Scribd Logo
Upload

Welcome to Scribd!

  • Gentotyping Protocol

    Uploaded by

    Janak Awasthi
    27 views1 page
    This document provides a PCR protocol for amplifying a gene target from mouse genomic DNA using three primers. It lists the primer sequences and their lengths, reaction components and concentrations, thermal cycling conditions, and expected product sizes of 459 bp for the wild type allele and 160 bp for the targeted allele. The protocol results in distinct bands on a gel for the wild type and targeted alleles.

    Original Description:

    This is the protocol for genotyping using PCR

    Original Title

    Gentotyping protocol

    Copyright

    © © All Rights Reserved

    Available Formats

    PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document
    This document provides a PCR protocol for amplifying a gene target from mouse genomic DNA using three primers. It lists the primer sequences and their lengths, reaction components and concentrations, thermal cycling conditions, and expected product sizes of 459 bp for the wild type allele and 160 bp for the targeted allele. The protocol results in distinct bands on a gel for the wild type and targeted alleles.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Flag for inappropriate content
    Download as pdf or txt
    27 views1 page

    Gentotyping Protocol

    Uploaded by

    Janak Awasthi
    This document provides a PCR protocol for amplifying a gene target from mouse genomic DNA using three primers. It lists the primer sequences and their lengths, reaction components and concentrations, thermal cycling conditions, and expected product sizes of 459 bp for the wild type allele and 160 bp for the targeted allele. The protocol results in distinct bands on a gel for the wild type and targeted alleles.

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Flag for inappropriate content
    Download as pdf or txt
    of 1

    Sheet ID PS_02445 Print: 6/3/2009

    PCR protocol
    BRC
    Sh/+
    RBRC 00040 Strain name C;B6-a/a・B/B-W

    Primer primer_name primer_seq length


    1 Wild tttgcacgtgctagttacac 20 Am. J. Pathol., 173, 6, 1693-1701 (2008).

    2 Sh aggcttgcagcgcattatGAATG 23 Am. J. Pathol., 173, 6, 1693-1701 (2008).

    Sh Am. J. Pathol., 173, 6, 1693-1701 (2008).


    3 gaggattcatagttgttcaatgtcc 25

    Reaction Components Reaction Conditions


    Enzyme TaKaRa Ex Taq (Cat. No. RR001A)
    temp time
    step (℃) (sec) note
    Conc Run 1 Run 2 Run 3 Run 4 1 94 180
    H2O 16.3 2 94 30 *
    PCR buffer 10 X 2.5 3 57 30 *
    dNTP 2.5 mM 2.0 4 72 60 * *Repeat for 30 cycles
    primer 1 10 pmol/μl 1.0 5 72 300
    primer 2 10 pmol/μl 1.0
    primer 3 10 pmol/μl 1.0
    DNA 1.0
    Taq 0.2

    total 25

    Marker sh/+ +/+ Marker

    500 bp wild: 459 bp

    200 bp
    sh: 160 bp
    100 bp

    Marker PCR products


    100 bp ladder (Invitrogen, Cat. primer_set product_size product
    primer 1 primer 3 459 bp WT
    15628-050)
    Gel primer 2 primer 3 160 bp sh
    2% agarose in 1 X TAE (100 V, 30
    min)

    Comment

    You might also like