General Biology 2 (BIO02)

Written Work 1A – Structure of DNA and RNA

Name: Babatugon, Louis Roy Vincent A.
Section: IS220
Date of Submission: 6/8/19

Instructions: Answer the following questions. You may add illustrations and/or figures if necessary, to supplement your
answers.
1) Following the observations of Frederick Griffith, an experiment led by Oswald Avery with his colleagues aimed to
determine the unknown, heritable substance present in the heat-killed S strain of Streptococcus pneomoniae. To achieve
this, heat-killed S strain bacteria was thoroughly investigated. Initially, lipids and carbohydrates of the said strain were
removed so that only DNA, RNA, and Protein were left in the solution. Then, three different aliquots from the lipid-
free and carbohydrate-free solution of S strain were prepared.

 Test Tube 1: Aliquot was added with proteinases so that it only contains DNA and RNA.
 Test Tube 2: Aliquot was added with ribonuclease so that it only contains DNA and proteins.
 Test Tube 3: Aliquot was added with deoxyribose so that it only contains RNA and proteins.
Thereafter, each of these aliquots were added to a culture solution containing R strains. Culture solutions with the
content of either test tube 1 or test tube 2 were observed to have living, virulent S strains, indicating that the R strains
have been transformed into virulent S strains by an unknown, heritable substance present in the heat-killed S strains.
a. What are proteinases, ribonucleases, and deoxyribonucleases? What are their specific functions? (5 pts)
 Proteinases - It is an enzyme that breaks down protein into its building blocks.
 Ribonucleases- It is a type of nuclease that generate the degradation of RNA into smaller components.
 Deoxyribonucleases- is an enzyme that breaks up extracellular DNA found in the purulent sputum during
respiratory infections.
b. What has been the conclusion of the study conducted by Avery and his group? (5 pts)
 Their conclusion was that the DNA is the substance the causes the bacterial transformation and concluded
that it is the genetic material of the cell.

2) Describe and explain the experiment performed by Alfred Hershey and Martha Chase to determine whether the genetic
material is DNA or protein. Why was DNA radioactively labelled with phosphorous (32P) and protein with sulfur (35S)?
(10 pts)
 Alfred Hershey and Martha Chase experiments were conducted in 1952. They were the ones who proved
that the DNA is the genetic material. DNA is already known to biologist and many scientist still believe
that the proteins transmits the material for inheritance because DNA seemed to be a passive molecule. In
their experiments they used a T2 phage bacteriophage then injects it into the bacterium and tested both
protein and DNA. They discovered that the DNA enters the bacterial cell but most of the protein does not
enter the bacterial cell.
 They were radioactively labelled because proteins contain almost no phosphorus and DNA contains
no sulfur, so the radioactive isotopes would show up in the cells if thephosphorus-32 or sulfur-35 appeared.

3) What is the complementary sequence of the coding sequence shown below? (5 pts)
5’ ATGCATAGATTAGGATATCCCAGATAG 3’
 The complementary sequence code- 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
General Biology 2 (BIO02)
Written Work 1A – Structure of DNA and RNA
Name: Babatugon, Louis Roy Vincent A.
Section: IS220
Date of Submission: 6/8/19

Additional Questions

4) How did James Watson and Francis Crick visualized and discovered the structure of DNA? What were there bases
and/or assumptions? (10 pts)
 James Watson and Francis Crick visualized and discovered the structure of DNA by using Linus Pauling’s
model and the key measurement from the unpublished X-ray diffraction data. Watson and crick’s most crucial
indications came from Rosalind Franklin a physicist who is an expert in a powerful method for determining
the structure of a molecule, known as X-ray crystallography. When DNA is exposed to X-rays some rays are
deflected by atoms, creating a diffraction pattern that gives indications about the molecule's structure.
Franklin’s X-ray crystallography gave Watson and Crick significant clues to the structure of DNA. Some of
these derived from the well-known “image 51,”. A clear X ray diffraction image of DNA made by franklin and
her student. Watson and crick immediately suggested a helical, two stranded structure of the DNA after seeing
the image 51. They gathered all the data from the scientist and researchers and assemble the 3d model structure
Of DNA, in 1962. Watson and Crick were awarded for their work in the Nobel Prize in Medicine. Rosalind
Franklin who is one of the biggest contributors of this research eventually died, therefore the Nobel prize was
not awarded.

5) What are the different types of bonds present in the DNA molecule? (5 pts)
 Covalent Bonds – the sharing of electron pairs between atoms.
 Phosphodiester Bonds- A bond between a two sugar groups and a phosphate group; such bonds form the
sugar-phosphate-sugar backbone of DNA and RNA.
 Hydrogen Bonds- interaction involving a hydrogen atom located between a pair of other atoms having a
high affinity for electrons.