Brain Struct Funct
DOI 10.1007/s00429-014-0761-5
ORIGINAL ARTICLE
Dysregulation of dopaminergic regulatory mechanisms
in the mesolimbic pathway induced by morphine
and morphine withdrawal
Daniel Garcı́a-Pérez • Roger López-Bellido •
Raquel E. Rodrı́guez • M. Luisa Laorden •
Cristina Núñez • M. Victoria Milanés
Received: 29 October 2013 / Accepted: 19 March 2014
Ó Springer-Verlag Berlin Heidelberg 2014
Abstract Dopamine (DA) is thought to represent a
teaching signal and has been implicated in the induction of
addictive behaviours. Previously, it has been proposed that
the transcription factors Nurr1 and Pitx3, which are critical
for transcription of a set of genes involved in DA metab-
olism in the mesolimbic pathway, are associated with
addiction pathology. The aim of our study was to investi-
gate abnormalities in the mesolimbic pathway associated
with morphine dependence and withdrawal. Using quanti-
tative real-time PCR, immunofluorescence, HPLC and
Western blotting, here we studied the effects of single
morphine administration, morphine dependence and mor-
phine withdrawal on Nurr1 and Pitx3 expression as well as
on the DA marker tyrosine hydroxylase (TH) and the
turnover of DA in the ventral tegmental area (VTA) and/or
nucleus accumbens. We showed that the three experimental
conditions caused induction of Nurr1 and Pitx3 in the
VTA, which correlated with changes in TH expression
during chronic morphine administration. Present data also
Electronic supplementary material The online version of this
article (doi:10.1007/s00429-014-0761-5) contains supplementary
material, which is available to authorized users.
D. Garcı́a-Pérez  M. L. Laorden  C. Núñez 
M. V. Milanés (&)
Group of Molecular and Cellular Pharmacology, Medical
Faculty of Murcia, University of Murcia, Campus de Espinardo,
30100 Murcia, Spain
e-mail: milanes@um.es
D. Garcı́a-Pérez  M. L. Laorden  C. Núñez  M. V. Milanés
Instituto Murciano de Investigación Biosanitaria (IMIB),
Murcia, Spain
R. López-Bellido  R. E. Rodrı́guez
Instituto de Neurociencias de Castilla y León (INCYL),
University of Salamanca, Salamanca, Spain
confirmed the colocalization of Nurr1 and Pitx3 with TH-
positive neurons in the posterior VTA. Furthermore, during
morphine dependence, Nurr1 was detected in the nucleus
compartment of VTA TH-positive neurons, whereas Pitx3
was strongly detected in the nucleus of TH-positive neu-
rons after single morphine administration and during
morphine withdrawal. The number of TH neurons, number
of Nurr1 or Pitx3-positive cells, and the number of TH
neurons expressing Nurr1 or Pitx3 were not modified in the
subpopulations of DA neurons. Present data provide novel
insight into the potential correlation between Nurr1 and
Pitx3 and DA neurons plasticity during opiate addiction in
the mesolimbic pathway.
Keywords Morphine dependence and withdrawal 
Ventral tegmental area  Nucleus accumbens  Nurr1 
Pitx3  Dopamine  Tyrosine hydroxylase
Introduction
Opiate drugs, including morphine, are used for treating
many forms of acute and chronic pain. However, they are
also highly addictive, which limits their medical use. The
non-medical use of opiates (heroine, morphine) has
increased greatly in recent years (Compton and Volkow
2006; Volkow and Skolnick 2012). Chronic use of opiates
causes brain neuroadaptations that lead to undesirable
effects, namely opiate addiction that is a significant med-
ical and public health problem.
Midbrain dopamine (DA) neurons and their target
structures are critically involved in the neural circuits
modifications that underlie a variety of adaptive changes
and pathological behaviours, including mental disorders
and the development and maintenance of addiction
123

(Kalivas and Volkow 2005; Hyman et al. 2006). Multiple
adaptive changes in molecular and cellular function in the
mesolimbic DA system have been shown after repeated
opiate administration, and are thought to be linked to the
persistent craving and relapse in animals and human
addicts (Nestler 2001; McClung and Nestler 2008). How-
ever, many issues regarding opioid regulation of DA neu-
rons remain unknown.
Among transcription factors involved in development
and physiological function of midbrain DA neurons, Nurr1
and Pitx3 may play critical role for determining the DA
transmitter identity and neurotransmission, as well as for
the survival and maintenance of DA neurons (Smits and
Smidt 2006; Kadkhodaei et al. 2009). Nurr1 is an orphan
member of the nuclear receptor superfamily of transcrip-
tion factors, which is critical for the generation of the DA
neurons of the substantia nigra and ventral tegmental area
(VTA). It is essential for transcription of a set of genes
involved in DA metabolism, including tyrosine hydroxy-
lase (TH; the rate-limiting enzyme in DA synthesis (Jan-
kovic et al. 2005; Reddy et al. 2011), which is a marker of
dopaminergic neurons in the VTA. Another critical tran-
scription factor for the development and for the survival
and maintenance of DA neurons is the homeobox protein
Pitx3 (Kim et al. 2007). The gene encoding for Pitx3 is
expressed exclusively in midbrain DA neurons (Smidt et al.
1997) and activates the transcription of genes directly
involved in the differentiation of dopaminergic neurons
(Hwang et al. 2009; Reddy et al. 2011). Previous results in
mice have shown significant downregulation of Nurr1 and
Pitx3 expression after chronic cocaine administration,
suggesting that these transcription factors could mediate
the neuroadaptive processes leading to alteration in dopa-
mine circuits (Leo et al. 2007). To date, only one study in
human heroin abusers has investigated Nurr1 in relation to
opiates (Horvath et al. 2007).
In recent years, experiments have begun to define the
diversity of functional phenotypes among midbrain DA
neurons in the context of their distinct projection targets
and their differential afferent inputs, as well as assigning
specific behavioural functions to each phenotype (Roeper
2013). Thus, recent findings have proposed that DA
neurons in the VTA are not homogeneous and that spe-
cific molecular and physiological properties are associated
with the target structures to which they project (Lammel
et al. 2012; Roeper 2013). Thus, neurons that project to
the medial shell of the nucleus accumbens (NAc, a crit-
ical component of the endogenous reward circuitry) and
the medial prefrontal cortex (mPFC) are mainly located in
the medial posterior VTA, whereas neurons that project to
the lateral shell of the NAc are located in the lateral VTA
(Lammel et al. 2012). Accordingly, the modulation of
synaptic function in DA neurons by administration of
123
Brain Struct Funct
cocaine is not uniform but is associated with the brain
area to which the DA neurons project (Lammel et al.
2014).
Given the important implications of DA neurotrans-
mission in the brain reward dopaminergic system in
addiction disorders, present study was focused on identi-
fying the DA markers that are altered in association with
acute and chronic morphine exposure as well as with
morphine withdrawal in the VTA and NAc. This hypoth-
esis was tested with the following aims: (1) to determine
expression of transcription factors Nurr1 and Pitx3
mRNAs and proteins as well as TH mRNA and protein
levels in specific regions of the mesolimbic system, (2) to
determine DA and DOPAC content and DA turnover in
the NAc, (3) to determine quantitative colocalization of
Nurr1 and Pitx3 in the VTA TH-positive neurons, (4) to
identify plasticity changes in VTA DA neurons subpopu-
lations in response to morphine, morphine dependence and
morphine withdrawal.
Materials and methods
Subjects
Male Wistar rats (n = 65, Harlan, Barcelona, Spain) ini-
tially weighting 220–240 g were housed (2–3/cage) on
arrival in a room with controlled temperature (22 ± 2 °C)
and humidity (50 ± 10 %), with free access to water and
food (Harlan Teklad standard rodent chow; Harlan Inter-
fauna Ibérica, Barcelona, Spain). Animals were adapted to
a standard 12-h light–dark cycle (lights on 0800–
2000 hours) for 7 days before the beginning of the exper-
iments. All surgical and experimental procedures were
performed in accordance with the European Communities
Council Directive of 24 November 1986 (86/609/EEC) and
were approved by the local committees for animal research
(REGA ES300305440012).
Drug treatment and experimental procedure
Following habituation, rats were implanted subcutaneously
(s.c.) with pellets containing lactose (placebo) for 6 days.
Another set of rats were made dependent on morphine by
implantation (s.c.) of two 75-mg morphine pellets under
light ether anaesthesia. This procedure has been shown to
produce consistent plasma morphine concentrations
beginning a few hours after the implantation of the pellets
and a full withdrawal syndrome after acute injection of
opiate antagonists (Frenois et al. 2002). On day 7, rats were
injected intraperitoneally (i.p.) with either morphine HCl
(20 mg/kg; in a volume of 1 ml/kg body weight), naloxone
(1 mg/kg; 1 ml/kg body weight) or an equivalent volume
Brain Struct Funct
of 0.9 % saline and killed 1 h later. There were five
experimental groups: chronic placebo ? acute saline,
chronic placebo ? acute morphine, chronic mor-
phine ? acute saline, chronic placebo ? acute naloxone
and chronic morphine ? acute naloxone. The weight gain
of the rats was checked during chronic treatment to ensure
that the morphine was liberated correctly from the pellets
because it is known that chronic morphine treatment
induces a decrease in body weight gain due to lower caloric
intake (Houshyar et al. 2004; Núñez et al. 2009) (Online
Resource 1). In addition, the animals were observed for
opioid withdrawal behaviours for 30 min before and after
naloxone injection.
Preparation of tissue extract
Sixty minutes after acute administration of saline, mor-
phine or naloxone rats were decapitated (between 1000 and
1200 hours to avoid circadian variations in plasma levels
of the hormones), and the brains were rapidly removed and
stored immediately at -80 °C until use for Western blot
analysis (Nurr1, Pitx3 and TH), quantitative real-time PCR
(qPCR; Nurr1, Pitx3 and Th) and DA and DOPAC levels.
Brains were sliced on a cryostat and kept at -20 °C until
each region of interest comes into the cutting plane
(Fig. 1A). For NAc (medial shell) study, three consecutive
500-lm coronal slides were made corresponding to *?2.7
to ?0.9 mm from bregma, according to the atlas of Paxinos
Fig. 1 A The locations of the razor blades used to cut three adjacent
NAc (medial shell) and two adjacent VTA coronal slices are indicated
in a sagittal view of the rat brain with the dorsal surface up. A0 , A00
Schematic illustrations showing the punches placement in consecutive
coronal sections of the NAc (medial shell) and VTA (blue circles),
respectively
and Watson (2007). For VTA analysis, two 500-lm coro-
nal brain sections were obtained from bregma -4.80 to
-6.15 mm (Paxinos and Watson 2007). Tissues of interest
were dissected using a punching device with a 1 mm
internal diameter. The anatomical locations and boundaries
of each region were determined using the rat brain Atlas of
Paxinos and Watson (2007). Bilateral punches of the NAc
(medial shell; Fig. 1A0 ) and VTA (Fig. 1A00 ) were col-
lected into Eppendorf tubes, according to the method of
Leng et al. (2004). A second set of animals from each
treatment group was used for immunofluorescence staining
of Nurr1–TH and Pitx3–TH colocalization.
Electrophoresis and Western blotting
Five and three bilateral punches from NAc and VTA,
respectively, were placed in homogenization buffer. Wes-
tern blot was performed as described previously (Garcı́a-
Pérez et al. 2013a). The following primary antibodies were
used: rabbit polyclonal anti-Nurr1 (1:500; sc-991, Santa
Cruz Biotechnology, Santa Cruz, CA, USA); rabbit poly-
clonal anti-Pitx3 (1:750; ab30734, Abcam, Cambridge,
UK); rabbit polyclonal anti-TH (TH; 1:10,000; AB152,
Millipore, Temecula, CA, USA). Goat anti-rabbit IgG,
HRP-linked antibody (1:5,000; sc-2004, Santa Cruz Bio-
technology) was used as secondary antibodies. We used
GAPDH as our loading control for all the experiments. The
ratios of Nurr1/GAPDH, Pitx3/GAPDH and TH/GAPDH
were plotted and analyzed. Protein levels were corrected
for individual levels.
RNA extraction and quantitative real-time PCR (qPCR)
One punch from the VTA was placed in an Eppendorf tube
containing 30 ll of diethyl pyrocarbonate-treated water.
Total RNA was isolated from tissue samples using TrizolÒ
reagent (Invitrogen Corp. Carlsbad, CA, USA) following
the protocol recommended by the manufacturers. RNA
concentrations and purity were determined using a
NANODROP 2000C spectrophotometer (Thermo Scien-
tific), measuring absorbance at 260 nm and the ratio
260/280 nm (a ratio of 1.6–2). Samples were assayed three
times, and mean values were recorded. qPCR was per-
formed as described previously (Sanchez-Simon et al.
2010). The oligonucleotides used to amplify the different
genes and the annealing temperatures are shown in
Table 1. Three samples were taken for each gene to per-
form the PCRs, and the experiments were repeated three
times for each gene. PCR products were visualized on
agarose gel (Online Resource 1), and the fragment corre-
sponding to each gene was cut from the agarose gel and
purified. The b-actin, reference gene, was used for nor-
malization of several gene expression data.
123
 Brain Struct Funct

Immunofluorescence study
efficiencya
Primer

1.95
1.97
1.96
1.99
Sixty minutes after morphine, saline or naloxone injections,
rats were deeply anesthetized with pentobarbital and then
transcardially perfused with 250 ml cold 0.9 % saline and
subsequently with 500 ml of cold fixative solution con-
Amplicon size
(base pairs)

taining 4 % paraformaldehyde in 0.1 M borate buffer, pH

9.5. Brains were removed and kept in the same fixative
solution containing sucrose (30 %) for 3 h. After that, the
167
151
117
160

brains were cryoprotected by submersion in phos-

phate buffered saline (PBS) containing 30 % sucrose
overnight at 4 °C. Brains were then sectioned into 30-lm-
temperature (°C)

thick tissue sections. Immunofluorescence was performed

as described previously (Garcı́a-Pérez et al. 2013a, b). For
Annealing

detecting TH-, Nurr1- and Pitx3-expressing neurons, sec-

tions were then incubated for 48 h at 4 °C with the fol-
59
60
58
59

lowing primary antibodies: rabbit polyclonal anti-Nurr1

(1:500; sc-991, Santa Cruz Biotechnology); rabbit anti-
Pitx3 (1:1,000; a gift of Dr. Marten Smidt, Netherlands
CCACAGGATTCCATACCCAGG
GCAATGCAGGAGAAGGCAGA

(Smidt et al. 2000, 2004); goat polyclonal anti-tTH

GTTCCCAGGTTCCCGAGGA
CAGTTGCCGTACGTGTAGC

(1:4,000; ab101853, Abcam). Alexa Fluor 488 Donkey

Anti-Rabbit IgG (1:1,000; A-21206, Invitrogen, Eugene,
Reverse primer (50 –30 )

OR, USA) and Alexa Fluor 594 Donkey Anti-Goat IgG

(1:1,000; A-11058, Invitrogen) labelled secondary anti-
bodies were applied for 4 h. Sections were incubated in 4,
6-diamino-2-phenylindole (DAPI, 1:100,000) for 1 min and
mounted in ProLong(R) Gold antifade reagent (Invitrogen).
 ð1=slopeÞ 

Image analysis
qPCR primer efficiency (E) was calculated according to the equation: E ¼ 10

The slides were scanned at a 1,2009 magnification using a

CCCTAGACTTCGAGCAAGAGATG

Leica SCN400F scanner with a BGR ET filter cube (Leica

GCATACAGGTCCAACCCAGT

Microsystems GmbH, Wetzlar, Germany). The gain and

TGCGGGTGTGGTTCAAGAA
GTCACGTCCCCAAGGTTC

exposure time used remained constant for every experimental

group. Images were uploaded and archived on the web-
Forward primer (50 –30 )

enabled digital slide management system, SlidePath’s Digital

Image Hub (Slidepath, Dublin, Ireland). Images were cap-
tured at 49 and 209 magnifications. The whole histological
quantification was performed blindly on caudal VTA sections
(Bregma -5.3 to -5.8), which were identified using the atlas
Table 1 Oligonucleotide primers used in qPCR

of Paxinos and Watson (2007). TH?, Nurr1?, Pitx3?, TH?/

Nurr1? and TH?/Pitx3? neurons were counted using a com-
puterized image analysis system (ImageJ 1.43 Analysis soft-
ware from directory at http://rsb.info.nih.gov/ij/). Midbrain
Accession number

sections were viewed at low power (49 objective), the VTA

NM_019328.3
NM_019247.1
NM_012740.3
NM_031144.2

was outlined, and the area was calculated. From each section,
twelve images at 209 magnification representing different
VTA subregions were captured. Serial sections were placed
for systematic analysis of randomly placed counting grids
(size of 223 9 223 lm). Positive cells were counted only
when they cut the superior and left limit of the square. Twelve
b-Actin
Nurr1

squares (one per image) were counted in each section, which

Pitx3
Gene

Th

represent 50–70 % of the total area. For each treatment, three

a

123
Brain Struct Funct

Table 2 Percentage of DA neurons that co-express Nurr1 or Pitx3 excitation for Alexa Fluor 488 and 543-nm excitation for
Experimental ?
% TH –Nurr1 ? ?
% TH –Pitx3 ? Alexa Fluor 594. Emitted light was detected in the range of
groups neurons neurons 450 nm for DAPI, 515–530 nm for Alexa Fluor 488 and
605 nm for Alexa Fluor 594. Every channel was captured
Pla ? sal 91.42 ± 0.56 92.51 ± 0.32
separately to avoid spectral crosstalking. Images were de-
Pla ? mor 93.95 ± 0.89 92.73 ± 2.37 convolved using Huygens Essential 3.6 by Scientifica
Mor ? sal 92.48 ± 1.49 94.88 ± 0.99 Volume Imaging (SVI, Hilversum, the Netherlands).
Pla ? nx 94.66 ± 1.43 95.03 ± 1.22 Three-dimensional reconstructions of the stacks of confo-
Mor ? nx 94.61 ± 1.79 89.19 ± 2.23# cal images were rendered in Imaris software (Bitplane
Pla placebo, sal saline, mor morphine, nx naloxone Scientific Software, Zurich, Switzerland).
#
p \ 0.05 vs. pla ? nx
Quantitative colocalization
sections from each animal were evaluated. A mean value for
different subregions of the animal was then calculated, and an Quantitative correlation and colocalization of TH/Nurr1
average number of cells per section in each animal generated. and TH/Pitx3 were estimated using Pearson’s correlation
coefficient (PCC) and Manders’ overlap coefficients,
Confocal analysis and 3D rendering respectively (MOC; M1 and M2) (Zinchuk et al. 2007;
Dunn et al. 2011). Colocalization analysis was performed
Confocal images were obtained using a Nikon Confocal in images previously processed with Huygens and carried
Microscope C1 (Nikon 90i, Confocal D-eclipse C1 Tokyo, out using the ImageJ Plugins. Four to six images were
Japan) using 408-nm excitation for DAPI, 488-nm analyzed per animal.

Fig. 2 Nurr1 mRNA expression and protein levels are altered by
acute and chronic morphine administration and during morphine
withdrawal. Over a 7-day period, control (pla) and morphine (mor)-
dependent rats received saline (sal), morphine (mor; 20 mg/kg i.p.) or
naloxone (nx; 1 mg/kg s.c.) and were killed 60 min later. A, B qRT-
PCR analyses of Nurr1 mRNA in the VTA micropunches isolated
from rats receiving the treatments mentioned above. C, D Densito-
metric analysis of specific integrated optical density (% of control)
signals normalized to the corresponding GAPDH levels and repre-
sentative Western blot analysis of Nurr1 protein in the VTA
micropunches. Bars represent the mean ± SEM. Statistical analysis
of the experiments was performed using one-way ANOVA followed
by the Newman–Keuls post hoc test. *p \ 0.05, **p \ 0.01,
***p \ 0.001 vs. pla ? sal control group; ?p \ 0.05 vs. pla ? mor;
##
p \ 0.01, ###p \ 0.001 vs. pla ? nx; &p \ 0.05 vs. mor ? sal
(Student’s t test)

123
 Brain Struct Funct

Fig. 3 Changes induced in the

VTA Pitx3 mRNA and Pitx3
protein levels after acute and
chronic morphine treatment and
during naloxone-induced
morphine withdrawal. Over a
7-day period, control (pla) and
morphine (mor)-dependent rats
received saline (sal), morphine
(mor; 20 mg/kg i.p.) or
naloxone (nx; 1 mg/kg s.c.) and
were killed 60 min later. A,
B qRT-PCR analyses of Pitx3
mRNA in the VTA
micropunches isolated from rats
receiving the treatments
mentioned above. C,
D Semiquantitative analysis and
representative immunoblots of
Pitx3 protein in the VTA
micropunches. Each bar
corresponds to mean optical
density ± SEM (% of control).
Statistical analysis of the
experiments was performed
using one-way ANOVA
followed by the Newman–Keuls
post hoc test. *p \ 0.05,
**p \ 0.01 vs. pla ? sal;
#
p \ 0.05 vs. pla ? nx

PCC was used for measuring the correlation of the detection. One punch from each animal was obtained and
intensity distributions between channels (values range: added to 60 ll of a solution composed by 1 M HClO4 and
-1.0 to 1.0), according to the formula: 2.7 mM EDTA. The samples were homogenized by slight
P sonication for about 1 min and centrifuged (6,0009g;
i ðS1i  S1aver Þ  ðS2i  S2aver Þ
Rr ¼ qffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
P ffi 4 °C) for 10 min, and the supernatants were taken for
2 P 2
i ðS1 i  S1 aver Þ  i ðS2 i  S2 aver Þ analysis and filtered through 0.22 mm GV (Millipore
Bedford, MA, USA). The pellets were re-suspended by
where S1 represents signal intensity of pixels in the channel
adding 100 ll of 1 N OHNa. Then, the total amount of
1 and S2 represents signal intensity of pixels in the channel
proteins from each sample was measured by spectropho-
2; S1aver and S2aver reflect the average intensities of these
tometry. HPLC analysis was performed as described pre-
respective channels.
viously (Garcı́a-Pérez et al. 2013a, b). The DA turnover
MOC represents the fraction of one protein that co-
was determined as the DOPAC/DA ratio. The ratio
localizes with a second protein and is a measure of the
DOPAC/DA was used as indices of transmitter
overlapped fraction of each signal. Its values are in the
metabolism.
range 0–1.0. For two probes (S1 and S2), these coefficients
are calculated as:
P P Materials
Pi S1i;coloc i S2i;coloc
M1 ¼ M2 ¼ P
1 S1 i 1 S2i Morphine HCl and morphine base were supplied from
Alcaliber Laboratories (Madrid, Spain) in cooperation with
where M1 is the fraction of S1 in compartments containing S2
the Área de Estupefacientes y Psicotropos, Agencia Es-
and M2 is the fraction of S2 in compartments containing S1.
pañola del Medicamento y de Productos Sanitarios
(Madrid, Spain). Naloxone HCl was purchased from
Estimation of dopamine and its metabolite DOPAC Sigma-Aldrich (Sigma Chemical Co, St Louis, MO, USA).
Morphine HCl and naloxone HCl doses are expressed as
DA and its metabolite DOPAC were determined in the the weight of the salt. Protease inhibitors were purchased
NAc (medial shell) by HPLC with electrochemical from Boehringer Mannheim (Mannheim, Germany);

123
Brain Struct Funct

Fig. 4 Th mRNA, TH protein

and DA turnover dysfunctions
in the mesolimbic (VTA-NAc)
pathway. Over a 7-day period,
control (pla) and morphine
(mor)-dependent rats received
saline (sal), morphine (mor;
20 mg/kg i.p.) or naloxone (nx;
1 mg/kg s.c.) and were killed
60 min later. VTA and NAc
micropunches were isolated
from rats receiving the above
treatments A, B qRT-PCR
analyses of Th mRNA in the
VTA. Semiquantitative analysis
and representative immunoblots
of TH protein in the VTA (C,
D) and NAc (E, F). G, H DA
turnover (as determined by the
DOPAC/DA ratio) in the NAc.
Each bar corresponds to mean
optical density ± SEM (% of
control for TH protein).
Statistical analysis of the
experiments was performed
using one-way ANOVA
followed by the Newman–Keuls
post hoc test. *p \ 0.05,
**p \ 0.01, ***p \ 0.001 vs.
pla ? sal; ??p \ 0.01,
???
p \ 0.001 vs. pla ? mor;
#
p \ 0.05, ###p \ 0.001 vs.
pla ? nx; &p \ 0.05,
&&&
p \ 0.001 vs. mor ? sal
(Student’s t test)

123
 Brain Struct Funct

123
 Brain Struct Funct
b Fig. 5 Number of TH-, Nurr1- and TH-positive neurons expressing
Nurr1 in the posterior VTA did not change after a single injection of
morphine, during morphine dependence or after naloxone-induced
morphine withdrawal. Over a 7-day period, control (pla) and
morphine (mor)-dependent rats received saline (sal), morphine
(mor; 20 mg/kg i.p.) or naloxone (nx; 1 mg/kg s.c.) and were killed
60 min later. The analyzed region within the VTA is schematically
illustrated in A, A0 (modificated from Paxinos and Watson 2007).
Three–four sections containing the VTA were selected per animal.
Coordinates are in mm from Bregma. B–F000 Representative confocal
images showing midbrain coronal sections of rat immunostained for
TH (red), Nurr1 (green), merged and DAPI (nuclear stain, blue; B000 –
F000 ). Scale bar 100 lm. TH-positive/Nurr1-positive-IR is shown by
orange/yellow neurons in the merged images of TH/Nurr1 (B00 –F00 ).
G–L Quantitative analysis of the number of TH neurons, Nurr1-
positive neurons and TH-positive neurons expressing Nurr1 (one-way
ANOVA). Results are shown as mean ± SEM
phosphatase inhibitor Cocktail Set was purchased from
Calbiochem (Darmstadt, Germany); and HPLC reagents
were purchased from Sigma Chemical Co. Morphine HCl
and naloxone were prepared fresh each day by reconstitu-
tion in sterile saline (0.9 % NaCl; ERN Laboratories,
Barcelona, Spain).
Data analysis
Data were analyzed using one-way analysis of variance
(ANOVA) followed by a post hoc Newman–Keuls test, to
determine specific group differences. Body weight chan-
ges were analyzed by two-way ANOVA. Student’s t test
was used when comparisons were restricted to two
experimental groups. The average values of the quantita-
tive colocalization parameters (PCC and MOC) were
calculated for each group and compared statistically using
one-way ANOVA followed by the Newman–Keuls test.
All statistical analyses were performed using GraphPad
Prism 5 (GraphPad Software Inc., San Diego, CA, USA).
Data are presented as mean ± standard error of the mean
(SEM). Significance was set at p \ 0.05 for all statistical
tests.
Results
All morphine-dependent rats receiving naloxone displayed
behaviour and somatic signs characteristics of opiate
withdrawal, as previously was shown using the same
method of morphine dependence induction (Garcı́a-Pérez
et al. 2012, 2013a, b): wet dog shakes, piloerection, teeth
chattering, diarrhoea, chromodacryorrhea, sniffing and
irritability. In addition, the body weight loss after saline or
naloxone injection to placebo-pelleted and morphine-
dependent rats was also recorded as a sign of opiate
withdrawal (Online Resource 2).
Effects of morphine and morphine withdrawal on VTA
expression levels of Nurr1 and Pitx3 transcripts
and proteins
ANOVA for Nurr1 mRNA showed significant effect after
acute or chronic morphine [F(2,21) = 10.44; p = 0.0009].
Post hoc comparisons showed that Nurr1 mRNA levels were
significantly (p \ 0.001) enhanced 60 min after acute
morphine injection. The Nurr1 mRNA increased levels were
still evident in morphine-dependent rats (p \ 0.05;
Fig. 2A). ANOVA also showed significant effect after nal-
oxone-induced morphine withdrawal [F(2,22) = 36.47;
p \ 0.000]). Significant (p \ 0.01) elevation was observed
60 min after naloxone injection to morphine-dependent rats
(Fig. 2B). Unexpectedly, control animals receiving nalox-
one showed significant (p \ 0.001) elevation of Nurr1
mRNA levels. The changes of Nurr1 mRNA expression
were paralleled by similar effects in protein levels, as
measured by Western blot analysis (Fig. 2C, D). Indeed,
ANOVA for Nurr1 revealed significant effect of acute and
chronic morphine [F(2,23) = 4.789; p = 0.0194]. ANOVA
also showed significant effect after naloxone-induced mor-
phine withdrawal [F(2,23) = 10.76; p = 0.0006]. Post hoc
test showed that Nurr1 immunoreactivity was significantly
(p \ 0.05) increased 60 min after single morphine injection
and in chronic morphine-treated rats (p \ 0.05). In addition,
significant increase of Nurr1 was observed after naloxone-
induced morphine withdrawal compared with control rats
receiving saline (p \ 0.001) or naloxone (p \ 0.01). Stu-
dent’s t test showed that Nurr1 protein levels in morphine-
withdrawn rats were significantly higher (t14 = 2.153;
p \ 0.05) than those observed in morphine-dependent rats.
In contrast to the elevation observed for the Nurr1 mRNA,
ANOVA showed that expression levels of Pitx3 mRNA did
not significantly change in acute or chronic morphine-treated
animals [F(2,20) = 0.341; p = 0.6931; Fig. 3A]. However,
ANOVA for Pitx3 protein levels revealed significant effects
of the same treatments [F(2,22) = 4.064; p = 0.0330;
Fig. 3C]. Post hoc test showed an increase of Pitx3 protein
levels after acute and chronic morphine administration
(p \ 0.05). ANOVA for Pitx3 mRNA showed no significant
changes after naloxone administration [F(2,23) = 0.4520;
p = 0.6424; Fig. 3B], whereas significant effects were
observed during morphine abstinence for Pitx3 protein
[F(2,20) = 6.296; p = 0.0085]. Post hoc analysis showed a
significant increase in Pitx3 immunoreactivity in morphine-
withdrawn rats (p \ 0.01; Fig. 3D).
VTA expression levels of Th transcript and protein,
accumbal TH protein levels and DA turnover
ANOVA for Th mRNA expression showed significant
changes after morphine administration [F(2,36) = 15.47;
123
 Brain Struct Funct

123
 Brain Struct Funct
b Fig. 6 Number of TH, Pitx3 and TH-positive neurons expressing
Pitx3 in the posterior VTA did not change after a single injection of
morphine, during morphine dependence or after naloxone-induced
morphine withdrawal. Over a 7-day period, control (pla) and
morphine (mor)-dependent rats received saline (sal), morphine
(mor; 20 mg/kg i.p.) or naloxone (nx; 1 mg/kg s.c.) and were killed
60 min later. A–E000 Representative confocal images showing
midbrain coronal sections of rat immunostained for TH (red), Pitx3
(green), merged and DAPI (nuclear stain, blue; A000 –E000 ). Scale bar
100 lm. TH-positive/Pitx3-positive-IR is shown by orange/yellow
neurons in the merged images of TH/Pitx3 (B00 –E00 ). F–K Quantita-
tive analysis of the number of TH neurons, Pitx3-positive neurons
and TH-positive neurons expressing Pitx3 (one-way ANOVA).
Results are shown as mean ± SEM
p \ 0.0001]. As shown in Fig. 4A, Newman–Keuls post
hoc test showed that acute and chronic morphine admin-
istration produced a significant (p \ 0.001) increase in Th
mRNA expression. ANOVA also showed significant
changes in Th mRNA after naloxone injection
[F(2,27) = 26.61; p \ 0.0001]. Unexpectedly, there was an
increase (p \ 0.001) in Th mRNA after naloxone injection
to control rats, which was attenuated (p \ 0.001) during
morphine withdrawal (Fig. 4B). Student’s t test showed
that Th mRNA expression in morphine-withdrawn rats was
significantly lower than that observed in morphine-depen-
dent rats (t22 = 3.895; p \ 0.001). We also quantified TH
protein levels in the VTA and NAc. ANOVA revealed no
significant alterations of TH after acute or chronic mor-
phine administration in the VTA [F(2,21) = 0.02444;
p = 0.9759; Fig. 4C]. ANOVA showed significant TH
changes after naloxone administration [F(2,20) = 4.823;
p = 0.0210]. Post hoc test revealed that TH immunoreac-
tivity was slightly increased (p \ 0.05) during morphine
withdrawal (Fig. 4D). We next quantified TH protein levels
in the medial accumbens shell, since this portion of NAc
receives strong dopaminergic innervations from the VTA
and appears to be more important than the core for reward.
ANOVA showed significant effect of morphine
[F(2,19) = 8.280; p = 0.0031]. As shown in Fig. 4E, post
hoc comparisons showed a significant increase in NAc TH
levels during morphine dependence. ANOVA also revealed
significant effect of naloxone administration
[F(2,16) = 5.554; = 0.0168]. As shown in Fig. 4F, there
was a significant (p \ 0.05) decrease in TH protein levels
in the NAc 60 min after naloxone injection to morphine-
dependent rats compared with placebo-pelleted rats also
receiving naloxone. In addition, Student’s t test showed
that TH protein levels in morphine-withdrawn animals
were significantly lower than those observed in morphine-
dependent rats (t10 = 3.045; p \ 0.05).
ANOVA for DA turnover (as revealed by DOPAC/DA
ratio) in the NAc showed significant effects of morphine
administration [F(2,15) = 35.14; p \ 0.0001]. Post hoc test
showed a significant (p \ 0.001) effect of acute morphine
injection. As shown in Fig. 4G, rats injected with morphine
showed higher DA turnover than the saline-injected group.
No changes were observed after chronic morphine treat-
ment. ANOVA revealed no changes in DA turnover after
naloxone administration [F(2,14) = 3.287; p = 0.0727;
Fig. 4H].
Immunohistochemical approach for the determination
of Nurr1 and Pitx3 in the VTA TH-positive neurons
The data from different studies are consistent with the
notion that the medial accumbens shell (drug-reward trigger
zone in the striatum) receives strong dopaminergic inner-
vation from the posteromedial VTA (Zangen et al. 2002;
Ikemoto 2007). Consequently, we focused on the effects of
morphine and morphine withdrawal on posterior VTA TH-
IR cell number and TH neurons expressing Nurr1 and Pitx3.
As shown in Fig. 5G, H, no significant changes were
detected for TH cell number after acute or chronic morphine
administration [ANOVA: F(2,11) = 0.1175; p = 0,8905] or
during morphine withdrawal [ANOVA: F(2,11) = 1.156;
p = 0.3574]. Subsequently, we investigated whether mor-
phine treatment and/or morphine withdrawal produce
changes in the number of Nurr1-positive neurons in the
posterior VTA. We did not identify differences after the
different treatments [ANOVA for morphine administration:
F(2,11) = 0.1333, p = 0,8769; ANOVA for morphine
withdrawal: F(2,11) = 0.7335, p = 0.5069], as depicted in
Fig. 5I, J. In the present study, we confirmed the co-local-
ization of Nurr1 with TH-positive neurons in the VTA
(Table 2). Representative images are shown in Fig. 5B–F000 ).
Double-labelling experiments showed that Nurr1-immu-
noreactivity (IR) was highly colocalized with the selective
DA neuron marker TH in the VTA, as shown in Fig. 5K, L.
ANOVA failed to detect any significant effects for acute or
chronic morphine administration [F(2,11) = 0.07373;
p = 0.9295] or during morphine withdrawal [F(2,11) =
0.6952; p = 0.5239] on the number of TH-positive neurons
expressing Nurr1 (Fig. 5K, L). As depicts Fig. 5F, G, no
significant changes were detected for TH cell number after
acute or chronic morphine administration [ANOVA:
F(2,11) = 0.2578; p = 0,7783] or during morphine with-
drawal [ANOVA: F(2,11) = 1.519; p = 0.2702]. We did not
identify significant differences in the number of Pitx3-
positive neurons in the posterior VTA after morphine
administration [F(2,11) = 0.2515; p = 0.7829] or during
morphine withdrawal [F(2,11) = 1.7800; p = 0.2232]. In
the present study, we confirmed the co-localization of Pitx3
with TH-positive neurons in the VTA (Table 2), although
no significant differences were found among the different
treatments [ANOVA for morphine administration:
F(2,11) = 0.1372, p = 0.8736; ANOVA for morphine
withdrawal: F(2,11) = 1.103, p = 0.3728; Fig. 6J, K).
Representative images are shown in Fig. 6A–E000 ).
123
 Brain Struct Funct

123
 Brain Struct Funct
b Fig. 7 Quantitative colocalization parameters of Nurr1 in TH-
positive neurons of the posterior VTA. Over a 7-day period, control
(pla) and morphine (mor)-dependent rats received saline (sal; s.c.),
morphine (mor; 20 mg/kg i.p.) or 1 mg/kg naloxone (nx; s.c.) and
were killed 60 min later. Representative confocal images in the VTA
of TH (red; A–E), Nurr1 (green; A0 –E0 ) and DAPI (nuclear stain,
grey; A00 –E00 ). Merged images are shown in A000 –E000 (Nurr1/TH).
Colocalization is shown by yellow/orange neurons in the cytoplasm of
merged images of TH/Nurr1. Scale bars 20 lm. Colocalization
analysis of TH and Nurr1 with JACoP. F–K Quantitative colocaliza-
tion analysis was performed, and several colocalization parameters
were determined [Pearson’s coefficient, Manders’ coefficient M1-the
fraction of objects in channel A (TH) colocalized with objects in
channel B (Nurr1) and Manders’ coefficient M2-vice versa]. Results
are shown as mean ± SEM. *p \ 0.05, **p \ 0.01 vs. pla ? sal;
?
p \ 0.05 vs. pla ? mor. L–O Three-dimensional reconstructions of
dopaminergic neurons expressing Nurr1 in the VTA after different
treatments. &&p \ 0.01 vs. mor ? sal (Student’s t test)
Quantitative colocalization analysis
Quantitative colocalization analysis was performed, and
correlation and colocalization parameters were performed.
Using Pearson’s and Manders’ coefficients, in the present
study, we confirmed the co-localization of Nurr1 and Pitx3
with TH-positive neurons in the posterior VTA. Repre-
sentative images are shown in Figs. 7A–E000 and 8A–E000 .
Double-labelling experiments showed that both Nurr1-
Pitx3-IRs were colocalized with the selective DA neuron
marker TH in the VTA. Quantitative analysis for TH-Nurr1
is shown in Fig. 7F–K and Supplementary (Online
Resource 3). According to the correlation analysis based on
Manders’ coefficient M2, Nurr1-IR was significantly
(p \ 0.05) detected in nuclear compartments of posterior
VTA TH-positive neurons during morphine dependence
(Fig. 7J). By contrast, naloxone-induced morphine with-
drawal significantly (p \ 0.01) decreases the expression of
Nurr1 in nuclear compartments of TH-positive cells
(Fig. 7K). Student’s t test showed an increase in Manders’
coefficient M2 in morphine-withdrawn rats compared with
morphine-dependent animals (t46 = 3.303; p \ 0.01).
Clear differences in the intracellular trafficking of Pitx3
were observable by the eye. Importantly, Pitx3-IR was
strongly detected in the nucleus of TH-positive cells after
acute morphine administration and in morphine-withdrawn
rats, according to the correlation analysis based on Pear-
son’s coefficient (p \ 0.001; Fig. 8F, G) and Manders’
coefficient M2 (p \ 0.05, p \ 0.01; Fig. 8J, K). Student’s
t test showed a decrease in Pearson’s coefficient during
morphine withdrawal compared with morphine-dependent
rats (t33 = 3.054; p \ 0.01). Additionally, Student’s t test
showed a decrease in Manders’ coefficient M2 in morphine-
dependent rats receiving naloxone compared with the
morphine-dependent group (t33 = 2.473; p \ 0.05).
Quantitative analysis for TH-Pitx3 is shown in Supple-
mentary (Online Resource 3).
Quantitative analysis of morphine and morphine
withdrawal-induced plasticity changes in VTA DA
neurons subpopulations
As shown in Fig. 9B–G, ANOVA showed no significant
effects of acute morphine administration, morphine
dependence or morphine withdrawal for TH-positive neu-
rons (B, C), Nurr1-positive (D, E) or TH-positive neurons
containing Nurr1 (F, G) in the lateral [morphine adminis-
tration: TH-positive, F(2,11) = 0.4239, p = 0.6669; Nurr1-
positive, F(2,11) = 0.1211, p = 0.8865; TH neurons con-
taining Nurr1, F(2,11) = 0.1839, p = 0.8351; morphine
withdrawal: TH-positive, F(2,11) = 0.4325, p = 0.6617;
Nurr1-positive, F(2,11) = 0.4625, p = 0.6439; TH neurons
containing Nurr1, F(2,11) = 0.2519, p = 0.7826], interme-
diate [morphine administration: TH-positive, F(2,11) =
0.5552, p = 0.5924; Nurr1-positive, F(2,11) = 0.7382,
p = 0.5048; TH neurons containing Nurr1, F(2,11) =
0.5452, p = 0.5977; morphine withdrawal: TH-positive,
F(2,11) = 0.07182, p = 0.9312; Nurr1-positive, F(2,11) =
0.4267, p = 0.6652; TH neurons containing Nurr1,
F(2,11) = 0.1601, p = 0.8544], medial [morphine admin-
istration: TH-positive, F(2,11) = 0.1131, p = 0.8943;
Nurr1-positive, F(2,11) = 0.7544, p = 0.4979; TH neurons
containing Nurr1, F(2,11) = 0.2158, p = 0.8099; morphine
withdrawal: TH-positive, F(2,11) = 0.7499, p = 0.4998;
Nurr1-positive, F(2,11) = 0.1505, p = 0.8624; TH neurons
containing Nurr1, F(2,11) = 0.2985, p = 0.7490] subre-
gions of the posterior VTA. As shown in Fig. 9B, G, there
were no significant differences in the number of VTA total
TH neurons [morphine administration: F(2,11) = 0.060,
p = 0.9421; morphine withdrawal: F(2,11) = 0.3919,
p = 0.6868], total Nurr1-positive neurons [morphine
administration: F(2,11) = 0.0368, p = 0.9639; morphine
withdrawal: F(2,11) = 0.4002, p = 0.6815] or total TH
neurons containing Nurr1 [morphine administration:
F(2,11) = 0.0455, p = 0.9557; morphine withdrawal:
F(2,11) = 0.0690. p = 0.9338].
As shown in Fig. 10A–F, ANOVA showed no significant
effects of acute morphine administration, morphine
dependence or morphine withdrawal for TH-positive neu-
rons (B, C), Pitx3-positive (D, E) or TH-positive neurons
containing Pitx3 (F, G) in the lateral [morphine adminis-
tration: TH-positive, F(2,11) = 0.3294, p = 0.7277; Pitx3-
positive, F(2,11) = 0.7380, p = 0.5049; TH neurons con-
taining Pitx3, F(2,11) = 0.7186, p = 0.5134; morphine
withdrawal: TH-positive, F(2,11) = 0.2942, p = 0.7520;
Pitx3-positive, F(2,11) = 1.2110, p = 0.3423; TH neurons
containing Pitx3, F(2,11) = 0.8035, p = 0.4774], intermediate
[morphine administration: TH-positive, F(2,11) = 0.2648,
p = 0.7731; Pitx3-positive, F(2,11) = 0.3040, p = 0.7452;
TH neurons containing Pitx3, F(2,11) = 0.1260, p = 0.8832;
morphine withdrawal: TH-positive, F(2,11) = 0.3558,
123
 Brain Struct Funct

123
 Brain Struct Funct
b Fig. 8 Quantitative colocalization parameters of Pitx3 in TH-positive
neurons of the posterior VTA. Over a 7-day period, control (pla) and
morphine (mor)-dependent rats received saline (sal; s.c.), morphine
(mor; 20 mg/kg i.p.) or 1 mg/kg naloxone (nx; s.c.) and were killed
60 min later. Representative confocal images in the VTA of TH (red;
A–E), Pitx3 (green; A0 –E0 ) and DAPI (nuclear stain, grey; A00 –E00 ).
Merged images are shown in A000 –E000 (TH/Pitx3). Colocalization is
shown by yellow/orange neurons in the cytoplasm of merged images
of TH/Pitx3. Scale bars 20 lm. Colocalization analysis of TH and
Pitx3 with JACoP. F–K Quantitative colocalization analysis was
performed, and several colocalization parameters were determined
[Pearson’s coefficient, Manders’ coefficient M1-the fraction of objects
in channel A (TH) colocalized with objects in channel B (Pitx3) and
Manders’ coefficient M2-vice versa]. Results are shown as mean ±
SEM. *p \ 0.05, **p \ 0.01, ***p \ 0.001 vs. pla ? sal; ?p \ 0.05
vs. pla ? mor; ##p \ 0.01, ###p \ 0.001 vs. pla ? nx. Arrows
indicate that Pitx3-IR was drastically expressed in the nucleus of
TH-positive neurons both during morphine withdrawal (E000 ) and after
a single dose of morphine (B000 ). L–O Three-dimensional reconstruc-
tions of dopaminergic neurons expressing Pitx3 in the VTA after
different treatments. &p \ 0.05, &&p \ 0.01 vs. mor ? sal (Student’s
t test)
p = 0.7100; Pitx3-positive, F(2,11) = 1.0120, p = 0.4015;
TH neurons containing Pitx3, F(2,11) = 0.3923; p =
0.6865], medial [morphine administration: TH-positive,
F(2,11) = 2.092, p = 0.1794; Pitx3-positive, F(2,11) = 0.2714,
p = 0.7684; TH neurons containing Pitx3, F(2,11) =
0.6020, p = 0.5683; morphine withdrawal: TH-positive,
F(2,11) = 0.9468, p = 0.4235; Pitx3-positive, F(2,11) =
0.5125, p = 0.6155; TH neurons containing Pitx3,
F(2,11) = 0.1002, p = 0.9056] subregions of the posterior
VTA. As shown in Fig. 9A, F, there were no significant
differences in the number of VTA total TH neurons
[morphine administration: F(2,11) = 0.2449, p = 0.7878;
morphine withdrawal: F(2,11) = 0.0402, p = 0.9607],
total Pitx3-positive neurons [morphine administration:
F(2,11) = 0.0422, p = 0.9588; morphine withdrawal:
F(2,11) = 1.6170, p = 0.2512) or total TH neurons con-
taining Pitx3 [morphine administration: F(2,11) = 0.0399,
p = 0.9610; morphine withdrawal: F(2,11) = 0.3270,
p = 0.7293).
Discussion
Multiple adaptive changes in molecular and cellular func-
tion in the mesolimbic DA system have been shown after
repeated opioid administration, which are thought to be
linked to the persistent craving and relapse in human and
animal addicts (Mazei-Robison and Nestler 2012; Nestler
2012). The present study provides new insight into the
regulation of DA markers in the VTA and NAc by acute
and chronic morphine as well as by morphine withdrawal
and suggests a role for the transcription factors Nurr1 and
Pitx3 as part of the machinery in dopaminergic neurons
that may act regulating patterns of transcription in response
to opiates.
TH, the rate-limiting enzyme for DA synthesis, as well as
the transcription factors Nurr1 and Pitx3 has been recently
identified as important regulators of DA function in the
midbrain (Jankovic et al. 2005; Smits and Smidt 2006;
Garcı́a-Pérez et al. 2013a, b). On the other hand, l-opioid
receptors (MOR) in the VTA are pivotally involved in
addictive behaviour (Matthes et al. 1996). Present study
provides neurobiological evidence that VTA neurons and its
projection area NAc are impaired in association with acute
and chronic morphine (MOR-agonist) administration as
well as with morphine withdrawal. Here, we show that acute
morphine administration, morphine dependence and mor-
phine withdrawal are, at least in part, sufficient for the
activation of the transcription factors Nurr1 and Pitx3 in the
VTA. Our observations regarding Nurr1 and Pitx3 protein
elevation in morphine-treated and morphine-withdrawn rats
add onto previous findings regarding the association of this
elevation to acute and chronic morphine administration at a
different time point (2 h) (Garcı́a-Pérez et al. 2013a, b). In
the present study, we also showed a direct correlation
between the change of Nurr1 protein levels and Nurr1
mRNA expression in the VTA. In contrast, Pitx3 mRNA
expression did not change after the same treatment,
although Pitx3 protein levels, as Nurr1, increased in the
VTA. Recent studies have shown that mRNA transcript
abundances only partially correlate with protein levels. In
fact, only 30–40 % of the variance in protein abundance is
explained by mRNA abundance (Vogel and Marcotte
2012). This evidence suggests a strong regulatory role for
processes downstream of transcription, such as post-tran-
scriptional (RNA processing, RNA stability, translational
and degradation) regulation in the determination of protein
concentration, contributing at least as much as transcription
itself (Lu et al. 2007; Vogel and Marcotte 2012).
Nurr1 and Pitx3 have been proposed to regulate typical
midbrain DA markers, thereby promoting the maintenance
of dopaminergic neurons during adult stage (Jankovic et al.
2005; Hwang et al. 2009; Reddy et al. 2011). Thus, few TH
cells remain within the VTA in the absence of Nurr1
(Kadkhodaei et al. 2009) or Pitx3 (Kim et al. 2007). In
addition, binding sites for both Nurr1 and Pitx3 have been
identified at the promoter region of Th gene (Jacobs et al.
2009a, b; Reddy et al. 2011). Our results revealed that both
acute and chronic morphine administration enhanced VTA
Th mRNA expression, which positively correlated with
Nurr1 and Pitx3 protein levels. These results would suggest
that a regulatory interaction exists between these tran-
scription factors and opiate effects on TH in the meso-
limbic pathway.
Opiates target GABAergic neurons in the VTA and
decrease their activity, which leads to an indirect increase
123

Fig. 9 Subregional number of TH, Nurr1 and TH neurons expressing
Nurr1 in the VTA from morphine-treated and morphine-withdrawn
rats. Over a 7-day period, control (pla) and morphine (mor)-dependent
rats received saline (sal; s.c.), morphine (mor; 20 mg/kg i.p.) or 1 mg/
kg naloxone (nx; s.c.) and were killed 60 min later. The analyzed
regions are schematically illustrated in A (diagram modified from
of DA neurons activity and DA release into synaptic cleft.
There is evidence that MOR constitutive activity regulates
GABAergic input to VTA dopaminergic neurons during a
drug-naive state (Meye et al. 2012). Furthermore, it has
been shown that endogenous opioids acting at the MOR in
the VTA have an important role in addiction (Wang et al.
2004; Meye et al. 2012). In the current study, our results
revealed that the blockade of MOR with the antagonist
naloxone in control animals induced an elevation of Nurr1
and Th mRNA levels in the VTA. Because Nurr1 is
required for proper neurotransmission and maintenance of
123
Brain Struct Funct
Paxinos and Watson 2007). B–G Quantitative analysis (one-way
ANOVA) revealed no significant changes in TH-positive neurons (B,
C), Nurr1-positive neurons (D, E) or TH neurons expressing Nurr1
(F, G) in the lateral, intermediate or medial VTA after the above
treatments. Bars represent the mean ± SEM
DA neurons (Jankovic et al. 2005; Jacobs et al. 2009a, b),
the combined increases in Nurr1 and Th mRNA expression
in control animals receiving naloxone may represent, in
part, some of the mechanisms that served to protect against
the possible decreased dopaminergic neurotransmission
due to increased GABAergic signalling onto VTA DA
neurons.
Acute morphine increases the firing rate of DA neurons
in the VTA and the release of DA in the NAc, thus acti-
vating mesolimbic reward pathway (Di Chiara and Bassa-
reo 2007; Mazei-Robison and Nestler 2012). This effect is
Brain Struct Funct
Fig. 10 Subregional number of TH, Pitx3 and TH neurons expressing
Pitx3 in the VTA from morphine-treated and morphine-withdrawn
rats. Over a 7-day period, control (pla) and morphine (mor)-dependent
rats received saline (sal; s.c.), morphine (mor; 20 mg/kg i.p.) or 1 mg/
kg naloxone (nx; s.c.) and were killed 60 min later. Quantitative
mediated by the binding of morphine to MOR on local
GABA neurons, thereby decreasing their activity and
subsequent GABA release on DA neurons and resulting in
disinhibition of DA neurons (Johnson and North 1992).
Consistent with this, present data showed DA release in the
context of DA turnover elevation in the NAc after single
administration of morphine. Here, we showed that a single
injection of morphine induced the activation of Nurr1 and
Pitx3 expression in the VTA. This fact can be interpreted
as a homoeostatic response to excess DA neurotransmis-
sion caused by acute exposure to morphine, thus main-
taining TH at normal levels and protecting against
excessive DA release. Present data also showed an increase
in Nurr1 and Pitx3 protein levels in morphine-withdrawn
rats, suggesting that these transcription factors may play a
role in controlling adaptation to morphine withdrawal-
induced depression of DA neurons activity in the NAc (as
revealed by decreased DA turnover), as has been proposed
recently (Garcı́a-Pérez et al. 2013a, b). These results are in
agreement with previous data showing an association of
opiate withdrawal with decreased activity of DA neurons
innervating the NAc (Georges et al. 2006). Decreases in
DA firing rate induced by withdrawal from chronic mor-
phine appear to be dependent on changes in GABA release.
analysis (one-way ANOVA) revealed no significant changes in TH-
positive neurons (A, B), Pitx3-positive neurons (C, D) or TH neurons
expressing Pitx3 (E, F) in the lateral, intermediate or medial VTA
after the above treatments. Bars represent the mean ± SEM
Thus, during morphine withdrawal, GABAergic signalling
onto VTA DA neurons is enhanced (Meye et al. 2012), an
effect that would contribute to the decreased dopaminergic
activity in the NAc. This is likely an important contributor
to the hypofunctionality of VTA neurons during morphine
withdrawal, which has been proposed to underlie the
compulsive drug intake that characterizes addiction (Vol-
kow et al. 2009). In fact, it has been demonstrated that the
expression of anxiety during opiate withdrawal results from
a drop in activity at VTA opiate receptors and the corre-
sponding loss of dopaminergic tone in terminal fields
(Radke et al. 2011). It remains to be determined the cas-
cade of events through which administration of naloxone to
control rats enhanced VTA Nurr1 and Th mRNAs.
It has been proposed that DA neurons in the posterior
VTA more specifically innervate ventromedial regions of
the striatum, including the medial shell of the NAc (the
drug-reward trigger zone in the striatum) (Zangen et al.
2002; Ikemoto 2007). On the other hand, the more ven-
trally located DA neurons project to more dorsal regions,
including the core of the NAc. Our data presented here
using immunofluorescence analysis indicate that overex-
pression of Nurr1 and Pitx3 after acute and chronic mor-
phine as well as during morphine withdrawal did not
123

correlate with an increase in the number of TH-positive
neurons in the posteromedial subregion of the VTA.
Likewise, quantitative analysis showed that the number of
Nurr1-, Pitx3-positive cells and TH neurons expressing
Nurr1 or Pitx3 were unchanged in the posterior VTA from
rats exposed to acute or chronic morphine or in morphine-
withdrawn animals, compared with their respective con-
trols. It is known that transcription factors are translocated
to the nucleus when activated. In vivo expression analysis
revealed that Nurr1 alone is not sufficient to drive the
dopaminergic phenotype in midbrain DA neurons, but
required Pitx3 for full activation of target gene expression
(Jacobs et al. 2009a, b). We therefore attempted to inves-
tigate whether Nurr1 and/or Pitx3 are translocated to the
nucleus of TH-positive neurons. Using immunostaining
and confocal microscopy in this report, we found that Pitx3
was significantly translocated to the nucleus of TH neurons
1 h after acute morphine administration and after naloxone
injection to morphine-dependent rats. These findings are
novel and are partially supported by previous studies
(Garcı́a-Pérez et al. 2013b), and might suggest that acute
morphine administration and morphine withdrawal activate
Pitx3. The recruitment of Pitx3 in the nucleus would lead
to activation of Nurr1 target gen Th in the dopaminergic
neurons of the posterior VTA.
Recent findings have proposed that DA neurons in the
VTA are not homogeneous and that specific molecular
and physiological properties are associated with the target
structures to which they project (Lammel et al. 2012;
Roeper 2013). Thus, neurons that project to the medial
shell of the NAc (a critical component of the endogenous
reward circuitry) and the mPFC are mainly located in the
medial posterior VTA, whereas neurons that project to the
lateral shell of the NAc are located in the lateral VTA
(Lammel et al. 2012). Accordingly, the modulation of
synaptic function in DA neurons by administration of
cocaine is not uniform but is associated with the brain
area to which the DA neurons project (Lammel et al.
2014). Our study showed that the number of TH neurons,
number of Nurr1- or Pitx3-positive cells, and the number
of TH neurons expressing Nurr1 or Pitx3 were not
modified in the subpopulations of DA neurons (lateral,
intermediate and medial) in the posterior VTA. Our
results could be explained by the hypothesis that cocaine
and morphine have a different mechanism of action on
mesolimbic DA circuitry. Thus, cocaine facilitates DA
neurotransmission by binding to DAT and inhibiting the
reuptake of DA into presynaptic neurons, whereas opiates
excite VTA DA neurons by a disinhibitory mechanism
involving GABA neurons (Hyman et al. 2006). For
present experiment, we can conclude that the changes in
transcription factors induced by morphine and morphine
withdrawal are consistent across the mediolateral extent
123
Brain Struct Funct
of the VTA, although differences in the expression of
Nurr1 and Pitx3 across the different subpopulations of the
VTA cannot be rule out.
In summary, this study shows that morphine dependence
and withdrawal are associated with consistent alteration of
transcription factors involved in the maintenance of dopa-
minergic neurons in the mesolimbic drug-reward pathway,
which correlated with alteration of TH. These results
suggest an impairment of the mesolimbic reward pathway
during opiate dependence and withdrawal and suggest an
important role for Nurr1 and Pitx3 in contributing to the
changes in gene expression that define neuronal plasticity
that ultimately regulate the motivation to consume opiates.
Acknowledgments This work was supported by grants from Min-
isterio de Ciencia e Imnovación (SAF/FEDER 2009-07178; SAF/
FEDER 2010-17907), Spain; Red de Trastornos Adictivos (RTA),
Instituto de Salud Carlos III, Spain; Fundación Séneca (15405/PI/10),
Región de Murcia, Spain. Daniel Garcı́a-Pérez was supported by a
fellowship from Ministerio de Economı́a e Innovación (AP2009-
2379).
References
Compton WM, Volkow ND (2006) Major increases in opioid
analgesic abuse in the United States: concerns and strategies.
Drug Alcohol Depend 81:103–107
Di Chiara G, Bassareo V (2007) Reward system and addiction: what
dopamine does and doesn’t do. Curr Opin Pharmacol 7:69–76
Dunn KW, Kamocka MM, MacDonald JH (2011) A practical guide to
evaluating colocalization in biological microscopy. Am J Physiol
Cell Physiol 300:C723–C742
Frenois F, Cador M, Caille S, Stinus L, Le Moine C (2002) Neural
correlates of the motivational and somatic components of
naloxone-precipitated morphine withdrawal. Eur J Neurosci
16:1377–1389
Garcı́a-Pérez D, Laorden ML, Milanes MV, Nı́ñez C (2012)
Glucocorticoids regulation of FosB/DFosB expression induced
by chronic opiate exposure in the brain stress system. PLoS One
7:e50264
Garcı́a-Pérez D, López-Bellido R, Hidalgo JM, Rodriguez RE,
Laorden ML, Núñez C, Milanés MV (2013a) Morphine regulates
Argonaute 2 and TH expression and activity but not miR-133b in
midbrain dopaminergic neurons. Addict Biol. doi:10.1111/adb.
12083
Garcı́a-Pérez D, Sáez-Belmonte F, Laorden ML, Núñez C, Milanés
MV, Milanés MV (2013b) Morphine administration modulates
expression of Argonaute 2 and dopamine-related transcription
factors involved in midbrain dopaminergic neurons function. Br
J Pharmacol 168:1889–1901
Georges F, Le Moine C, Aston-Jones G (2006) No effects of
morphine on ventral tegmental dopamine neurons during with-
drawal. J Neurosci 26:5720–5726
Horvath MC, Kovacs GG, Kovari V, Majtenyi K, Hurd YL, Keller E
(2007) Heroin abuse is characterized by discrete mesolimbic
dopamine and opioid abnormalities and exaggerated nuclear
receptor-related 1 transcriptional decline with age. J Neurosci
27:13371–13375
Houshyar H, Manalo S, Dallman MF (2004) Time-dependent
alterations in mRNA expression of brain neuropeptides
Brain Struct Funct
regulating energy balance and hypothalamo-pituitary-adrenal
activity after withdrawal from intermittent morphine treatment.
J Neurosci 24:9414–9424
Hwang DY, Hong S, Jeong JW, Choi S, Kim H, Kim J, Kim KS
(2009) Vesicular monoamine transporter 2 and dopamine
transporter are molecular targets of Pitx3 in the ventral midbrain
dopamine neurons. J Neurochem 111:1202–1212
Hyman SE, Malenka RC, Nestler EJ (2006) Neural mechanisms of
addiction: the role of reward-related learning and memory. Ann
Rev Neurosci 29:565–598
Ikemoto S (2007) Dopamine reward circuitry: two projection systems
from the ventral midbrain to the nucleus accumbens-olfactory
tubercle complex. Brain Res Brain Res Rev 56:27–78
Jacobs FMJ, van der Linden AJA, Wang Y, von Oerthel L, Sul HS,
Burbach JPH, Smidt MP (2009a) Identification of Dlk1, Ptpru
and Klhl1 as novel Nurr1 target genes in meso-diencephalic
dopamine neurons. Development 136:2363–2373
Jacobs FMJ, van Erp S, van der Linden AJA, von Oerthel L, Burbach
JP, Smidt MP (2009b) Pitx3 potentiates Nurr1 in dopamine
neuron terminal differentiation through release of SMRT-med-
iated repression. Development 136:531–540
Jankovic J, Chen S, Le WD (2005) The role of Nurr1 in the
development of dopaminergic neurons and Parkinson’s disease.
Prog Neurobiol 77:128–138
Johnson SW, North RA (1992) Opioids excite dopamine neurons by
hyperpolarization of local interneurons. J Neurosci 12:483–488
Kadkhodaei B, Ito T, Joodmardi E, Mattsson B, Rouillard C, Carta M,
Muramatsu SI, Sumi-Ichinose C, Nomura T, Metzger D,
Chambon P, Lindqvist E, Larsson NG, Olson L, Björklund A,
Ichinose H, Perlmann T (2009) Nurr1 is required for mainte-
nance of maturing and adult midbrain dopamine neurons.
J Neurosci 29:15923–15932
Kalivas PW, Volkow ND (2005) The neural basis of addiction: a
pathology of motivation and choice. Am J Psychiatry
162:1403–1413
Kim J, Inoue K, Ishii J, Vanti WB, Voronov SV, Murchison E,
Hannon G, Abeliovich A (2007) A microRNA feedback circuit
in midbrain dopamine neurons. Science 317:1220–1224
Lammel S, Lim BK, Ran C, Betley MJ, Tye KM, Malenka RC (2012)
Input-specific control of reward and aversion in the ventral
tegmental area. Nature 491:212–217
Lammel S, Lim BK, Malenka RC (2014) Reward and aversion in a
heterogeneous midbrain dopamine system. Neuropharmacology
76(Part B):351–359
Leng A, Feldon J, Ferger B (2004) Long-term social isolation and
medial prefrontal cortex: dopaminergic and cholinergic neuro-
transmission. Pharmacol Biochem Behav 77:371–379
Leo D, di Porzio U, Racagni G, Riva MA, Fumagalli F, Perrone-
Capano C (2007) Chronic cocaine administration modulates the
expression of transcription factors involved in midbrain dopa-
minergic neuron function. Exp Neurol 203:472–480
Lu P, Vogel C, Wang R, Yao X, Marcotte EM (2007) Absolute
protein expression profiling estimates the relative contributions
of transcriptional and translational regulation. Nat Biotech
25:117–124
Matthes HWD, Maldonado R, Simonin F, Valverde O, Slowe S,
Kitchen I, Befort K, Dierich A, Le Meur M, Dolle P, Tzavara E,
Hanoune J, Roques B, Kieffer BL (1996) Loss of morphine-
induced analgesia, reward effect and withdrawal symptoms in
mice lacking the [micro]-opioid-receptor gene. Nature
383:819–823
Mazei-Robison MS, Nestler EJ (2012) Opiate-induced molecular and
cellular plasticity of ventral tegmental area and locus coeruleus
catecholamine neurons. Cold Spring Harb Perspect Med
2:a012070
McClung CA, Nestler EJ (2008) Neuroplasticity mediated by altered
gene expression. Neuropsychopharmacology 33:3–17
Meye FJ, van Zessen R, Smidt MP, Adan RAH, Ramakers GMJ
(2012) Morphine withdrawal enhances constitutive ??-opioid
receptor activity in the ventral tegmental area. J Neurosci
32:16120–16128
Nestler EJ (2001) Molecular basis of long-term plasticity underlying
addiction. Nat Rev Neurosci 2:119–128
Nestler EJ (2012) Transcriptional mechanisms of drug addiction. Clin
Psychopharmacol Neurosci 10:136–143
Núñez C, Földes A, Pérez-Flores D, Garcı́a-Borrón JC, Laorden ML,
Kovács KJ, Milanés MV (2009) Elevated glucocorticoid levels
are responsible for induction of tyrosine hydroxylase (TH)
mRNA expression, phosphorylation and enzyme activity in the
nucleus of the solitary tract (NTS-A2) during morphine
withdrawal. Endocrinology 150:3118–3127
Paxinos G, Watson C (2007) The rat brain in stereotaxic coordinates,
6th edn. Academic Press, Amsterdam
Radke AK, Rothwell PE, Gevirtz JC (2011) An anatomical basis for
opponent process mechanisms of opiate withdrawal. J Neurosci
31:7533–7539
Reddy SD, Rayala SK, Ohshiro K, Pakala SB, Kobori N, Dash P, Yun
S, Qin J, O’Malley BW (2011) Multiple coregulatory control of
tyrosine hydroxylase gene transcription. PNAS 108:4200–4205
Roeper J (2013) Dissecting the diversity of midbrain dopamine
neurons. TINS 36:336–342
Sanchez-Simon FM, Zhang XX, Loh HH, Law PY, Rodriguez RE
(2010) Morphine regulates dopaminergic neuron differentiation
via miR-133b. Mol Pharmacol 78:935–942
Smidt MP, van Schaick HSA, Lanctôt C, Tremblay JJ, Cox JJ, van der
Kleij AAM, Wolterink G, Drouin J, Burbach JP (1997) A
homeodomain gene Ptx3 has highly restricted brain expression in
mesencephalic dopaminergic neurons. PNAS 94:13305–13310
Smidt MP, Asbreuk CH, Cox JJ, Chen H, Johnson RL, Burbach JP
(2000) A second independent pathway for development of
mesencephalic dopaminergic neurons requires Lmx1b. Nat
Neurosci 3:337–341
Smidt MP, Smits SM, Burbach JP (2004) Homeobox gene Pitx3 and
its role in the development of dopamine neurons of the substantia
nigra. Cell Tissue Res 318:35–43
Smits SM, Smidt MP (2006) The role of Pitx3 in survival of midbrain
dopaminergic neurons. J Neural Transm Suppl 70:57–60
Vogel C, Marcotte EM (2012) Insights into the regulation of protein
abundance from proteomic and transcriptomic analysis. Nat Rev
Genet 13:227–232
Volkow ND, Skolnick P (2012) New medications for substance use
disorders: challenges and opportunities. Neuropsychopharma-
cology 37:290–292
Volkow ND, Fowler JS, Wang GJ, Baler R, Telang F (2009) Imaging
dopamine’s role in drug abuse and addiction. Neuropharmacol-
ogy 56:3–8
Wang D, Raehal KM, Lin ET, Lowery JJ, Kieffer BL, Bilsky EJ,
Sadée W (2004) Basal signaling activity of l-opioid receptor in
mouse brain: role in narcotic dependence. J Pharmacol Exp Ther
308:512–520
Zangen A, Ikemoto S, Zadina JE, Wise RA (2002) Rewarding and
psychomotor stimulant effects of endomorphin-1: anteroposte-
rior differences within the ventral tegmental area and lack of
effect in nucleus accumbens. J Neurosci 22:7225–7233
Zinchuk V, Zinchuk O, Okada T (2007) Quantitative colocalization
analysis of multicolor confocal immunofluorescence microscopy
images: pushing pixels to explore biological phenomena. Acta
Histochem Cytochem 40:101–111
123