) T-DNA vector
backbone sequences are frequently integrated into the genome of transgenic
plants obtained by Agrobacterium-mediated transformation. Molecular
Breeding 6, 459-468
Fig. 4 Greenhouse with intragenic strawberry plants transformed
Debnath SC, Teixeira da Silva JA (2007) Strawberry culture in vitro:
with the pMF1- 1.6pFaExp2-FaPGIP-tFaExp2.. applications in genetic transformation and biotechnology. Fruit, Vegetable
and Cereal Science and Biotechnology 1, 1-12
Ebinuma H, Sugita K, Matsunaga E, Endo S, Yamada K, Komamine A
co-integrated with the gene of interest. This result indicates (2001) Systems for the removal of a selection marker and their combination
with a positive marker. Plant Cell Reports 20, 383-392
that the number of true intragenic (marker- and vector back- Ferrari S, Galletti R, Vairo D, Cervone F, De Lorenzo G (2006) Antisense
bone-free) plants obtained described here is likely to be expression of the Arabidopsis thaliana AtPGIP1 gene reduces polygalacturo-
lower. Although the aim of the EU project was just to nase-inhibiting protein accumulation and enhances susceptibility to Botrytis
demonstrate the possibility to produce intragenic strawberry cinerea. Molecular Plant-Microbe Interactions 19, 931-936
plants, we obviously were interested in the performance of Haymes KM, van de Weg WE, Arens P, Maas JL, Vosman B, den Nijs APM
the newly introduced FaPGIP gene under the regulation of (2000) Development of SCAR markers linked to a Phytophthora fragaria re-
the FaExp2 promoter and terminator. For this the intragenic sistance gene and their assessment in European and North American straw-
strawberry plants were transferred to the greenhouse (Fig. berry genotypes. Journal of the American Society for Horticultural Sciences
4) for production of fruits for further characterisation. For 125, 330-339
ISAAA Brief 39-2008 Global Status of Commercialized Biotech/GM Crops:
evaluation of the level of Botrytis resistance in ripening 2008; The First Thirteen Years, 1996 to 2008. Available online:
fruits, Botrytis spores were injected (50 μl of conidial sus- www.isaaa.org/RESOURCES/PUBLICATIONS/BRIEFS/39
pension of 105 spores.ml-1 in fruits at different developmen- James DJ, Passey AJ, Barbara DJ (1990) Agrobacterium-mediated transfor-
tal stages and fruit rot incidence was monitored one week mation of the cultivated strawberry (Fragaria × ananassa Duch.) using dis-
after injection of the fruits. Unfortunately, this assay could armed binary vectors. Plant Science 69, 79-94
not demonstrate any increase in Botrytis resistance in the Janni M, Sella L, Favaron F, Blechl AE, De Lorenzo G, D’Ovidio R (2008)
intragenic fruits as compared to control fruits. Because we The expression of a bean PGIP in transgenic wheat confers increased resis-
have not quantified FaPGIP transcript or FaPGIP protein tance to the fungal pathogen Bipolaris sorokiniana. Molecular Plant-Microbe
levels in the intragenic fruits, we cannot conclude whether Interactions 21, 171-177
Joersbo M, Donaldson I, Kreiberg J, Guldarger Petersen S, Brunstedt J,
the lack of improved resistance was due to poor FaPGIP Okkels FT (1998) Analysis of mannose selection used for transformation of
expression in the fruits tested or that PGIP alone was in- sugar beet. Molecular Breeding 4, 111-117
sufficient to stop Botrytis colonisation in the intragenic Lerceteau-Kohler E, Guerin G, Laigret F, Denoyes-Rothan B (2003) Charac-
strawberry fruits or that the number of spores that were terization of mixed disomic and polysomic inheritance in the octoploid straw-
injected was too high to discriminate between resistant and berry (Fragaria x ananassa) using AFLP mapping. Theoretical and Applied
susceptible. Genetics 107, 619-628
Lusk JL, Sullivan P (2002) Consumers acceptance of genetically modified
CONCLUSION foods. Food Technology 56, 32-37
Lusk JL, Rozan A (2006) Consumer acceptance of ingenic foods. Biotechnol-
ogy Journal 1, 1433-1434
In this short communication different steps have been des- Matsuzaki H, Nakajima R, Nishiyama J, Araki H, Oshima Y (1990) Chro-
cribed to come to genetically modified plants in which only mosome engineering in Saccharomyces cerevisiae by using a site-specific
gene sequences from the species itself have been introduced. recombination system of a yeast plasmid. Journal of Bacteriology 172, 610-
To demonstrate the successful production of intragenic 618
strawberry plants, an intragene was constructed by com- Mehli L, Schaart JG, Kjellsen TD, Tran DH, Salentijn EMJ, Schouten HJ,
bining the regulatory properties of the strawberry FaExp2 Iversen T-H (2004) A gene encoding a polygalacturonase-inhibiting protein
gene with the functional gene properties of the strawberry (PGIP) shows developmental regulation and pathogen-induced expression in
FaPGIP gene. This new gene combination was successfully strawberry. New Phytologist 163, 99-110
introduced into strawberry plants after which the undesired Nehra NS, Chibbar RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C
(1990a) Genetic transformation of strawberry by Agrobacterium tumefaciens
selectable marker genes, that were essential for the produc- using a leaf disk regeneration system. Plant Cell Reports 9, 293-298
tion of the genetically modified strawberry plants, were Nehra NS, Chibbar RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C
removed. This resulted ultimately in the production of intra- (1990b) Agrobacterium-mediated transformation of strawberry calli and re-
genic strawberry plants. covery of transgenic plants. Plant Cell Reports 9, 10-13
Because the intragenic strawberry plant did not show Nielsen KM (2003) Transgenic organisms – time for conceptual diversifica-
the expected phenotype, i.e. enhanced resistance to Botrytis, tion? Nature Biotechnology 21, 227-228
other intragenes should be constructed and tested to ulti- Powell ALT, van Kan J, ten Have A, Visser J, Greve LG, Bennett AB, Laba-
mately reach the goal of producing Botrytis resistant intra- vitch JM (2000) Transgenic expression of pear PGIP in tomato limits fungal
genic strawberry lines. Cultivating such intragenic straw- colonization. Molecular Plant-Microbe Interactions 13, 942-950
Richter A, Jacobsen HJ, de Kathen A, de Lorenzo G, Briviba K, Hain R,
berries will result in reduction of fungicide applications, Ramsay G, Kiesecker H (2006) Transgenic peas (Pisum sativum) expressing
which will be favourable to producers, consumers and envi- polygalacturonase inhibiting protein from raspberry (Rubus idaeus) and stil-
ronment, and because of its intragenic nature, it is en- bene synthase from grape (Vitis vinifera). Plant Cell Reports 25, 1166-1173
visaged that such a particular intragenic strawberry will find Rommens CM (2004) All-native DNA transformation: a new approach to plant
good acceptance by producers and consumers of straw- genetic engineering. Trends in Plant Science 9, 457-464
berries. In the end, the use of intragenic strawberry plants Rommens CM, Humara JM, Ye J, Yan H, Richael C, Zhang L, Perry R,
106
Swords K (2004) Crop improvement through modification of the plant’s own (PGIP) using Pyrosequencing™. The Plant Journal 41, 493-500
genome. Plant Physiology 135, 421-431 Schaart JG, Salentijn EMJ, Pelgrom KTB, Aharoni A, Krens FA (2011)
Rommens CM (2007) Intragenic crop improvement: Combining the benefits of Isolation and characterisation of a strawberry fruit-specific promoter. In:
traditional breeding and genetic engineering. Journal of Agricultural Food Husaini AM, Mercado JA (Eds) Genomics, Transgenics, Molecular Breeding
Chemistry 55, 4281-4288 and Biotechnology of Strawberry. Genes, Genomes and Genomics 5 (Special
Salentijn EMJ, Aharoni A, Schaart JG, Boone MJ, Krens FA (2003) Dif- Issue 1), 108-114
ferential gene expression analysis of strawberry cultivars that differ in fruit- Schouten HJ, Jacobsen E (2008) Cisgenesis and intragenesis, sisters in in-
firmness. Physiology Plantarum 118, 571-578 novative plant breeding. Trends in Plant Science 13, 260-261
Schaart JG, Salentijn EMJ, Krens FA (2002) Tissue-specific expression of Schouten HJ, Krens FA, Jacobsen E (2006) Cisgenic plants are similar to
the -glucuronidase reporter gene in transgenic strawberry (Fragaria x ana- traditionally bred plants. EMBO Reports 7, 750-753
nassa) plants. Plant Cell Reports 21, 313-319 Sharrock KR, Labavitch JM (1994) Polygalacturonase inhibitors of Barlett
Schaart JG, Krens FA, Pelgrom KTB, Rouwendal GJA (2004) Efficient pro- pear fruits: differential effects on Botrytis cinerea polygalacturonase iso-
duction of marker-free transgenic strawberry plants using inducible R/RS site zymes, and influence on products of fungal hydrolysis of pear cell walls and
specific recombination and a positive-negative selectable marker hybrid gene. on ethylene induction in cell culture. Physiological and Molecular Plant
Plant Biotechnology Journal 2, 233-240 Pathology 45, 305-319
Schaart JG, Krens FA, Wolters A-MA, Visser RGF (2010) Transformation Srivastava V, Anderson OD, Ow DW (1999) Single-copy transgenic wheat
methods for obtaining marker-free genetically modified plants. In: In: Neal generated through the resolution of complex integration patterns. Proceed-
Stewart Jr. C, Touraev A, Citovsky V, Tzfira T (Eds) Plant Transformation ings of the National Academy of Sciences USA 96, 11117-11121
Technologies, Wiley-Blackwell Publishing, London, pp 229-242 Yao CL, Conway WS, Sams CE (1995) Purification and characterization of a
Schaart JG, Mehli L, Schouten HJ (2005) Quantification of allele-specific ex- polygalaturonase-inhibiting protein from apple fruit. Phytopathology 85,
pression of a gene encoding strawberry polygalacturonase-inhibiting protein 1373-1377
107
Isolation and Characterisation

of a Strawberry Fruit-Specific Promoter
Jan G. Schaart1* • Elma M. J. Salentijn1 • Koen T. B. Pelgrom1 •
Asaph Aharoni2 • Frans A. Krens1
1 Wageningen UR Plant Breeding, Wageningen University and Research Centre, P.O. Box 16, 6700 AA, Wageningen, the Netherlands
2 Department of Plant Sciences, Weizmann Institute of Science, Rehovot, Israel
Corresponding author: * jan.schaart@wur.nl
ABSTRACT
In order to achieve specific expression of transgenes in strawberry fruits, the availability of tissue- (receptacle) specific promoter
sequences is desired. For this reason, 5-upstream sequences of the strawberry expansin gene FaExp2, which is expressed in a fruit-
specific manner, have been isolated. To characterise the promoter activity of the isolated sequences, fragments of 0.7 kb (0.7pFaExp2)
and 1.6 kb (1.6pFaExp2) have been fused to the -glucuronidase reporter gene (gus). In transgenic strawberry plants transformed with
either 0.7pFaExp2-gus or 1.6pFaExp2-gus, a fruit-specific expression pattern was observed for both promoter constructs. However,
quantitative RT-PCR revealed that gus expression levels driven by the 1.6pFaExp2 promoter fragment were much more higher. In
addition to the expression in fruits, both promoter fragments also seemed to direct gene expression in the achenes and to some extent in
epidermal and subepidermal tissues of petioles and stems of flowers and fruits. It is concluded that both promoter sequences are suitable
for directing transgene expression in strawberry fruits in a specific way.
_____________________________________________________________________________________________________________
Keywords: expansin gene, Fragaria x ananassa, gene expression, receptacle

Abbreviations: CaMV35S, cauliflower mosaic virus 35S; dbp, putative DNA binding protein from Arabidopsis thaliana; FaExp,
strawberry expansin gene; GUS, -glucuronidase; gus, -glucuronidase reporter gene; X-gluc, 5-bromo-4-chloro-3-indolyl -glucuronide
INTRODUCTION cribed. Spolaore et al. (2003) demonstrated differences in

timing and levels of expression of two endo--1,4-gluca-
Genetic modification of crop plants is gaining importance. nase genes and studied promoter activities of the correspon-
A key feature of genetic modification is that a cultivar of ding regulatory sequences using gus-reporter gene fusions.
particular interest can undergo improvement of one or a few It was concluded that both promoter sequences could be
traits, while the cultivar’s own characteristic properties are candidates for genetic modification approaches involving
in principle not disturbed. Most currently cultivated genetic- modification of fruit-specific characteristics. Unfortunately,
ally modified crops have been modified by introducing no data showing spatial expression patterns of both pro-
genes that provide the plant with resistances to herbicides, moters were shown. The strawberry AGAMOUS homolog
bacterial or fungal pathogens or insects. In these crops STAG1 showed a low level of fruit-specific expression as
generally strong heterologous constitutive promoters like determined by Northern blot analysis (Rosin et al. 2003). A
the cauliflower mosaic virus 35S (CaMV35S) promoter detailed expression study was performed using transgenic
have been employed, but the advantages of regulating trans- strawberry plants containing STAG1-promoter-gus fusions.
gene expression more finely and specifically are increa- Histochemical GUS staining revealed that STAG1-promoter
singly being recognised (Potenza et al. 2004). activity was mainly localised in the achenes and in vascular
Breeding of improved strawberry cultivars is difficult strands leading to the achenes. In mature fruits a faint GUS
and time-consuming. Amongst others, breeding of straw- staining was observed throughout the cortex and the pith of
berries is hampered because of their octoploid, hybrid and the strawberry fruit. This promoter may, therefore, be
highly heterozygous genome (Shaw and Famula 2005). In suitable for certain applications for which low expression
addition, the availability of genetic resources is limited for levels are required. Agius et al. (2005) analysed the activity
many important traits such as disease resistance. Genetic of two heterologous promoters and the homologous GalUR
modification of strawberry looks promising for a relatively promoter, which regulates the expression of the D-galactu-
quick improvement of existing important strawberry culti- ronate reductase gene in ripe strawberry fruits. Using bio-
vars (Nehra et al. 1990a, 1990b). Depending on the cultivar listic transient transformation of ripe strawberry fruit tissue
of interest, the production of transgenic strawberry plants is it was shown that the GalUR promoter drives luciferase
rather easy to realise. However, the number of suitable reporter gene expression to a similar high level as the
genes and specific regulatory sequences that will result in CaMV35S promoter did. Recently, the isolation of a fruit-
the desired improvements is still rather limited. specific promoter of the strawberry -xylosidase gene was
Initially, we described the possibility of two heterolo- also reported (Bustamante et al. 2009), but in this study no
gous promoter sequences to direct gene expression in straw- expression analysis of the isolated promoter sequence was
berry fruits (Schaart et al. 2002). However, for more spe- performed.
cific and higher levels of gene expression, other promoters, We aimed at the identification of a strawberry promoter
for example promoters that are highly strawberry recepta- sequence, which is able to direct transgene expression to a
cle-specific, have to be identified and isolated from straw- high level in a receptacle-specific way. For this, we selected
berry itself. Only for a few strawberry genes the isolation the strawberry expansin 2 gene (FaExp2), which showed a
and characterisation of promoter sequences have been des- high expression level in strawberry fruit during ripening
Received: 25 January, 2010. Accepted: 16 April, 2011.

(Civello et al. 1999; Aharoni et al. 2002; Salentijn et al. EcoRI

2003; Dotto et al. 2006; Figueroa et al. 2009), and cloned
and characterised its 5-upstream genomic DNA fragments. RB
MATERIALS AND METHODS 1.6pFaExp2
Isolation of nucleic acids gus
Genomic DNA was isolated from young folded leaves from green- RK2
house plants according to the method described by Doyle and EcoRI
Doyle (1987), including 1% (w/v) polyvinylpyrrolidone-10 tnos HindIII
(Sigma-Aldrich) in the DNA extraction buffer. Total RNA was 16105 bps
isolated from young leaves, roots and small green, green-white,
tnos
large white, turning and orange and red ripe fruits as described by
Asif et al. (2000). ColE1
nptII
Isolation of promoter fragments nptIII
pnos
nptII-probe
Isolation of 5’-upstream sequences was performed as described by trfA LB
Rosin et al. (2003). In short, for the isolation of expansin promoter
fragments, genomic DNA libraries of the strawberry cultivar
‘Elsanta’ were used which had been constructed using the Univer-
sal Genome Walker™ kit (BD Bioscience). For the primary and Fig. 1 Schematic representation of the binary vector used for transfor-
nested PCR the FaExp2 gene specific primers GSP1 (5-CCAGAA mation of strawberry for expression analysis of the FaExp2 promoter
GCATCACCACCTCCATAGA-3) and GSP2 (5-GATACCAG- fragments. For analysis of the shorter promoter fragment, the 1.6pFaExp2
AAGAGTAATAGCCAAGC-3) were used, together with the cor- in the binary vector promoter sequence is replaced by 0.7pFaExp2. The
responding adapter primers (AP1 and AP2, respectively). PCR CaMV35S promoter was used for control plants. The restriction enzyme
conditions used were as described into the Universal Genome sites EcoRI and HindIII and the indicated nptII probe are used in DNA-gel
WalkerTM kit user manual. Three cloned PCR fragments of res- blot analysis.
pectively 400, 700 and 1600 bp were obtained from a ScaI-, StuI-
and DraI-digested genomic DNA library, and were completely
sequenced. triction enzymes EcoRI or HindIII. After electrophoretic separa-
tion of the fragmented DNA on a 0.9% agarose gel, the DNA was
Sequence-specific PCR transferred onto Hybond-N+ membranes (Amersham Biosciences).
Overnight hybridisation at 65°C with an alkaline phosphatase-
Because in strawberry different expansin gene sequences have labelled nptII probe, stringent washing [2 × (1.0 SSC + 0.1% SDS)
been identified, sequence- specific PCR was applied to check cor- + 1 × (0.1 SSC + 0.1% SDS)] at 65°C and chemiluminescent
relation of the obtained promoter fragments with the different ex- detection was performed according to the ‘gene images AlkPhos
pansin gene sequences. For this PCR, forward primers unique for direct labelling and detection system’ (Amersham Biosciences).
each of the 700 and 1600 bp promoter fragments (5-TTCTGC
TTCTTACAATCCACCAC-3 and 5-TTCTGCTTCGAGTTC Histochemical GUS-assay
TCATTATCC-3, respectively; Fig. 2) were combined with reverse
primers, which have been described by Harrison et al. (2001) and Histochemical GUS staining of leaf discs, root tips, cross-sections
which are specific for six different expansin genes (FaExp 2 –7). of petioles and longitudinal sections of petioles, flowers and fruits
at various developmental stages was performed as described by
Construction of transformation vector Jefferson (1987) using a modified staining solution containing 1
mM 5-bromo-4-chloro-3-indolyl -glucuronide (X-gluc; Duchefa)
To study promoter activities of the 700 bp and 1600 bp FaExp2 in 50 mM sodium phosphate buffer (pH 7.5), 10 mM EDTA, 0.1%
promoter fragments, both were cloned upstream of the -glucu- (v/v) Triton X-100, 0.5 mM potassium ferricyanide and 5% (w/v)
ronidase (GUS) reporter gene (gus) that was equipped with a polyvinylpyrrolidone-40 (all from Sigma-Aldrich).
nopaline synthase terminator sequence. The promoter-gus fusions,
which are indicated as 0.7pFaExp2-gus and 1.6pFaExp2-gus, were Quantitative RT-PCR
cloned into the binary vector pBinplus (van Engelen et al. 1995)
(Fig. 1), and the ultimate construct was subsequently transferred to For quantification of gus expression levels quantitative RT-PCR
the supervirulent Agrobacterium tumefaciens strain Agl0 (Lazo et was performed. In order to limit the number of RNA isolations, for
al. 1991). each tissue type RNA was isolated from pooled tissue of the dif-
ferent independent transformants produced with the same cons-
Strawberry transformation truct. cDNA was synthesised using the SuperScript first-strand
cDNA synthesis system for RT-PCR (Invitrogen) according to the
For expression analysis of the cloned promoter fragments, trans- instruction manual. Quantitative RT-PCR was performed using the
genic strawberry plants of the cultivar ‘Calypso’ harbouring T- ABI Prism7700 Sequence Detection System (Perkin Elmer,
DNA with the described constructs were produced according to Applied Biosystems) as described by Schaart et al. (2002), but
Schaart et al. (2002). As a control, transgenic plants with the gus instead of the fluorogenic TaqMan probes, SYBR Green was used
gene under the control of the constitutive CaMV35S promoter for detection of PCR products. For amplification of gus, the for-
were produced. From the obtained transgenic strawberry plants ward and reverse gus-primers (5-cggaagcaacgcgtaaactc-3 and 5-
containing 0.7pFaExp2-gus or 1.6pFaExp2-gus, respectively three tgagcgtcgcagaacattacat-3) were used (product size: 80 bp). As
and four independent transgenic lines, showing intense GUS stain- endogenous control, a strawberry gene encoding a DNA binding
ing in red fruit tissue were selected for further analysis. One protein with high homology to a gene coding for a putative DNA
CaMV35S-gus plant showing intense blue staining in red fruit binding protein from Arabidopsis thaliana, was selected as a ref-
tissue was included as control. erence gene. This gene, indicated as dbp (forward primer 5-TTG
GCAGCGGGACTTTACC-3, reverse primer 5-CGGTTGTGT
DNA gel-blot analysis GACGCTGTC-AT-3, product size: 72 bp), has shown a similar
level of expression in multiple strawberry tissues (Schaart et al.
Ten microgram of genomic DNA of the different transgenic lines 2002). All PCR reactions were performed in triplicate. For each
and a non-transgenic strawberry plant was digested with the res- reaction the threshold cycle, CT, which is defined as the PCR cycle
109
Strawberry fruit-specific promoter. Schaart et al.
-1574 : TTTAAACGGAGACCTTACTTATTACTTATCAAGAGGTGAGCATTTATTAGAAATTAAGAAGCATYTTAGTAATCTCG 1.6pFaExp2

Dra
-1500 : ATGATAGATTACAGCGTCAACATGTAACATGCTACTGTTATTTTAGTTCTTCACAAATCTTCGTATTGAAGCTAACAAACGTGTATGAGTGATTCTATAT
I 1.6pFaExp2
-1400 : AAACCCTAGTCATTATTATTTTTTGGTTGACAATCACTCTACCTATTCAACTAGCACTTTGTTTATACTTCCAATCTGTCTCGAACGTTTTCGTTTCTTA 1.6pFaExp2
-1300 : ATTTCAACCGACAAACTATTCTCGAAATCTTTCTACCTATTTGGCCTTTTGGTGACTCATATCTGCACTTTGTTTAACTTGTTTTATTAATTTGACTCAT 1.6pFaExp2
-1200 : GTCTAACAAATCAAGCATATTTACAGATTCTCAATCTTTGAAGAGGCGAATAATGATCAAAACTCACACGTGGGAACTGATAGTTCATGATTCTCAATCT 1.6pFaExp2
-1100 : TCTCCTCAAAGACGTACAATGATTTTTATGTCGGATTTACTAAGAAGATCCTCTGCAAAACAATCTTCATTGGATTCATTGCATCTTTCATGCATCAAAT 1.6pFaExp2
-1000 : GAAATATATGATTGATTGTTTCATGTAACCTTCTTGGGGTTTCTAACAAATATTAAGCAAAGAACCTAAAAGGGTAGGTAAATTTGCTTCATTGCTTGGA 1.6pFaExp2
-900 : GGGAAGGGTAACTAATAAGTTGGGGGTAACTACTCCGCAAACAAGTAATGGGGGAAACTACATGTAGTCTTTTGGGGTTCCTATGGCAACAGGGAAATGC 1.6pFaExp2
-800 : TTCGGTTCTTAAGCAGAGGTTAACGGAATACGTATAGAAACCAATGGACTTAGCTTTATGTATGCCTAGGATTTTGACAGCAACAAGTAATATTATCTCT 1.6pFaExp2

: AGGCCTAGGATTTTGACAGCAACAAGTAATATTATCTCT 0.7pFaExp2
Stu I
-700 : TGAAAGGATAGTGTTCACCTGGCCGGTTGCGGCTACAAATTATAAAGCAAA-AGTGTTCAAACACTTTTTCTT-----AAGTGTGCAATATGAATTCAAG 1.6pFaExp2
: TGTAACGATAGTGTTCACCTGGTCGGTGGCGGCTACAAATTATAAAGTAAATAGTGTTCAATCACCTTTTCTTTTCTTAAGTGTGAAATATGAATTCAAG 0.7pFaExp2
-600 : GTATTTAAGRTGAAGATATGACTTGCCTACCAAATTGGACCTAAACAGCCCCCAATCGAAGGGTATACTACGTTGATGGCTAATCTAATCTGCGTAATTT 1.6pFaExp2

: GTATTTAAGATGAAGATA-GACTTGCCTACCAAATTGGACCTAAACAGCCCC-AATCGAAGGGTATAATACGTTGATGGCTAATCTAATCTGCTTAATTT 0.7pFaExp2
-500 : CAGGCAAAAAACTGAAATGAAAGAAGGAAAATATATACCCAATTCCACACGTAATAACCATTTGAAAATCACATAAACAAAAAACAATAATGGTACTGTT 1.6pFaExp2

: CAGGCAAAAAACTGAAATGAAAGAAGGAAATGAAATACCCAATTCCACACGTAATAACCATTTGAAAATCACRTAAACAAAAA-CAATAATGGTACTGTT 0.7pFaExp2
: AGTACTGTT 0.4pFaExp2
Sca I
-400 : TGTTGAAGAAAAATACATATGGAAATAAAAATGCATGTGCAGGTAGGGACCTTGGGTTTTGCAGTTGGTAGTCTAACTGGAACATTTCCATGTGCCACCA 1.6pFaExp2
: TGTTGAAAGAAAA-ATATATGGAAATAAAAATGCATGTGCAGGTAGGGACCTTGGGTTTTGCAGTTGGTAGTCTAACTGGAACATTTCCATGTGCCACCA 0.7pFaExp2
: TGTTGAAAGAAAA-ATATATGGAAATAAAAATGCATGTGCAGGTAGGGACCTTGGGTTTTGCAGTTGGTAGCCTAACTGGAACATTTCCATGTGCCACCA 0.4pFaExp2
-300 : TTGATTCTTGCGAAAACTGACCTGAAAATATAAATCTGTTTCTGTGGTTTTGGCTCTTTCCCTCTCTAAGCTCACCTTT-----GCTCTCTCACAGTCTC 1.6pFaExp2

: TTGATTCTTGCGAAAACTGACCTGAAAATATGAATCTGTTTCTGTGGTTTTGGCTCTTTCCCTCTCTAAGCTCACCTTT-----GCTCTCTC----TCTC 0.7pFaExp2
: TTGATTCTTGCGAAAACTGACCTGAAAATATGAATCTGTTTCTGTGGTTTTGGCTCTTCCCCTCTCTAAGCTCACCTTTAATTTGCTCTC------TCTC 0.4pFaExp2
-200 : ACYTGCCTTGTCTCTTTCTGCTTCGAGTTCTCATTATCCACCACCCTCCTAACCTCCTTTGCCTTCTCTCATTTCCTATATAAGCAAACCCCAGCTCCCC 1.6pFaExp2

: ACTTGCCTCGTCTCTTTCTGCTTC---TT-ACA--ATCCACCACCCTCCTAACCTCCTTTGCCTTCTCTCATTTCCTATATAAGCAAACCCCAGCTCCCC 0.7pFaExp2
: ACTTGCCTCGTCTCTTTCTGCTTC---TT-ACA--ATCCACCACCCTCCTAACCTCCTTTGTCTTCTCTCATTTCCTATATAAGCAAACCCCAGCTCCCC 0.4pFaExp2
-100 : ATATTCTATATCACTCAAGTGTTTTCAGCACTCTCCACCTTCTTCTCCTTCTAGCTAGCTAGCTCTCACTTTCTTTCTCACACAATGGCTTTTACTTCAT 1.6pFaExp2

: ATATTCTATATCAC---------------ACTCTCCACCTTCTTCTCCTTCTAGC-AGCT---CCCCACTTTCTTTCTCACACAATGGCTTTTACTTCAT 0.7pFaExp2
: ATATTCTATATCAC---------------ACTCTCCACCTTCTTCTCCTTCTAGC-AGCT---CCCCACTTTCTTTCTCACACAATGGCTTTTACTTCAT 0.4pFaExp2
+1
Fig. 2 Sequence alignment of the 0.4, 0.7 and 1.6 kb FaExp2 promoter fragments. Nucleotides in bold indicate polymorphic sites, hyphen indicates
deletion. The restriction enzyme sites, DraI, StuI and ScaI, which have been used in the construction of strawberry genome-walking libraries, are boxed as
well as a TATATAA-box and the first ATG of the FaExp2-gene. The putative start of transcription is indicated by an arrowhead. Forward primers used for
the sequence-specific PCR are indicated by arrows above the 1.6pFaExp2 and 0.7pFaExp2 sequences.
at which a statistically significant increase of Rn is first detected, and a larger (15 bp) indel (Fig. 2). SNPs in the ScaI and
was determined. The relative quantification was done using the StuI-restriction sites, that were responsible for promoter
comparative CT-method (User bulletin #2, ABI PRISM 7700 fragment length polymorphisms, could be traced back in the
Sequence Detection System, December 1997, Perkin-Elmer, Ap- larger sequences (Fig. 2).
plied Biosystems) in which the differences in the CT for the gus- For strawberry several homologous expansin genes
amplicon and the CT for the endogenous control dbp, called CT, have been identified and especially FaExp2 and FaExp7
were calculated to normalise for the differences in the total amount show a high degree of similarity (Harrison et al. 2001). In
of cDNA present in each reaction and the efficiency of the RT step. order to check the origin of the obtained promoter sequen-
For comparison of two samples the CT values were subtracted ces, sequence-specific PCR was performed using specific
from each other, giving a CT value and finally the relative forward primers for the two longest promoter fragments in
amount of gus mRNA copies was calculated by 2- CT. combination with reverse primers that are specific for six
different strawberry expansin genes (see Harrison et al.
RESULTS 2001). Only for the combination of both forward promoter
primers together with the reverse primer specific for
Isolation of FaExp2 promoter fragments FaExp2, amplification of a fragment of expected size was
obtained (Fig. 3), indicating that both different 5-upstream
In order to isolate a strawberry receptacle specific promoter, sequences belong to the FaExp2 gene and represent most
the strawberry expansin 2 gene (FaExp2) was selected. The likely allelic sequences.
expression of this gene was described to be relatively strong
and highly strawberry fruit-specific (Civello et al. 1999; Construction of the reporter vector and
Aharoni et al. 2002; Harisson et al. 2002; Salentijn et al. introduction into strawberry plants
2003; Dotto et al. 2006; Figueroa et al. 2009). Furthermore,
its expression was demonstrated not to be affected by either To study the promoter activity of two longest fragments
auxin (Civello et al. 1999; Aharoni et al. 2002) or ethylene obtained, the 700 and 1600 bp fragments were fused to the
treatment (Aharoni et al. 2002) which made this gene a gus reporter gene and transferred to the strawberry cultivar
good candidate for isolation of a strawberry receptacle-spe- ‘Calypso’ using A. tumefaciens mediated transformation.
cific promoter sequence. Following a genome walking For comparison, a construct in which the heterologous
approach using gene specific primers for FaExp2, three dif- CaMV35S-promoter was combined with the gus reporter
ferent 5-upstream genomic DNA sequences of 400, 700 gene was introduced in the same strawberry cultivar. For all
and 1600 bp have been amplified from ScaI, StuI, and DraI- constructs several transgenic lines expressing gus in fruit
digested ‘Elsanta’ genomic libraries, respectively. tissue have been produced, and three 0.7pFaExp2-gus (A-
DNA sequence alignment of the three different frag- C) and four 1.6pFaExp2-gus (A-D) lines, showing a rela-
ments showed a high degree of similarity. The sequences tively high intensity of histochemical GUS staining in ripe
differed in several SNPs and small indels (inserts/deletions) fruits, were selected for further analysis. DNA gel-blot
110
FaExp- 2 3 4 5 6 7 FaExp- 2 3 4 5 6 7
A B
Fig. 3 Sequence-specific PCR using forward primers specific for 0.7pFaExp2 (A) or 1.6pFaExp2 (B) and reverse primers specific for the
strawberry expansin genes FaExp2-7.
0.7pFaExp2 1.6pFaExp2 0.7pFaExp2 1.6pFaExp2

CaMV CaMV
-gus -gus -gus -gus
35S 35S
A B C A B C D -gus nt A B C A B C D -gus nt
12 kb
9 kb
5 kb
3 kb
2 kb
HindIII EcoRI
Fig. 4 DNA-gel blot analysis of genomic DNA of independent transgenic strawberry lines harbouring the 0.7pFaExp2-gus, the 1.6pFaExp2-gus or
the CaMV 35S-gus constructs. DNA of a non-transgenic plant (nt) is included as control. Total DNA was digested with HindIII (left blot) or EcoRI (right
blot) and the blotted DNA was hybridised with an nptII probe. The number of hybridisation bands indicates the integrated T-DNA copy number. An
aspecific hybridisation band is present in all lanes, including the non-transgenic control lane.
analysis using genomic DNA of all transgenic lines was was observed (Fig. 5, 0.7pExp2 B, 1.6pExp2 A). In flowers
performed in order to determine the number of integrated T- and young fruits of these plants, no visible GUS staining
DNA copies (Fig. 4). Both EcoRI and HindIII cut the T- was found in receptacle tissue, but in big white and red
DNA at one side of the nptII gene (Fig. 1), while the other fruits a clear blue staining was observed. It was remarkable
relevant restriction site is located in the host DNA that however, that the development of GUS staining in big white
flanks the nptII gene at the other side after T-DNA integ- and red fruits of 1.6pFaExp2-gus transgenic plants was ex-
ration. Depending on the position of the restriction site in tremely fast as compared to similar fruits from 0.7pFaExp2-
the host DNA, hybridisation bands of different sizes may be gus or 35SCaMV-gus transgenic plants, indicating a high
obtained after hybridisation with an nptII probe, represen- level of GUS activity in these fruits (results not shown). In
ting different T-DNA integration events. For both blots an addition to the GUS-staining found in receptacle tissue,
aspecific hybridisation band is visible at a similar position blue staining was also found in achenes and in epidermal
in all lanes (Fig. 4; approximately 10 kb for the HindIII-blot and sub-epidermal layers of petioles and stems of flowers
and 8 kb for the EcoRI-blot). Since this band is also present and fruits. No GUS staining was observed in roots, and for
in the non-transgenic DNA lane, it should be left out in leaf-discs only plants transformed with the 1.6pFaExp2-gus
consideration when determining the T-DNA copy number. construct showed some GUS staining near the vascular tis-
The DNA gel- blot analysis confirms the integration of the sue.
T-DNA, with a variable copy number, from 1 to at least 9
insertions, depending on the line. Gus expression analysis
Histochemical GUS staining For the different transgenic lines made with pFaExp2-gus
and CaMV35S-gus constructs the level of gus expression
For the selected 0.7pFaExp2-gus plants and 1.6pFaExp2- was determined by quantitative RT-PCR. In order to limit
gus transgenic plants, a fruit-specific GUS staining pattern the number of RNA isolations, for each tissue type RNA
111
0.7p
FaExp2
-gus
1.6p
FaExp2
-gus
CaMV
35S
-gus
leaf root petiole flower small green big red

green white white
Fig. 5 Histochemical GUS staining of leaf, root, petiole and flower tissue and of fruits at different developmental stages. Typical GUS staining
patterns for the 0.7pFaExp2 and the 1.6pFaExp2 promoters are represented by tissues of plant 0.7pFaExp2-gus B and plant 1.6pFaExp2-gus A, respec-
tively. Tissue of a CaMV35S-gus transgenic strawberry plant is included as reference. Size bars: 1.0 mm for roots and flowers; 5.0 mm for all other
tissues.
was isolated from pooled tissue samples from independent FaExp2 promoter sequences, both fragments were fused to
transgenic lines harbouring the same construct. Therefore, the gus reporter gene and the resulting gene fusion was
this will give average expression levels for the different transferred to the strawberry genome by means of Agrobac-
constructs, rather than specific expression results for each terium-mediated transformation.
transgenic line. Fig. 6 shows that for 0.7pFaExp2-gus Histochemical GUS staining showed that both 5-flan-
plants (Fig. 6, lower panel) as well as for 1.6pFaExp2-gus king fragments of FaExp2 were sufficient to confer fruit-
plants (Fig. 6, upper panel) expression levels are upregu- specific and ripening-regulated expression of gus. For white
lated in ripening fruits, starting with big white fruits. For and red fruits of transgenic plants containing the 1.6 kb
1.6pFaExp2-gus transformants there was also considerable promoter fragment fused to the gus reporter gene, a much
expression in the green-white fruit stage. For CaMV35S-gus faster development of blue staining was observed than for
plants gus expression was not correlated with any fruit stage the 0.7 kb fragment, suggesting a higher GUS activity in
and highest expression levels were observed for leaf and these fruits. However, no differences in the tissue-specific
root tissue. GUS staining pattern were observed between fruits of the
0.7pFaExp2-gus and 1.6pFaExp2-gus transgenic strawberry
DISCUSSION plants. Although the 1.6pFaExp2-gus plants showed quite
some variation in T-DNA copy number as determined by
For tissue-specific expression of genes in strawberry, the DNA-gel blot analysis, these differences do not seem to
availability of specific regulatory sequences is desirable. have much influence on the gus expression pattern. GUS
Because FaExp2 was known to be tightly regulated during staining of petiole tissue and achenes indicated that the ex-
ripening (Civil et al. 1999; Aharoni et al. 2002; Salentijn et pression of FaExp2 is not completely restricted to ripening
al. 2003; Dotto et al. 2006; Figueroa et al. 2009), we selec- strawberry fruits. Aharoni and O’Connell (2002) deter-
ted this gene for the isolation of a strawberry receptacle and mined, using DNA microarrays, that the expression level of
ripening-specific promoter sequence. Using a genome FaExp2 in receptacle of red fruits was 13-fold higher than
walking approach we cloned three highly homologous in achenes. For a number of other expansin genes from
FaExp2 5-upstream PCR fragments of different lengths. strawberry, pear and tomato an overlapping expression has
PCR-analysis using a specific forward primer for the 0.7 also been reported (Brummel et al. 1999; Harrison et al.
and 1.6 kb FaExp2 promoter fragments in combination with 2001; Hiwasa et al. 2003). Possibly, it is a common feature
sequence specific reverse primers for six of the seven of certain expansin genes to be expressed in different tis-
known strawberry expansin genes (FaExp2-7), revealed that sues, suggesting variable functions for these genes.
both promoter sequences belong to the FaExp2 gene. How- Quantitative gus expression analysis showed a large dif-
ever, whether the promoter fragments belong to different ference in gus transcript level in ripening fruits of
alleles or different gene copies of FaExp2, could not be 0.7pFaExp2-gus and 1.6pFaExp2-gus plants. This suggests
determined from this experiment. that in the 1.6pFaExp2 promoter sequence one or more ad-
In general, promoter sequences do not have strictly ditional positive regulatory cis-acting elements were present
defined borders. For some genes regulatory elements as far as compared to the 700 bp fragment, which gave rise to an
as 20 kb upstream from the transcription start have been overall higher level of gene expression. The temporal and
identified (Potenza et al. 2004). However, most promoter spatial control of gene transcription is generally mediated
sequences used for regulating transgene expression range by the interaction of negative and positive regulatory ele-
between 0.5-2.0 kb in length (Potenza et al. 2004). In order ments. For example, for a fruit-specific promoter of the
to investigate the promoter activity of the 0.7 and 1.6 kb tomato polygalacturonase gene, deletion analysis indicated
112
30
20 0.7pFaExp2
1.6pFaExp2
Relative gus expression

CaMV35S
10
1.6
1.2
0.8
0.4
0.0
Leaf Root Small Green Big White Turning Orange Red
Green White
Fruit developmental stages
Fig. 6 Gus gene expression analysis by quantitative RT-PCR. Due to large differences in gus transcript levels, the data are plotted against two different
scales. Two oblique lines indicate change in the scale on the Y axis. Expression levels of all samples are related to the gus expression level in red fruits of
the CaMV35S-gus control plant. Error bars represent ± SE values. All fruit sample values are replicates in two-fold. Leaf and root samples have been
analysed once. RT-PCRs for 0.7pFaExp2-gus and 1.6pFaExp2-gus have been performed on RNA samples obtained from pooled tissues of different
transgenic lines transformed with the same construct.
the presence of different positive and negative regulatory expansin gene family members during growth and ripening of tomato fruit.
regions which modulated tissue-specific gene expression Plant Molecular Biology 39, 161-169
(Montgomery et al. 1993). For the FaExp2 promoter it is Bustamante CA, Civello PM, Martinez GA (2009) Cloning of the promoter
region of -xylosidase (FaXyl1) gene and effect of plant growth regulators on
most likely that cis-acting elements, which promote the
the expression of FaXyl1 in strawberry fruit. Plant Science 177, 49-56
level of gene expression, are located in the proximal 900 bp Civello PM, Powell ALT, Sabehat A, Bennett AB (1999) An expansin gene
region. However, the observed differences in expression expressed in ripening strawberry fruit. Plant Physiology 121, 1273-1279
could also be due to polymorphisms that discriminate the Dotto MC, Martinez GA, Civello M (2006) Expression of expansin genes in
two promoter sequences in the first 700 bp (Fig. 2). In order strawberry varieties with contrasting fruit firmness. Plant Physiology and
to clear up the location of relevant regulatory elements, Biochemistry 44, 301-307
more detailed experimental data are required. Doyle JJ, Doyle JL (1987) A rapid DNA isolating procedure for small quanti-
ties of fresh leaf tissue. Phytochemical Bulletin 19, 11-15
CONCLUSION Engelen van FA, Molthoff JW, Conner AJ, Nap JP, Pereira A, Stiekema WJ
(1995) pBin plus: An improved plant transformation vector based on pBin19.
Transgenic Research 4, 288-290
In order to achieve strawberry fruit-specific expression of Figueroa CR, Pimentel P, Dotto MC, Civello PM, Martínez GA, Herrera R,
transgenes, 5-upstream sequences of FaExp2, a strawberry Moya-León MA (2009) Expression of five expansin genes during softening
gene which is expressed in a fruit-specific manner, have of Fragaria chiloensis fruit: Effect of auxin treatment. Postharvest Biology
been isolated and two different fragment lengths have been and Technology 53, 51-57
characterized. Depending on the desired level of expression, Harrison EP, McQueen Mason SJ, Manning K (2001) Expression of six
both lengths of the FaExp2 promoter may be good candi- expansin genes in relation to extension activity in developing strawberry fruit.
dates to direct trans- (or intra-)gene expression in ripening Journal of Experimental Botany 52, 1437-1446
strawberry receptacle tissue. Currently, we investigate the Hiwasa K, Rose JKC, Nakano R, Inaba A, Kubo Y (2003) Differential ex-
pression of seven -expansin genes during growth and ripening of pear fruit.
suitability of the 1.6pFaExp2 promoter to direct the expres-
Physiologia Plantarum 117, 564-572
sion of an antifungal gene with the aim to enhance the resis- Jefferson RA (1987) Assaying chimeric genes in plants: The GUS gene fusion
tance level to fruit rot caused by Botrytis cinerea. system. Plant Molecular Biology Reporter 5, 387-405
Lazo GR, Stein PA, Ludwig RA (1991) A DNA transformation competent
REFERENCES Arabidopsis genomic library in Agrobacterium. Bio/Technology 9, 963-967
Montgomery J, Pollard V, Deikman J, Fischer RL (1993) Positive and nega-
Agius F, Amaya I, Botella MA, Valpuesta V (2005) Functional analysis of tive regulatory regions control the spatial distribution of polygalacturonase
homologous and heterologous promoters in strawberry fruits using transient transcription in tomato fruit pericarp. Plant Cell 5, 1049-1062
expression. Journal of Experimental Botany 56, 37-46 Nehra NS, Chibb RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C
Aharoni A, O’Connell AP (2002) Gene expression analysis of strawberry (1990a) Genetic transformation of strawberry by Agrobacterium tumefaciens
achene and receptacle maturation using DNA microarrays. Journal of Expe- using a leaf disc regeneration method. Plant Cell Reports 9, 293-298
rimental Botany 53, 2073-2087 Nehra NS, Chibb RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C
Aharoni A, Keizer LCP, van den Broeck HC, Blanco Portales R, Muñoz (1990b) Agrobacterium-mediated transformation of strawberry calli and re-
Blanco J, Bois G, Smit P, De Vos RCH, O’Connell AP (2002) Novel insight covery of transgenic plants. Plant Cell Reports 9, 10-13
into vascular, stress, and auxin-dependent and -independent gene expression Potenza C, Aleman L, Sengupta-Gopalan C (2004) Targeting transgene ex-
programs in strawberry, a non-climacteric fruit. Plant Physiology 129, 1019- pression in research, agricultural, and environmental applications: promoters
1031 used in plant transformation. In Vitro Cellular and Developmental Biology –
Asif H, Dhawan P, Nathm P (2000) A simple procedure for the isolation of Plant 40, 1-22
high quality RNA from ripening banana fruit. Plant Molecular Biology Re- Rosin FM, Aharoni A, Salentijn EMJ, Schaart JG, Boone MJ, Hannapel DJ
porter 18, 109-115 (2003) Expression patterns of a putative homolog of AGAMOUS, STAG1,
Brummell DA, Harpster MH, Dunsmuir P (1999) Differential expression of from strawberry. Plant Science 165, 959-968
113
Salentijn EMJ, Aharoni A, Schaart JG, Boone MJ, Krens FA (2003) Dif- Shaw DV, Famula TR (2005) Complex segregation analysis of day-neutrality
ferential gene expression analysis of strawberry cultivars that differ in fruit- in domestic strawberry (Fragaria×ananassa Duch.). Euphytica 145, 331-338
firmness. Physiologia Plantarum 118, 571-578 Spolaore S, Trainotti L, Pavanello A, Casadoro G (2003) Isolation and pro-
Schaart JG, Salentijn EMJ, Krens FA (2002) Tissue-specific expression of moter analysis of two genes encoding different endo--1,4-glucanases in the
the -glucuronidase reporter gene in transgenic strawberry (Fragaria x ana- non-climacteric strawberry Journal of Experimental Botany 54, 271-277
nassa). Plant Cell Reports 21, 313-319
114
In Vitro Selection and Strawberry Plant Regeneration for

Developing Resistance to Botrytis cinerea Pers., Phytophthora
cactorum Leb. et Cohn (Schroet) and Salinity Stress
Dina B. Shokaeva1* • Natalya V. Solovykh2 • Dmitry N. Skovorodnikov3
1 Department of Small Fruit Breeding, All-Russian Research Institute of Horticultural Breeding, Zhilina, Orel, 302530, Russia
2 Laboratory of Biotechnology, I.V. Michurin Russian Research Institute of Genetics and Breeding of Fruit Plants, CGL, Michurinsk, Tambov District, 393770, Russia
3 Laboratory of Biotechnology, Bryansk State Agricultural Academy, Kokino, Bryansk District, 243365, Russia
Corresponding author: * dinashokaeva@rekom.ru or shokaeva@orel.ru
ABSTRACT
In vitro screening techniques were employed to obtain strawberry (Fragaria × ananassa Duch.) lines with resistance/tolerance to
environmental stressors. The aim was to select genotypes resistant to Phytophthora cactorum and Botrytis cinerea and tolerant to chloride
salinity. Callus tissues were screened for tolerance on MS medium, supplemented with 2 mg l-1 indole-3-butyric acid (IBA), which
contained selective agents: either monthly culture filtrate of one of the two pathogens at 10, 20 and 30% or 0.05, 0.10 and 0.15 M sodium
chloride. Tolerant tissues were used for adventitious shoot regeneration on MS medium with 2 mg l-1 6-benzylaminopurine (BAP), 0.5 mg
l-1 IBA and 0.2 mg l-1 gibberellic acid (GA3), which were then micropropagated on MS medium supplemented with 1 mg l-1 BAP and 0.1
mg l-1 IBA. Rooting was achieved on MS medium supplemented with 0.5–1 mg l-1 IBA. The obtained plants were acclimatized to in vivo
conditions in a plastic greenhouse and subsequently planted in the field. Tests for disease resistance were conducted using artificial leaf
inoculation with spore-mycelium suspensions of the phytopathogens. Three methods were employed to assess tolerance to salinity: (1)
evaluation of growth parameters on selective media containing 0.05 and 0.1 NaCl, and determination of propagation coefficient and
leaf necrosis scores, (2) laser analysis of tissue microstructure (LAM) and (3) leaf diagnostics. Lines exceeding the level of resistance to P.
cactorum and B. cinerea (‘Lvovskaya Rannyaya’, ‘Urozhainaya CGL’ and ‘Zolushka’), and those with superior tolerance to salt toxicity
(‘Feierverk’, ‘Lvovskaya Rannyaya’, ‘Urozhainaya CGL’ and ‘Zolushka’) were selected. In addition to either trait, the most promising
lines produced high yield and large fruit.
_____________________________________________________________________________________________________________
Keywords: strawberry (Fragaria × ananassa), laser analysis, leaf diagnostics, phytopathogenic fungi, salt stress, selective media, tissue
selection
Abbreviations: 2,4-D, 2,4-dichlorophenoxy-acetic acid; BAP, 6-benzylaminopurine; GA3, gibberellic acid; IBA, indole-3-butyric acid;
IFS, index of functional state; LAM, laser analysis of tissue microstructure; PAM, pulse amplitude modulation; PCD, programmed cell
death; PPFD, photosynthetic photon flux density; ROS, reactive oxygen species
INTRODUCTION irreversible (Karp 1995). Frequency of somaclonal altera-

tions is a very important precondition for researchers wor-
In addition to high yield and fruit quality, modern straw- king on tissue selection. To obtain a wider variability of im-
berry cultivars must be tolerant to unfavourable environ- portant traits, it can be significantly enhanced by mutagene-
mental factors. Biotechnological approaches, using cell and sis (Jain 1997b, 1997c). Orton (1987) reported a big number
tissue selection, are commonly employed to accelerate the of gene mutation occurrences in cell culture, which could
recovery of lines with such valuable traits. These methods be up to 10-2 events per locus and even more. Jain (1993)
employ selective media as a selection pressure tool to select observed various differences in a number of morphological
cells and calli with valuable somaclonal changes for plant and physiological traits in Begonia × elatior and Saint-
regeneration. As these methods require a moderate working paulia ionantha L. Development of tissue culture systems,
space and allow screening of large amount of plant material using selective media for modulation of unfavourable envi-
under strictly controlled conditions, plants with desirable ronmental impacts, is very important for facilitating selec-
traits can be obtained faster at lower labour costs, besides tion of plants possessing resistance/tolerance to environ-
eliminating need of field experiments. mental stressors (Bell et al. 1997; Butenko 1999; Jain 2001;
Extensive variability of characters in callus cells is a Sowik et al. 2001; Singh et al. 2002; Biswas et al. 2009).
peculiarity encouraging tissue selection. The wide-ranging Nosov (1999) summarized data on somaclonal varia-
variability, usually called somaclonal, is influenced by con- bility and selection of valuable somaclones obtained by
ditions of cultivation during cell dedifferentiation. Pre-exis- numerous researchers, and concluded that cell and tissue
ting genetic variation in somatic cells (Walbot 1985), single selection for physiological traits did not guarantee availa-
gene mutations aneuploidy and transposable elements, cyto- bility of these traits in regenerated plants, even if they were
genetic changes, DNA methylation and plant hormones conditioned by gene alterations. Processes of secondary
pressure in media contribute to the somaclonal variability metabolism, growth and development in a whole plant orga-
(Evans et al. 1984; Evans 1987; Dolgykh and Shamina nism differ from those in cell suspensions. Nonetheless,
1991; Konstantinov and Rivkin 1991; Jain and Pehu 1992; when resistance/tolerance to an unfavourable environmental
Jain 1997a, 1997b). Unlike epigenetic changes, somaclonal impact has a genetic basis and is driven by mechanisms
variation that results from altered gene expression is usually operating within a cell, i.e. acts at the cellular level, the trait
Received: 3 February, 2010. Accepted: 18 October, 2010.

is considered to be stable. Most likely, a whole plant re- 2002; Shin et al. 2004; Koiwa et al. 2006; Gao et al. 2007)
generated from such a resistant cell will exhibit the same and changes of reactive oxygen species (ROS) and antioxi-
resistance (Nosov 1999). Mechanisms driving traits such as dant enzymes activity in root tip cells at the early stages of
tolerance to soil salinity, acidity and alkalinity (Dolgykh salt stress-induced programmed cell death (PCD), a rapid
1994), antibiotics, herbicides, analogs of amino-acids and process which may help plants survive adverse stresses by
nitrogenous bases, resistance to extreme temperatures eliminating cells, tissues or organs that render a plant more
(Popov et al. 1995) and pathogens affecting cells with phy- vulnerable to its environment (Li et al. 2007). Li et al.
totoxins (Dolgykh 1994) act at the cellular level. Therefore, (2007) suggested that the response of root tips to salt should
tissue selection for these characters can be carried out in be divided into two phases: the salt stress responding phase
vitro. and the PCD phase. In the responding phase, increased ROS
Noteworthy results in cell and tissue selection for resis- induces scavenging-enzyme activities. This response re-
tance to diseases and tolerance to salinity have been achieved moves toxic ROS and prevents PCD from occurring. If the
in alfalfa (Frame et al. 1991), maize (Dolgykh 1994), potato stress prolongs, the cell antioxidant system is damaged,
(Behnke 1979), Poncirus (Beloualy and Bouharmont 1992), ROS will accumulate, overcome the threshold and initiate
rice (Gregorio et al. 2002) and some other, mainly annuals PCD events, such as mitochondria membrane permeability
and biennials species. Similar investigations have been transition, the release of proteins from mitochondria inter-
carried out in strawberries, but the number or reports are not membrane space, and finally lead to nuclear changes, such
numerous. Tissue selection experiments for resistance to as chromatin condensation, nuclear deformation and DNA
phytopathogenic fungi, such as Botrytis cinerea Pers., Phy- fragmentation.
tophthora cactorum Leb. et Cohn (Schroet), P. fragariae Water containing up to 2,500 mg of chlorides is sup-
Hickman and Verticillium dahliae, and for tolerance to posed to be successfully used for irrigation of salt resistant
salinity stress were undertaken in different countries (Maas cultivars of many vegetables and some horticultural crops
et al. 1993; Solovykh and Tarabrin 1994; Orlando et al. in desert regions (Dziadczyk et al. 2005). However, using
1997; Debnath and Teixeira da Silva 2007; Shaw et al. soils with high salt contents requires selecting cultivars of
2008; Biswas et al. 2009; Solovykh 2009), which resulted agricultural crops, tolerant to salinity, because the soils can-
in finding this method to be useful and promising to im- not be irrigated with saline water without significant dam-
prove individual traits. age to plants (Choi et al. 2003; Li et al. 2007). In such cir-
P. cactorum causes severe damage to strawberry plants, cumstances, some biotechnological methods have certain
such as crown rot and leather fruit rot. The disease is wide- chances to be helpful to solve the problem (Dziadczyk et al.
spread in Russia (Novotelnova 1974; Drozdovsky and Bar- 2003, 2005).
batunova 1985). Yield losses in infected plants range from The first aim of this study was to assess tissue screening
50 to 100%, while infection of susceptible cultivars usually on selective media containing phytotoxins from B. cinerea
results in plant death. Grey mould, caused by B. cinerea, is and P. cactorum as a method for recovering strawberry lines,
one of the most destructive diseases attacking strawberries resistant to, using both pathogens. The other aim was to
when environmental and cultural conditions are favourable optimize the composition of selective media supplemented
for disease development. Pre- and post-harvest fruit rot is with NaCl for tissue screening to obtain strawberry lines
the main damage caused by this pathogen, which in wet tolerant to chloride salinity and to estimate different methods
conditions may lead to yield losses exceeding 50% in sus- of testing the lines.
ceptible cultivars. Moreover, plant parts of especially vulne-
rable cultivars may also be attacked by the fungus (Scott MATERIALS AND METHODS
and Lawrence 1975). The disease is particularly disastrous
in regions with mild and moderately warm climates, abun- Plant material and experimental design
dant in rain falls. Mycelia of both fungi affect plant tissues
with phytotoxins, killing them and subsequently developing In vitro selection for resistance to B. cinerea and P. cactorum,
on plant remains. Thus, resistance to either disease is likely using callus tissues derived from ‘Zolushka’, a very high-yielding
dependent on cell tolerance to the toxins, which may allow standard cultivar of mid-late term of fruit maturing, and ‘Lvov-
selection for these traits in vitro, screening tissue cultures skaya Rannyaya’ (early ripening) was carried out in 2000–2003.
on selective media and using phytotoxins as selective Testing of selected lines, obtained during the study, along with
agents. promising somaclones of ‘Urozhainaya CGL’ (mid-season) selec-
In Russia, the necessity of strawberry lines tolerant to ted earlier, for resistance to diseases was conducted in 2004.
salinity is conditioned by the existence of wide cultivation Plants of ‘Feierverk’ (mid-season), ‘Lvovskaya Rannyaya’,
areas of alkalescent and alkaline soils with excessive salt ‘Urozhainaya CGL’ and ‘Zolushka’, all high-yielding and winter
levels. Most strawberry cultivars are very sensitive to sali- hardy in conditions of central Russia, were used as sources of ex-
nity (Ehling and Bernstein 1958; Dziadczyk et al. 2003). It plants to obtain callus cultures for tissue screening to select lines
affects plants unremittingly, breaks normality of physiolo- tolerant to salinity. All of them are typical June-bearing strawberry
gical processes, deteriorates plant state and lowers their genotypes. The studies were performed in 2004–2007. Selected
productivity (Udovenko 1977; Ashraf 1989; Ashraf and lines were tested for tolerance to the stressor in 2008.
Ahmad 2000). More than a half of territories are supposed Callus tissues of each cultivar on each variant of selective
to get salinized by mid-century. Inappropriate agricultural media were screened, using four successive passages (except for
practices and predicted effects of global climate changes the screening for salt tolerance where only three passages were
will further deepen the problem (Yeo 1999). On the other performed) and three replicates in each passage. Each replicate
hand, in some places only salty water is available for crop included 30 calli, therefore, 90 tissue specimens in total were
irrigation. However, the problem of soil and water saliniza- grown in each passage, on each medium, at each percentage of any
tion may be partially overcome by breeding and selection of selective agent in the medium (three different concentrations of
new varieties. each selective agent were used for screening throughout) and in
A noteworthy progress in the study of and breeding for control (with no selective agents). Only calli exhibiting the most
salinity tolerance and its related abiotic stresses has been active growth and proliferation on selective media were selected
reported in rice (Gregorio et al. 2002), which encourages for inclusion in each following passage.
analogous efforts in working with other species. Although Callus tissues proliferating on selective media were trans-
reactions to salt stress in plant organisms are extremely ferred to media for proliferation with no selective agents favouring
complex, the advances in physiology, genetics and molecu- cell growth and multiplication; thereafter fragments of obtained
lar biology achieved in some species, have greatly im- tissues were placed on selective media containing the same
proved the understanding of plant responses to the stresses, stressor again.
such as changes of amino acid and protein contents in res- Calli, selected for resistance/tolerance to unfavourable factors,
ponse to NaCl treatment (Hasegawa et al. 2000; Yokoi et al. were used to regenerate adventitious shoots every two passages.
116
In vitro selection of strawberry for resistance to biotic and abiotic stresses. Shokaeva et al.
Leaves from the regenerated shoots were taken to induce callus from cool white fluorescent lamps ranging from 35 to 38 mol m-2
formation. Then fragments of the latter, in their turn, were placed s-1 (computed using tables of UKROP.info/TopTropicals.com).
on appropriate selective media to carry on screening processes.
Such an alternation of procedures allowed maintenance of a mor- Acclimatization of in vitro-rooted plants to in vivo
phogenetic potential of selected tissues. conditions
At the final stage of the tissue selection process, every callus
line, selected for an exceptional tolerance rate exhibited in regard A plastic-covered greenhouse equipped with trickle irrigation was
to whatever stressor, was used for regeneration of whole plants, used for acclimatization of in vitro-rooted plants to in vivo con-
and afterwards, regenerated plants were cloned to obtain sufficient ditions. Only well-developed and rooted plants were chosen for
plant material for further studies. transplanting. Before being transferred to the greenhouse, the
plants were subjected for 9-10 days to a higher PPFD, beginning
Induction of callus formation and proliferation from a minimum of 70.0 mol m-2 s-1, which was gradually in-
creased to 100.0 mol m-2 s-1, to stimulate plant photosynthetic
To initiate callus formation, strawberry leaf explants, taken from activity. To acclimatize plants, the following routine procedures
plants cultivated in vitro, were cultured on MS medium (Mura- were performed: plants were extracted from vessels, washed with
shige and Skoog 1962) supplemented with either 2 mg l-1 2,4- running tap water to eliminate the culture medium and planted on
dichlorophenoxy-acetic acid (2,4-D) or IBA (all auxins, cytokinins preliminary prepared beds in the greenhouse. A mixture of soil,
and gibberellins were purchased from Sigma-Aldrich, Moscow, peat and sand in equal proportions was used as the substrate. Ac-
Russia). Explants were placed with the adaxial side in contact with climated plants were planted in the greenhouse in late May and
the medium and then incubated under dark conditions at 25 ± 2°. early June. They grew in the greenhouse for 2.5 months, and later
Callus formation was achieved in 30–40 days. Every 35–40th day transferred to field conditions.
calli were divided into fragments (subsequent calli), approximately
0.3 cm3 each, which were transplanted onto a fresh prepared Preparation of inoculums and testing plants for
medium in separate vessels and cultured in the dark to induce cal- resistance to phytopathogens
lus regeneration.
Testing plants for resistance to B. cinerea and P. cactorum was
Preparation of selective media for tissue conducted using artificial leaf inoculation with spore-mycelium
screening suspensions of the fungi (mixes of mycelium fragments and coni-
dia of B. cinerea, and mycelium, sporangia and zoospores of P.
To conduct tissue screening for resistance to phytopathogens, cactorum), followed by incubation of inoculated leaves in Petri
selective media were prepared by adding fungal culture filtrates in dishes at 100% air humidity.
media for callus subcultures. Filtrates of monthly fungal cultures, Inoculums were prepared by homogenization of a gelatinized
containing phytotoxins of P. cactorum and B. cinerea, were pre- wort-based medium, used for fungi cultivation, along with either
pared in the Laboratory of Immunity of the Michurin Russian fungal culture. A medium containing 10 g agar and 100 g wort per
Research Institute of Genetics and Breeding of Fruit Plants. l of water was prepared, followed by cultivation of a fungal culture
Efficient concentrations of the selective agents in selective media in a test tube (to enlarge a medium surface area and obtain a larger
to be applied were determined experimentally. Cultural filtrates of fungal population, test tubes with a hot medium poured into them
phytotoxins from P. cactorum at 20% and those from B. cinerea at were disposed at 15° to the table surface until the medium was set)
15% (for ‘Feierverk’) or 20% (for ‘Urozhainaya CGL’ and ‘Zol- in a thermostat at 23 ± 2°C over 3 weeks. Thereafter, contents of
ushka’) restricted growth in 80–90% of calli (unpublished data). the test tube were stirred up, thoroughly homogenized and diluted
Hence, media containing filtrates of both fungi at 10, 20 and 30% with distilled water to a final volume of 100 ml. Afterward, mix-
were used for screening. Experiments in the Laboratory of Bio- tures were additionally diluted to adjust to approximately 30,000
technology of the Michurin Russian Research Institute of Genetics conidia per ml for B. cinerea and 12,000–15,000 sporangia per ml
and Breeding of Fruit Plants proved that the thermal stability of for P. cactorum, and used for leaf inoculation.
phytotoxins from the pathogens was high enough to allow incor- Ten completely developed leaves of each line were used to
porating them with nutrient media prior to autoclaving (unpub- estimate resistance to each disease. Leaves were immersed in an
lished data), which was technically easier to perform. inoculum and placed over blotting paper moistened with distilled
Selective media for screening calli for tolerance to chloride water in Petri dishes. The inoculated leaves were incubated in the
salinity contained NaCl at 0.3, 0.6 and 0.9% (50, 100 and 150 m, closed Petri dishes at 25 ± 2°. As soon as blotting paper became
respectively). drying out, it was carefully moistened again to maintain 100%
relative humidity inside the Petri dish.
Adventitious shoot regeneration, micropro- Symptoms of disease development were usually observed in
pagation and rooting of selected lines in vitro 5–7 days after inoculation with both fungal mixtures. Disease
symptoms were estimated using a 6-point scale, where 0 = no
Adventitious shoot regeneration from selected lines of calli which symptoms, line is resistant; 1 = weak symptoms that appeared on
exhibited resistance/tolerance to the phytopathogens or salt less than 10% of leaf blade surface, line is tolerant; 2 = disease
toxicity, was made on MS and/or QL (Quoirin and Lepoivre 1977) symptoms appeared on 10–25% of leaf surface, line is relatively
media with macro- and micronutrients (both macrosalts of a first- tolerant; 3 = 25–50% of leaf blade surface is affected with disease,
grade purity and microsalts of the highest-grade purity were pur- line exhibits low tolerance; 4 = 50–75% of leaf surface with dis-
chased from Reakhim, Shostka, Sumy district, Ukraine), sup- ease symptoms, line is susceptible and 5 = leaves fully brown in
plemented with 2.0 mg l-1 BAP (98%), 0.5 mg l-1 IBA and 0.2 mg colour and dead. This scale has been accepted in Russia for the
l-1 GA3 (97%). Also, media without GA3 and those supplemented evaluation of most economically important fungal strawberry dis-
with antioxidants, viz. ascorbic acid and reduced glutathione (95%, eases in field conditions (Shokaeva and Zubov 1999).
Sigma-Aldrich, Moscow, Russia), were applied to some selected
lines in subtests. Regenerated shoots were micropropagated on a Testing for tolerance to salinity
modified Boxus medium (Boxus 1974, 1992), viz. MS medium
with 1.0 mg l-1 BAP, supplemented with 0.1 mg l-1 IBA, and 1. In vitro testing
rooted on half-strength MS medium (Yue et al. 1993) supplemen-
ted with 1.0 mg l-1 BAP and 0.5–1.0 mg l-1 IBA (depending on the Preliminary testing of in vitro-micropropagated plants from selec-
cultivar used as tissue source). Additionally, the medium contained ted lines for tolerance to chloride salinity was conducted on micro-
20 g l-1 sucrose. For shoot micropropagation of ‘Zolushka’-derived propagation culture medium supplemented with 0, 50 or 100 mM
lines GA3 at 0.5 mg l-1 instead of IBA was included in the medium. NaCl. MS medium, containing 30 g l-1 sucrose and supplemented
In vitro plantlets were maintained at 22–24°C and a relative with 1 mg l-1 BAP, 0.1 mg l-1 IBA and 1 mg l-1 GA3, was used for
humidity within the range of 70–75%, under conditions of a 16-h this purpose. Cultures were maintained at 23–25° under a 16-h
photoperiod and a photosynthetic photon flux density (PPFD) photoperiod and a PPFD from fluorescent lamps ranging from
117
40.0 to 45.0 mol m-2 s-1 for 35-45 days depending on line and to them, all the control cultivars were tested for salt tolerance
level of salt tolerance. Shoot growth, proliferation rate and per- using this method.
centage of leaf death caused by salt toxicity were measured. A 6-
point scale was used for tolerance estimation. Plantlets developed Morphological and agricultural characterization of
as those in control were characterized as resistant to salt stress selected lines
(score 0). Lines showing an average decline in plant development
lower than 10% were tolerant to salinity and ranked with score 1. In the MV2 and MV3 generations, all selected lines were exa-
Score 2 was given when decline in growth and development did mined for stability of the characters which they were selected for.
not exceed 25%, indicating relative tolerance. If growth was slow, The plants that exhibited their instability were destroyed. High
while damage to plants ranged from 25 to 50%, line was given fertility of flowers was the other trait that should be uncondition-
score 3, which was evidence of its low tolerance. Almost no ally characteristic of them.
growth resulted in score 4, while score 5 designated plant death. Morphological characterization and agricultural evaluation of
To avoid unnecessary costs, only the plantlets that exhibited a selected strawberry lines were performed using UPOV system
significantly higher tolerance compared with that of initial culti- (Shokaeva and Zubov 1999; Shokaeva 2006, 2008). Yield and its
vars, were subsequently rooted, acclimatized in the greenhouse components, and fruit size and quality were the main characters
and planted in the field. evaluated.
2. Laser analysis of tissue microstructure Statistical analyses of data
The method of laser analysis of leaf tissue microstructure (LAM), Statistical analyses have been performed, using a package of sta-
using a device named FSR–03–08 (Budagovsky et al. 1998, 2007), tistics, based on or analogous to ANOVA tests developed in the
was employed to test plants growing in field conditions for resis- SAS Institute (Version 6, MathSoft, Inc., USA), and adapted to a
tance to salt toxicity. The device has been developed in the Michu- Microsoft Office Excel Software. Means, significance of differen-
rin Research Institute of Horticulture (Engineering Centre, Michu- ces between means at P 0.05 and standard errors were computed
rinsk, Tambov District, Russia) by Budagovskaya ON (Budagov- for each study. Data from tests for both tolerance to phytotoxins
skaya 2004). It consists of a measuring module, a power block and and salt tolerance in vitro and data obtained from LAM analysis
a digital tester (10 × 15 cm). Additionally to this, a stop-watch is were statistically analysed as bifactorial experiments, where ef-
needed to conduct measurements. The method is based on a con- fects of main factors were studied to compute related LSD05 values.
nection of a functional state of chlorophyll-containing plant tissues These factors were as follows: for tests in vitro A = medium
to dynamics of amplitude-phase characteristics of laser rays, ema- variant and B = passage, and for LAM analysis A = variant of
nated by the device and diffused with the tested plant tissues treatment of leaf discs and B = selected line. Results of tests for
(Budagovskaya et al. 2007). resistance to diseases using leaf inoculation, and tests for salt tol-
Ten discs, 1.5 cm in diameter, obtained from leaf blades of erance using leaf diagnostics were analysed using Duncan’s multi-
each selected line under study, were dipped in Petri dishes half- ple range test (available in the statistics package mentioned above).
filled with distilled water (control) or a sodium chloride solution at
1.2% (200 mM). The functional state of leaf tissues was deter- RESULTS AND DISCUSSION
mined by measuring diffused light intensity with ‘FSR–03–08’ at
24, 48 and 72 h after beginning the treatments. Each leaf disc was Effects of callus tissue screening for
positioned in the working sector of the measuring module with the resistance/tolerance to biotic and abiotic stressors
adaxial side up, after which a helium-neon laser with a wave-
length of 632.8 nm was lighted up. Diffused light intensity was An alternation of calli screening and conditions of subcul-
measured twice, at the beginning of irradiation and 60 s later. The ture for selected tissues, which favoured cell growth and
period was chosen as optimal in previous experiments (unpub- multiplication, resulted in obtaining rather stable tissue
lished data). An index of functional state (IFS) of plant tissues, de- lines, visibly tolerant to phytotoxins from B. cinerea and P.
pending on capabilities of chlorophyll-protein complexes to per- cactorum (Fig. 1). Amounts of callus tissues derived from
form light-induced re-organizing themselves in conformity with ‘Zolushka’, which remained capable to proliferate on media
changed conditions, was computed using obtained data and the containing phytotoxins of B. cinerea, became evidently
following formula: higher in every following passage, although differences
were frequently insignificant (Fig. 2). This was particularly
IFS = (Imax – Imin)/Imin, noticeable in the 20% cultural filtrate treatment. Increment
in tissue tolerance to P. cactorum was less perceptible (Fig.
where IFS = index of functional state, Imax = diffused light inten- 3). As expected, few cells were able to withstand the high-
sity at the beginning of irradiation and Imin = diffused light inten- est phytotoxin concentration. Somewhat lower percentages
sity in 60 s. of tolerant tissues were obtained in ‘Lvovskaya Rannyaya’
(data not shown). These data corroborated that obtained
3. Leaf diagnostics earlier in an experiment carried out in 1997–2000, where
tissues from ‘Feierverk’ and ‘Urozhainaya CGL’ were
Newly developed full-sized leaves, ranging by area from a mini- screened. The results were especially prominent in variants
mum of 70 cm2 in ‘Zolushka’ and its derivatives to a maximum of with tissues derived from ‘Urozhainaya CGL’ (Solovykh
110 cm2 in ‘Lvovskaya Rannyaya’, were taken from each selected and Tarabrin 2004). In this cultivar, screening on selective
line (ten replicas per line) and incubated in a test tube with their media containing fungal filtrates with phytotoxins from P.
petioles immersed in 1.2% NaCl solution (200 mM). Necroses that cactorum at 20% yielded a 33.3% of tolerant calli in pas-
emerged on the leaf blades, being caused by salt toxicity, were sage 4 vs. 9.7% in passage 1. Screening for resistance to B.
measured in 48 and 72 h, using the following 6-point scale: 0 = no cinerea on media containing cultural filtrates at 20% led to
necroses, line is resistant to salinity; 1 = necroses emerged on a 5.9% of proliferating calli in passage 1, whereas their pro-
maximum of 10% of leaf surface, line is salt-tolerant; 2 = 10–25% portion reached 30.0% in passage 4. ‘Lvovskaya Rannyaya’
of leaf surface is spotted with necroses, line is relatively tolerant; 3 gave lower percentages of calli tolerant to the pathogens. To
= 25–50% of leaf surface is necrosis-diseased, line is rather sus- all appearance, plant tissues derived from the cultivar are
ceptible; 4 = 50–75% of leaf surface is necrosis-diseased, line is more susceptible to the diseases. Susceptibility to B. cinerea
very susceptible and 5 = leaves are dead. and P. cactorum distinguishes many early-season June-bear-
In some leaves, salt damages manifested as green dry areas ing strawberry genotypes (pers. obs.).
instead of necroses areas. Similar phenomena were observed when calli were
32 lines in total were tested: eight lines derived from ‘Zol- screened for tolerance to salinity. Proportions of calli pro-
ushka’, four from ‘Feierverk’, eight from ‘Lvovskaya Rannyaya’ liferating under the highest NaCl concentration increased
and twelve lines obtained from ‘Urozhainaya CGL’. Additionally from passage to passage, as can be seen in variants with tis-
118
90 0 10% 20% 30%
80
70
Proliferating calli (%)

60
50
40
30
20
10
0
Passage 1 Passage 2 Passage 3 Passage 4
Fig. 3 Proliferation of calli derived from ‘Zolushka’ on MS medium

with toxins of P. cactorum. Variants are following: without (0.0%, con-
trol) and with cultural filtrates at 10, 20 and 30%. Values represent mean ±
standard error (SE). LSDA05 = 57.2, LSDB05 = 8.3, where A = medium
variant, B = passage.
Fig. 1 Callus growth and proliferation on MS medium containing 90 Passage 1 Passage 2 Passage 3
cultural filtrate of P. cactorum at 20%. Callus tissues are derived from
80
‘Zolushka’. Data correspond to passage 3 after 35 days of cultivation.
Proliferating calli (%) 70
60
90 0 10% 20% 30%
50
80 40
70 30
Proliferating calli (%)
60 20
50 10
0
40
0 0.30% 0.60% 0.90%
30
Concentrations of NaCl in media (%)
20
10 Fig. 4 Numbers of calli that kept proliferating on MS medium sup-
plemented with NaCl. Variants are: without (0.0%, control) and with
0
NaCl at 0.3, 0.6 and 0.9%. Calli are derived from ‘Zolushka’. Values rep-
Passage 1 Passage 2 Passage 3 Passage 4 resent mean ± standard error (SE). LSDA05 = 29.8, LSDB05 = 10.9, where A
= medium variant, B = passage.
Fig. 2 Proliferation of calli derived from ‘Zolushka’ on MS medium
with toxins of B. cinerea. Variants are: without (0.0%, control) and with
cultural filtrates of phytotoxins at 10, 20 and 30%. Values represent mean
± standard error (SE). LSDA05 = 52.9, LSDB05 = 15.1, where A = medium ally conditioned tolerance to this destabilizing factor. To
variant, B = passage. test this hypothesis, these calli were cultured on regenera-
tion medium to induce adventitious shoot regeneration.
sues from ‘Zolushka’ (Fig. 4). Close percentages of tolerant Getting over difficulties of adventitious shoot
tissues were obtained when calli, derived from ‘Feierverk’ regeneration and micropropagation
and ‘Urozhainaya CGL’, were screened (data not shown). In
the case of tissues derived from ‘Lvovskaya Rannyaya’, Adventitious shoot regeneration from the selected calli was
proportions of salt tolerant lines were lower. In passage 1, the following critical stage of this work. Strawberry callus
only 6.7% of calli demonstrated capability to proliferate on tissues are deemed to have good abilities for plant regenera-
a medium containing NaCl at 0.6%, while the amount of tion. However, tissue selection requires subculture of callus
tolerant tissues in passage 3 at the same salt concentration for a long time (up to 14 months) on artificial cultural media,
reached 21.7%. It is likely that plant tissue cells of the after which shoot regeneration from the cells becomes a
genotype exhibit a higher water requirement per g of raw considerable problem. For instance, average morphogenesis
weight, typical of most cultivars fruit of which mature early frequency from calli derived from ‘Lvovskaya Rannyaya’
(Udovenko 1977), which can more rapidly result in toxic after 12-month subculture (eight passages) decreased to
levels of ion accumulation. Influx of Na+ negatively im- 3.6%, from calli of ‘Urozhainaya CGL’ and ‘Zolushka’ to
pacts intracellular K+ influx, attenuating acquisition of this 1.5 and 1.2%, respectively, and no regeneration occurrence
essential nutrient by cells, alters the H+ electrochemical gra- was observed in the case of callus tissues obtained from
dient and dissipates the membrane potential, thereby facili- ‘Feierverk’. After 6-month subculture adventitious shoots
tating uptake of Cl- (Hasegawa et al. 2000). This might to could be regenerated from 6.2% of ‘Feierverk’-derived calli,
some extent elucidate the lower salt tolerance of the calli in 8.5% of calli from ‘Lvovskaya Rannyaya’ and 9.9% of calli
vitro. Proportions of calli that kept growing and prolif- from either of the two other cultivars. Regeneration fre-
erating on media containing NaCl at 0.9% (stress treat- quency after two cultivations (three months) on selective
ments) were very low compared with the other variants, media ranged from 24.0 to 51.4%. To facilitate solving this
particularly of those derived from ‘Lvovskaya Rannyaya’, problem, a callus subculture on a selective medium was
although gradually increased, reaching the highest percen- alternated with adventitious shoot regeneration from the
tages in passage 3 (Fig. 4, data on the other cultivars not callus tissues. There is usually some probability of ob-
shown). Calli that proliferated actively on media with high taining resistant plants from a callus tissue, selected in a
NaCl concentrations could form plants possessing genetic- single subculture on a selective medium, however, due to
119
Fig. 6 Salt-tolerant strawberry plants, acclimatized to growing in field

conditions. Lines are derived from ‘Zolushka’ and obtained using tissue
selection.
a medium is dependent on an endogenous balance of phyto-

B hormones in each particular genotype (Rastorguyev 1996).
The strawberry cultivars used in this study differ in regene-
ration frequency on media of different hormonal composi-
tions (unpublished data), nevertheless, calli of most culti-
vars provided intensive shoot regeneration on the medium
supplemented with 2 mg l-1 BAP and 0.5 mg l-1 IBA. As
previously observed in disease resistant and tolerant lines
derived from regenerated calli of ‘Urozhainaya CGL’ and
‘Feierverk’ (Solovykh and Tarabrin 2004), 0.2 mg l-1 GA3
positively influenced the regeneration process, favouring
shoot growth, although differences were often insignificant
(data not shown). Antioxidants, viz. 250–750 μM ascorbic
acid and 100250 μM reduced glutathione, also favoured
shoot regeneration, increasing vigor of plantlets, although
they usually had no significant influence on either shoot
number or shoot length (data not shown). The highest re-
generation frequency of plants with the characters which
calli were selected for, achieved in optimal variants, fluc-
Fig. 5 (A) Micropropagation and (B) rooting of salt-tolerant plants in tuated from 6% (‘Lvovskaya Rannyaya’) to 11% (‘Urozhai-
vitro on MS medium. Media are supplemented with: (A) 1.0 mg l-1 BAP naya CGL’).
and 0.1 mg l-1 IBA, 36th day of cultivation; (B) 1.0 mg l-1 BAP and 1 mg l-1 As proposed by Boxus (1974, 1992), adventitious
IBA, 40th day of cultivation. Plants are regenerated from a callus line shoots were micropropagated on MS medium supplemented
derived from ‘Zolushka’. with 1.0 mg l-1 BAP. Although micropropagation of straw-
berry cultivars in vitro may be successfully carried out
without auxins, the addition of 0.10.2 mg l-1 IBA has been
heterogeneity of callus cells, there is no guarantee that found to favour shoot development (Muratova et al. 2004).
morphogenesis will occur exactly from those resistant cells. A combination of 1.0 mg l-1 BAP and 0.1 mg l-1 IBA was
Only two of eight plants, regenerated from calli selected optimal for micropropagation of most selected lines (Fig.
after two first passages on a selective medium that con- 5A). In lines derived from ‘Zolushka’, using proliferation
tained cultural filtrate of P. cactorum at 20%, turned out to media with 0.5 mg l-1 GA3 instead of IBA resulted in a
be resistant to the pathogen itself. Amounts of resistant cells, somewhat larger shoot size in approximately 50% of the
as well as the number of resistant plants regenerated from lines. Although when cultivated for a long period of time,
them, increase from passage to passage thanks to a sus- strawberry plantlets are able to root even without auxins,
taining screening process, but when cultivation in vitro lasts media that contained 1 mg l-1 IBA turned out to be particu-
seven or eight passages, declining of a morphogenetic larly felicitous for in vitro rooting of selected lines, favour-
potential of callus tissues becomes irreversible. Quantities ing both quick root formation, strength and well-balanced
of plants, regenerated from ‘Zolushka’-derived calli that development of plantlets (Fig. 5B).
were selected after four passages of subculture on selective
media and exhibited resistance/tolerance to different stres- Results of testing for resistance/tolerance to the
sors, amounted to 43.8-85.0%. 54.5-61.5% of resistant/tol- stressors and main achievements of the selecting
erant plants were obtained from ‘Lvovskaya Rannyaya’, work
28.6-80.0% from ‘Urozhainaya CGL’ and 50% from ‘Feier-
verk’. On the other hand, the in vitro tissue culture fre- Depending on selected lines and initial cultivars, 69 to 85%
quently led to accumulation of somaclonal changes (pers. of plantlets rooted in vitro were successfully acclimatized to
obs.), including those affecting useful and economically imin vivo conditions and subsequently planted in the field (Fig.
portant traits of initial cultivars. Hence, concluding stages 6). Tests for resistance to P. cactorum, using leaf inocula-
of tissue selection must be accompanied by field testing of tion method which exhibited in similar studies on grape
selected plants. cultivars being precise enough to be used instead of crown
MS medium was most suitable for regeneration of inoculation (Shtin 1971), proved most selected lines to be
strawberry plants. Optimal ratio of auxins and cytokinins in resistant or more tolerant to the fungal infection compared
120
Table 1 Results of testing for resistance to B. cinerea and P. cactorum ones, producing less tolerant plantlets than that might be ex-
using artificial leaf inoculation. pected.
Initial cultivar Percentage of leaves/lines with scores 0 and 1 Results, obtained in tissue selection for resistance to B.
B. cinerea P. cactorum cinerea, bear evidence that tolerance to phytotoxins from
Z (control) 0.0 5.0 the fungus does not ensure resistance to the pathogen in
Z (selected lines) 43.8 83.7 each case. It was especially clear in the study where clones
LR (control) 0.0 2.2 of ‘Urozhainaya CGL’ were tested (Table 1). Nevertheless,
LR (selected lines) 54.5 66.7 in view of the fact that considerable proportions of resistant
U (selected lines) 28.6 80.0 and tolerant somaclones were selected, one could say that
Z: Zolushka, LR: Lvovskaya Rannyaya, U: Urozhainaya CGL this particular method of tissue selection is possible to be a
success. This method may be an important addition to the
conventional method of breeding for the character and gain-
with initial cultivars. In four days following inoculation, ing recognition transgenic methods enhancing resistance to
development of the disease on most leaves, taken from the important disease in strawberry genotypes (Jain and
‘Lvovskaya Rannyaya’ and ‘Zolushka’ (control), was scored Pehu 1992; Vellicce et al. 2006).
with 3, 4 and 5; leaves from ‘Lvovskaya Rannyaya’ had Results, obtained during evaluation of selected lines,
particularly heavy symptoms. The remaining leaves were allow concluding that the method, based on leaf inoculation
almost all given score 2. Such a high susceptibility was with spore-mycelium suspensions, has proved its reliability
characteristic of the cultivars in wet conditions favouring and may be used for estimation of strawberry plant resis-
the disease development, while most leaves, taken from the tance to the diseases. It requires neither much time nor large
selected lines of both cultivars, exhibited resistance or costs, which is its most important advantage compared with
tolerance (scores 0 and 1) to the disease (Table 1), and only other methods, used in greenhouses and field conditions,
a few leaves were given score 3. Percentage of lines, resis- with crown inoculation methods in particular (Bell et al.
tant or tolerant to B. cinerea, was lower, particularly among 1997; Parikka 2007).
somaclones of ‘Urozhainaya CGL’. At the same time, none Preliminary testing of selected lines for tolerance to
of the leaves that were taken from control plants, had scores salinity in vitro was combined with micropropagation of
0, 1 or 2. In the preceding study (1997–2000), where ‘Uro- shoots, regenerated from selected calli. The tests exhibited
zhainaya CGL’ (Solovykh and Tarabrin 2004) and ‘Feier- that selected lines, although differed from each other in
verk’ (unpublished data) were used for tissue selection, tolerance, were still superior to initial cultivars. Whereas
52.4% of selected lines derived from ‘Urozhainaya CGL’ plantlets of the latter were usually affected by salt toxicity
demonstrated resistance/tolerance to B. cinerea vs. 0.0% of heavily (Fig. 7A), most selected lines demonstrated visibly
resistant leaves in control. 56.7% of lines derived from higher capabilities to withstand the stressor (Fig. 7B), al-
‘Feierverk’ also revealed tolerance compared with 2.1% of though when salt levels in media were high, they were vis-
leaves taken from the cultivar. 64.8% of somaclones of ibly depressed compared with control plants (Fig. 7C cor-
‘Urozhainaya CGL’, selected for tolerance to toxins of P. responds with selected line 3-1-07 growing in the absence
cactorum, proved being resistant or tolerant to the fungus. of NaCl). Salinity slowed down shoot growth, led to sinking
Proportion of equally resistant/tolerant lines derived from of the propagation coefficient, caused leaf necroses and
‘Feierverk’ amounted to 81.7%. Taking into account the fact partial leaf death to practically all selected lines (data not
that the conventional method of breeding and selection for shown).
resistance to P. cactorum is usually significantly less resul- In saline conditions, to protect actively growing and
ting (Eikemo et al. 2003; Shaw et al. 2008), the method of metabolizing cells, plants regulate ion movement into tis-
tissue selection can be one of the vital tools to gain the desi- sues (Flowers and Yeo 1992; Munns 1993). One mode by
rable feature. which plants control salt flux to the shoot is regulating the
Some lines, selected for tolerance to phytotoxins from B. entry of ions into the xylem stream. The other, the accumu-
cinerea or P. cactorum, revealed neither resistance nor toler- lation of large quantities of ions in mature and old leaves,
ance to the phytopathogens themselves, as this can be seen which then dehisce, has often been observed under salt
from Tables 1 and 2. Apart from these studies, a number of stress (Flowers and Yeo 1992; Munns 1993). In a function
researchers (Behnke 1979; Orton 1987; Frame et al. 1991) as ion sinks, old leaves may restrict ion deposition into
obtained plants, regenerated from cells or calli tolerant to meristematic and actively growing and photosynthesizing
phytopathogen toxins, which were resistant or tolerant to cells. An alternative possibility is that cellular ion discrimi-
the phytopathogen itself. At least it was true in regard to P. nation is a natural consequence of transpirational and ex-
cactorum (Solovykh and Tarabrin 2004). In other words, pansive growth fluxes, cell morphology, and degree of
possessing a tolerance to toxins at the cellular level often intercellular connection. Meristematic cells, which are not
conditioned a resistance/tolerance of the regenerated plant directly connected to the vasculature, are less exposed to
to the disease (Nosov 1999). However, exceptions might ions delivered through the transpiration stream, and their
occur when defensive mechanisms of plant cells were based small vacuolar space is not conducive to ion storage. De
on hypersensitive responses (HRs) to the fungus penetration. facto, the solute content of tissues containing cells with
Also, resistance happens in some cases to be epigenetic. little vacuolation (e.g. meristematic regions) is predomi-
Besides, heterogeneity of callus cells, which is kept even nated by organic osmolytes and in tissues with highly vacu-
after long cultivation terms on selective media, might play olated cells by ions (Wyn Jones 1981; Binzel et al. 1988).
its role, and cells that experienced a somewhat less tight Judging overall, tolerant plants have higher capabilities to
pressure of a selection tool and possessed a poorer tolerance, control contents of the streams and protect the most actively
could participate in plant regeneration instead of tolerant growing and photosynthesizing tissues and organs by syn-
Table 2 Quantities of lines, resistant to B. cinerea and P. cactorum, obtained using tissue selection.
Initial cultivar Phytopatogen Lines showing resistance after leaf Lines showing no symptoms in Resistant/tolerant lines producing
inoculation field conditions fruit not inferior to initial cultivar
Z B. cinerea 7 7 4
Z P. cactorum 17 17 9
LR B. cinerea 6 4 0
LR P. cactorum 8 6 2
U B. cinerea 2 2 2
U P. cactorum 16 14 10
Z: Zolushka, LR: Lvovskaya Rannyaya, U: Urozhainaya CGL
121
A B C
Fig. 7 Growth and development of in vitro plants on MS medium: (A-B) containing NaCl at 0.6% (100 mM); (A) ‘Zolushka’ (control). (B) Line 3-1-
07 derived from ‘Zolushka’. (C) Line 3-1-07 on MS medium without NaCl. 38th day of cultivation in all variants.
Table 3 Quantities of lines, tolerant to chloride salinity, obtained using tissue selection and tested with different methods.
Initial cultivar Lines regenerated from calli Lines showing tolerance being Lines with tolerance proved Large-fruited lines proved to
tested in vitro by LAM tests be tolerant by leaf diagnostics
Z 12 8 6 3
F 8 4 4 0
LR 13 8 7 4
U 18 12 10 7
Z: Zolushka, F: Feierverk, LR: Lvovskaya Rannyaya, U: Urozhainaya CGL
0.30 0 200
solution, 0.23 after 48-h and 0.21 after 72-h treatment,
whereas corresponding IFS values in the control cultivar
0.25 were 0.20, 0.14 and 0.12, respectively. Computation of IFS
Index of functional state
values for plant tissues, taken from ‘Lvovskaya Rannyaya’,

0.20 found out a noticeable decrease of its average value after
72-h soaking in NaCl solution by 32.7% compared with the
0.15 control treatment with distilled water, while the difference
in selected lines did not exceed 8% (Solovykh 2009). To be
0.10
compared with the results obtained in the experiment with
soaked leaf discs, measuring IFS of tissues taken from
0.05
leaves of ‘Lvovskaya Rannyaya’ that were incubated in test
0.00
tubes with their petioles immersed in 1.2% (200 mM) NaCl

Control -1-07 -2-07 -3-07 -4-07 -5-07 solution, using the same method, led to comparable results:
IFS = 0.20 after both 24-h and 48-h treatments, 0.16 in 72 h,
Fig. 8 Indices of functional state of salt-tolerant lines, determined with and 0.10 in 96 h, while values of this index for a selected
LAM method. Measuring was carried out after 72-h treatments with line (LR 6-07) derived from the cultivar, were 0.23, 0.22
distilled water (0, control) and solution of NaCl at 1.2% (200 mM). Lines and 0.21, respectively (Solovykh 2009).
are derivatives from ‘Zolushka’, obtained using tissue selection. Values This method has proved being somewhat more sensitive
represent mean ± standard error (SE). LSDA05 = 0.07, LSDB05 = 0.05, (Solovykh et al. 2009) than the method of pulse amplitude
where A = variant of treatment, B = line. modulation (PAM) of chlorophyll fluorescence, proposed
by Schreiber et al. (1986), which has been used in last dec-
ades for different purposes, first of all for estimation of
thesis of special compounds regulating biochemical path- photosynthetic activity and photoinhibition in leaves (Krause
ways. Hasegawa et al. (2000) have defined determinants of and Weis 1991; Lutts et al. 1996; Goh et al. 1999; Solovykh
salt stress tolerance as effector molecules (metabolites, pro- et al. 2009). Also, ‘FSR–03–08’ can be successfully em-
teins, or components of biochemical pathways) that lead to ployed to determine chlorophyll contents in leaves and
adaptation and as regulatory molecules (signal transduction other chlorophyll-containing tissues by computation of a
pathway components) that control the amount and timing of coefficient of permeability for rays of the red spectrum,
these effector molecules. Stress adaptation effectors are using data obtained by measuring with the device.
categorized as those that mediate ion homeostasis, osmolyte Studies of chlorophyll characteristics, performed in rice
biosynthesis, toxic radical scavenging, water transport, and under salt stress conditions, resulted in the finding that sali-
transducers of long-distance response coordination (Rhodes nity alters chloroplast ultrastructure, causing a prominent
and Samaras 1994; Niu et al. 1995; Asada 1999). swelling of thylakoids (Yamane et al. 2003, 2004). The
Testing selected lines, grown in field conditions, using ultrastructural changes were induced by ion toxicity or ionic
the LAM method, revealed 84.4% of somaclones to possess imbalance (Yamane et al. 2003), while salt-induced oxi-
an elevated tolerance to the salinity stress compared with dative stress was responsible for the alteration of thylakoids
initial cultivars (Fig. 8; Table 3), although lines, similar to membrane property (Yamane et al. 2004). A few years later,
the control, also occurred, for instance, line 3–5–07 derived evaluating rice seedlings treated with NaCl solution of dif-
from ‘Zolushka’ (Fig. 8). Comparable data were obtained ferent concentrations, these researchers detected chloro-
when somaclones of the other cultivars and control plants phyll fluorescence emission with a PAM instrument and
were tested using the method. For example, leaf tissues of a examined for chloroplast ultrastructure in the regions where
selected line derived from ‘Urozhainaya CGL’, U 7-07, chlorophyll fluorescence had been recorded (Yamane et al.
showed IFS = 0.24 after 24-h soaking in 200-mM NaCl 2008). NaCl treatment caused swelling thylakoids, which
122
was quantified by the percentage of the length of swollen nyaya’ began to ripen 5-7 days later. One selected line des-
thylakoids to the total length of them. This value increased cending from ‘Zolushka’ revealed a similar tendency, while
with increasing of NaCl concentration. A minimal fluores- a clone of ‘Urozhainaya CGL’ produced fruit that started to
cence yield (after treatment with nutrient solution without mature a week earlier compared with the cultivar. A line,
NaCl) was not increased by treatments with 75 or 100 mM derived from ‘Zolushka’, selected for salt tolerance, rev-
NaCl. On the other hand, the index increased and the swel- ealed a phenomenon of everbearing. Most changes in mor-
ling of thylakoids was prominent at 150 and 200-mM NaCl phological traits were of no use. Some of them deteriorated
treatments. A high concentration of NaCl (200 mM) caused fruit quality, first of all because of their smaller size. Altera-
an increase in fluorescence yield within three days. An in- tions of that type were particularly typical of the plants,
crease of fluorescence yield is characteristic of destruction which were regenerated from calli, cultivated on media sup-
of photosynthesis II reaction centres or inhibition of transfer plemented with 2,4-D. Prolonged cultivation on these media
of excitation energy from the antennae to the reaction led to obtaining numerous small-fruited plants quantities of
centres. The highest level is theoretically the fluorescence which ranged from 28% (from ‘Urozhainaya CGL’-derived
emission when all reaction centres are open and the photo- calli) to 100% (derived from ‘Feierverk’). Moreover, a few
chemical quenching is maximal. These results suggested plants produced sterile flowers, whereas quantities of small-
that the increase in fluorescence yield index under salt stress fruited plants regenerated from calli cultivated on related
was correlated with the ultrastructural damage (Yamane et media supplemented with IBA, ranged from 15% (derived
al. 2008). Similar phenomena were observed in NaCl-treated from ‘Urozhainaya CGL’) to 35% (derived from ‘Lvov-
maize (Hasan et al. 2006). The swelling of thylakoids under skaya Rannyaya’).
salinity is induced by lipid peroxidation caused by ROS,
such as H2O2 and ·OH derived from H2O2 (Yamane et al. CONCLUSIONS
2004), which are also related to the destruction of reaction
centres. Tolerance to phytotoxins from P. cactorum almost in all
The speculation suggests that a similar ultrastructural cases indicated resistance/tolerance to the pathogen itself.
distortion of chloroplasts might take place in strawberry The majority of plants regenerated from calli that kept in-
leaf tissues and be the reason of higher indices of light dif- tensive growing and proliferating on selective media, pos-
fusion, measured with ‘FSR–03–08’ after their treatment sessed resistance/tolerance to the fungus.
with 200-mM NaCl solution compared to those treated with Tolerance to phytotoxins of B. cinerea was not equal to
distilled water, and, accordingly, of the lower IFS values resistance/tolerance to the fungal disease, but tissue screen-
computed using the indices of diffused light intensity. The ing on media containing toxins from the fungus may be a
fact that this sinking of IFS values was no more than slight selection tool to obtain genotypes with the desirable trait,
after 24-h treatment with the saline and prominent in most since its employment resulted in several tolerant lines.
cases after 72-h soaking in it is additional evidence to allow Testing for resistance to the diseases using leaf inocula-
the supposition of conformity of the phenomena to the re- tion followed by incubation of infected leaves in Petri
sults obtained in the photochemical and chloroplast struc- dishes proved to be reliable enough to consider this tech-
ture investigations performed on rice and maize. nique as an alternative to crown inoculation. This method is
Leaf diagnostics that was employed to estimate salinity faster and inexpensive, and may be successfully used at
tolerance of the most promising strawberry lines in the field least at early stages of selecting work, with a subsequent
had much in common with the method usually used for evaluation of the most promising lines in field conditions,
classification of rice cultivars for salt tolerance by visual using more reliable but cost-consuming methods.
score at seedling stage, when seedlings, grown until 3rd to Plants, regenerated from most callus tissue specimens
4th leaf stages, then were treated with a nutrient solution selected for tolerance to salinity on selective media, were
containing 0.5% NaCl by bottom watering (Lee et al. 2003). significantly more tolerant to the stressor compared with
The difference was that in this research only leaves were initial cultivars, which was confirmed by testing in vitro,
taken for the test instead of small intact plantlets, and a followed by laser analyses of leaf tissue microstructure and,
higher concentration of NaCl solution was used for leaf in- finally, by the method of leaf diagnostics. The three methods
cubation. Herewith the protecting function of roots (Hase- proved being highly reliable to obtain needed estimates at
gawa et al. 2000; Li et al. 2007) was removed, and tissues different phases of selecting work.
underwent the stress treatment directly. It was a matter of a Tissue selection allowed obtaining lines, resistant/toler-
few days to find out which lines could withstand the severe ant to B. cinerea, P. cactorum and excessive salinity, pos-
salinity stress and to what extent. The visual score based on sessing important traits of initial cultivars. Optimal media
necrosis ratio appeared to be a rapid, simple and fairly compositions were found for micropropagation of nearly all
reliable assessment tool, based on which, the lines were selected lines depending on their origin and plant charac-
given definitive estimates in accordance with their salt tol- teristics.
erance level.
So far selected lines have not yet been completely eval- ACKNOWLEDGEMENTS
uated and described. Some morphological and physiological
traits, first of all characters contributing to fruit quality, Preparation of fungal culture filtrates of B. cinerea and P. cacto-
winter hardiness and frost resistance of flowers are to be rum for selective media was provided by Ishchenko LA and Ches-
measured and estimated to be compared with those of the nokova IN; preparation of inoculums and leaf inoculation were
cultivars which they were derived from. Also, possible un- performed by Kozayeva MI (Laboratory of Immunity of the
desirable traits are needed to be found out. Michurin Russian Research Institute of Genetics and Breeding of
Long cultivation of calli on nutrient media led to ac- Fruit Plants). The authors thank Dr. Jaime A. Teixeira da Silva for
cumulation of somaclonal alterations touching on different extensive improvements to language.
useful traits of the cultivars used in the studies, some of
which would be of interest for both strawberry fruit growers REFERENCES
and researchers, because might be used for studying regu-
larities of emergence and variability of different somaclonal * In Russian
alterations. Several lines, derived from ‘Zolushka’ and
Asada K (1999) The water-water cycle in chloroplasts: Scavenging of active
superior to the cultivar in resistance to fungal diseases, dif-
oxygens and dissipation of excess photons. Annual Review on Plant Physiol-
fered from it in inflorescence count per plant, flower count ogy and Plant Molecular Biology 50, 601-639
per inflorescence, fruit size and runner formation. Also, Ashraf M (1989) The effect of NaCl on water relations, chlorophyll, and pro-
lines of ‘Lvovskaya Rannyaya’, ‘Urozhainaya CGL’ and tein and proline contents of two cultivars of blackgram (Vigna mungo L.).
‘Zolushka’ with noticeably differing terms of fruit maturing Plant and Soil 119 (2), 205-210
were selected. Fruit of two somaclones of ‘Lvovskaya Ran- Ashraf M, Ahmad S (2000) Influence of sodium chloride on ion accumulation,
123
yield components and fiber characteristics in salt-tolerant and salt-sensitive Plant Molecular Biology 51, 463-499
lines of cotton (Gossypium hirsutum L.). Field Crop Research 66, 115-127 Jain SM (1993) Somaclonal variation in Begonia x elatior and Saintpaulia
Behnke (1979) Selection of potato callus for resistance to culture filtrates of ionantha L. Scientia Horticulturae 54 (3), 221-231
Phytophthora infestans and regeneration of resistant plants. Theoretical and Jain SM (1997a) Micropropagation of selected somaclones of Begonia and
Applied Genetics 55, 69-71 Saintpaulia. Journal of Bioscience 22 (5), 585-592
Bell JA, Simpson DW, Harris DC (1997) Development of a method for Jain SM (1997b) Somaclonal variation and mutagenesis for crop improvement.
screening strawberry germplasm for resistance to Phytophthora cactorum. Maatalouden Tutkimuskeskuksen Julkaisuja 18, 122-133
Acta Horticulturae 439, 175-179 Jain SM (1997c) Creation of variability by mutation and tissue culture for im-
Beloualy N, Bouharmont J (1992) NaCl-tolerant plants of Poncirus trifoliata proving plants. Acta Horticulturae 447, 69-78
regenerated from tolerant cell lines. Theoretical and Applied Genetics 83, Jain SM (2001) Tissue culture-derived variation in crop improvement. Euphy-
509-514 tica 118, 153-166
Binzel ML, Hess FD, Bressan RA, Hasegawa PM (1988) Intracellular com- Jain SM, Pehu E (1992) The prospects of tissue culture and genetic engineer-
partmentation of ions in salt adapted tobacco cells. Plant Physiology 86, 607- ing for strawberry improvement. Acta Agriculturae Scandinavica 42 (3), 133-
614 139
Biswas MK, Dutt M, Roy UK, Islam R, Hossain M (2009) Development and Karp A (1995) Somaclonal variation is a tool for crop improvement. Euphytica
evaluation of in vitro somaclonal variation in strawberry for improved horti- 85, 295-302
cultural traits. Scientia Horticulturae 122 (3), 409-416 Koiwa H, Bressan RA, Hasegawa PM (2006) Identification of plant stress-
Boxus P (1974) The production of strawberry plants by in vitro micropropaga- responsive determinants in arabidopsis by large-scale forward genetic screens.
tion. Journal of Horticultural Science 49 (3), 209-210 Journal of Experimental Botany 57 (5), 1119-1128
Boxus P (1992) Mass production of strawberry and new alternatives for some Konstantinov YM, Rivkin MI (1991) The probable free-radical mechanism of
horticultural crops. In: Kurata K, Kozai T (Eds) Transplant Production Sys- somaclonal alteration emergence in plants. In: Tarasov VA (Ed) Molecular
tems, Kluwer Academic Publishers, The Netherlands, pp 151-162 Mechanisms of Genetic Processes, Proceedings of 7th Symposium, 27-30
Budagovskaya ON (2004) Laser diagnostics of plants. Mekhanizatsiya i Elec- March, 1990, Moscow, Russia, pp 127-130*
trifikatsiya Selskogo Khozyaistva 9, 24-26* Krause GH, Weis E (1991) Chlorophyll fluorescence and photosynthesis: The
Budagovskaya ON, Budagovsky AV, Budagovsky IA (2007) The automatic basics. Annual Review of Plant Biology 42, 313-349
monitoring system of structural re-organising in plant tissues. Pribory i Tekh- Lee SY, Ahn JH, Kwon TO (2003) Evaluation and classification of selected
nika Experimenta 1, 161-162* rice varieties for salinity tolerance at seedling stage. Korean Journal of Crop
Budagovsky AV, Budagovskaya ON, Lents F, Mirovskaya A, Elkaut K Science 48 (4), 339-344
(1998) A new method of functional state analyses of cultivated plants. In: Li J-Y, Jiang A-L, Zhang W (2007) Salt stress-induced programmed cell death
Gudkovsky AV, Skripnikov VY, Shchyokotova LA, Ilyinsky AS, Akulova OS in rice root tip cells. Journal of Integrative Plant Biology 49 (4), 481-486
(Eds) Ways of Sustaining of Horticulture, Michurinsk, pp 98-113* Lutts S, Kinet JM, Bouharmont J (1996) NaCl-induced senescence in leaves
Butenko RG (1999) Biology of Higher Plant Cells in Vitro and Biotechnology of rice (Oryza sativa L.) cultivars differing in salinity resistance. Annals of
Based on them (1st Edn), FBK-PRESS, Moscow, 159 pp* Botany 78, 389-398
Choi W-Y, Lee K-S, Ko J-C, Choi S-Y, Choi D-H (2003) Critical saline con- Maas JL, Zhong L, Galletta GJ (1993) In vitro screening of strawberry plant
centration of soil and water for rice cultivation on a reclaimed saline soil. and root cultures for resistance to Phytophthora fragariae and P. cactorum.
Korean Journal of Crop Science 48 (3), 238-242 Acta Horticulturae 348, 496-499
Debnath S, Teixeira da Silva JA (2007) Strawberry culture in vitro: Applica- Munns R (1993) Physiological processes limiting plant growth in saline soils:
tion in genetic transformation and biotechnology. Fruit, Vegetable and Cereal some dogmas and hypotheses. Plant, Cell and Environment 16, 15-24
Science and Biotechnology 1 (1), 1-12 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio-
Dolgykh YI (1994) Establishment of callus cultures and regeneration of maize assays with tobacco tissue cultures. Physiologia Plantarum 15, 473-497
plants. In: Bajaj YPS (Ed) Biotechnology in Agriculture and Forestry, Sprin- Muratova SA, Yankovskaya MB, Solovykh NV, Tyulenev VM (2004) Soft
ger, Berlin, 25, pp 24-36 fruit crop propagation in vitro. In: Loyko RE, Samus VA (Eds) Horticulture,
Dolgykh YI, Shamina ZB (1991) Modern notions of causes and mechanisms Samokhvalovichi, 15, pp 232-236*
of somaclonal variability. In: Tarasov VA (Ed) Molecular Mechanisms of Niu X, Bressan RA, Hasegawa PM, Pardo JM (1995) Ion homeostasis in
Genetic Processes, Proceedings of 7th Symposium, 27-30 March, 1990, Mos- NaCl stress environments. Plant Physiology 109, 735-742
cow, Russia, pp 123-127* Nosov AM (1999) Higher plant cells culture is a unique system, model and
Drozdovsky EM, Barbatunova GA (1985) Phytophthora in strawberry. device. Physiologiya Rasteniy 46 (6), 837-844*
Plodoovoshchnoye Khozyaistvo 12, 24-28* Novotelnova NS (1974) Phytophthora Fungi (1st Edn), Nauka, Leningrad, 156
Dziadczyk P, Bolibok H, Tyrka M, Hortynsky J (2003) In vitro selection of pp*
strawberry (Fragaria x ananassa Duch.) clones tolerant to salt stress. Orlando R, Magro P, Rugini E (1997) Pectic enzymes as a selective pressure
Euphytica 132 (1), 49-55 tool for in vitro recovery of strawberry plants with fungal disease resistance.
Dziadczyk P, Kiszczak W, Tyrka M, Laba M, Diufer K (2005) Evaluation of Plant Cell Reports 16, 272-276
strawberry (Fragaria x ananassa Duch.) cultivars salt stress tolerance on the Orton TJ (1987) Genetic instability in celery tissue and cell cultures. Iowa
basis of S1 Seeds in vitro germination. International Journal of Food, Agri- State Journal Research 61 (4), 481-498
culture and Environment 2 (2), 275-281 Parikka P (2007) Screening of strawberry resistance to Phytophthora cactorum.
Ehling CF, Bernstein L (1958) Salt tolerance of strawberries. Proceedings of Sodininkyst ir Daržininkyst 26 (3), 23-30
the American Society of Horticultural Science 72, 198-206 Popov AS, Volkova EA, Butenko RG (1995) Cryoreservation of germplasm of
Eikemo H, Stensvand A, Davik R, Tronsmo AM (2003) Resistance to crown Dioscorea deltoidea (medicinal jam) In: Bajaj YPS (Ed) Biotechnology in
rot (Phytophthora cactorum) in strawberry cultivars and in offspring from Agriculture and Forestry, Springer, Berlin, 32, pp 487-498
crosses between cultivars differing in susceptibility to the disease. Annals of Quoirin M, Lepoivre P (1977) Improved medium for in vitro culture of Prunus
Applied Biology 142 (1), 83-89 sp. Acta Horticulturae 78, 437-442
Evans DA (1987) Somaclonal variation. Plant Biology 4, 59-69 Rastorguyev SL (1996) Plant regeneration from isolated somatic tissues of
Evans D, Sharp W, Medina-Filho H (1984) Somaclonal and gametoclonal strawberry and raspberry. In: Tyulenev VM (Ed) Induction of Morphogenesis
variation. American Journal of Botany 71, 759-774 and Tissue Selection of Horticultural Crops, Michurinsk, pp 40-61*
Flowers TJ, Yeo AR (1992) Solute Transport in Plants (1st Edn), Blackie, Glas- Rhodes D, SamarasY (1994) Genetic control of osmoregulation in plants. In:
gow, Scotland, 176 pp Strange K (Ed) Cellular and Molecular Physiology of Cell Volume Regula-
Frame , Kung-fu Yu, Christie RR, Pauls KP (1991) In vitro selection for tion, CRC Press, Boca Raton, pp 347-361
resistance to Verticillium wilt in alfalfa (Medicago sativa L.) using a fungal Schreiber U, Schliwa U, Bilger W (1986) Continuous recording of photoche-
culture filtrate. Physiological and Molecular Plant Pathology 3 (5), 325-340 mical chlorophyll fluorescence quenching with a new type of modulation
Gao J-P, Chao D-Y, Lin H-X (2007) Understanding abiotic stress tolerance fluorometer. Photosynthesis Research 10, 51-62
mechanisms: Recent studies on stress response in rice. Journal of Integrative Scott DH, Lawrence FJ (1975) Strawberries. In: Janick J, Moore JN (Eds) Ad-
Plant Biology 49 (6), 742-750 vances in Fruit Breeding, University press, N.Y., 71 pp
Goh C-H, Schreiber U, Hedrich R (1999) New approach of monitoring chan- Shaw DV, Hansen J, Brown GT, Shaw SM (2008) Components of genetic
ges in chlorophyll fluorescence of single guard cells and protoplasts in res- variation for resistance of strawberry to Phytophthora cactorum estimated
ponse to physiological stimuli. Plant, Cell and Environment 9, 1057-1070 using segregating seedling populations and their parent genotypes. Plant
Gregorio GB, Senadhira D, Mendoza RD, Manigbas NL, Roxas JP, Guerta Pathology 57 (2), 210-215
CQ (2002) Progress in breeding for salinity tolerance and associated abiotic Shin S-H, Lee Y-M, Cho B-H (2004) Amino acid and protein contents in the
stresses in rice. Field Crops Research 76 (2/3), 91-101 seedlings of salt-tolerant and salt-susceptible rice cultivars. Korean Journal
Hasan R, Kawasaki M, Taniguchi M, Miyake H (2006) Salinity stress in- of Breeding 36 (5), 320-325
duces granal development in bundle sheath chloroplasts of maize, an NADP- Shokaeva DB (2006) Principles of Fruiting of Short-Day Strawberries (1st Edn),
malic enzyme-type C4 plant. Plant Production Science 9 (3), 256-265 Cartouche, Orel, 134 pp
Hasegawa PM, Bressan RA, Zhu J-K, Bohnert HJ (2000) Plant cellular and Shokaeva DB (2008) Relationships between yield components in first cropping
molecular responses to high salinity. Annual Review of Plant Physiology and year and average yield of short-day strawberries over two main seasons. Sci-
124
entia Horticulturae 118 (1), 14-19 Vellicce GR, Ricci JCD, Hernandez L, Castagnaro AP (2006) Enchanced re-
Shokaeva DB, Zubov AA (1999) Strawberry, hautboy strawberry and their sistance to Botrytis cinerea mediated by the transgenic expression of the Chi-
hybrids. In: Sedov EN, Ogoltsova TP (Eds) The Programme and Methods of tinase gene ch5B in strawberry. Transgenic Research 15 (1), 57-68
Variety Trialling of Horticultural Crops, Izdatelstvo VNIISPK, Orel, pp 417- Walbot V (1985) On the life strategies of plants and animals. Trends in Gene-
443* tics 1, 165-169
Shtin LT (1971) The method of plant inoculation using cultures of fungi grown Wyn Jones RG (1981) Salt tolerance. In: Johnson CB (Ed) Physiological Pro-
in test-tubes to obtain disease resistant grape cultivars. Zashchita Rasteniy 12, cesses Limiting Plant Productivity, Butterworth, London, pp 271-292
21-28* Yamane K, Kawasaki M, Taniguchi M, Miyake H (2003) Differential effect
Singh RK, Mishra B, Chauhan MS, Yeo AR, Flowers SA, Flowers TJ (2002) of NaCl and polyethylene glycol on the ultrastructure of chloroplasts in rice
Solution culture for screening rice varieties for sodicity tolerance. Journal of seedlings. Journal of Plant Physiology 160 (5), 573-575
Agricultural Science 139 (3), 327-333 Yamane K, Kawasaki M, Taniguchi M, Miyake H (2004) Pre-treatment with
Solovykh NV (2009) Using of biotechnological methods in works with soft antioxidants decreases the effect of salt stress on chloroplast ultrastructure in
fruit crops, Izdatelstvo Michurinskogo Agrouniversiteta, Michurinsk-Nauko- rice leaf segments (Oryza sativa L.). Plant Production Science 7 (3), 292-300
grad RF, 47 pp* Yamane K, Kawasaki M, Taniguchi M, Miyake H (2008) Correlation bet-
Solovykh NV, Tarabrin AY (2004) Tissue selection of strawberry for resistance ween chloroplast ultrastructure and chlorophyll fluorescence characteristics
to a set of fungal pathogens, VGAU, Voronezh, 29 pp* in the leaves of rice segments (Oryza sativa L.) grown under salinity. Plant
Solovykh NV, Budagovsky AV, Budagovskaya ON (2009) Biotechnological Production Science 11 (1), 139-145
and biophysical methods of salt resistance evaluation in strawberry. Vestnik Yeo A (1999) Predicting the interaction between the effects of salinity and cli-
RASHN 1, 53-55* mate change on crop plants. Scientia Horticulturae 78 (2), 159-174
Sowik I, Bielenin A, Michalczuk L (2001) In vitro testing of strawberry resis- Yokoi S, Bressan RA, Hasegawa PM (2002) Salt stress tolerance of plants.
tance to Verticillium dahliae and Phytophthyra cactorum. Scientia Horticul- JIRCAS Working Report 23, 25-33
turae 88 (1), 31-40 Yue D, Gosselin A, Desjardins Y (1993) Re-examination of the photosynthetic
Udovenko GV (1977) Salt Resistance of Cultivated Plants (1st Edn), Kolos, capacity of in vitro-cultured strawberry plantlets. Journal of the American
Leningrad, 215 pp* Society for Horticultural Science 118, 419-424
125
Tolerance to Fusarium Wilt and Changes

in Antioxidative Ability and Free Amino Acid Content
in Mycorrhizal Strawberry Plants
Yoh-ichi Matsubara
Faculty of Applied Biological Sciences, Gifu University, Gifu 501-1193, Japan

Corresponding author: * ymatsu@gifu-u.ac.jp
ABSTRACT
The influence of arbuscular mycorrhizal fungi (AMF) colonization on tolerance to fusarium wilt and the changes in antioxidative ability
and free amino acid content in strawberry (Fragaria×ananassa Duch. cv. ‘Nohime’) plants was investigated. Strawberry runner plants
were treated with split root system and inoculated with Glomus mosseae. Mycorrhizal plants showed higher dry weight of shoots and
roots than did non-mycorrhizal plants among most of the plots. Five weeks after Fusarium oxysporum f. sp. fragariae (Fof) inoculation,
severity of disease symptoms was eased in shoots and roots of mycorrhizal plants. Plant mycorrhization did not modified the antioxidative
ability before Fof inoculation. However, 5 weeks after Fof inoculation, mycorrhizal plants showed higher SOD activity, DPPH radical
scavenging activity, polyphenol content, ascorbic acid content in some plant portions. Free amino acid content GABA, aspartic acid,
threonine, serine, glycine, citrulline and arginine increased in mycorrhizal plants with different entity depending on plant portions. In
addition, some among the amino acids increased in mycorrhizal plants showed suppressed by 20 to 70% the propagation of Fof cultured
by Czapec-Dox media in vitro depending their concentration. From these findings, plant growth enhancement and tolerance to fusarium
wilt including induced tolerance occurred in mycorrhizal strawberry plants. In this case, the disease tolerance might be associated with the
increase in antioxidative ability and symbiosis-specific amino acids.
_____________________________________________________________________________________________________________
Keywords: Fragariaananassa Duch., GABA, Glomus mosseae, polyphenol, SOD, symbiosis
INTRODUCTION lated with five species of AMF (Gigaspora margarita, Glo-

mus fasciculatum, Gl. mosseae, Gl. sp. R10 and Gl. aggre-
In strawberry cultivation, Fusarium wilt and anthracnose gatum) in greenhouse experiment, and the effect mostly
have been the serious diseases in the major strawberry pro- appeared in Gl. mosseae-inoculated plants (Matsubara et al.
ducing regions in Japan, and the diseases caused heavy 2004). The mechanisms of disease tolerance in mycorrhizal
losses during nursery and fruit production period (Tezuka plants are unclear. However, for mycorrhizal plants, disease
and Makino 1991; Okayama 1993; Mori and Kitamura tolerance and increase in superoxide dismutase (SOD) acti-
2003). Recently, capillary watering as a cultural control vity show correlation in tomato (Pozo et al. 2002) and pep-
method of these diseases has been introduced to strawberry per (Garmendia et al. 2006), drought tolerance and increase
cultivation, but the diseases are still difficult to control in SOD took place in lettuce (Lozano et al. 1996) and shrub
(Okayama 1993; Akita 2001). As for biological control of (Roldan et al. 2008), tolerance to SO2 and SOD increase
Fusarium disease, an attempt has been made to use non- occurred in Avena nuda (Huang et al. 2008). In addition, Li
pathogenic isolates of Fusarium oxysporum in strawberry et al. (2008) demonstrated that tolerance to high tempera-
(Tezuka and Makino 1991). However, the non-pathogenic ture stress and increase in antioxidative enzymes occurred
isolates have no growth-promoting effect and the method is in mycorrhizal strawberry plants. However, the relationship
still not enough to control. between antioxidative abilities and disease tolerance in
Arbuscular mycorrhizal fungi (AMF) are ubiquitous mycorrhizal strawberry plants still remains unclear.
soil inhabitants, and form a symbiotic relationship with the As for the changes in constituents related to disease
roots of most terrestrial plants. AMF promote host plant tolerance in mycorrhizal plants, Baltruschat and Schonbeck
growth by enhancing phosphorus uptake through symbiosis (1975) demonstrated that in tobacco plants, an increase in
(Marschner and Dell 1994) and hence an alternative to high both arginine and citrulline occurred in mycorrhizal plants,
inputs of fertilizers and pesticides in sustainable crop pro- which inhibited the propagation of Thielaviopsis basicola.
duction systems. As for strawberry, growth enhancement In addition some reports mentioned that the free amino acid
through AMF inoculation was reported in several combina- level in plants changes through AMF colonization. Sood
tions of fungal species and strawberry cultivars (Robertson (2003) and Fattah and Mohamedin (2000) reported that in-
et al. 1988; Chavez and Ferrera 1990; Williams et al. 1992; creases in the contents of free amino acids occurred in
Niemi and Vestberg 1992; Varma and Schuepp 1994). In mycorrhizal tomato and sorghum plants, respectively. Rolin
addition, the inoculation of strawberry plants with AMF re- et al. (2001) reported in leek plants that total amino acid
sulted in a reduced disease when challenged with Phytoph- levels in roots decreased in mycorrhizal plants. However, it
thora fragariae; however, the effect differed with host has been unclear how free amino acid content changes
cultivar and AMF species (Baath and Hayman 1984; Mark through symbiosis with AMF in strawberry plants and how
and Cassells 1996; Norman et al. 1996). Previously, the the changes are associated with disease tolerance.
author found the tolerance to Fusarium wilt in strawberry In this study, the influence of AMF colonization on
(Fragariaananassa Duch. cv. ‘Nohime’) plants inocu- tolerance to Fusarium wilt and the changes in antioxidative
Received: 1 December, 2009. Accepted: 5 May, 2011.

ability and free amino acid content in mycorrhizal straw- vinylpyrrolidone. The filtrate was centrifuged (EF-1300, Tomy Co.,
berry plants was investigated in order to clarify the mecha- Ltd., Tokyo, Japan) at 13,000 rpm for 20 min. The supernatant was
nisms of disease tolerance. used for crude enzyme extract. The activity was determined using
the Nitro Blue Tetrazolium (NBT) reduction method (Beauchamp
MATERIALS AND METHODS and Fridovich 1971). One unit of SOD activity was defined as the
amount of enzyme required to cause 50% inhibition of the rate of
Inoculation of AMF NBT reduction measured at 560 nm using a spectrophotometer (U-
1900, HITACHI, Tokyo, Japan). All the chemicals used in this
Strawberry (Fragaria×ananassa Duch. cv. ‘Nohime’, a com- study were analytical grade and obtained from Nacalai Tesque, Co.,
mercial cultivar in Japan) runner plants were treated with split root Inc., Kyoto, Japan.
system method. The plant root system was separated into halves
and each was placed in a different pot (10.5 cm in diameter): one 2) 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging
with disinfested bedding soil (autoclaved at 1.2 kg cm-2 and 121°C activity
for 1 h), and one with the same soil inoculated with Glomus mos-
seae (supplied by Idemitsukosan Co. Ltd.), according to Matsu- DPPH radical scavenging activity was measured according to the
bara et al. (2004). Two weeks after AMF inoculation, the plants method of Brurits and Bucar (2000). One gram sample was ground
were administered by mixed fertilizer (N: P: K = 13: 11: 13, 1 g in 40 ml of 90% methanol. The 10 l of the extract was introduced
per pot). Twenty plants with split root system were raised per treat- into test tubes, and 4ml distilled water and 1 ml of 250 l DPPH
ment with two replications, were irrigated by the capillary water- solution was added. The tubes were mixed and allowed to stand
ing method (Matsubara et al. 2004) and grown in a greenhouse (28 for 30 min in the dark. Absorbance was read against a blank at 517
± 3°C under natural light and day length). nm using a spectrophotometer (U-1900, HITACHI). DPPH radical
scavenging activity was calculated as the percent of inhibition
Inoculation with Fusarium oxysporum f. sp. relative to the control.
fragariae
3) Polyphenol content
Fusarium oxysporum f. sp. fragariae (Fof: strain 2S, supplied by
National Agricultural Research Center for Kyusyu Okinawa Polyphenol content was determined with Folin-denis method
Region in Japan) was grown on potato-dextrose agar media. The (1915). One gram sample was ground in 10 ml of 90% methanol.
conidia were harvested in potato-sucrose liquid media (Nissui The 400 l of the extract was placed in a test tube, then 3 ml dis-
pharmaceutical Co., Ltd.) and incubated at 25°C in the dark for 7 tilled water and 200 l Folin-denis reagents (10% Na2WO4·2H2O,
days. The conidial suspension of Fof was sieved (45 m), and the 2% H3(PMo12O40)·nH2O, 5% phosphoric acid). After 3 min, 0.4 ml
concentration was adjusted to 106 conidia mL-1. Eight weeks after of Na2CO3 (10%) was added, the mixture was allowed to stand for
AMF inoculation, all the plants were inoculated by each 10 mL of 30 min in the dark. Absorbance was measured at 700 nm using a
the Fof conidial suspension onto all the split roots. Plants were spectrophotometer (U-1900, HITACHI). Polyphenol content was
grown in a growth chamber by capillary watering at 28 ± 3°C, 60 determined as quercetin equivalent using an equation obtained
± 5% relative humidity under natural light and day length. from a standard quercetin graph.
Estimation of symptoms of Fusarium wilt 4) Ascorbic acid content
Five weeks after Fof inoculation, the severity of fusarium wilt was The assay was performed by the 2,4-dinitrophenyl hydrazine
categorized into 5 degrees on the base of the percentage of dis- method (Roe et al. 1948). Briefly, one gram sample was ground in
eased petioles in a plant: <20%, 20-40%, 40-60%, 60-80%, 80- 20 ml of 5% methaphosphate. The 2 ml of the extract was placed
100%. in a test tube, and1ml of 2,6-dichloroindophenol sodium (0.03%)
was added. Then, 1 ml of 2% 2,4-dinitrophenylhydrazine was
Evaluation of AMF colonization level mixed and incubated for 3 hrs. Absorbance was measured at 520
nm using a spectrophotometer (U-1900, HITACHI). Ascorbic acid
Roots of AMF plants were harvested 8 weeks after AMF inocula- content was determined using an equation obtained from a stan-
tion and 5 weeks after Fof inoculation. The root samples were dard L-ascorbic acid graph.
stained according to Phillips and Hayman (1970) and the rate of
AMF colonization in 1-cm segments of lateral roots (RFCSL) was Determination of free amino acids in plants
calculated. Hence, RFCSL expresses the percentage of 1-cm
AMF-colonized segments to the total 1-cm segments of all the Eight weeks after AMF inoculation, plants were sampled and par-
lateral roots; the number of total segments was approx. 50 plant-1. titioned into petioles, crowns and main roots (in AMF plants, sam-
The average colonization was calculated from the values of 3 pled only AMF-inoculated roots), and all samplers were freeze-
plants. dried using a freeze dryer (FDU-1200, Tokyo Rikakikai Co., Ltd.,
Tokyo, Japan). The samples for free amino acid analysis were
Determination of plant dry weight collected from 10 plants as follows: petioles (approx. 1 cm long
from the base), main roots (approx. 1 cm from the crown). Free
Plants were sampled 8 weeks after AMF inoculation and 5 weeks amino acids in each 200 mg-weighed samples were extracted at
after Fof inoculation. Plant samples were separated into shoots and 0°C in 2 mL 0.2 N perchloric acid solution mixed with 1 mL 0.25
roots and dry matter was weighed after drying at 100 °C for 2 days. M D,L-norleucine as an internal standard. Extracts were cen-
trifuged at 14,000 rpm at 4°C, and pH was adjusted to 4.0 with
Determination of antioxidative abilities KHCO3. Then the extracts (20 L in each time) were filtrated by a
GL-chromatodisc (GL science Co., Ltd., Tokyo, Japan). Free
Eight weeks after AMF inoculation (just before Fof inoculation) amino acid concentrations (41 constituents) were measured using
and 5 weeks after Fof inoculation, plants were sampled and paran automatic amino acid analyzer (JLC-500, JEOL Co., Ltd.,
titioned into petioles, crowns and main roots with no colonization Tokyo, Japan) using ninhydrin.
and frozen in liquid nitrogen. Analyses of antioxidative abilities
were carried out as the methods as follows. Fof culture with several amino acids in vitro
1. SOD activity The conidia of Fof grown on PDA media was subcultured for 2
weeks on Czapec-Dox media (Ohata 1995) containing NaNO3 3 g,
One gram of sample was ground in 4 ml of 0.1 mol phosphate- K2HPO4 1 g, KCl 0.5 g, MgSO4·7H2O 0.5 g, FeSO4·7H2O 0.01 g,
borate buffer (pH7.8) with 1 mmol ethylenediaminetetra acetic sucrose 30 g, agar 8 gL-1 (pH 5.8). Then, the conidia were further
acid, 3 mmol dichlorodiphenyltrichloroethane and 4% (w/v) poly- subcultured (106 conidia mL-1) in liquid Czapec-Dox media with or
127
Disease tolerance, physiology in mycorrhizal strawberry. Yoh-ichi Matsubara
6 60
Dry weight of shoots (g)

*
50
RFCSL (%)
4 40
*
30
20
2
10
0
0 Fof Fof+
Fof- Fof+
0 Fig. 2 AMF colonization level (RFCSL) in mycorrhizal strawberry
Dry weight of roots (g)
plants. Fof-, Fof+, see Fig. 1. Bars represent standard errors. *Data sig-
0.4 nificantly different following t-test, P=0.05.
0.8
Ratio of diseased shoots in a plant:
0-20 20-40 40-60
1.2 a b 60-80 80-100 %
a a
a a 100
Severity of fusarium wilt

1.6
non-AMF (Glomus mosseae)-inoculated plants 80
in shoots (%)
AMF-inoculated plants
AMF-inoculated roots in AMF-inoculated plants 60
AMF-noninoculated roots in AMF-inoculated plants
Fig. 1 Dry weight of strawberry plants. Fof-, before Fusarium oxyspo- 40

rum f. sp. fragariae (Fof) inoculation; Fof+, 5 weeks after Fof inoculation.
Bars represent standard errors. *Data significantly different following t- 20
test, P=0.05. Columns denoted by different letters indicate significant dif-
ference according to Tukey's multiple range test (P=0.05). 0 AMF
NAM
AMF+ AMF-
Severity of fusarium wilt 0
without addition of several filter-sterilized amino acids (gamma- 20
aminobutyric acid (GABA), aspartic acid, threonine, serine, gly-
in roots (%)
cine, citrulline, leucine and arginine; 0.1, 1%, w/v) at 25°C in the 40
dark for 7 days by shaked culture (100 rpm). Then, the density of
conidia was investigated using hemocytometer and calculated the 60
propagation index of amino acid-added plots to amino acid-non-
added plots. The average was calculated from 5 replications. 80
Experimental design and statistical analyses 100
Severity of symptoms in a root system:
Most of the values were expressed as the mean of three measure-
a part diseased half diseased
ments for each treatment. Mean values were separated by t-test at all diseased
P < 0.05 and Tukey’s multiple range test at P < 0.05 via analysis
of variance (ANOVA). Fig. 3 Severity of fusarium wilt in strawberry plants with split root
system. NAM, noninoculated; AMF, Glomus mosseae-inoculated plants;
RESULTS AND DISCUSSION AMF+, AMF-inoculated roots; AMF-, AMF-noninoculated roots.
Effect of AMF inoculation on plant growth and

Fusarium wilt increase SOD activity in petioles; a reduction of DPPH in
plant crown, and a reduction of SOD and polyphenols in
AMF plants had higher dry weight of shoots and roots than main roots. Mycorrhized plants challenged with Fof showed
did NAM ones except roots of before Fof inoculation (Fig. a significant increase in 3 out of 4 antioxidative composts in
1), suggesting that growth promotion effect appeared in the crown (DPPH, polyphenols, and ascorbic acid), but not
mycorrhizal strawberry plants. AMF colonization was suc- in the petioles. In the main roots of these plants, SOD and
cessful, reaching values about 40% and 48% just before and DPPH activities and polyphenols were restored to the levels
5 weeks after Fof inoculation, respectively (Fig. 2). The detected in the healthy plants, whereas ascorbic acid was
severity of fusarium wilt symptoms decreased in shoots of not imbalanced.
AMF plants (Fig. 3). In addition, reduction in symptom SOD plays a primary role in defensive reactions and
severity in roots became lower in both AMF+ and AMF- detoxify superoxide (O2-) among the antioxidative enzymes,
than in NAM one. Thus, AMF- roots showed disease toler- thus, SOD activity is considered as the most important key
ance. From these findings, tolerance to Fusarium wilt and enzyme in antioxidative abilities in plants (Fridovich 1986).
induced tolerance were recognized in mycorrhizal straw- Garmendia et al. (2006) reported that tolerance to Verticil-
berry plants. Our results agreed with those of Pozo et al. lium dahliae and increase in SOD activity occurred in
(2002), which reported an induced tolerance to Phytoph- mycorrhizal pepper plants. Moghaddam et al. (2006) and
thora parasitica in tomato plants with split root system. Sahoo et al. (2007) mentioned that resistant cultivar to
Mycosphaerella fragariae and Phytophthora colocasiae
Influence of AMF inoculation on antioxidative showed higher levels in SOD activity than a susceptible one
ability in strawberry and taro, respectively. The results in this study
had similar patterns with the findings as the increase in
In this study, AMF did not cause variations in SOD and SOD activity related to the disease tolerance.
DPPH activities, polyphenols and ascorbic acid content in Previously, Pozo et al. (2002) demonstrated a relation-
leaf petioles, crown and main roots of strawberry (Fig. 4). ship between the tolerance to Phytophthora parasitica of
Fof caused a reduction of ascorbic acid and DPPH, but an mycorrhizal tomato plants and SOD activity in both non-
128
SOD activity DPPH radical scavenging activity Polyphenol content Ascorbic acid content
DPPH radical scavenging

Petiole Petiole Petiole Petiole
Ascorbic acid content

activity (mg࡮g-1 FW)
2500 100
Polyphenol content
25
(units࡮g FW)
350
SOD activity
(mg࡮g-1 FW)
2000 80 20 300
(mg࡮g-1 FW)
1500 60 250
15 200
1000 40 10 150
500 20 5 100
0 50
Fof Fof+ 0 0 0
Fof Fof+ Fof Fof+ Fof Fof+

Crown Crown Crown Crown

Polyphenol content
1000 120 30 350
(units࡮g FW)
*
SOD activity
* *
(mg࡮g -1 FW)
800 * 100 25 300
(mg࡮g -1 FW)
80 20 250
600 200
60 15
400 150
40 10 100
200 20 5 50
0 0 0 0
Fof Fof+ Fof Fof+ Fof Fof+ Fof Fof+
Main roots Main roots Main roots Main roots

Polyphenol content
1200 20 300
(units࡮g FW)
a 80 a a aa
(mg࡮g-1 FW)
SOD activity
1000 a 250 a a
(mg࡮g -1 FW)
a a 15 a
800 ab
60 a aa a ab 200
a aa a b
600 b 40 b 10 150
400 100
200 20 5
50
0 0 0 0
Fof Fof+ Fof Fof+ Fof Fof+ Fof Fof+
non-AMF-inoculated plants AMF-inoculated plants AMF+ AMF-
Fig. 4 Antioxidative ability in mycorrhizal strawberry plants. Fof-, Fof+, see Fig. 1. AMF+ and AMF-, see Fig. 3. Bars represent standard errors.
*Data significantly different following t-test, P=0.05. Columns denoted by different letters indicate significant difference according to Tukey's multiple
range test (P=0.05).
AMF inoculated and AMF-inoculated roots in split root sys- changes in antioxidative ability. However, the levels of
tem. Li et al. (2008) reported that tolerance to high tempe- most antioxidative factors varied in mycorrhizal plants after
rature stress and the increase in activities of SOD and APX Fof inoculation rather than those before the inoculation.
under the stress condition occurred in strawberry (cv. Following our results, antioxidative abilities may play a
‘Nohime’) plants inoculated with Glomus mosseae, though partial or a secondary role in induced tolerance to Fof in
the antioxidative enzyme activities differed little between mycorrhizal strawberry plants. Further investigation would
AMF and NAM plants before high temperature stress con- be needed to clarify the relationship between induced
dition. Hence, the increase in antioxidative ability might be tolerance and antioxidative ability in mycorrhizal plants.
induced especially under the stress conditions in mycor- In the present study, AMF symbiosis promoted the
rhizal strawberry plants, resulted in the tolerance to Fusa- growth of strawberry plants, and reduced the severity of
rium wilt in this study. Fusarium wilt symptoms. Opposite conclusions were drown
Some other reports indicate that the mycorrhizal colo- by others: no relationship were found between AMF colo-
nization itself induces temporal increases in antioxidative nization level and: tolerance to P. fragariae in strawberry
enzymes (APX, CAT), H2O2, flavonoid content, suggesting (Mark and Cassells 1996), growth promotion and tolerance
that colonization might act as a temporal stress for host to Phytophthora capsici in pepper (Ozgonen and Erkilic
plants (Volpin et al. 1995; Salzer et al. 1999; Blilou et al. 2007), SOD activity and drought tolerance in lettuce and
2000). In this study, G. mosseae colonization did not cause shrub (Lozano et al. 1996; Roldan et al. 2008).
8 2.0
Free amino acid content (Ǵmol/gFW)
*
*
* petiole crown main roots
6 1.5
*
*
4 1.0
2 0.5 *
*
* *
0n a n a na 0 na na n a n a n a na na n a n a na na na na na n a na
e e e in e e e e e e e e e
in in id in ine id ne in
gi n in
e BAl BA lin in in in in in
ra
Ser aur Ac eon Ser c Ac ami lyc trul a-A Va leuc euc nith Lys rgin
l an GA
A pa
P - T ic r i t G i o L r A
As r t Th am Glu C Is O
spa l ut
A G
Fig. 5 Influence of AMF colonization on free amino acid content in strawberry plants. n, non-AMF-inoculated plants; a, AMF-inoculated. Bars
represent standard errors for total contents. *Data significantly different following t-test, P=0.05.
129
Disease tolerance, physiology in mycorrhizal strawberry. Yoh-ichi Matsubara
Changes in free amino acid content and influence Fusarium infection. Thus, some physiological and histolo-
of several amino acids on Fof propagation gical factors may be associated with disease tolerance in
mycorrhizal plants.
In the present study, as for free amino acid content, GABA,
aspartic acid, threonine, serine, glycine, citrulline, leucine REFERENCES
and arginine increased in AMF plants more than in NAM
ones; the effect differed among plant portions (Fig. 5). In Akita S (2001) Developmental distribution and cultural control of anthracnose
addition, some of the increased amino acids in mycorrhizal in strawberry. Agriculture and Horticulture 56, 76-79 (In Japanese)
plants showed suppression effect on the index of Fof propa- Baath E, Hayman DS (1984) No effect of VA mycorrhiza on red core disease
gation (Fig. 6). Sood (2003) reported increases in glutamic of strawberry. Transactions British Mycological Society 82, 534-536
acid, glycine, alanine and leucine in mycorrhizal tomato Baltruschat H, Schonbeck F (1975) The influence of endotrophic mycorrhiza
seedlings, and Fattah and Mohamedin (2000) reported glu- on the infestation of tobacco by Thielaviopsis basicola. Phytopathologische
Zeitschrift 84, 172-188
tamic acid and serine increases in mycorrhial sorghum
Beauchamp C, Fridovich I (1971) Superoxide dismutase: Improved assays
plants. On the other hand, Baltruschat and Schonbeck and an assay applicable to acrylamide gels. Analytical Biochemistry 44, 276-
(1975) demonstrated that in tobacco plants, an increase in 287
both arginine and citrulline occurred in mycorrhizal plants. Blilou I, Bueno P, Ocampo JA, Garrido JM (2000) Induction of catalase and
The results in this study havesimilar points as those repor- ascorbate peroxidase activities tobacco roots inoculated with the arbuscular
ted for tomato, sorghum and tobacco. mycorrhizal Glomus mosseae. Mycological Research 104, 722-725
Fattah and Mohamedin (2000) mentioned that the Burits M, Bucar F (2000) Antioxidant activity of Nigella sativa essential oil.
degree of the increase in amino acids was correlated with Phytotherapy Research 14, 323-328
the level of mycorrhizal colonization in the sorghum-Glo- Chavez MCG, Ferrera RC (1990) Effect of vesicular-arbuscular mycorrhizae
on tissue culture-derived plantlets of strawberry. HortScience 25, 903-905
mus intraradices combination. Sutton (1973) demonstrated
Dehne HW, Schonbeck F (1979) The influence of endotrophic mycorrhiza on
AMF colonization consisted of three phases: (1) a lag phase plant diseases. II. Phenol metabolism and lignification. Phytopathologische
during which spore germination, germ tube growth, and ini- Zeitschrift 95, 210-216
tial penetration occur; (2) a rapid growth phase, coinciding Fattah GM, Mohamedin AH (2000) Interactions between a vesicular-arbuscu-
with the development of external mycelium, and spread of lar mycorrhizal fungus (Glomus intraradices) and Streptomyces coelicolor
the fungus within the roots; and (3) a stable phase during and their effects on sorghum plants grown in soil amended with chitin of
which the proportion of infected roots to non-infected ones brawn scales. Biology and Fertility of Soils 32, 401-409
remains nearly constant. In this study, amino acids and Folin O, Denis W (1915) A colorimetric method for the determination of phe-
AMF colonization were investigated only 8 weeks after ino- nols (and phenol derivatives) in urine. The Journal of Biological Chemistry
22, 305-308
culation, so that it was difficult to estimate the fluctuations.
Fridovich I (1986) Biological effects of the superoxide radicals. Archives of
Baltruschat and Schonbeck (1975) demonstrated that in Biochemistry and Biophysics 247, 1-11
tobacco plants, an increase in both arginine and citrulline Garmendia I, Aguirreolea J, Goicoechea N (2006) Defence-related enzymes
occurred in mycorrhizal plants, which inhibited the propa- in pepper roots during interactions with arbuscular mycorrhizal fungi and/or
gation of Thielaviopsis basicola. Starratt and Lazarovits Verticillium dahliae. Biocontrol 51, 293-310
(1999) reported low levels of the herbicide trifluralin in- Huang LL, Yang C, Zhao Y, Xu X, Xu Q, Li GZ, Cao J, Herbert SJ, Hao L
duced resistance to fusarium wilt and elevated levels of free (2008) Antioxidant defenses of mycorrhizal fungus infection against SO2-
amino acids in melon seedlings. In this study, the increase induced oxidative stress in Avena nuda seedlings. Bulletin of Environmental
in several free amino acids through mycorrhizal symbiosis Contamination and Toxicology 53, 525-534
Li Y, Matsubara Y, Miyawaki C, Miyawaki Y, Liu Y, Koshikawa K (2008)
in strawberry was confirmed. From these findings, tolerance
Temperature stress tolerance and increase in antioxidative enzyme activities
to Fusarium wilt occurred through symbiosis with AMF in in mycorrhizal strawberry plants. Acta Horticulturae 774, 391-396
strawberry plants and the increase in free amino acid Lozano JM, Azcon R, Palma JM (1996) Superoxide dismutase activity in
content in mycorrhizal plants would be also associated with arbuscular mycorrhizal Lactuca sativa plants subjected to drought stress.
disease tolerance as a direct factor to Fof. On the other hand, New Phytologist 134, 327-333
Dehne and Schonbeck (1979) reported that the lignification Mark GL, Cassells AC (1996) Genotype-dependence in the interaction bet-
in the endodermis and the stele enhanced by AMF colo- ween Glomus fistulosum, Phytophthora fragariae and the wild strawberry
nization suppressed Fusarium wilt in tomato plants. Matsu- (Fragaria vesca). Plant and Soil 185, 233-239
bara et al. (2003) reported that pectic substances in aspara- Marschner H, Dell B (1994) Nutrient uptake in mycorrhizal symbiosis. Plant
and Soil 159, 89-102
gus roots were increased by AMF colonization, and they
Matsubara Y, Hasegawa N, Ohba N (2003) Relation between fiber and pectic
supposed that the resulting rigidity of root tissue suppressed substances in root tissue and tolerance to fusarium root rot in asparagus
plants infected with arbuscular mycorrhizal fungus. Journal of the Japanese
Society for Horticultural Science 72, 275-280
180
Matsubara Y, Hirano I, Sassa D, Koshikawa K (2004) Increased tolerance to
* Fusarium wilt in mycorrhizal strawberry plants raised by capillary watering
160 0.1% (w/v) 1.0% (w/v)
methods. Environmental Control in Biology 42, 185-191
Moghaddam B, Charles MT, Carisse O, Khanizadeh S (2006) Superoxide
Index of Fof propagation
140
dismutase responses of strawberry cultivars to infection by Mycosphaerrella
fragariae. Journal of Plant Physiology 163, 147-153
120
Mori T, Kitamura H (2003) Comparion of fruit quality and earliness of straw-
100 berry between inoculated and non-inoculated progenies for resistance to an-
thracnose. Journal of the Japanese Society for Horticultural Science 72, 64-
* 68 (In Japanese with English abstract)
80
* Niemi M, Vestberg M (1992) Inoculation of commercially grown strawberry
60 with VA mycorrhizal fungi. Plant and Soil 144, 133-142
Norman JR, Atkinson D, Hooker JE (1996) Arbuscular mycorrhizal fungal-
40 induced alteration to root architecture in strawberry and induced resistance to
the root pathogen Phytophthora fragariae. Plant and Soil 185, 191-198
20 Ohata K (1995) Cultivation of pathogenic fungi. In: Ohata K, Araki T, Kiso H,
Kudo A, Takahasshi H (Eds) Methods for Isolation, Cultivation, Inoculation
0 of Plant Pathogens, Japan Plant Protection Association, Tokyo, pp 1-11
e
Ci ine
ar BA
ne
Le e
ne
re e
Se d
rin
in
Okayama K (1993) Effects of rain shelter and capillary watering on disease

Th in
i
ac
ci
lli
on
in
A
uc
ly
tru
G
rg
tic
development of symptomless strawberry plants infected with Glomerella cin-

G
A
gulata (Colletotrichum gloeosporioides). Annals of the Phytopathological

sp
A
Society of Japan 59, 514-519

Fig. 6 Influence of several amino acids on propagation of Fof. Bars Ozgonen H, Erkilic A (2007) Growth enhancement and Phytophthora blight
represent standard errors. *Data significantly different following t-test, (Phytophthora capsici Leonian) control by arbuscular mycorrhizal fungal
P=0.05. inoculation in pepper. Crop Protection 26, 1682-1688
130
Phillips JM, Hayman DS (1970) Improved procedures for clearing roots and 163, 241-248
staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assess- Salzer P, Corbiere H, Boller T (1999) Hydrogwn peroxidase accumulation in
ment of infection. Transactions British Mycological Society 55, 158-163 Medicago truncatula roots colonized by the arbuscular mycorrhiza-forming
Pozo MJ, Cordier C, Gaudot ED, Barea JM, Aguilar CA (2002) Localized fungus Glomus intraradices. Planta 208, 319-325
versus systemic effect of arbuscular mycorrhizal fungi on defence responses Sood SG (2003) Chemotactic response of plant-growth-promoting bacteria
to Phytophthora infection in tomato plants. Journal of Experimental Botany towards roots of vesicular-arbuscular mycorrhizal tomato plants. Microbiol-
53, 525-534 ogy Ecology 45, 219-227
Robertson WJ, Boyle CD, Brown HL (1988) Endomycorrhizal status of cer- Starratt AN, Lazarovits G (1999) Herbicide-induced disease resistance and
tified strawberry nursery stock. Journal of the American Society for Horticul- associated increases in free amino acid levels in melon plants. Canadian
tural Science 113, 525-529 Journal of Plant Pathology 21, 33-36
Roe JH, Mary BM, Oesterking MJ, Charlotle MD (1948) The determination Sutton JC (1973) Development of vesicular-arbuscular mycorrhizae in crop
of diketo-L-gluconic acid, dehydro-L-ascorbic acid, and L-ascorbic acid in the plants. Canadian Journal of Botany 51, 2487-2493
same tissues by 2,4-dinitrophenyl hydrazine method. The Journal of Biologi- Tezuka N, Makino T (1991) Biological control of fusarium wilt of strawberry
cal Chemistry 174, 201-208 by nonpathogenic Fusarium oxysporum isolated from strawberry. Annals of
Roldan A, Vivancos PD, Hernandez JA, Carrasco L, Caravaca F (2008) the Phytopathological Society of Japan 57, 506-511 (In Japanese with Eng-
Superoxide dismutase and total peroxidase activities in relation to drought lish abstract)
recovery performance of mycorrhizal shrub seedlings grown in a amended Varma A, Schuepp H (1994) Infectivity and effectiveness of Glomus intraradi-
semiarid soil. Journal of Plant Physiology 165, 715-722 ces on micropropagated plants. Mycorrhiza 5, 29-37
Rolin D, Pfeffer PE, Douds DD, Farrell HM, Shachar Y (2001) Arbuscular Volpin H, Phillips DA, Okon Y, Kapulnik Y (1995) Suppression of an iso-
mycorrhizal symbiosis and phosphorus nutrition: Effects on amino acid pro- flavonoid phytoalexin defense response on mycorrhizal alfalfa roots. Plant
duction and turnover in leek. Symbiosis 30, 1-14 Physiology 108, 1449-1454
Sahoo MR, Dasgupta AM, Paresh A, Kole C, Jayant A, Bhat S, Mukherjee Williams SC, Vestberg M, Uosukainen M, Dodd JC, Jeffries P (1992) Ef-
A (2007) Antioxidative enzymes and isozymes analysis of taro genotypes and fects of fertilizers and arbuscular mycorrhizal fungi on the post-vitro growth
their implications in Phytophthora blight disease resistance. Mycopathologia of micropropagated strawberry. Agronomie 12, 851-857
131

Genomics Transgenics Molecular Breeding PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Genomics Transgenics Molecular Breeding PDF

Uploaded by

Copyright:

Available Formats

Global Science Books ®

Head Office and Editorial Office

GSB homepage: www.globalsciencebooks.info

Genes, Genomes and Genomics ©2011 Global Science Books

Dr. Amjad Masood Husaini

Dr. José A. Mercado

Printed in Japan on acid-free paper.

Amjad Masood Husaini José A. Mercado

Amjad Masood Husaini*, José A. Mercado**

E-mails: * dr.amjadhusaini@hotmail.com ** mercado@uma.es

Dr. Daniel James Sargent

Senior researcher in Fragaria molecular genetics and genomics

East Malling Research, East Malling, United Kingdom

IASMA Research and Innovation Centre, San Michele all’Adige, Italy

Prof. Narendra Tuteja

Senior Scientist, International Centre for Genetic Engineering & Biotechnology

Genes, Genomes and Genomics ©2011 Global Science Books

Review of Factors Affecting Organogenesis,

Corresponding author: * amjadhusaini@yahoo.com, dr.amjadhusaini@hotmail.com

Received: 20 April, 2010. Accepted: 6 May, 2011.

2. Growth of Agrobacterium culture Production of marker-free genetically modified

Table 3 Different ways of calculating transformation success in strawberry transformation.

transformation and regeneration of transgenic strawberry plants. Plant Cell 173

Genes, Genomes and Genomics ©2011 Global Science Books

Plant Architecture of Strawberry in Relation to Abiotic Stress,

Francesca Massetani • Ramesh Gangatharan • Davide Neri*

INTRODUCTION peratures (threshold ranging between 9-21°C; Hartmann

Received: 20 August, 2010. Accepted: 8 May, 2011.

24 position or rank of the flower within the inflorescence

Fig. 3 Schematic representation of the physiological mechanism of

cence. The features of the growth habit differ between

PLANT ARCHITECTURE IN RELATION TO

Photoperiod is a primary environmental factor controlling Temperature

photoperiod (Okimura and Igarashi 1997). The fluctuating Altitude

(Palha et al. 2010).

The nutrient level and type of substrate strongly influence

Table 2 Number of branch crowns and flowers of strawberry plants cul-

Genes, Genomes and Genomics ©2011 Global Science Books

New Insights in the Study of Strawberry Fungal Pathogens

Keywords: biocontrol, elicitor, molecular tools, proteomics, real-time PCR

INTRODUCTION modern cultivated strawberry F. x ananassa Duch. In the

Received: 24 March, 2010. Accepted: 21 August, 2010.

Table 1 Strawberry fungal pathogens causing leaf diseases.

Table 2 Strawberry fungal pathogens causing fruit diseases.

Table 3 Strawberry fungal pathogens causing crown and root diseases.

Genes, Genomes and Genomics ©2011 Global Science Books

Strawberry Fruit Softening: Role of Cell Wall Disassembly

INTRODUCTION Texture is a key quality character for fleshy fruits.

Received: 27 April, 2010. Accepted: 10 August, 2010.

Polygalacturonase earlier stages of development than F. u ananassa, sug-

expressed in ripening strawberry fruit. Plant Physiology 121, 1273-1279 1310-1315

Genes, Genomes and Genomics ©2011 Global Science Books

Could an Understanding of the

Corresponding author: * amodeo@bg.fcen.uba.ar

Keywords: Fragaria x ananassa, water channel, turgor, ripening

FRUIT RIPENING AND SOFTENING ........................................................................................................................................................ 1

FRUIT RIPENING AND SOFTENING Strawberry fruit ripening

Received: 10 February, 2010. Accepted: 10 August, 2010.

been detected as abscisic acid responsive proteins (Pilati et ACKNOWLEDGEMENTS

Genes, Genomes and Genomics ©2011 Global Science Books

Genetic and Environmental Regulation

Timo Hytönen* • Paula Elomaa

Department of Agricultural Sciences, P.O.Box 27, 00014 University of Helsinki, Finland