Journal of Integrative Agriculture

Advanced Online Publication: 2013 Doi: 10.1016/S2095-3119(13)60384-6

Expression of Chicken Toll Like Receptors and Signal Adaptors in Spleen and

Cecum of Young Chickens Infected with Eimeria tenella1

ZHOU Zuo-yong1, HU Shi-jun1, WANG Zhi-ying1, GUO Zhi-li2, QIN Bo2 and Nie Kui2

1
Department of Veterinary Medicine, Rongchang Campus of Southwest University, 160 Xueyuan Road,
Rongchang County, Chongqing 402460, P.R.China
2
College of Animal Science and Technology, Southwest University, Chongqing 400715, P.R.China

Abstract

Toll-like receptors (TLRs) are a group of highly conserved molecules which initiate the innate immune response
to pathogens by recognizing structural motifs of microbes. Understanding the changes in chicken toll-like
receptors (ChTLRs) and signal adaptors expression that occur with Eimeria tenella infection will help to elucidate
the molecular basis of immune control of coccidiosis caused by Eimeria. The present study detected the dynamic
changes in the expression of ChTLRs and associated signal adaptors in the spleen and cecum of E.
tenella-infected chickens during the early stage of infection. The results showed that the expression peak for
ChTLRs, MyD88 and TRIF occurred at 12 h post-infection (hpi), ChTLR3, ChTLR15 and MyD88 mRNA
expression in the spleen of E. tenella infected chickens were significantly higher (P<0.05) than that of negative
control chickens, and there were similar tendencies of these molecules expression in the cecum and spleen of E.
tenella infected chickens. The expression of MyD88 was upregulated at four time points in the cecum of E. tenella
infected chickens. The results of this study indicate that ChTLR3，ChTLR15 and MyD88 play a role in young
chickens infected with E. tenella.

Key words: Eimeria tenella, signal adaptors, Toll-like receptors, spleen and cecum, chicken

INTRODUCTION

Eimeria tenella is one of the most important apicomplexan parasites, which causes coccidiosis in chickens.
Avian coccidiosis is considered to be a major problem for the poultry industry. Presently, the main means of
chicken coccidiosis prevention and therapy is to treat the infected chickens with anti-coccidiosis drug. It is urgent

ZHOU Zuo-yong, Tel: +86-23-46751100, E-mail: zzyxnny@163.com; Correspondence NIE Kui, Tel: +86-23-68251196, Fax:
+86-23-68251196, E-mail: niekui@126.com
to find available methods to control this disease for the emergence of the drug resistant pathogens and the problem
of chemical medicines residue (Dalloul and Lillehoj 2005; Williams 2002). Inoculation with anticoccidial vaccine
is a practical alternative to drugs for coccidiosis control (Del et al. 2011). Although this method is widely used
each year, little is known about the host innate immune response mechanisms against E. tenella. Innate immunity
is the first line of defense against invading pathogens (Medzhitov 2001). During the early stages of infection, the
host innate immune system can rapidly detect and respond to protozoan parasite infection via innate immune
receptors (Gazzinelli and Denkers 2006). A recent report has demonstrated that broiler breeders with an efficient
innate immune response are more resistant to E. tenella (Swaggerty et al. 2011).
The toll-like receptor (TLR) family is one of the most important innate immune receptors in vertebrates,
which is responsible for recognizing conserved components of pathogens, typically called pathogen-associated
molecular patterns (PAMPs). The recognization of PAMPs, will trigger TLR signaling, including
MyD88-dependent and TRIF-dependent pathways, and induce expression of cytokines such as interleukin (IL)-12,
interferons (IFNs) and tumor necrosis factor (TNF) (Kawai and Akira 2007), which are essential effector
molecules of innate and adaptive immunity against pathogenic microorganisms (Hong et al. 2006). 10 types of
chicken toll like receptor (ChTLR) have been identified, and five of them (ChTLR2a, 2b, 4, 5 and 7) have clear
orthologs to those found in mice and humans. ChTLR15 appears to be unique to the avian species (Brownlie and
Allan 2011; Temperley et al. 2008). However, the previous studies have focused on the adaptive immune
responses to Eimeria, only a few reports mentioned the relationship of innate immunity and Eimeria infection
(Sumners et al. 2011; Zhang et al. 2012). Cecum and spleen tissues of chicken are two immunologically important
sites (Abasht et al. 2008), and were chosen for the study of chicken innate immune response to Salmonella
enterica (Abasht et al. 2008; Li et al. 2010). The aims of this study were to evaluate the effect of E. tenella
infection on the mRNA expression levels of ChTLRs, MyD88 and TRIF in cecum and splenic tissues of young
chickens and to determine which ChTLRs and signal adaptors involved in innate immune response to E. tenella
infection.

MATERIALS AND METHODS

Animals, infection schemes, and sampling

50 one-day-old male Luoman chickens were obtained from Sichuan shendile ecological food Co., Ltd., and were
maintained under clean conditions in flame sterilized wire cages. The chickens were given cold boiled water and
feeds without any anti-coccidial drugs. 13 d later, 36 chickens with the similar body weight were selected and
divided equally into two groups (an E. tenella infected group and a negative control group). At 15 d of age,
experimental chickens of infected group were orally inoculated with 50000 E. tenella sporulated oocysts (500 µL),
and chickens of negative control group were given 500 µL physiological saline. Three chicken of each group were
randomly chosen and sacrificed at 3, 12, 24 and 72 h post infection (hpi). The spleen and cecum were collected
and put in liquid nitrogen immediately.

RNA isolation and reverse transcription

The spleen and cecum tissues were ground into fine powder in liquid nitrogen with a precooled mortar and pestle,
and the RNA was extracted with an RNAisoTM Plus (TaKaRa Biotechnology, Dalian, China) following
manufacturer’s instructions. Genomic DNA contamination was removed using Recombinant DNase I (RNase-free)
(TaKaRa Biotechnology, Dalian, China). Total RNA was stored at -80℃ until cDNA synthesis. Reverse
transcription (RT) were performed with the SYBR® PrimeScript RT-PCT Kit II (TaKaRa Biotechnology, Dalian,
China), according to the manufacturer’s instructions. Briefly, 0.5 mg of total RNA was combined with 2.0 μL
5×PrimeScript® Buffer, 0.5 μL PrimeScript® RT Enzyme MixⅠ, 0.5 μL of Oligo dT Primer (50 μmol L-1) and 0.5
μL Random 6 mers primer (100 μmol L-1), added RNase-free water to total volume of 10 μL. The mixture was
incubated at 37℃ for 15 min, and the reaction was stopped by heating at 85℃ for 5 s.

Real-time quantitative polymerase chain reaction

The primers for chicken TLRs, signal adaptors and the housekeeping gene β-actin were designed with the
software Primer Premier 5.0 (Primer, Canada) and Oligo 6.0 (MBI, Cascade, CO) (Table 1). Real-time
quantitative PCR was performed using the SYBR® PrimeScript RT-PCT Kit II (TaKaRa Biotechnology, Dalian,
China) following the manufacturer’s instruction. The PCR conditions consisted of an initial denaturation at 95℃
for 30 s, followed by 40 PCR cycles: 95℃ for 5 s, 60℃ for 30 s with Bio-Rad Mini Opticon Real Time PCR
△△Ct
(Bio-Rad Laboratories, Inc., USA). Expression of target genes were analyzed by the 2- method with the CFX
Manager™ software (Bio-Rad Laboratories, Inc. USA), and β-actin was used as endogenous housekeeping gene.

Statistical analysis

Data were analyzed using SPSS 11.5 software (SPSS Inc., Champaign, IL). The differences between infected
group and negative control group were evaluated by One-way ANOVA and Tukey honestly significant differences
(HSD). Significance was accepted at P<0.05, and results were reported as means±standard deviation.

Results

Dynamic changes of ChTLRs, MyD88 and TRIF expression in the spleen of chickens
infected with E. tenella

Analysis of ChTLRs, MyD88 and TRIF mRNA expression in spleen of chickens is presented in Figs. 1 and 2. The
expression peak for ChTLRs, MyD88 and TRIF occurred at 12 hpi except for ChTLR1 and ChTLR4. ChTLR3,
ChTLR15 and MyD88 mRNA expression in the spleen of E. tenella infected chickens were significantly higher
(P<0.05) than that of negative control chickens. At 3 hpi, ChTLRs and TRIF mRNA expression were decreased
compared with control chickens, only a little upregulation of MyD88 mRNA expression was found in E. tenella
infected chickens. At 24 hpi, the expression of ChTLRs (with ChTLR3 exception), MyD88 and TRIF were
downregulated in E. tenella infected chickens. The expression of ChTLR7, MyD88 and TRIF were upregulated in
the spleen of chickens infected with E. tenella at 72 hpi, and with no significant difference.
Dynamic changes of ChTLRs, MyD88 and TRIF expression in the cecum of chickens
infected with E. tenella.

The mRNA expression of ChTLRs, MyD88 and TRIF in the cecum of chickens is presented in Figs. 1 and 2. The
ChTLRs (except ChTLR3) and signal adaptors (except MyD88) mRNA expression were decreased at 3 hpi. At 12
hpi, ChTLRs, MyD88 and TRIF mRNA expression were up-regulated, and the expression of ChTLR3 (3.85 fold
increase), ChTLR15 (2.35 fold increase) and MyD88 (10.45 fold increase) in the cecum of E. tenella infected
chickens were significantly higher (P<0.05) than that of negative control chickens. However, non-significant
increases of MyD88 (both at 24 and 72 hpi) and TRIF (at 24 hpi) were found in the cecum of E. tenella infected
chickens at 24 and 72 hpi.

DISCUSSION

TLRs have been studied extensively in mammals, especially in mice and humans, demonstrating the necessity of
these receptors in reduction and clearance of pathogens (Albiger et al. 2007). However, there is limited
information available in chickens infected with E. tenella. We provide the dynamic changes of ChTLRs and signal
adaptors mRNA expression in the spleen and cecum of E. tenella infected chickens at early stage (at 3, 12, 24, and
72 hpi), and found several ChTLRs and MyD88 appear to be involved in the host response to E. tenella infection.
ChTLR1 and ChTLR2 are mainly involved in recognition of bacterial pathogens (Brownlie and Allan 2011;
Higuchi et al. 2008). In the current study, there were only a little upregulation of ChTLR2 expression in the spleen
and cecum of E. tenella infected chickens at 12 hpi, and upregulation of ChTLR1 expression in the cecum at 12
hpi and 24 hpi, which were different from the results of ChTLR1 and ChTLR2 expression in these two tissues of
chickens infected with Salmonella (Abasht et al. 2008; Higgs et al. 2006; MacKinnon et al. 2009), suggested that
ChTLR1 and ChTLR2 may not be involved in response to E. tenella infection at early stage.
TLR4 is important for the recognition of LPS from Gram-negative bacteria, envelope proteins from viruses,
Glycoinositolphospholipids (GIPLs) and glycosylphosphatidylinositol anchors (GPI-anchors) from protozoan
parasites (Kropf et al. 2004; Kumar et al. 2009). Our study revealed that there were no obvious changes of
ChTLR4 mRNA expression in E. tenella infected chickens. The similar results were found in previous studies,
which had demonstrated that there were no upregulation of ChTLR4 expression in cecum of chicken following
Salmonella infection (Abasht et al. 2008; Higgs et al. 2006; Li et al. 2010) and in intestines (duodenum and
jejunum) of chicken following E. praecox infection (with 50000 E. praecox oocysts each ) (Sumners et al. 2011).
TLR4 is thought to be involved in a biphasic regulation of the expression of TLR2, initially upregulating it
followed by a self-inhibitory effect. It has been shown that mouse TLR2 upregulation in response to Salmonella
infection is reduced in C3H/HeJ mice, which carry mutated TLR4 (Totemeyer et al. 2003), supporting a
regulatory role for TLR2 and TLR4. Thus, the observed upregulation of TLR2 may be a direct consequence of
initial TLR4 activation followed by self downregulation (Higgs et al. 2006; Totemeyer et al. 2003).
Chicken TLR5 recognizes and responds to S. enteritidis flagellin (Keestra et al. 2008). Zhang et al. (2012)
observed significantly higher expression of ChTLR5 in cecum intraepithelial lymphocytes of 3-wk-old chickens
than in 1-d-old chickens infected with E. tenella, and speculated that ChTLR5 may be induced by the parasite
actin-myosin motor in E. tenella invade host target cells, and may also be induced by the flagellin of normal
intestinal flor (such as flagellated bacillus) (Zhang et al. 2012). In our study, although a little upregulation of
ChTLR5 expression in the spleen and cecum of E. tenella infected chickens were observed at 12 hpi, the
expression of ChTLR5 were decreased at 24 and 72 hpi, and since there were no significant difference, we
presume that ChTLR5 may not be involved in response to E. tenella infection.
ChTLR15 is a unique TLR in avian species and its precise function is currently unknown. In this study, we
found that ChTLR15 expression was significantly upregulated both in cecum and spleen at 12 hpi, which was
consistent with the previous studies of ChTLR15 expression in the cecum of chickens following infection of
Salmonella (Higgs et al. 2006; MacKinnon et al. 2009; Shaughnessy et al. 2009) and Eimeria (Sumners et al.
2011; Zhang et al. 2012), suggested that ChTLR15 may play an essential role in response to E. tenella infection.
In mammals, TLR3, TLR7, TLR8 and TLR9 are concerned with pathogenic nucleic acid recognization, while
in chicken, only TLR3 and TLR7 were identified in genome (Brownlie and Allan 2011; Temperley et al. 2008). A
significant upregulation of ChTLR3 were found in the cecum and spleen of E. tenella infected chickens in the
present study, which is in accordance with Sumners et al. (2011) who noted that a significant increase of ChTLR3
expression in duodenal of E. praecox infected chicken on days 4 and 6 post-infection (Sumners et al. 2011), and
suggested that ChTLR3 plays an important role in innate immune response to E. tenella infection. In addition,
increases of ChTLR7 and ChTLR21 were found in spleen and cecum at 12 hpi, and with no significance, which
indicated that these two receptors were not greatly affected by E. tenella infection.
MyD88 and TRIF are important adaptor molecules which mediate MyD88-dependent and TRIF-dependent
signaling of TLRs respectively (O'Neill et al. 2003). We found MyD88 expression was upregulated significantly
in the spleen and cecum of E. tenella infected chickens at 12 hpi, while there were not significant changes of TRIF
expression. Similarly, the increase of MyD88 expression were found in intestinal intraepithelial lymphocytes
(IELs) of E. maxima infected chickens at 2 and 3 d post inoculation (Hong et al. 2006), in chicken monocytes
following a invasion of Lactobacillus acidophilus for 12 h (Brisbin et al. 2008) and in the spleen of the
Salmonella serovar Pullorum infected chickens on day 3 post-infection (Li et al. 2010). The significant
upregulation of MyD88 suggested that this adaptor molecule plays an important role in TLR signaling pathway
and induces innate immune response to E. tenella infection. It was reported that, the expression of ChTLR15 was
significantly upregulated after induction with B- and C-type CpGoligonucleotides (ODN), and the induction
through ChTLR15 in response to CpG-ODN operates via the MyD88-dependent pathway in chicken macrophages
(Ciraci et al. 2011). Similar to the report of Ciraci et al. (2011), the upregulation of both ChTLR15 and MyD88
expression in the cecum and spleen of E. tenella infected chickens suggested that the response of ChTLR15 to E.
tenella may operates in a MyD88-dependent manner. As an essential adaptor, TRIF mediates TRIF-dependent
signaling of TLR3 and TLR4 (O'Neill et al. 2003). Although the expression of ChTLR3 was observed increased
significantly in spleen and cecum of E. tenella infected chickens, there wasn’t obvious changes of TRIF
expression, suggested that TRIF is not involved in TLRs signal transduction triggered by E. tenella.
Another interesting result of this study was the similar tendency of TLR3, TLR15 and MyD88 expression
levels in the cecum and spleen of E. tenella infected chickens, which concurs with the report of TLRs expression
in cecum and spleen of advanced intercross line chicks infected with Salmonella enterica serovar Enteritidis
(Abasht et al. 2008), suggested that the expression of innate immune related molecules may not be site restricted
to E. tenella infection.
Chicken immune system can inhibit E. tenella development at three stages. The first is when the sporozoite
searches for a site of penetration and binds to the epithelium, the second is when the sporozoite is in the villus
epithelium amongst intra-epithelial leucocytes, and the third is during its passage through the lamina propria to the
crypt epithelium (Jeurissen et al. 1996). Although sporozoites could penetrate cells at 1 h post inoculation
(Augustine and Danforth 1986), non-significant changes of ChTLRs expression were found at 3 hpi in the
experiment, this may attribute to the lack of sufficient sporozoites for cecum stimulation. While at 12 hpi, the
expression of ChTLRs (with ChTLR1 and ChTLR4 exception in spleen) were upregulated, which may owe to the
large number of sporozoites invade in cells of cecum. To our surprise, the expression of ChTLRs (except ChTLR7)
were downregulated at 72 hpi, which may at least in part be explained by the stimulation of too many merozoites,
and this findings are supported by the results of Sumners et al. (2011) who noted that higher E. praecox infection
load result in downregulated expression of ChTLRs (Sumners et al. 2011). It is also noteworthy to mention that
the expression of MyD88 were upregulated at four time points in cecum of infected chickens in the present study,
and this phenomenon may attribute to the central role of MyD88 in signaling triggered by most TLRs as well as
by IL-1 and IL-18 (Hong et al. 2006).
In conclusion, our study demonstrated that ChTLR3, ChTLR15 and MyD88 were significantly upregulated
during E. tenella infection, and there were similar tendences of these molecules expression in the cecum and
spleen of infected chickens. The results of this study indicate that ChTLR3，ChTLR15 and MyD88 play a role in
young chickens infected with E. tenella.

Acknowledgements

This work was supported by the Fundamental Research Funds for the Central Universities (XDJK2010C099),
the Natural Science Fundation Project of China SWU (QNRC200804) and the Scientific Research Fund of
Veterinary Medicine Department of Southwest University.
Table Real-time PCR primers and GenBank accession numbers of chicken TLRs , signal adaptors and

cytokines, β-actin

Target Accession Length of Annealing

Primer sequences (5’-3’)2)
gene1) number product (bp) temperature (℃)
SF：ACCCGTTCAAGTGTTCGTG
ChTLR1* AB109401 120 60
SR：TTCCGCTCAAGTCTTCTGG
SF：GGTGTTCCTGTTCATCCTCATC
ChTLR2# NM_204278 169 60
SR： GTTGGAGTCGTTCTCACTGTAGG
SF：GCTATTGAGCAAAGTCGAGA
ChTLR3 NM_001011691 203 60
SR：ACAGGGGGCACTTTACTATT
SF：ATCTTTCAAGGTGCCACATC
ChTLR4 NM_001030693 167 60
SR： GGATATGCTTGTTTCCACCA
SF：ACTCCCTTCCTTCCCACATCT
ChTLR5 AJ626848 118 60
SR： GTTTGCGAGCCAGTTTCTCTCT
SF：TCTGGACTTCTCTAACAACA
ChTLR7 NM_001011688 187 60
SR：AATCTCATTCTCATTCATCATCA
SF：GGCTGTGGTATGTGAGAATG
ChTLR15 NM_001037835 113 60
SR： ATCGTGCTCGCTGTATGA
SF：AGTTGTGTCCTGTGCTGAGAGAG
ChTLR21 NM_001030558 130 60
SR：AGCAGGTTGTGTTCCACTGTC
SF：CTGGCATCTTCTGAGTAGT
MyD88 NM_001030962 76 60
SR：TTCCTTATAGTTCTGGCTTCT
SF：AGCCTGATGGAGAGAGACAGAG
TRIF EF025853 139 64
SR：GATAGACGAGAGGAACTGACCTG
SF: GCCAACAGAGAGAAGATGACAC
β-actin L08165 140 60
SR: GTAACACCATCACCAGAGTCCA
1) *, primers used for ChTLR1La and ChTLR1Lb amplification. #, primers used for ChTLR2a and ChTLR2b amplification.
2) SF, special forward primer; SR, special reverse primer.
 4.5 (A)
*
Normalized Fold expression
4
3.5
3
2.5 *
2
1.5
1
0.5
0
ChTLR1 ChTLR2 ChTLR3 ChTLR4 ChTLR5 ChTLR7 ChTLR15 ChTLR21
6 (B)
Normalized Fold expression

5 *
4
3 *
2
1
0
-1
ChTLR1 ChTLR2 ChTLR3 ChTLR4 ChTLR5 ChTLR7 ChTLR15 ChTLR21
6
3h 12h 24h 72h
5
4
Fig. 1 Dynamic changes of ChTLRs expression in the spleen (A) and cecum (B) of chickens infected with
3
Eimeria tenella. Infected chickens were orally inoculated with 50, 000 E. tenella sporulated oocysts. The spleens
2
and cecum were collected at 3, 12, 24, and 72 hpi. ChTLRs expression were analyzed by real-time quantitative
1 polymerase chain reaction. Expression of target genes were analyzed by the 2-
△△Ct
method with the CFX
0 Manager™ software, and β-actin was used as endogenous housekeeping gene. Chickens without E. tenella
-1 infection were used as the negative control. Bars with asterisks denote a significant (P<0.05) difference from
ChTLR1 ChTLR2 ChTLR3 ChTLR4 ChTLR5 ChTLR7 ChTLR15 ChTLR21
chickens of negative control group.

16
3h 12h
14 *
24h 72h
Normalized Fold expression

12
10
8
6
4 *
2
0
MyD88 TRIF MyD88 TRIF

spleen cecum
Fig. 2 Dynamic changes of MyD88 and TRIF expression in the spleen and cecum of chickens infected with E.
tenella. Infected chickens were orally inoculated with 50000 E. tenella sporulated oocysts. The spleens and
cecums were collected at 3, 12, 24 and 72 hpi. MyD88 and TRIF expression were analyzed by real-time
 △△Ct
quantitative polymerase chain reaction. Expression of target genes were analyzed by the 2- method with the
CFX Manager™ software, and β-actin was used as endogenous housekeeping gene. Chickens without E. tenella
infection were used as the negative control. Bars with asterisks denote a significant (P<0.05) difference from
chickens of negative control group.

References

Abasht B, Kaiser M G, Lamont S J. 2008. Toll-like receptor gene expression in cecum and spleen of advanced
intercross line chicks infected with Salmonella enterica serovar Enteritidis. Veterinary Immunology and
Immunopathology, 123, 314-323.
Albiger B, Dahlberg S, Henriques-Normark B, Normark S. 2007. Role of the innate immune system in host
defence against bacterial infections: focus on the Toll-like receptors. Journal of Internal Medicine, 261,
511-528.
Augustine P C, Danforth H D. 1986. A study of the dynamics of the invasion of immunized birds by Eimeria
sporozoites. Avian Disease, 30, 347-351.
Brisbin J T, Zhou H, Gong J, Sabour P, Akbari M R, Haghighi H R, Yu H, Clarke A, Sarson A J, Sharif S. 2008.
Gene expression profiling of chicken lymphoid cells after treatment with Lactobacillus acidophilus cellular
components. Developmental and Comparative Immunology, 32, 563-574.
Brownlie R, Allan B. 2011. Avian toll-like receptors. Cell and Tissue Research 343, 121-130.
Ciraci C, Lamont S J. 2011. Avian-specific TLRs and downstream effector responses to CpG-induction in chicken
macrophages. Developmental and Comparative Immunology, 35, 392-398.
Dalloul R A, Lillehoj H S. 2005. Recent advances in immunomodulation and vaccination strategies against
coccidiosis. Avian Disease, 49, 1-8.
Del C E, Gallego M, Lee S H, Lillehoj H S, Quilez J, Lillehoj E P, Sanchez-Acedo C. 2011. Induction of
protective immunity against Eimeria tenella infection using antigen-loaded dendritic cells (DC) and
DC-derived exosomes. Vaccine, 29, 3818-3825.
Gazzinelli RT, Denkers E Y. 2006. Protozoan encounters with Toll-like receptor signalling pathways:
implications for host parasitism. Nature Reviews Immunology, 6, 895-906.
Higgs R, Cormican P, Cahalane S, Allan B, Lloyd A T, Meade K, James T, Lynn D J, Babiuk, L A, O'farrelly C.
2006. Induction of a novel chicken Toll-like receptor following Salmonella enterica serovar Typhimurium
infection. Infection and Immunity, 74, 1692-1698.
Higuchi M, Matsuo A, Shingai M, Shida K, Ishii A, Funami K, Suzuki Y, Oshiumi H, Matsumoto M, Seya T.
2008. Combinational recognition of bacterial lipoproteins and peptidoglycan by chicken Toll-like receptor 2
subfamily. Developmental and Comparative Immunology, 32, 147-155.
Hong Y H, Lillehoj H S, Lillehoj E P, Lee S H. 2006. Changes in immune-related gene expression and intestinal
lymphocyte subpopulations following Eimeria maxima infection of chickens. Veterinary Immunology and
Immunopathology, 114, 259-272.
Jeurissen S H, Janse E M, Vermeulen A N, Vervelde L. 1996. Eimeria tenella infections in chickens: aspects of
host-parasite: interaction. Veterinary Immunology and Immunopathology, 54, 231-238.
Kawai T, Akira S. 2007. TLR signaling. Seminars in Immunology, 19, 24-32.
Keestra A M, de Zoete M R, van Aubel R A, van Putten J P. 2008. Functional characterization of chicken TLR5
reveals species-specific recognition of flagellin. Molecular Immunology, 45, 1298-1307.
Kropf P, Freudenberg M A, Modolell M, Price H P, Herath S, Antoniazi S, Galanos C, Smith D F, Muller I. 2004.
Toll-like receptor 4 contributes to efficient control of infection with the protozoan parasite Leishmania major.
Infection and Immunity, 72, 1920-1928.
Kumar H, Kawai T, Akira S. 2009. Toll-like receptors and innate immunity. Biochemical and Biophysical
Research Communications, 388, 621-625.
Li P, Xia P, Wen J, Zheng M, Chen J, Zhao J, Jiang R, Liu R, Zhao G. 2010. Up-regulation of the
MyD88-dependent pathway of TLR signaling in spleen and caecum of young chickens infected with
Salmonella serovar Pullorum. Veterinary Microbiology, 143, 346-351.
MacKinnon K M, He H, Nerren J R, Swaggerty C L, Genovese K J, Kogut M H. 2009. Expression profile of
toll-like receptors within the gastrointestinal tract of 2-day-old Salmonella enteriditis-infected broiler chickens.
Veterinary Microbiology, 137, 313-319.
Medzhitov R. 2001. Toll-like receptors and innate immunity. Nature Reviews Immunology, 1, 135-145.
O'Neill L A, Fitzgerald K A, Bowie A G. 2003. The Toll-IL-1 receptor adaptor family grows to five members.
Trends in Immunology, 24, 286-290.
Shaughnessy R G, Meade K G, Cahalane S, Allan B, Reiman C, Callanan J J, O'Farrelly C. 2009. Innate immune
gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.
Veterinary Immunology and Immunopathology, 132, 191-198.
Sumners L H, Miska K B, Jenkins M C, Fetterer R H, Cox C M, Kim S, Dalloul R A. 2011. Expression of
Toll-like receptors and antimicrobial peptides during Eimeria praecox infection in chickens. Experimental
Parasitology, 127, 714-718.
Swaggerty C L, Genovese K J, He H, Duke S E, Pevzner I Y, Kogut M H. 2011. Broiler breeders with an efficient
innate immune response are more resistant to Eimeria tenella. Poultry Science, 90, 1014-1019.
Temperley N D, Berlin S, Paton I R, Griffin D K, Burt D W. 2008. Evolution of the chicken Toll-like receptor
gene family: a story of gene gain and gene loss. BMC Genomics, 9, 62.
Totemeyer S, Foster N, Kaiser P, Maskell D J, Bryant C E. 2003. Toll-like receptor expression in C3H/HeN and
C3H/HeJ mice during Salmonella enterica serovar Typhimurium infection. Infection and Immunity, 71,
6653-6657.
Williams R B. 2002. Anticoccidial vaccines for broiler chickens: pathways to success. Avian Pathology, 31,
317-353.
Zhang L, Liu R, Ma L, Wang Y, Pan B, Cai J, Wang M. 2012. Eimeria tenella: expression profiling of toll-like
receptors and associated cytokines in the cecum of infected day-old and three-week old SPF chickens.
Experimental Parasitology, 130, 442-448.