FOODBORNE PATHOGENS AND DISEASE

Volume 16, Number 11, 2019 ORIGINAL ARTICLES

ª Mary Ann Liebert, Inc.
DOI: 10.1089/fpd.2019.2629

Effect of Specimen Type and Processing on the Detection

of Clostridioides [Clostridium] difficile in Piglet Fecal Samples

Carmen Candel-Pérez,1 Silvia Martı́nez-Miró,2 Gaspar Ros-Berruezo,1 and Carmen Martı́nez-Graciá1

Abstract
Subclinical Clostridioides difficile colonization in piglets could be a potential source of this bacterium for
community-acquired C. difficile infection. The purposes of this study were to assess the effect of specimen type
and processing on C. difficile isolation, culture, and detection by polymerase chain reaction (PCR), and to
Downloaded by 5.13.47.20 from www.liebertpub.com at 11/10/19. For personal use only.

determine the occurrence of C. difficile in piglets of different ages. We compared different culture procedures—
direct plating, ethanol shock, and an enrichment step—to isolate C. difficile from swine feces and rectal swabs.
DNA was isolated directly from feces, processed feces, and bacterial isolates to detect the triose phosphate
isomerase (tpi) gene and identify the toxins A and B genes. The results show that ethanol shock increased the
C. difficile isolation from feces, while it decreased it for rectal swabs, in comparison with direct plating. The use
of the enrichment broth gave the highest C. difficile recovery from both types of specimen. Our findings show
low sensitivity for tpi gene detection after the DNA extraction directly from feces and an increase in PCR-
positive samples when feces were processed before the DNA extraction. The overall prevalence of C. difficile
was 16.9% (22/130), of which 100% were found to be toxigenic as assessed by the enrichment culture of fecal
samples. The rate of isolation of positive samples decreased with the animal age, regardless of the presence or
absence of diarrhea. Our results demonstrate the persistent reservoir of toxigenic C. difficile in fecal samples of
piglets and support the impact of specimen processing on its isolation.

Keywords: Clostridioides difficile, DNA extraction, enrichment culture, ethanol shock, foodborne transmission,
rectal swab

Introduction understand the potential changes in the epidemiology of

community-associated C. difficile infection in this country.

C lostridium difficile, recently renamed Clostridi-

oides difficile (Lawson et al., 2016), is a spore-forming
human pathogen associated with serious enteric diseases
around the world. C. difficile has been identified also as a
cause of enteritis in many animal species, including pigs, and
can be isolated from feces, from both diseased and healthy
animals (Songer and Anderson, 2006). Thus, subclinical an-
imals can be both hosts of C. difficile and possible carriers and
might play an important role in the spread of the community-
acquired infection (Hensgens et al., 2012). Furthermore, the
presence of C. difficile spores in the feces of animals destined
for human consumption may represent a risk for the con-
tamination of meat products, with a possible impact on the
economics of food production (EFSA BIOHAZ Panel,
2013).
The data available about C. difficile carriage in animals
destined for human consumption in Spain are scarce. De-
tection of animal C. difficile isolates would help us to further
A multitude of assays are available for C. difficile testing
(Arroyo et al., 2005). Traditionally, studies of enteric path-
ogens are based on stool specimens, although rectal swabs
have been proposed for use in surveillance studies of multiple
enteric pathogens, due to their easy collection, transport, and
handling. The need for specimen pretreatment before culture
is based on the fact that the presence of Clostridium spp. is
quantitatively lower than that of other microorganisms in
most fecal specimens. To facilitate the isolation and detection
of C. difficile, methods to eliminate fecal contaminants are
used, such as ethanol shock, based on the high survival ca-
pacity of the spores of C. difficile in ethanol, set against the
inactivation of the vegetative forms of the contaminants
present in the specimen (Marler et al., 1992). Molecular
detection methods could potentially serve as a more rapid
screening test, compared with conventional culturing tech-
niques (Bélanger et al., 2003; van den Berg et al., 2006, 2007).
However, many commercial assays for the detection of

Departments of 1Food Science and Nutrition and 2Animal Production, Veterinary Faculty, Regional Campus of International Excellence
Campus Mare Nostrum, University of Murcia, Murcia, Spain.

731
 732
C. difficile have been systematically evaluated for use in
human samples, but their performance with specimens of
animal origin or other complex samples (soil, water, food,
etc.) has not been validated.
The first objective of this study was to develop a specific and
sensitive method for C. difficile isolation from fecal specimens
of piglets and to assess if the C. difficile recoveries from feces
and rectal swabs were comparable. The second objective was
to evaluate the direct extraction of DNA from feces and pro-
cessed feces for the detection of C. difficile by polymerase
chain reaction (PCR). The third objective was to determine the
occurrence and the toxigenic profile of C. difficile in different
age groups of piglets from Murcia, Spain.
Materials and Methods
Animals and sampling
One hundred thirty samples of feces were obtained from
109 piglets belonging to 4 age-range populations (1–15 days,
16 days to 1 month, 1–2 months, and 2–3 months). Sampling
Downloaded by 5.13.47.20 from www.liebertpub.com at 11/10/19. For personal use only.
included 114 feces from 93 piglets from ‘‘farm A’’ and 16
from 16 piglets from ‘‘farm B,’’ both located in Murcia
(in the southeast of Spain), between February and October
2015.
All fecal specimens were collected directly from the ani-
mals in sterile plastic containers after rectal stimulation with
a dry cotton-tipped swab (Deltalab).
The samples were preserved in sterile packs at -20C until
being processed, except for an aliquot of each feces sample
that was used for procedure 3 (explained below); this was
processed within 2 h of its collection.
Specimen pretreatment and C. difficile cultivation
Eighteen feces samples, previously known to be culture
positive for C. difficile and their corresponding rectal swabs
were selected for the first objective. As a preparation step for
the specimens before culture, we tested an ethanol shock and
an enrichment step and compared both with the direct plating.
Procedure 1: ‘‘direct plating’’. A feces aliquot of *0.5 g
was directly plated onto C. difficile selective agar ‘‘CLO’’
(bioMèrieux, Marcy l’Etoile, France). Each rectal swab tip
was briefly scrubbed out onto solid CLO agar.
Procedure 2: ‘‘ethanol shock’’ before plating. A feces
aliquot of *1 g was mixed with an equal volume of filter-
sterilized 70% ethanol (v/v; Panreac Quı́mica S.L.U., Bar-
celona, Spain). Each rectal swab used in procedure 1 was
submerged for 30 s in a microtube containing 1 mL of 70%
ethanol. Both kinds of specimen-ethanol mixture were vor-
texed and incubated at room temperature (23–25C) for
20 min. Then, each mixture was centrifuged at 4000 rpm for
10 min, and 75 lL of the pellet, resuspended with the re-
maining ethanol, and were plated onto CLO agar.
Procedure 3: ‘‘enrichment step+ethanol shock’’ be-
fore plating. A feces aliquot of *1 g was inoculated into
5 mL of C. difficile enrichment broth medium described by
Blanco et al. (2013). Each rectal swab used in procedure 2
was also used in procedure 3 and was introduced into 5 mL of
C. difficile enrichment broth. The inoculated broths were
CANDEL-PÉREZ ET AL.
incubated anaerobically—80% N2, 10% CO2, and 10% H2—
in an anaerobic chamber (bioMèrieux) at 37C for 7 days.
Then, 2 mL of each broth was mixed with an equal volume of
filter-sterilized absolute ethanol (Panreac Quı́mica S.L.U.),
vortexed briefly and incubated at room temperature for 1 h.
Then, each mixture was centrifuged at 4000 rpm for 10 min,
and 75 lL of the pellet, resuspended with the remaining
broth, and were plated onto CLO agar.
Figure 1 shows a schematic representation of the proces-
sing of the specimens and the culture of the feces and rectal
swabs. The culture plating onto CLO agar was performed by
four-way streaking, differentiating four areas: discharge area,
first quadrant, second quadrant, and third quadrant. The
plates were incubated anaerobically at 37C for 72 h. The
isolates were identified as C. difficile on the basis of mor-
phological criteria (grayish, nonhemolytic, and rough colo-
nies) and the typical horse-manure-like odor. They were
subcultured onto brain heart infusion broth (BHI) agar plates
(Scharlau; Scharlab, S.L.) and incubated anaerobically at
37C for 24–48 h. The area where there was growth of sus-
pected C. difficile colonies and other fecal microbiota, able to
survive the ethanol and antibiotics used in the processing,
was recorded.
DNA extraction from bacterial isolates, feces,
and enriched feces
Figure 2 shows a schematic representation of DNA ex-
traction from bacterial isolates, feces, and enriched feces. The
DNA from C. difficile isolates was purified from suspected
C. difficile colonies grown on BHI agar by a manual method
described by Lemee et al. (2004). In brief, bacterial sus-
pensions, made using one colony and 0.5 mL of distilled
water, were heated at 100C for 20 min and then centrifuged
for 2 min at 10,000 rpm to pellet bacterial debris. The su-
pernatants were used as a source of DNA for PCR. This
manual method was set to compare with a commercial kit
designed for removing Taq polymerase inhibitors of com-
plex sample matrices. The commercial kit -QIAamp DNA
stool Mini Kit (Qiagen) was used for DNA extraction of 18
aliquots of feces (0.2 g) and 22 enriched—with C. difficile
enrichment broth—feces aliquots (0.2 mL), according to the
manufacturer’s protocol. The DNA was quantified in both
methods by absorbance spectrophotometry (NanoDrop-2000
Spectrophotometer; Thermo-Scientific, NanoDrop products,
Wilmington, DE).
Molecular identification and toxigenic profiling
of DNA isolates
All the DNA extracts were evaluated by real-time PCR for
the presence of the triose phosphate isomerase (tpi) house-
keeping gene, an alternative marker to 16S ribosomal DNA
for genotypic and phylogenetic characterization of bacterial
species (Verlag et al., 2003). This gene allows the differen-
tiation of pathogenic Clostridium species by revealing some
variable gene regions. Positive tpi gene isolates were
screened by PCR for the tcdA and tcdB genes, encoding toxin
A and toxin B, respectively. The sequences of the amplifi-
cation primers are listed in Table 1. The PCRs were per-
formed in a CFX96 thermal cycler (Bio-Rad), in a final
volume of 25 lL containing 0.5 lL of the forward primer
(10 lM), 0.5 lL of the reverse primer (10 lM), 1 lL of DNA
 C. DIFFICILE IN PIGLET FECAL SAMPLES
Downloaded by 5.13.47.20 from www.liebertpub.com at 11/10/19. For personal use only.
FIG. 1. Schematic representation of specimen pretreatment and culture of feces and rectal swabs. A detailed description
of procedures 1, 2, and 3 and the culture is given in the Materials and Methods section. RT, room temperature (23–25C)
template, 10.5 lL of PCR-grade water (Panreac Quı́mica
S.L.U.), and 12.5 lL of SensiMix SYBR No-ROX kit (Bio-
line). Detection of tpi and tcdB were done using the primers
and thermal cycling conditions as described by Lemee et al.
(2004). Detection of the nonrepeating region of tcdA gene
was done using the NK2 and NK3 primers as described by
Kato et al. (1991) and thermal cycling conditions as de-
scribed by Justin and Antony (2015). DNA manually ex-
tracted from an isolate of C. difficile ATCC 9689 (Colección
Española de Cultivos Tipo, Universitat de València, Spain)—
a strain positive for toxins A and B—and PCR-grade water
were used as positive and negative controls, respectively.
Finally, melting curve analysis was performed to determine
the specificity of the amplified products.
Results
The first objective of this study was to compare the per-
formance of three culture procedures—direct plating, ethanol
shock before plating, and an enrichment step before ethanol
shock—used to isolate C. difficile from piglet specimens and
to assess if the C. difficile recovery rates from feces and rectal
swab samples were comparable. C. difficile was recovered
from 66.67% (12/18) of feces and 94.44% (17/18) of rectal
swabs with the direct plating procedure (procedure 1). For
feces, the rate of recovery was increased when specimen
pretreatment was used, obtaining isolation rates of 94.44%
(17/18) with ethanol shock (procedure 2) and 100% (18/18)
with the enrichment step (procedure 3). By contrast, for rectal
swabs, the ethanol shock decreased the recovery rate to
83.33% (15/18), and the enrichment step increased the iso-
lation rate to 100% (18/18).
Table 2 shows the growth area results of pure and con-
taminated C. difficile-positive cultures from feces and the
733
corresponding rectal swab, according to the pretreatment. In
the direct plating procedure, C. difficile was isolated from
nonpure cultures contaminated with fecal microbiota in
91.67% of cases (11/12) for feces and in 88.23% of cases (15/
17) for rectal swabs. This contamination rate decreased when
specimen pretreatment was used, especially with ethanol
shock, obtaining contamination rates of 47.06% (8/17) in
feces and 46.67% (7/15) in rectal swabs, while the contami-
nation rate in the enrichment treatment was 72.22% (13/18) in
feces and 83.33% (15/18) in rectal swabs. Regarding the
growth area, in most cases C. difficile reached the third
quadrant in the selective medium, mainly in the feces samples.
The second objective of this study was to assess the per-
formance of DNA extraction—directly from feces, from
enriched feces, and from bacterial isolates—for the detection
of C. difficile by PCR. A mismatch between the PCR results
for bacterial isolates and those of feces was found. Positive
PCR results obtained from bacterial isolates of a selection of
feces were taken into account to determine true positive
samples. On this basis, the specific C. difficile tpi gene was
amplified in 11.11% (2/18) of samples when the DNA used in
the PCR was extracted directly from feces. When DNA ex-
tract from a fecal aliquot was enriched with C. difficile en-
richment broth, C. difficile was detected in 27.27% (6/22) of
samples.
The third objective of this study was to determine the oc-
currence of toxigenic C. difficile in different age groups of
piglets. Table 3 shows the occurrence of C. difficile-positive
feces cultures according to the age population and feces
consistency. Of the 130 feces samples processed with the
enrichment culture (procedure 3), bacterial growth was ob-
tained in 111 samples, of which 31 were suspected C. difficile
colonies. The presence of the tpi gene was confirmed in
16.9% (22/130) of samples, all of them from the same farm.
 734 CANDEL-PÉREZ ET AL.
Downloaded by 5.13.47.20 from www.liebertpub.com at 11/10/19. For personal use only.

FIG. 2. Schematic representation of DNA extraction from bacterial isolates, feces, and enriched feces.

All the positive samples belonged to different animals. Both
the tcdA gene and the tcdB gene were amplified by PCR
(A+B+) in 100% (22/22) of C. difficile isolates.
Discussion
In the present study, the ethanol shock treatment of spec-
imens before plating decreased the growth of fecal bacteria,
favoring the identification of C. difficile and accelerating its
isolation. The incubation of specimens in an enrichment
broth supplemented with lysozyme and compounds such as
bile salts improves C. difficile recovery, facilitating the ger-
mination of its spores on a solid medium (Buggy et al., 1985).
We obtained the 100% C. difficile recovery both in feces and
swabs with the enrichment incubation before plating, in
agreement with other authors (Arroyo et al., 2005; Blanco

Table 1. Sequences of the Specific Primers Used in Polymerase Chain Reaction Amplification
Gene target Specific primersa Oligonucleotide sequence (5¢/ 3¢) References
tpi tpi-F AAAGAAGCTACTAAGGGTACAAA Lemee et al. (2004)
tpi-R CATAATATTGGGTCTATTCCTAC
tcdAb NK3-F GGAAGAAAAGAACTTCTGGCTCACTCAGGT Kato et al. (1991)
NK2-R CCCAATAGAAGATTCAATATTAAGCTT
tcdB tcdB-F GGAAAAGAGAATGGTTTTATTAA Lemee et al. (2004)
tcdB-R ATCTTTAGTTATAACTTTGACATCTTT
a
All primers were purchased from Sigma-Aldrich (St Louis, MO).
b
Nonrepeating region.
tpi, triose phosphate isomerase.
 C. DIFFICILE IN PIGLET FECAL SAMPLES 735

Table 2. Growth Area Results of Pure and Contaminated Clostridioides Difficile-Positive Cultures
from Feces and the Corresponding Rectal Swab, According to the Pretreatment
Procedure 1 Procedure 2 Procedure 3
Feces
n consistency Feces Rectal swab Feces Rectal swab Feces Rectal swab
a
1 S NG NG d NG ++ +++
2 L NG da da NG +a +++
3 L NG ++ NG d da +++
4 S NG d d da +++ +++
5 S NG + da d da +
6 S NG d + +a + ++a
7 S d d +++a da +++ +++
8 L +a da ++a NG ++ +++
9 L +++ ++ +++ ++ +++ +++
10 L +++ ++ +++a +++ +++ +++
11 S +++ ++ +++ +a +++a ++a
12 S +++ ++ +++ ++a +++a ++a
13 S +++ ++ +++ ++ +++ +++
14 S +++ ++ +++a ++a +++ +++
15 S +++ ++ +++ ++a +++ +++
Downloaded by 5.13.47.20 from www.liebertpub.com at 11/10/19. For personal use only.

16 S +++ ++ +++a ++a +++ +++

17 S +++ ++ +++a +++ +++ ++
18 S +++ +++ +++ +++ ++ +++
a
C. difficile pure culture.
+, first quadrant; ++, second quadrant; +++, third quadrant; d, discharged area; L, liquid; NG, no growth; S, solid/semisolid.

et al., 2013). In this study, the enrichment treatment of rectal
swabs gave sensitivity results identical to those of feces, in
agreement with other authors (McFarland et al., 1987; Curry
et al., 2011; Kundrapu et al., 2012; Shakir et al., 2012).
Unlike the feces culture, direct plating of swabs yielded better
recovery rates than the ethanol shock procedure. This may be
due to the fact that the same swab was used for procedures 1
and 2, being the first step in the direct plating. During the
rolling of the swab tip over the culture medium surface, the
microbial load may have been reduced for the next step. If
two different swabs were used, further studies would be
necessary to conclude whether a causal association existed
between the order of swab collection and the order of the
pretreatment used.
Although PCR could serve as a rapid screening test, the
literature on this topic is limited to a few studies, which
reported varied performance with respect to the detection of
C. difficile directly in feces of animal origin (Alvarez-Pérez
et al., 2009; Avbersek et al., 2011, 2017). Our findings show
low sensitivity for tpi gene detection after DNA extraction
directly from piglet feces, using the commercial kit, com-
pared with the manual method for extraction from bacterial
isolates. The most critical step in PCR assays is the proces-
sing of the specimens. Although it is not essential to isolate
DNA of great purity, it is necessary to remove or inactivate
substances that may inhibit PCR assays and that are common
to complex samples, such as feces. The enrichment of sam-
ples before PCR analysis, consisting of sample incubation in
a selective broth for 5–7 days, and subsequent DNA extrac-
tion from these broths, has been shown to be effective in the
detection of DNA in complex samples (Tansuphasiri et al.,
2005; Houser et al., 2010). In accordance with this, the data
presented in this study show a 16.16% increase in PCR-
positive samples when the feces were enriched before DNA
extraction, compared with nonenriched feces. A likely ex-
planation for this result is that this enrichment procedure
includes the multiplication of C. difficile in a broth to a PCR-
detectable concentration. Despite the enrichment step used in
this study, 16 samples were positive for C. difficile culture
and negative for tpi gene detection. Although the reason for
this observation remains unclear, we speculate that these
false-negative results are due to the duration of the lysis step
used in DNA extraction and the difficulty in achieving lysis
of the spores. As C. difficile is sporogenic, its resistant spore
coat is difficult to lyse; therefore, the release of nucleic acids
is limited and this reduces the effectiveness of C. difficile

Table 3. Occurrence of Clostridioides Difficile-Positive Feces Cultures, According to the Pig Age
Population and Feces Consistency
Feces consistency
Facility Age population Liquid Semisolid/solid Total C. difficile-positive cultures
Farrowing 1–15 Days 36.36% (4/11) 31.25% (10/32) 32.56% (14/43)
16 Days to 1 month 0 11.11% (1/9) 11.11% (1/9)
Nursery 1–2 Months 6.67% (2/30) 13.64% (3/22) 9.62% (5/52)
2–3 Months 0 (0/3) 8.69% (2/23) 7.69% (2/26)
Total 13.63% (6/44) 18.6% (16/86) 16.92% (22/130)
 736
DNA extraction methods (Avbersek et al., 2017). These sen-
sitivity analysis results agree with the Society for Healthcare
Epidemiology of America and the Infectious Diseases Society
of America, which recommend feces culture as the most
sensitive test (Cohen et al., 2010). Although traditional culture
is time-consuming and laborious, it provides an isolate for
further genotyping and susceptibility testing, essential for ep-
idemiological studies (Cohen et al., 2010).
Previous European reports showed that the mean carriage
rate of C. difficile in symptomatic and subclinical piglets was
24.3%, with the highest rate reported in Sweden (67%)
(Rodriguez et al., 2016). Our findings show an overall
prevalence of C. difficile of 16.9%. This is lower than that
reported in other European studies, but comparable to pre-
vious results from other farms in Spain, which showed an
isolation rate of 17.9% for the studied population (Alvarez-
Pérez et al., 2009). Worldwide, the overall prevalence ranges
from 0% to 73%, with the highest rate reported in Ohio
(Rodriguez et al., 2016). All the 22 isolates found in this
study were toxigenic. This was in agreement with the isola-
Downloaded by 5.13.47.20 from www.liebertpub.com at 11/10/19. For personal use only.
tion rates obtained in previous reports that toxin genes were
found at 83.6–100% of isolates (Rodriguez et al., 2016).
Hopman et al. (2011) demonstrated a cumulative preva-
lence of 100% within 48 h after the birth of piglets. This
intestinal colonization in new-born piglets occurs during the
first hours of life, although clinical manifestations only occur
in specific circumstances (Hopman et al., 2011). An impor-
tant age effect was observed in the C. difficile colonization
and several studies reported a significant decrease in isolation
rates over time for piglets after the first week of life (Alvarez-
Pérez et al., 2009; Weese, 2009; Rodriguez et al., 2012). Our
results indicate a decrease in colonization rates to below 10%
after the first month of life. Among the population groups
analyzed in the present study, carriage rates ranged from
7.69% of 2- to 3-month-old pigs to 32.56% of piglets <15
days old. A likely explanation for this age effect is that the
bacterium is better able to colonize and proliferate in the
intestinal tract of younger animals, where the gut microbiota
is less developed.
Conclusion
This study demonstrates that subclinical colonization in
piglets could be a significant reservoir of C. difficile and a
potential source of bacteria for community-acquired C. dif-
ficile disease. Currently, no guidelines are available for the
detection of C. difficile in animals. Our results support the use
of an enrichment broth supplemented with sodium taur-
ocholate before plating on a solid medium; therefore, this step
is recommended to maximize the C. difficile recovery. The
establishment of a standardized method could be useful in the
implementation of measures to prevent C. difficile trans-
mission to farm personnel or its entry into the food chain by
contamination of carcasses at slaughterhouses.
Ethics Statement
The study received approval from the University Ethics
Committee for Animal Experimentation and the Autonomic
Community of Murcia Region Ethics Committee (Study
protocol No. A13150101). The study was carried out in ac-
cordance with EU Directive 2010/63/EU for the care and use
of animals for scientific purposes.
CANDEL-PÉREZ ET AL.
Acknowledgment
This work was supported by the University of Murcia and
the Regional Campus of International Excellence Campus
Mare Nostrum.
Disclosure Statement
No competing financial interests exist.
References
Alvarez-Pérez S, Blanco JL, Bouza E, Alba P, Gibert X, Mal-
donado J, Garcia ME. Prevalence of Clostridium difficile in
diarrhoeic and non-diarrhoeic piglets. Vet Microbiol J 2009;
137:302–305.
Arroyo LG, Rousseau J, Willey BM, Low DE, Staempfli H,
McGeer A, Weese JS. 2005. Use of a selective enrichment
broth to recover Clostridium difficile from stool swabs stored
under different conditions. J Clin Microbiol 2005;43:5341–
5343.
Avbersek J, Cotman M, Ocepek M. Detection of Clostridium
difficile in animals: Comparison of real-time PCR assays with
the culture method. J Med Microbiol 2011;60:1119–1125.
Avbersek J, Zajc U, Gruntar I, Krt B, Ocepek M. Evaluation
and comparison of DNA extraction kits for the detection of
Clostridium difficile in spiked and field faeces from piglets by
real-time PCR. Slov Vet Res 2017;54:143–148.
Bélanger SD, Boissinot M, Clairoux N, Picard FJ, Bergeron
MG, Be SD, Picard J. Rapid detection of Clostridium difficile
in feces by real-time PCR rapid detection of Clostridium
difficile in feces by real-time PCR. J Clin Microbiol 2003;41:
730–734.
Blanco JL, Álvarez-Pérez S, Garcı́a ME. Is the prevalence of
Clostridium difficile in animals underestimated? Vet J 2013;
197:694–698.
Buggy BP, Hawkins CC, Fekety R. Effect of adding sodium
taurocholate to selective media on the recovery of Clos-
tridium difficile from environmental surfaces. J Clin Micro-
biol 1985;21:636–637.
Cohen SH, Gerding DN, Johnson S, Kelly CP, Loo VG,
McDonald LC, Pepin J, Wilcox MH. Clinical practice
guidelines for Clostridium difficile infection in adults: 2010
update by the society for healthcare epidemiology of America
(SHEA) and the infectious diseases society of America
(IDSA). Infect Control Hosp Epidemiol 2010;31:431–455.
Curry SR, Schlackman JL, Hamilton TM, Henderson TK,
Brown NT, Marsh JW, Shutt K, Brooks MM, Pasculle W,
Muto C, Harrison LH. Perirectal swab surveillance for
Clostridium difficile by use of selective broth preamplifica-
tion and real-time PCR detection of tcdB. J Clin Microbiol
2011;49:3788–3793.
[EFSA BIOHAZ Panel] EFSA Panel on Biological Hazards.
Scientific opinion on the public health hazards to be covered
by inspection of meat (bovine animals). EFSA Journal 2013;
11:3266.
Hensgens MPM, Keessen EC, Squire MM, Riley TV, Koene
MGJ, de Boer E, Lipman LJA. Clostridium difficile infection
in the community: A zoonotic disease? Clin Microbiol Infect
2012;18:635–645.
Hopman NE, Keessen EC, Harmanus C, Sanders IM, van
Leengoed LA, Kuijper EJ, Lipman LJ. Acquisition of Clos-
tridium difficile by piglets. Vet Microbiol 2011;149:186–192.
Houser BA, Hattel AL, Jayarao BM. Real-time multiplex
polymerase chain reaction assay for rapid detection of
 C. DIFFICILE IN PIGLET FECAL SAMPLES
Clostridium difficile toxin-encoding strains. Foodborne Pa-
thog Dis 2010;7:719–726.
Justin S, Antony B. Polymerase chain reaction for the detection
of toxin A (Tcd A) and toxin B (Tcd B) genes of Clostridium
difficile isolated from diarrhoeal cases and analysis of the
clinical spectrum. J Evol Med Dent Sci 2015;4:4938–4947.
Kato N, Ou C, Kato H, Bartley SL, Brown VK, Dowell VR,
Ueno K. Identification of toxigenic Clostridium difficile by the
polymerase chain reaction. J Clin Microbiol 1991;29:33–37.
Kundrapu S, Sunkesula VCK, Jury La, Sethi AK, Donskey CJ.
Utility of perirectal swab specimens for diagnosis of Clos-
tridium difficile infection. Clin Infect Dis 2012;55:1527–1530.
Lawson PA, Citron DM, Tyrrell KL, Finegold SM. Re-
classification of Clostridium difficile as Clostridioides difficile
(Hall and O’Toole 1935) Prévot 1938. Anaerobe 2016;40:
95–99.
Lemee L, Dhalluin A, Testelin S, Mattrat M, Maillard K, Pons
J. Multiplex PCR targeting tpi (triose phosphate isomerase),
tcdA (toxin A), and tcdB (toxin B) genes for toxigenic culture
of Clostridium difficile. J Clin Microbiol 2004;42:5710–5714.
Marler LM, Siders JA, Wolters LC, Pettigrew Y, Skitt BL,
Downloaded by 5.13.47.20 from www.liebertpub.com at 11/10/19. For personal use only.
Allen SD. Comparison of five cultural procedures for isola-
tion of Clostridium difficile from stools. J Clin Microbiol
1992;30:514–516.
McFarland LV, Coyle MB, Kremer WH, Stamm WE. Rectal
swab cultures for Clostridium difficile surveillance studies.
J Clin Microbiol 1987;25:2241–2242.
Rodriguez C, Taminiau B, Broeck JV, Delme M, Daube G.
Clostridium difficile in food and animals: A comprehensive
review. Adv Exp Med Biol 2016;932:65–92.
Rodriguez C, Taminiau B, Van Broeck J, Avesani V, Delmeé
M, Daube G. Clostridium difficile in young farm animals and
slaughter animals in Belgium. Anaerobe 2012;18:621–625.
Shakir FA, Thompson D, Marlar R, Ali T. A novel use of rectal
swab to test for Clostridium difficile infection by real-time
PCR. Am J Gastroenterol 2012;107:1444–1445.
737
Songer JG, Anderson MA. Clostridium difficile: An important
pathogen of food animals. Anaerobe 2006;12:1–4.
Tansuphasiri U, Chanyasanha C, Cheaochantanakij N. An en-
richment broth culture-duplex PCR combination assay for the
rapid detection of enterotoxigenic Clostridium perfringens in
fecal specimens. Southeast Asian J Trop Med Public Health
2005;36:1229–1238.
van den Berg RJ, Kuijper EJ, van Coppenraet LESB, Claas ECJ.
Rapid diagnosis of toxinogenic Clostridium difficile in faecal
samples with internally controlled real-time PCR. Clin Mi-
crobiol Infect 2006;12:184–186.
van den Berg RJ, Vaessen N, Endtz HP, Schülin T, Van Der
Vorm ER, Kuijper EJ. Evaluation of real-time PCR and
conventional diagnostic methods for the detection of Clos-
tridium difficile-associated diarrhoea in a prospective multi-
centre study. J Med Microbiol 2007;56:36–42.
Verlag F, Dhalluin A, Lemée L, Pestel-Caron M, Mory F, Le-
luan G, Lemeland J, Pons J. Genotypic differentiation of
twelve clostridium species by polymorphism analysis of the
triosephosphate isomerase (tpi). Gene 2003;96:90–96.
Weese JS. Clostridium difficile in food—Innocent bystander or
serious threat? Clin Microbiol Infect 2009;16:3–10.
Address correspondence to:
Carmen Martı́nez-Graciá, PhD
Department of Food Science and Nutrition
Veterinary Faculty
Regional Campus of International Excellence
Campus Mare Nostrum
University of Murcia
Campus Espinardo
Murcia 30100
Spain
E-mail: mamen@um.es