J Forensic Sci, September 2015, Vol. 60, No.

5
doi: 10.1111/1556-4029.12828
PAPER Available online at: onlinelibrary.wiley.com

PATHOLOGY/BIOLOGY

Kathleen A. Hauther,1 B.A.; Kelly L. Cobaugh,2 M.S.; Lee Meadows Jantz,1 Ph.D.;
Tim E. Sparer,3 Ph.D.; and Jennifer M. DeBruyn,2 Ph.D.

Estimating Time Since Death from

Postmortem Human Gut Microbial
Communities*

ABSTRACT: Postmortem succession of human-associated microbial communities (“human microbiome”) has been suggested as a possible
method for estimating postmortem interval (PMI) for forensic analyses. Here we evaluate human gut bacterial populations to determine quantifi-
able, time-dependent changes postmortem. Gut microflora were repeatedly sampled from the proximal large intestine of 12 deceased human
individuals as they decayed under environmental conditions. Three intestinal bacterial genera were quantified by quantitative PCR (qPCR) using
group-specific primers targeting 16S rRNA genes. Bacteroides and Lactobacillus relative abundances declined exponentially with increasing
PMI at rates of Nt = 0.977e
0.0144t (r2 = 0.537, p < 0.001) and Nt = 0.019e
0.0087t (r2 = 0.396, p < 0.001), respectively, where Nt is relative
abundance at time (t) in cumulative degree hours. Bifidobacterium relative abundances did not change significantly: Nt = 0.003e
0.002t
(r2 = 0.033, p = 0.284). Therefore, Bacteroides and Lactobacillus abundances could be used as quantitative indicators of PMI.

KEYWORDS: forensic science, forensic anthropology, postmortem interval, human microbiome, gut bacteria, microbial ecology, quantitative
polymerase chain reaction

In forensics and law enforcement accurate estimates of time
since death (postmortem interval [PMI]) are critical. Empirical
methods of PMI assessment are increasingly required to provide
more accurate estimates for use in a medicolegal context (1).
Historically, visual assessment of the stages of decomposition
comprised the primary method to estimate PMI. However,
because decay is a continuous and dynamic process, categoriza-
tion is not always consistent between evaluators. A variety of
empirical methods to estimate PMI have thus been developed.
Over the short term, in the immediate hours postmortem, mortis
triad (algor, liver, and rigor mortis) and changes in vitreous
humor and soft tissue components can be used to estimate PMI,
but there exists considerable error in these methods (2). For
intermediate intervals (days to weeks), forensic entomology
offers estimations of the minimum PMI based on insect coloni-
zation but is limited to cases where insects can access the human
remains, and may be inaccurate if there are delays in initial
1
Department of Anthropology, 250 South Stadium Hall, University of
Tennessee, Knoxville, TN, USA 37996.
2
Biosystems Engineering & Soil Science, 2506 EJ Chapman Drive,
University of Tennessee, Knoxville, TN, USA 37996.
3
Department of Microbiology, M409 Walters Life Sciences, University of
Tennessee, Knoxville, TN, USA 37996.
*Funding provided by the William M. Bass Endowment, the University of
Tennessee Undergraduate Summer Internship program, and the Microbiology
Across Campuses Research and Educational Venture.
Presented at the 64th Annual Meeting of the American Academy of Foren-
sic Sciences, February 20-25, 2012, in Atlanta, GA; and at the Mountain,
Swamp, and Beach (MS & B) Regional Forensic Anthropology Meeting,
October 1, 2011, in Clemson, SC.
Received 7 Jan. 2014; and in revised form 1 Sept. 2014; accepted 2 Sept.
2014.
oviposition (3). Fluid analysis, specifically volatile fatty acids
(VFAs) surrounding and under a decomposing body, is a viable
approach (4), along with chemical or biological characterization
of the soils beneath (5,6), although is not useful if the body has
been moved from the original site of decomposition. It has been
proposed that the inorganic constituents of bone could indicate
longer term PMI estimates (weeks to months) (7,8). All these
methods can provide an estimate of PMI or minimum PMI but
suffer from high variability. For investigators, using a combina-
tion of approaches improves PMI estimation (e.g., 9), and
environmental parameters (moisture, temperature, and partial
pressure of oxygen) can sometimes be integrated into models to
account for local variability within a climatic region (10). The
more parameters that can be included in the calculation, the
more reliable the PMI estimation.
The human microbiome, the diverse microbial communities
residing in or on the human body, plays a key role in decompo-
sition of soft tissues postmortem. The majority of our commen-
sal microbes reside in the gut, which has been well characterized
through efforts such as the Human Microbiome Project (11).
Human large intestine microbial communities are dominated by
Bacteroidetes (e.g., Bacteroides spp.) and Firmicutes (e.g., Lac-
tobacillus spp.), with smaller populations of Proteobacteria
(e.g., Escherichia spp.) and Actinobacteria (e.g., Bifidobacterium
spp.). Despite variation in the relative proportions of these spe-
cies between individuals due to diet and lifestyle (12,13), the
human gut microbiome composition is consistent enough to be
distinct from other microbial communities (e.g., those from soil
and water) (14). Succession in the human gut microbiome has
been examined in living subjects and revealed these communities
are relatively stable over time (11,15); however, there has been no

1234 © 2015 American Academy of Forensic Sciences

 HAUTHER ET AL. . POSTMORTEM HUMAN GUT MICROBIOME 1235

examination (to our knowledge) of these human microbial com-
munities postmortem. After death, human cells undergo autoly-
sis, releasing new substrates for commensal microbes. The dense
microbial communities in the gut ferment the cellular byprod-
ucts, causing the characteristic bloating. This led us to postulate
that changes in decomposition products and available substrates
would select for different populations of microbes, resulting in a
succession of microbiome populations.
The postmortem succession of insects has been well docu-
mented and is a key tool in minimum PMI estimation.
Evidence is emerging microbial communities, too, undergo
successional changes postmortem and could be used as indica-
tors of PMI (16–19). For example, in decomposing mice,
distinct changes in gut populations could be observed in as
little as several hours postmortem (16), and population shifts
are repeatable (19). Similarly, Pechal et al. (20) observed
shifts in the microbial communities on decomposing pig
carcasses’ skin and mouth cavities. There is also evidence
microbial communities in soils below decaying humans
undergo successional shifts (18).
While promising, these studies have been limited to animal
models (16,17,19,20) and/or limited sample sizes and temporal
resolution (18,21), so it remains difficult to evaluate the applica-
bility of these changes as a forensic tool. In theory, because
these microbes are an intrinsic part of the body, the human
microbiome could offer important advantages as a forensic tool:
There is no delay in colonization as with insects, and the gut
communities should not be greatly affected by changes in loca-
tion (e.g., if a body was moved), or when decay occurs
indoors.
The objective of this study was to quantify changes in gut
microbial populations postmortem and evaluate these as potential
markers for PMI estimation. We tested the specific hypothesis
that three common genera of gut microflora (Bacteroides, Lacto-
bacillus, and Bifidobacterium) would decline in relative
abundance as other more fastidious populations proliferate. To
test our hypothesis, we employed replicate human bodies
(n = 6) and control bodies (n = 6) decaying under natural envi-
ronmental conditions at the Anthropology Research Facility in
Knoxville, Tennessee, USA.
Materials and Methods
Body Placement
Twelve human individuals were used in this study (Table 1).
Six individuals were sampled daily and six were used as controls
and were sampled only once. All individuals were donations to
the University of Tennessee Forensic Anthropology Center for
the W. M. Bass Donated Skeletal Collection and were placed at
the Anthropological Research Facility (ARF) in Knoxville, TN
in May–October 2011. The ARF is in a deciduous forest biome;
site description and soil characteristics have been previously
described (22). No preference was employed for sex, age, ances-
try, weight, etc. The University of Tennessee protocol for
accepting donations ensures the individuals do not have commu-
nicable diseases. The bodies were not autopsied or embalmed
and had no known bowel disease. All individuals were immedi-
ately refrigerated after death and placed at the ARF within
5 days, except individual G (placed after 14 days) (Table 1).
Bodies were placed unclothed and uncovered in a supine
position at random locations at the ARF. Rocks were removed
from the area before placement. Scavenging was limited and
restricted to extremities.
Sampling
An incision was made in the right lower quadrant of the abdo-
men diagonal to palpation of the anterior superior iliac spine and
the adjacent iliac crest. The approximately 20-cm incision was
made with a disposable Feather #11 scalpel (Graham-Field).
Once the cecum was located, a 1cm incision was cut in the
cecum, approximately 8 cm from the ileum. A sterile swab was
inserted into the incision of the cecum enough to cover the
cotton tip completely in gut material. The sterile swab was
removed, immediately placed into a sterile 5mL collection tube,
and the plastic handle of the swab was cut off with sterile scis-
sors. The samples were stored on ice in a cooler for transport to
the laboratory at which time they were weighed and stored at

20°C until further processing. Three samples were taken at
each time point for each individual. Duct tape was placed over

TABLE 1––Individuals used in this study. Shaded rows indicate control bodies, which were only sampled once during the study.

Date of Age at Death Cadaver

Individual Death (M/D/Y) Date of Placement Ancestry Sex (years) Stature (cm) Weight (kg)† Cause of Death
A 6/10/2011 6/12/2011 W* M 65 173 77 Pneumonia or cerebrovascular
accident
B 7/3/2011 7/4/2011 W M 64 171 64 Chronic obstructive pulmonary
disease
C 5/17/2011 5/18/2011 W F 62 161 113 Unknown; manner natural
D 6/11/2011 6/16/2011 W F 67 160 159 Congestive heart failure
E 5/8/2011 5/10/2011 W F 51 166 64 Metastatic breast cancer‡
F 6/15/2011 6/20/2011 W F 58 163 100 Metastatic small cell lung
carcinoma‡
G 4/1/2011 4/14/2011 W M 66 193 100 Cardiovascular disease
H 4/14/2011 4/18/2011 W F 62 167 102 Malignant lymphoma
I 7/27/2011 7/29/2011 W F 67 159 60 Chronic obstructive pulmonary
disease
J 9/30/2011 9/30/2011 W F 57 157.5 82 Unknown; manner natural
K 9/30/2011 10/2/2011 W M 84 177.5 82 Myocardial infarction
L 11/9/2011 11/10/2011 W F 85 156 68 Congestive heart failure
*W = White.
†
Weight represents self-reported value so may not reflect weight at death.
‡
Individual was undergoing active radiation or chemotherapy at time of death.
1236 JOURNAL OF FORENSIC SCIENCES
the incision to reduce insect activity at the incision site. At the
next sampling date, the original incision was accessed through
an incision in the duct tape; at all costs, the duct tape was not
removed to maintain the insect barrier, up until natural decom-
position processes prevented duct tape from sticking. Samples
were collected daily or every other day for the six test individ-
uals, for as long as the incision and intestinal structure
remained intact.
Cumulative Degree Hours
As temperature is a primary determinant of decomposition rates,
and bodies were not all placed simultaneously, we calculated
cumulative degree hours (CDH) according to Vass et al. (8). To
calculate CDH, we used temperatures recorded at the University of
Tennessee Institute of Agriculture meteorological station (located
< 0.5 km from the ARF) averaged over twelve-hour periods. CDH
was calculated as CDH = ∑ ((Ta + Tp)/2), where Ta and Tp were
the temperatures in degrees Celsius at 11:00 AM and 11:00 PM
local time, respectively. Threshold was assumed to be 0°C.
DNA Extraction
DNA isolation utilized the PowerSoilâ DNA Isolation Kit
(MoBio Laboratories, Inc.). For each 1 mg of sample weight,
2.5 lL of lysis buffer was added to the collection tube, vortexed,
and the swab with gut material was transferred to a bead beating
tube. Samples were heated at 65°C for 10 min, followed by
95°C for 10 min according to the Human MicroBiome Project
Manual of Procedures (23). The remainder of the extraction was
performed according to the manufacturer’s instructions, and the
DNA was eluted in water. The extracted DNA was visualized
using a 1.2% agarose gel electrophoresis with an ethidium bro-
mide stain.
qPCR Assays
For this study, we selected three common gut genera to quan-
tify. Two are representative genera of the two major phyla of
intestinal bacteria: Bacteroides (phylum Bacteroidetes;
Gram-negative, strictly anaerobic) and Lactobacillus (phylum
Firmicutes; Gram-positive, facultative anaerobic). The third
group represents one of the less abundant populations: Bifido-
bacterium (phylum Actinobacteria; Gram-positive, also strictly
anaerobic).
Bacteroides were quantified using a Taqmanâ qPCR assay
targeting human-associated Bacteroides according to Layton et al.
(24) (Table 2). Lactobacillus were quantified using a SYBR
Green PCR assay with a forward primer designed by Ritchie et al.
TABLE 2––PCR primers and thermocycling conditions used in this study.
Target Primer Sequence (50 to 30 )
Bacteroides HuBac566f GGGTTTAAAGGGAGCGTAGG
HuBac692r CTACACCACGAATTCCGCCT
(Probe) HuBac594Bhqf (FAM)TAAGTCAGTTGTGAAA
GTTTGCGGCTC(BHQ-1)
Lactobacillus LactoF AGCAGTAGGGAATCTTCCA
LactoR TACCGTCAAATAAAGGCCAGT
Bifidobacterium Bifid-F CTCCTGGAAACGGGTGG
Bifid-R GACTACCTGATAGGACGCGA
All bacteria Bact1369-for CGGTGAATACGTTCYCGG
Prok1492-rev GGWTACCTTGTTACGACTT
(25) and a reverse primer designed for this study (Table 2). Bifido-
bacterium were quantified using a SYBR Green PCR assay with
a forward primer designed by Matsuki et al. (26) and a reverse
primer designed for this study. Primer pairs were used to amplify
products from gut samples, and PCR products were sequenced and
searched against the bacterial 16S rRNA gene database at
Ribosomal Database Project (http://rdp.cme.msu.edu) using Probe
Match to ensure group specificity. Total 16S rRNA genes were
quantified using “universal” primers as previously described (27).
Quantitation standards for Lactobacillus and Bifidobacterium
were created by cloning amplicons into pCRâII plasmid (Life
Technologies, Grand Island, NY, USA) and diluting the plasmid
to known concentrations. Each 50 lL PCR reaction contained
5 lL 109 Buffer B (Thermo Fisher Scientific, Waltham, MA,
USA), 6 lL dNTP 2.5 mM each (Takara Bio Inc., Mountain
View, CA, USA), 4 lL 25 mM MgCl2 (Thermo Fisher Scientific,
Waltham, MA, USA), 0.1 lL Taq DNA Polymerase (Thermo
Fisher Scientific, Waltham, MA, USA), 2 lL each group primer
at a concentration of 25 lM (Invitrogen), and 1 lL DNA template
(diluted 1:10 with sterile water). PCR was carried out with a PTC-
100 Thermal Cycler (BioRad, Hercules, CA, USA). The PCR con-
ditions for each group primer were as follows: for Lactobacillus,
95°C for 5 min followed by 35 cycles of 95°C for 60 sec, 46°C
for 30 sec, and 72°C for 25 sec with a final extension at 72°C for
7 min. For Bifidobacterium, 95°C for 5 min followed by 40
cycles of 95°C for 20 sec, 49°C for 30 sec, and 72°C for 25 sec
with a final extension of 72°C for 7 min. Amplified products were
visualized on a 1.2% agarose gel with ethidium bromide stain.
Amplicons were cloned into the vector using TA Cloningâ Kit
(Life Technologies, Grand Island, NY, USA) according to the
manufacturer’s directions. Ligation products were transformed
into DH5a competent cells and positive colonies sequenced using
Sanger sequencing at the University of Tennessee Molecular Biol-
ogy Resource Facility for sequence confirmation. Concentration
of plasmids was determined by a PicoGreen Quant-iT assay (Life
Technologies, Grand Island, NY, USA) and diluted to create a ser-
ies of quantitation standards ranging from 102 to 108 copies per
reaction.
The qPCR amplification was performed on a Opticon Monitor
III or CFX96 (BioRad, Hercules, CA, USA). Each 20 lL reac-
tion was composed of 1 lL of each primer (10 pm/lL), 2.5 lL
sterile water, 12.5 lL Maxima SYBRâ Green Master Mix
(Thermo Fisher Scientific, Waltham, MA, USA), and 3 lL of
1:10 diluted DNA extract as a template. Amplification condi-
tions are shown in Table 2. Melt curve analysis was performed
for the three SYBR-based assays to ensure a single PCR ampli-
con was produced. Results were only considered if the standard
curve had an r2 > 0.99 and the log linear slope was between

2.9 and
3.6.
Amplicon qPCR Conditions
Size (bp) (°C/sec) References
116 95/30, 60/45 (23)
135 95/15, 45/30, 72/60, 80/01 (24)
This study
102 95/20, 49/30, 72/60, 80/01 (25)
This study
142 95/15, 55/30, 72/60, 80/01 (26)
 HAUTHER ET AL.
Gene quantities were all normalized to total 16S rRNA gene
copies, quantified using qPCR universal bacterial primers target-
ing highly conserved regions of the 16S rRNA genes (27). In
several samples, quantities of the highly abundant Bacteroides
populations were equal to or even greater than total 16S rRNA
gene copies due to differences in PCR efficiencies between the
two assays. However, PCR efficiencies were comparable across
all samples and therefore could be used for internal normaliza-
tion of gene quantities.
Statistical Analyses
qPCR data were initially processed with CFX Manager soft-
ware (BioRad, Hercules, CA, USA). All further statistical analy-
ses were performed in R (28). Data were fit to several different
linear and nonlinear models in order to determine the best fit
models (highest r2). Predicted values and confidence intervals
were calculated. To establish whether the variability between
individuals was due to cause of death, sex, or body mass, two-
tailed Student’s t-tests were performed on subgroups of test sub-
FIG. 1––Relative abundance of bacterial populations for each of the test bodies (A–F) over the postmortem interval (days since placement).
. POSTMORTEM HUMAN GUT MICROBIOME 1237
jects. In all analyses, the results were considered significant if
p < 0.05.
Results
Sampling
We collected samples from the six test bodies (A–F) daily or
every other day until structures were too compromised due to
decay: either the intestinal site could not be identified due to
advanced decomposition of the tissues or became extremely
desiccated. Sampling duration ranged from 9 to 20 days, or 205
to 595 cumulative degree hours (CDH). The specific sampling
durations for the six bodies were 9 days (205 CDH), 14 days
(408 CDH), 14 days (313 CDH), 15 days (330 CDH), 20 days
(478 CDH), and 20 days (595 CDH), respectively (Fig. 1). Five
of the six bodies exhibited similar rates of decay: Bloating was
apparent for the first 5–7 days (100-150 CDH), followed by a 3-
to 4-day period of active decay (end of active decay was 183-
265 CDH). One body, C, experienced a longer bloat (first
1238 JOURNAL OF FORENSIC SCIENCES

10 days, 215 CDH) and active decay period (9 days, end of

active decay was 453 CDH) compared to the others. The reason
for this discrepancy between body C and the others is unknown;
it cannot be accounted for by differences in temperature or envi-
ronment that we observed, nor by any of the physiological data
available (Table 1). For two bodies, C and E, additional samples
were taken between days 20 and 40 (CDH > 600) and quantities
of the three genera determined (data not shown). However,
abundances of the different populations at these additional time
points were considerably variable and resulted in a reduction in
the goodness of fit of the models. Because data from
CDH > 600 were only available for two bodies and were highly
variable, these data were not used in the analyses.

Controls
To determine whether our repeated sampling of the proximal
large intestine influences bacterial population numbers (e.g.,
through introduction of oxygen), we used six additional bodies
as controls. Control bodies (G–L) were only sampled once each,
with the incisions made and samples taken at 0, 0, 44, 224, 230,
and 330 CDH, respectively. We found the relative abundances
of Bacteroides and Lactobacillus populations in the controls
were within one standard deviation of the mean of the six test
bodies (Fig. 2). For Bifidobacterium, however, only the starting
sample (0 day) was similar to the test bodies; the remaining
samples were greater than one standard deviation from the mean,
indicating that Bifidobacterium abundances may have been
affected by the repeated sampling (Fig. 2).

Population Relative Abundances

Over the first 20 days postmortem, relative abundances of
Bacteroides declined in all individuals, dropping an average of
four orders of magnitude over the study (Figs 1 and 2A). The
reduction in relative abundance with time was best fit using
an exponential decay model (Table 3) Nt = N0e-kt, where Nt is
the relative abundance of the group at time (t), N0 is the
starting relative abundance at time 0, k is the decay constant,
and t is time since death in cumulative degree hours (CDH).
As temperature is one of the main variables affecting decom-
position rates and processes (e.g., 29,30), and bodies experi-
enced slightly different weather due to placement at different
times of the spring and summer, we converted days to CDH.
Data from all six test bodies were aggregated; the resulting
best fit exponential decay equation is provided in Table 3 and
displayed in Fig. 2 with 95% confidence intervals. Bacteroides
exhibited the greatest decay constants (i.e., most rapid
decline), and the exponential decay model was statistically sig-
nificant (Table 3). Lactobacillus relative abundances declined
about three orders of magnitude (Fig. 2B), and this decline
was significant (p < 0.001) for all bodies (Table 3).
Bifidobacterium, the least abundant of the three, exhibited no
significant change over the course of the study (Fig. 2C),
increasing in two bodies and declining in the other four
(Table 3). This resulted in a decay constant (k) that was not sig-
nificantly different from zero (Table 3).
Variability Between Individuals
While some individual variability was noted, these differ-
ences could not be explained by cause of death, sex, or weight:
A Student’s two-tailed t-test revealed no significant differences
FIG. 2––Relative abundance of three bacterial populations over the post-
mortem interval (in cumulative degree hours). Lines correspond to the expo-
nential decay equation (solid line) and 95% confidence intervals (dotted
lines) of Nt = N0e
kt where Nt is the relative abundance of the group at time
(t), N0 is the starting relative abundance at time 0, k is the decay constant,
and t is time since death in cumulative degree hours. Control points (open)
refer to bodies that were only sampled once (bodies G–L).
in decay constants (k) between the individuals in terms of
cause of death (respiratory disease [A and B] vs. cancer [E and
F], p = 0.262, 0.573, 0.761 for Bacteroides, Lactobacillus, and
Bifidobacterium, respectively), sex (male [A and B] vs. female
[C, D, E, and F], p = 0.191, 0.331, 0.421), and body mass
(body mass index >30 [C, D, and F] vs. body mass index <30
[A, B, and E], p = 0.407, 0.140, 0.624).
Discussion
Here we have provided proof of concept that human-associ-
ated microbial populations (i.e., the human microbiome) could
be used as an indicator of postmortem interval (PMI). Quantifi-
cation of three common gut bacterial populations postmortem
revealed these populations decline in relative abundance over
time. For two of these populations (Bacteroides and Lactobacil-
 HAUTHER ET AL. . POSTMORTEM HUMAN GUT MICROBIOME 1239

TABLE 3––Best fit exponential decay models Nt = N0ekt, where Nt is the weight, or cause of death, although we acknowledge the sample
relative abundance of the group at time (t), N0 is the starting relative sizes in these categories are small. In order for this approach to
abundance at time 0, k is the decay constant, and t is time since death in
cumulative degree hours (CDH). *p < 0.05, **p < 0.01, ***p < 0.001. be broadly applicable, future research should focus on validating
this approach under a variety of environment conditions (e.g.,
Individual N0 k r2 temperature, humidity etc.). For example, the use of microbio-
mes as a forensic indicator could offer significant utility in win-
Bacteroides A 0.142
0.0174 0.384
B 7.891
0.0228 0.828***
ter when insect activity is reduced, so this method should be
C 2.895
0.0125 0.640** evaluated under winter conditions. In addition, the deceased indi-
D 2.187
0.0233 0.558** viduals in this study represent typical populations of the south-
E 0.540
0.0127 0.939*** eastern USA. While we found consistent results despite different
F 0.795
0.0146 0.703** lifestyles, therapeutic drug use, and cause of death, regional dif-
ALL 0.977
0.0144 0.537***
ferences in diet and lifestyle can affect human gut flora composi-
Lactobacillus A 0.021
0.0087 0.280 tion (13), so our methods should also be evaluated for different
B 0.009
0.0129 0.672* human populations with varying diets and geographic locations.
C 0.047
0.0101 0.679**
D 0.016
0.0025 0.070
E 0.047
0.0096 0.986** Summary
F 0.009
0.0059 0.050
ALL 0.019
0.0087 0.396*** Our results provided a quantitative look at the postmortem
Bifidobacterium A 0.0002 0.0112 0.404 human gut microbiome over time. We confirmed bacterial
B 0.003
0.004 0.426 populations change in relative abundance postmortem, and the
C 0.016
0.009 0.419 change was consistent and predictable between individuals for
D 0.003
9E-04 0.056
E 0.016
0.002 0.663
the first 600 CDH (20 days) postmortem. In particular, Bacte-
F 0.001 0.0036 0.046 roides and Lactobacillus exhibited repeatable and statistically
ALL 0.003
0.002 0.033 significant exponential decay in relative abundance over time.
Overall, this method provided an accurate estimation of the
postmortem interval and contributed to the strength of the
lus), the declines were repeatable and statistically significant, biological profile forensic scientists use to yield a personal
which is best described by exponential decay models. These identification in a medicolegal context.
anaerobic populations likely declined, due to the introduction
of oxygen to the body cavity and the proliferation of other Acknowledgments
decomposer bacterial populations, either from the gut or the
environment. Our results corroborate those demonstrated by The authors thank all of the donors and their families who
Heimesaat et al. (16) in human-flora-associated mice where dis- make this research possible.
tinct changes in bacterial populations in the ileum gut flora We gratefully acknowledge Dr. Tom Masi, Pranay Dogra,
were observed within 72 h postmortem: the total bacterial load and Dr. Heather Williamson for their laboratory instruction
(general 16S rRNA genes) had increased, while populations of and assistance. The authors would like to thank all of the
Lactobacillus, Bacteroides, and Bifidobacteria were comparable students in the Department of Anthropology who have assisted
to starting quantities, resulting in a decrease in relative abun- in sampling, especially Jake Smith, Rebecca Taylor,
dances (16). Yangseung Jeong, Beatrix Dudzik, and David Mercer. Finally,
Bifidobacterium populations declined in relative abundance the authors thank the two anonymous reviewers for their con-
only in some individuals and the declines were not significant. structive critiques which helped improve this manuscript.
One explanation is that Bifidobacteria are typically present at
much lower abundances compared to the other two populations,
References
so changes were not distinguishable from the background
variability. In healthy living adults, Bifidobacteria quantities and 1. Christensen AM. The impact of Daubert: implications for testimony
composition did not vary over a 6-month period (31). Similarly, and research in forensic anthropology (and the use of frontal sinuses
in personal identification). J Forensic Sci 2004;49(3):427–30.
we did not observe consistent changes over the time period 2. Jashnani KD, Kale SA, Rupani AB. Vitreous humor: biochemical
measured in our study (up to 20 days or 600 CDH). constituents in estimation of postmortem interval. J Forensic Sci 2010;55
This work provides a foundation and proof of concept that (6):1523–7.
some human-associated microbial populations could be used as 3. Amendt J, Krettek R, Zehner R. Forensic entomology. Naturwissenschaf-
ten 2004;91(2):51–65.
indicators of PMI, at least for intervals <600 CDH (<20 days in 4. Vass AA, Bass WM, Wolt JD, Foss JE, Ammons JT. Time since death
this study). This method offers several advantages. First, DNA- determinations of human cadavers using soil solution. J Forensic Sci
based methods are becoming increasingly affordable and most 1992;37(5):1236–53.
crime laboratories are equipped for PCR-based analyses making 5. Carter DO, Yellowlees D, Tibbett M. Using ninhydrin to detect grave-
this a cost-effective means to quantify a complex ecological pro- soil. J Forensic Sci 2008;53(2):397–400.
6. Benninger LA, Carter DO, Forbes SL. The biochemical alteration of soil
cess. Second, this method allows for PMI estimates even if the beneath a decomposing carcass. Forensic Sci Int 2008;180(2–3):70–5.
body has been removed from the original site of decomposition. 7. Schwarcz HP, Agur K, Jantz LM. A new method for determination of
Third, the decay equations account for the effect of temperature postmortem interval: citrate content of bone. J Forensic Sci 2010;55
with the use of cumulative degree hours. Fourth, demonstration (6):1516–22.
8. Vass AA, Barshick SA, Sega G, Caton J, Skeen JT, Love JC, et al.
that two populations had significant relationships with PMI sug- Decomposition chemistry of human remains: a new methodology for
gests that monitoring multiple microbial populations could pro- determining the postmortem interval. J Forensic Sci 2002;47(3):542–53.
vide multiple estimates of PMI and thus strengthen the 9. Garcia-Rojo AM, Martinez-Sanchez A, Lopez R, de la Vega JMG,
estimation. Finally, we observed no significant effects of sex, Rica M, Gonzalez M, et al. A mathematical model applied for
1240 JOURNAL OF FORENSIC SCIENCES
assisting the estimation of PMI in a case of forensic importance. First
record of Conicera similis (Diptera: Phoridae) in a corpse. Forensic
Sci Int 2013;231(1–3):E11–8.
10. Vass AA. The elusive universal post-mortem interval formula. Forensic
Sci Int 2011;204(1–3):34–40.
11. Costello EK, Lauber CL, Hamady M, Fierer N, Gordon JI, Knight R.
Bacterial community variation in human body habitats across space and
time. Science, 2009;326(5960):1694–7.
12. Ley RE, Hamady M, Lozupone C, Turnbaugh PJ, Ramey RR, Bircher
JS, et al. Evolution of mammals and their gut microbes. Science
2008;320(5883):1647–51.
13. Moschen AR, Wieser V, Tilg H. Dietary factors: major regulators of the
gut’s microbiota. Gut Liv 2012;6(4):411–6.
14. Ley RE, Lozupone CA, Hamady M, Knight R, Gordon JI. Worlds within
worlds: evolution of the vertebrate gut microbiota. Nat Rev Microbiol
2008;6(10):776–88.
15. Jalanka-Tuovinen J, Salonen A, Nikkila J, Immonen O, Kekkonen R,
Lahti L, et al. Intestinal microbiota in healthy adults: temporal analysis
reveals individual and common core and relation to intestinal symptoms.
PLoS ONE 2011;6(7):e23035.
16. Heimesaat MM, Boelke S, Fischer A, Haag LM, Loddenkemper C,
Kuhl AA, et al. Comprehensive postmortem analyses of intestinal
microbiota changes and bacterial translocation in human flora associ-
ated mice. PLoS ONE 2012;7(7):e40758.
17. Dickson GC, Poulter RTM, Maas EW, Probert PK, Kieser JA. Marine
bacterial succession as a potential indicator of postmortem submersion
interval. Forensic Sci Int 2011;209(1–3):1–10.
18. Parkinson RA, Dias KA, Horswell J, Greenwood P, Banning N, Tibb-
ett M, et al. Microbial community analysis of human decomposition
in soil. In: Ritz K, Dawson L, Miller D, editors. Criminal and
environmental soil forensics. Netherlands: Springer, 2009;379–94.
19. Metcalf JL, Wegener Parfrey L, Gonzalez A, Lauber CL, Knights D,
Ackermann G, et al. A microbial clock provides an accurate estimate
of the postmortem interval in a mouse model system. eLife 2013;2:
e01104.
20. Pechal J, Crippen T, Benbow ME, Tarone A, Dowd S, Tomberlin J. The
potential use of bacterial community succession in forensics as described
by high throughput metagenomic sequencing. Int J Legal Med 2013;128
(1):1–13.
21. Hyde ER, Haarmann DP, Lynne AM, Bucheli SR, Petrosino JF. The
living dead: bacterial community structure of a cadaver at the onset
and end of the bloat stage of decomposition. PLoS ONE 2013;8(10):
e77733.
22. Damann FE, Tanittaisong A, Carter DO. Potential carcass enrichment of
the University of Tennessee Anthropology Research Facility: a baseline
survey of edaphic features. Forensic Sci Int 2012;222(1–3):4–10.
23. McInnes P, Cutting M. Core microbiome sampling protocol: a manual of
protocols for the human microbiome project. 2010;HMP Protocol # 07-
001; http://www.ncbi.nlm.nih.gov/projects/gap/cgi-bin/GetPdf.cgi?id=phd
002854.2.
24. Layton A, McKay L, Williams D, Garrett V, Gentry R, Sayler G. Devel-
opment of Bacteroides 16S rRNA gene TaqMan-based real-time PCR
assays for estimation of total, human, and bovine fecal pollution in
water. Appl Environ Microbiol 2006;72(6):4214–24.
25. Ritchie LE, Burke KF, Garcia-Mazcorro JF, Steiner JM, Suchodolski JS.
Characterization of fecal microbiota in cats using universal 16S rRNA
gene and group-specific primers for Lactobacillus and Bifidobacterium
spp. Vet Microbiol 2010;144(1–2):140–6.
26. Matsuki T, Watanabe K, Fujimoto J, Miyamoto Y, Takada T, Matsumoto
K, et al. Development of 16S rRNA-gene-targeted group-specific primers
for the detection and identification of predominant bacteria in human
feces. Appl Environ Microbiol 2002;68(11):5445–51.
27. Buchan A, Hadden M, Suzuki MT. Development and application of
quantitative-PCR tools for subgroups of the roseobacter clade. Appl
Environ Microbiol 2009;75(23):7542–7.
28. R Core Team. R: a language and environment for statistical computing.
R Foundation for Statistical Computing, 2014; http://www.R-project.org.
29. Carter DO, Yellowlees D, Tibbett M. Temperature affects microbial
decomposition of cadavers (Rattus rattus) in contrasting soils. Appl Soil
Ecol 2008;40(1):129–37.
30. Meyer J, Anderson B, Carter DO. Seasonal variation of carcass decom-
position and gravesoil chemistry in a cold (Dfa) climate. J Forensic Sci
2013;58(5):1175–82.
31. Matsuki T, Watanabe K, Fujimoto J, Kado Y, Takada T, Matsumoto K,
et al. Quantitative PCR with 16S rRNA-gene-targeted species-specific
primers for analysis of human intestinal Bifidobacteria. Appl Environ
Microbiol 2004;70(1):167–73.
Additional information and reprint requests:
Jennifer DeBruyn, Ph.D.
Biosystems Engineering & Soil Science
2506 EJ Chapman Drive
University of Tennessee
Knoxville, TN 37996
E-mail: jdebruyn@utk.edu