Veterinary Parasitology 124 (2004) 187–199

www.elsevier.com/locate/vetpar

Detection of Trypanosoma evansi in camels using

PCR and CATT/T. evansi tests in Kenya
Z.K. Njirua,*, C.C. Constantinea, J.M. Ndung’uc, I. Robertsonb,
S. Okayec, R.C.A. Thompsona, S.A. Reida
a
Western Australian Biomedical Research Institute, Division of Health Sciences, School of Veterinary
and Biomedical Sciences, Murdoch University, South Street, Murdoch, WA 6150, Australia
b
Division of Health Sciences, School of Veterinary and Biomedical Sciences, Murdoch University,
South Street, Murdoch, WA 6150, Australia
c
Kenya Trypanosomiasis Research Institute (KETRI), P.O. box 362, Kikuyu, Kenya
Received 27 February 2004; received in revised form 18 June 2004; accepted 26 June 2004

Abstract

Camel trypanosomosis (Surra) causes high morbidity and is an impediment to the camel
husbandry in Kenya. The lack of a sensitive diagnostic test has hindered the collection of accurate
epidemiological data and institution of control programmes. A cross-sectional study was con-
ducted in three districts of Kenya to estimate the prevalence of Trypanosoma evansi (T. evansi) and
to compare four diagnostic tests: polymerase chain reaction (PCR), card agglutination test (CATT/
T. evansi), microhaematocrit centrifugation technique (MHCT) and mouse inoculation (MI). A
total of 549 camels were randomly sampled. The overall prevalence of Surra was 5.3% using
MHCT, 26.6% using PCR and 45.9% using CATT/T.evansi. There was a significant difference (P
< 0.001) between PCR and CATT/T.evansi test, MHCT and MI in detection of T. evansi. The
prevalence of T. evansi was 39.8% in Samburu, 24.7% in Nanyuki and 14.4% in Isiolo districts
using PCR. A male camel was 2.6 times more likely to be infected with T. evansi compared to a
female camel (OR = 3.0% CI: 1.6, 4.1), while an adult camel was 2.2 times more likely to be
infected compared to non-adults (OR = 2.2; 95% CI: 1.2, 5.0). There was a poor association
between the presence of the published clinical signs and seropositivity (k = 0.12), PCR (k = 0.11)
and MHCT (k = 0.05). However, there was a higher agreement between farmers’ classification
of disease with the PCR test (k = 0.5, n = 61). The mean PCV varied with age, presence of
infection, locality and gender, with the lowest mean PCV being recorded in MHCT-positive

* Corresponding author. Tel.: +61 08 9360 2690; fax: +61 08 9310 4144.
E-mail address: zknjiru@hotmail.com (Z.K. Njiru).

0304-4017/$ – see front matter # 2004 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetpar.2004.06.029
188 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199

animals (20.97
0.5) and from infected calves (19.5
1.2). This study shows that PCR was
more sensitive in detecting T. evansi than other tests used. Further, the prevalence of T. evansi
in the camel herds sampled is higher than that previously reported in Kenya, and that the
judgment by camel keepers may be a reliable ‘‘pen-side’’ diagnostic test for Surra. Considering
the low sensitivity of parasitological techniques in detection of chronic T. evansi infection and
high cost of PCR, development of a sensitive pen side diagnostic test, with a low cost is still a
priority.
# 2004 Elsevier B.V. All rights reserved.

Keywords: Trypanosoma evansi; Camel; PCR; CATT/T. evansi; Trypanosomosis

1. Introduction

Trypanosma evansi (T. evansi), the cause of cameline trypanosomosis (Surra), is the
most widespread pathogenic trypanosome in the world. It is mechanically transmitted by
haemotophagus biting flies and therefore distributed widely outside the tsetse belts. The
disease causes significant morbidity and mortality in camels in arid and semi arid regions in
Kenya, which have a population of over 1 million camels and support over 25% of human
population and over half of livestock production (Anonymous, 1997).
Trypanosomosis in camels occurs both in chronic and acute forms (Wilson et al., 1983).
The chronic form is most common and may present an association with secondary
infections due to immunosuppression caused by T. evansi infection, which complicates
clinical diagnosis. Published clinical signs (emaciation, fever, anaemia, lacramation,
corneal opacity, diarrhoea and oedema of the dependent parts) (Chaudhary and Iqbal,
2000) are insufficient for diagnosis, while detection of parasites in the blood is difficult
because parasitaemia is intermittent (Mahmound and Gray, 1980). Consequently, there is a
need for alternative more sensitive diagnostic techniques.
Serological tests have been developed and evaluated for diagnosis of trypanosomosis in
camels. The antibody-detecting tests such as the CATT/T. evansi (Bajyana-Songa and
Hamers, 1988) and enzyme-linked immunosorbent assay (Ab-ELISA) (Atarhouch et al.,
2003) have been shown to be reliable while the antigen based Suratex1 (Nantulya, 1994)
and Ag-ELISA (Olaho-Mukani et al., 1993) are seldom used. CATT/T. evansi, which is a
commercially produced kit, is widely used in the field. However, it is unable to distinguish
past (treated) from current infections because it detects antibodies that may persist for a
long time following treatment. The polymerase chain reaction (PCR) is highly sensitive
and specific and has been widely used in detection of trypanosomes. Primers targeting
subgroup Trypanozoon (Moser et al., 1989; Masiga, 1994; Wuyts et al., 1994) and
putatively T. evansi-specific (Artama et al., 1991; Masiga, 1994; Ventura et al., 2002) have
been developed. The PCR has been used in surveys to determine the prevalence of T. evansi
in buffaloes in Vietnam (Holland et al., 2001) and T. equiperdum in Mongolian horses
(Clausen et al., 2003). However, PCR has not been systematically used for the detection of
T. evansi in camels in Kenya (Masiga and Nyang’ao, 2001).
In this study, we determined the prevalence of T. evansi in three camel-keeping regions
of Kenya and compared the diagnostic utility of PCR, CATT/T. evansi, MHCT and mouse
inoculation for the detection of T. evansi infections in camels.
 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199 189

2. Materials and methods

2.1. Sampling sites

A survey was conducted in three districts Samburu (Wamba and Ngurunit), Isiolo
(Tractor, Eremet, Isiolo town and Ngare Ndare) and Nanyuki (Nanyuki town and Eldana)
districts in August, 2003. The districts lie between longitudes 3684W and 3684 27E and
between latitudes 0817S and 0845N. Rearing of camels is the major activity in these regions
although small ruminants (sheep and goats) are also kept. The camels are moved by owners
within a defined area depending on the availability of pasture. Rainfall is bimodal in pattern
with long rains occurring between March and May and short rains from October to
December. The annual rainfall and temperatures range from 500 to 900 mm and 20 to
37 8C, respectively. In Isiolo and Nanyuki, vegetation is predominantly savannah with
Acacia species; communities of wooded grassland and bush land thickets are found along
seasonal watercourses. In Samburu, most of the regions containing camels are grasslands
with scattered Acacia species and short shrubs, with stretches of bare land. Numerous
biting flies (Haematobia minuta) are prevalent in Nanyuki and Isiolo with few recorded
occurrences of Tabanus taeniola, Hippobosca camelina and H. variegata (Njiru et al.,
2002).

2.2. Study design and sampling

A cross-sectional sampling procedure was used during this study. A total of 549
camels were sampled, 153 in Isiolo, 161 in Samburu and 235 in Nanyuki district,
respectively. The sampling areas were chosen because information from respective
district veterinary offices suggested the presence of Surra. Before the field trip,
information was passed to the camel owners through their community leaders. On the day
of sampling, animals were selected using a random number generator, marked using
permanent spray, then information on age, gender, previous trypanocide treatment,
history of abortions and weight estimations was recorded. Each animal was clinically
examined, and 5 ml of blood was collected from the jugular vein. Two millilitres of blood
was placed into a tube containing heparin for PCV, parasite examination and mouse
inoculation, and 3 ml blood was placed in plain tubes and left to clot for serum collection.
The serum was removed after 12 h and stored in liquid nitrogen. Collected heparinised
blood samples were stored in cool boxes and transported to a temporary laboratory within
the immediate vicinity. Approximately, 0.5 ml of blood was transferred into cryovials,
mixed with phosphate saline glucose (PSG) and 10% glycerol, and stored in liquid
nitrogen for subsequent extraction of genomic DNA. Animals were grouped into age
groups; calves <12 months, immature 12 and 36 months and adults >36 months for
purposes of analysis.

2.3. Parasitological examination and mouse inoculation

Two capillary tubes were prepared from each heparinised blood sample and centrifuged
in a microhaematocrit centrifuge for 5 min at 12,000 g. The packed cell volume (PCV) was
190 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199

determined, and both capillary tubes were examined for the presence of motile
trypanosomes using the microhaematocrit centrifugation technique (MHCT) (Woo, 1970)
and the buffy-coat technique (Murray et al., 1977). Four hundred microlitres of blood from
animals with a PCVof 26% and/or showing clinical signs suggestive of Surra (Chaudhary
and Iqbal, 2000) were inoculated into Swiss-bred mice, which were screened for infection
with T. evansi by wet smear examination of tail-tip blood every day for 60 days. Any
camel shown to be infected with T. evansi using MHCT and those animals showing clinical
signs suggestive of Surra (emaciation, PCV 20% or a recent history of abortion) were
treated with quinapyramine sulphate/chloride (Triquin1) intramuscular at 5 mg/kg body
weight.

2.4. Serological tests

Sera were tested for the presence of anti-T. evansi antibodies using the card
agglutination test for T. evansi (CATT/T. evansi) (Institute of Tropical Medicine, Antwerp,
Belgium). Approximately, 45 ml of the antigen was transferred into the test card and mixed
with an equal amount of the test sera diluted at 1/4 with PBS pH 7.2 as per manufacturer’s
instructions. The card was agitated for 5 min, and the reaction was checked in the clear
light. Positive reaction was confirmed on recording agglutinations (blue granules)
(Bajyana-Songa and Hamers, 1988).

2.5. Template preparation and DNA amplification

Genomic DNA was extracted from samples of camel blood using commercially
available QIAamp DNA mini kit (Qiagen, 2003), and the purified DNA template was
stored at 20 8C for later use. PCR was carried out in 25 ml reaction mixtures containing
10 reaction buffer (Fischer Biotech), 1.5 mM MgCl2, 200 mM of each of the four
deoxynucleoside triphosphates (dNTPs) (Promega), primers at 1 mM and 0.5 U of Taq
DNA polymerase (Fischer Biotech). The cycles included an initial step at 94 8C for 4 min,
followed by 30 cycles of denaturing at 948 C for 30 s, annealing at 608 C for 30 s and
extension at 728 C for 30 s. PCR Elongation was continued at 728 C for 5 min. The amount
of DNA template added per reaction was 3 ml. A positive (reference T. evansi DNA, 25–
50 ng/ml) and a negative control (without DNA) were included for each PCR reaction.
Amplification products were resolved in 1.5% molecular grade agarose gel (Fischer
Biotech) stained with ethidium bromide (5 mg/ml).

2.6. Primers

Primers targeting a repetitive region specific for Trypanozoon subgenus (Wuyts et al.,
1994) pMURTec.F, 50 -TGCAGACGACCTGACGCTACT; pMURTec.R, 50 -CTCCTA-
GAAGCTTCGGTGTCCT and T. evansi minicircle specific (Masiga, 1994) EVA1, 50 -
ACATATCAACAACGACAAAG, EVA2 50 -CCCTAGTATCTCCAATGAAT were used.
Since the minicircle primers are less sensitive than the Wuyts primers, they were used only
on those samples that gave strong reactions using the latter primers and/or on samples
shown to be MHCT positive.
 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199 191

2.7. Weight measurements

The live body weight of camels (kg) was estimated by measuring (in meters) shoulder
height, thoracic girth and abdominal girth and multiplying these by 50 (Schwartz et al.,
1983). Only camels from Isiolo and Samburu districts had their weights estimated.

2.8. Statistical analysis

Statistical analysis was performed using SPSS v11.5. The level of agreement between
diagnostic tests was determined using (Kappa statistics (k) and the influence on prevalence
of various factors, such as gender, age, locality, abortion and presence of clinical signs were
determined using chi-square test and odds ratios and their 95% confidence intervals.
Analyses of variance (ANOVA) with Bonferoni mean-separation tests and t-tests were used
to compare mean PCV values and weights in groups of camels.

3. Results

3.1. Diagnostic tests analysis

A total of 549 camels were screened for infection with T. evansi using parasitological
methods (MHCT and BCT), PCR and the CATT/T. evansi. Overall prevalence was 5.3%
(95% CI: 3.4, 7.2) with the MHCT, 26.2% (95% CI: 22.5, 29.9) with the PCR and 45.9%
(95% CI: 41.7, 50.1) with CATT/T. evansi. The prevalence of infection in each area
sampled is presented in Table 1. There was a significant difference in the prevalence
estimate determined using PCR and CATT/T. evansi (P < 0.001) while prevalence
estimates using MHCT was significantly lower (P < 0.001) than those of PCR and CATT/T.
evansi. There was fair agreement between PCR and MHCT (k = 0.3; 95% CI: 0.22, 0.38)
and between PCR and CATT/T. evansi (k = 0.2; 95% CI: 0.13, 0.27). Camel owners
identified the clinical signs of Surra as rough coat, drop in milk yield, abortion and by a
characteristic urine odour. There was a moderate agreement between diagnosis by camel
owners and PCR (k = 0.52; 95% CI: 0.3, 0.7, n = 61). Using PCR results, a camel reared in
Samburu district was four times (OR = 3.9; 95% CI: 2.3, 6.8) and two times (OR = 2.0; 95%
CI: 1.3, 3.1) more likely to be infected than a camel reared in either Isiolo or Nanyuki
district, respectively.

Table 1
T. evansi and seroprevalence in Samburu, Isiolo and Nanyuki district
District No. of animals MHCT PCR CATT test
Positive (%) 95% CI Positive (%) 95% CI Positive (%) 95% CI
Samburu 161 20 (12.4) 7.3, 17.5 64 (39.8) 32.2, 47.4 68 (42.2) 34.6, 49.8
Isiolo 153 2 (1.3) 0, 3.1 22 (14.4) 8.8, 20.0 53 (34.6) 27.1, 42.1
Nanyuki 235 7 (3.0) 0.8, 5.2 58 (24.7) 19.2, 30.2 131 (55.7) 49.3, 62.1
Total 549 29 (5.3) 3.4, 7.2 144 (26.2) 22.5, 29.9 252 (45.9) 41.7, 50.1
192 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199

Fig. 1. Prevalence of T. evansi within age structure and sex.

3.2. Age and gender

The prevalence of infection estimated using PCR was significantly higher in adult
camels as compared to immature and calves (P < 0.05 and P < 0.01, respectively). The
prevalence of T. evansi infection estimated using PCR and MHCT was also higher in male
compared to female camels (x2 = 17.0, df = 1, P < 0.001 and (x2 = 9.1, df = 1, P < 0.01,
respectively) (Fig. 1). Conversely, the seroprevalence was higher in adult camels compared
to immature camels and calves (P < 0.001). Adult camels were 2.2 times more likely to be
CATT/T. evansi-positive compared to non adult camel (OR = 2.2; 95% CI: 1.2, 5.0). There
was no significant difference in the seroprevalence between the genders while male camels
were 2.6 times more likely to be T. evansi-positive using PCR test compared to female
camels (OR = 2.6; 95% CI: 1.6, 4.1).

3.3. Packed cell volume

The lowest PCV means were recorded for MHCT-positive animals (20.9
0.5),
infected calves (19.5
1.4) and animals from Samburu district (23.1
0.4). Overall the
mean male camels had significantly lower PCVs compared to female camels (P < 0.05)
and immature camels had significantly lower PCVs compared to adult camels (P < 0.001)
(Table 2). The PCV of camels shown to have circulating T. evansi by PCR or MHCT was
significantly lower than aparasitaemic animals (P < 0.001). There was no significant
difference in mean PCV of seropositive and seronegative camels.

3.4. Sensitivity

Of 29 MHCT-positive samples collected in this study, 28 (96.6%) were PCR-positive

and 19 (65.5%) CATT/T. evansi-positive. Using both tests, 19 samples were positive and
only one was negative on both tests. In earlier and separately collected samples, PCR
 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199 193

Table 2
Packed cell volume for camels in Samburu and Isiolo district
Category n Mean PCV Status n PCV
S.E.M. t-test
Gender
Male 95 23.48
0.43a Infected 41 22.98
0.52
Non infected 54 23.69
0.63 P = 0.4
b
Female 454 25.23
0.17 Infected 103 24.28
0.43
Non infected 351 25.51
0.18 P < 0.01
Age
Adult 397 25.55
0.18c Infected 119 24.59
0.36
Non infected 278 25.97
0.20 P < 0.001
Immature 84 24.95
0.35c Infected 15 21.47
0.60
Non infected 69 25.71
0.34 P < 0.001
d
Calves 68 21.09
0.4 Infected 10 19.50
1.39
Non infected 58 21.36
0.41 P = 0.12
Districts
Samburu 161 23.11
0.36b Infected 64 22.48
0.62
Non infected 97 23.53
0.43 P = 0.16
a
Isiolo 153 25.54
0.28 Infected 22 26.77
0.75
Non infected 131 25.33
0.29 P = 0.06
a
Nanyuki 235 25.73
0.19 Infected 58 24.40
0.28
Non infected 177 26.17
0.23 P < 0.001
Superscripts that are different are significantly different within each group for mean PCV (mean PCV for age and
district was analyzed with ANOVA, P < 0.05, while gender was done with t-test, P < 0.05).

sensitivity was 70/72 (97.2%) and 48/72 (66.7%) for CATT/T. evansi test. Mouse
inoculation sensitivity was done for 22 positive samples from Samburu and Isiolo of which
19 (86.4%) were positive. There was a poor association but still significant difference
between MI and PCR in detecting T. evansi infections in 175 aparasitaemic samples (k =
0.19; P < 0.001) as shown in Table 3.

3.5. Weights

The estimated mean weights for adults, immature and calves were 484
9.1, 264

13.3 and 203
16.4 kg, respectively. Significant difference weights were only recorded
Table 3
Relationship between PCR and mouse inoculation in detection of T. evansi infections in aparasitaemic camels with
PCV of 26% and showing clinical signs of Surra
Mouse inoculation PCR
Positive Negative Total
Positive 8 2 10
Negative 42 123 165
Total 50 125 175
Fischer’s exact test, P < 0.001, k = 0.19, 95% CI: 0.06, 0.3.
194 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199

between seropositive (501
8.75) and seronegative adults (462
17.3) (P < 0.05) and
between estimated weights of camels from Isiolo and Samburu (433.75
14.30 and
(381.36
12.8; P < 0.001).

4. Discussion

In this study, infection with T. evansi infection was demonstrated in the three districts
sampled. The prevalence estimates from this study are higher than those of previous studies
(Ngaira et al., 2003). There is no obvious reason why the prevalence of T. evansi in camels
in Samburu district was higher than in other districts sampled. However, it is worth noting
that the areas visited in Samburu district were difficult to access (poor roads especially in
the rainy seasons) as compared to Nanyuki and Isiolo, which have better communication
and transport network. Therefore, it is possible that some of the difference in prevalence
may be because camel keepers in the latter districts have better access to trypanocidal drugs
and veterinary services.
The results of this study indicate that PCR is the most accurate test for the detection of T.
evansi parasitaemia in camels. PCR has been used successfully in detecting infection with
T. evansi in buffaloes (Omanwar et al., 1999; Holland et al., 2001), horses (Clausen et al.,
2003) and in camels (Masiga and Nyang’ao, 2001). It is interesting to note that the
prevalence estimate determined using PCR varied in the different districts visited with the
highest prevalence in Samburu district. This may indicate differences in the epidemiology
of infection because seroprevalence did not vary significantly with district, which might
indicate a higher level of active infections in Samburu compared to other districts. These
differences may also be due to genetic differences in T. evansi isolated from each area.
Animals in Samburu district also weighed less and showed poor body conditions due to
factors, which were associated with higher disease burden and poor foliage.
The CATT/T.evansi test is a well-validated field assay for the detection of T. evansi in
camels (Dia et al., 1997; Ngaira et al., 2003) buffalo (Davison et al., 1999) and cattle (Reid
and Copeman, 2003)). It has been the test of choice for the field surveys, although being an
antibody-detecting assay, it has inherent shortcomings of not being able to differentiate
between past and present infections. The sensitivity of CATT/T. evansi in this study was
65.5%, which compared well with 68.6% reported in an earlier study by Ngaira et al.
(2003) in Isiolo district. So far, there is no comprehensive data on the use of PCR for
detecting infection in camels and/or comparison of CATT/T. evansi test with PCR. Such
data are necessary in the face of camel husbandry strengthening in Kenya. A comparison of
the PCR with CATT/T. evansi showed a significant difference (P < 0.001) and only a fair
association (k = 0.3), implying that the two tests were categorizing infections
independently. The CATT/T. evansi test failed to detect 51/144 (35.4%) of PCR positive
samples and 10/29 (3.5%) of MHCT positive samples. Not only the phenomenon of
parasitological positive samples but CATT/T. evansi negative test were also observed by
Ngaira et al. (2003), Elsaid et al. (1998) and Davison et al. (1999). The 51 PCR positive
cases missed by CATT/T. evansi may indicate early infections where animals have not yet
formed detectable antibody levels or isolates that lack Ro Tat 1.2 gene and/or do not
express Ro Tat 1.2 VSG. If treatment had been instigated based on the results of CATT/T.
 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199 195

evansi, 252 animals would have been treated as opposed to 144 animals if the results had
been based on the PCR. Assuming no false positive with PCR, this indicates 108 (43%)
unnecessary treatments. This means that in an area where treatment is frequent, CATT/T.
evansi test needs to be used with second confirmatory test. In our case, PCR, although
expensive, it was the most appropriate in detecting both chronic and current infections.
The CATT/T. evansi is based on variable surface antigen (VSG) designated as RoTat 1.2,
which is thought to be expressed in all T. evansi isolates (Verloo et al., 2001). However,
recently Ngaira et al. (2004) have shown isolates from Kenya that lack both Ro Tat 1.2 gene
and their associated VSG and another group of isolates with Ro Tat 1.2 gene but absence of
expressed VSG. Earlier studies showed variable expression of VSG genes in the closely
related species T. b. gambiense (Dukes et al., 1992). If the recently observed variations are
widespread in Kenya camel-rearing regions, then it may explain the low sensitivity of the
CATT/T. evansi observed. Moreover, isolates of T. evansi from Kenya have also been
shown to differ genetically (Gibson et al., 1983) and the existence of T.evansi type B
suggests some genetic variation occurring in the Kenyan northern frontier (Borst et al.,
1987). Further ongoing studies of isolates from the same study areas reveal regional genetic
differences in T. evansi isolates (Njiru, unpublished results). The possible occurrence of
infections with other Trypanozoon parasites was ruled out by testing most of the PCR-
positive isolates (n = 88) with T. evansi-specific minicircle primers (Masiga, 1994).
Ongoing work will confirm whether our 10 MHCT-positive but CATT/T. evansi-negative
isolates express the RoTat 1.2 gene. However, one way to improve CATT/T. evansi
sensitivity would be to add other not additional to other antigens in the test.
The PCR test had a sensitivity of 97% in this study and 97.2% in a separate study using
Trypanozoon spp primers (Wuyts et al., 1994). The one missed case in this study could
either be due to degraded DNA and/or loss of DNA during extraction. The strength of PCR
was further shown in detection of infection in aparasitaemic animals showing clinical
symptoms (Table 3). Analysis of animals with PCV of 26% and some with clinical signs
of Surra (lachrimation, diarrhoea, emaciation, enlargement of lymph nodes and recent
aborted females) showed T. evansi prevalence of 50/175 (28.6%) and 10/175 (5.7%) with
PCR and MI. When all clinical symptoms were combined together, a fair association
between clinical signs and seroprelevalence (k = 0.3; 95% CI: 0.22, 0.38) and low
association with PCR (k = 0.1; 95% CI: 0.05, 0.19) were recorded. These results are
suggestive that Surra may not be the only cause of the observed clinical signs. This
argument is reflected in the low numbers of infected animals showing each clinical
symptom, e.g. 1/7 (diarrhoea), 5/15 (lacrimation) and 10/26 (emaciated) were positive
either with MHCT or PCR. Documented clinical signs of Surra are general for most of the
susceptible animals. In the absence of other diagnostic techniques, this leaves treatment of
camels based on personal opinion/experience. An interesting strong association (k = 0.5;
95% CI: 0.32, 0.72, n = 61) was shown in this study between signs recognized by camel
keepers (urine with a characteristic smell, drying up of lactating camels, reluctance to
move, rough coat and abortions) and infection in animals (MHCT and PCR). The
characteristic smell of urine is due to ketones produced after breakdown of amino acids by
parasite in infected animals (Hunter, 1986). Though the sample size was small, it appears
that the camel owners have dependable diagnostic knowledge of Surra having lived with
these animals for generations. Use of parasitological technique in T. evansi detection still
196 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199

remains wanting because of the chronic nature of T. evansi in the field. Both BCT and
MHCT will not be done away soon considering the cost of other diagnostic techniques.
However, these techniques may be made more useful if clinical sign guidelines are
established with disease prevalence and are used side by side.
In this study, 36 camels were treated in Samburu and Isiolo district based on results of
PCV, MHCT and the presence of clinical signs in the field. However, the PCR results
indicated that 86 of the sampled animals were infected in these regions. If the PCR
indicated active infection, then 58.1% of infected animals could not be detected through the
most commonly used method. If we included CATT/T. evansi test results, the number
treated could have gone up to 52 still leaving 39.2% animals as untreated but also
increasing the number of treated ‘‘false’’ negative. These undetected cases would
eventually act as a source for future infection in the herds. MI is a frequently used technique
in the field to detect latent infections. In our study, MI showed a sensitivity of 86.4% of
parasitaemic cases, however it picked only 16% (8/50) of PCR-positive aparasitaemic
cases. The low prevalence identified with the MI may be due to trypanosomes being lost
through the mice immune systems. Sensitivity of MI may be improved by use of irradiated
mice though expensive.
The observation that seropositivity increases with age is in agreement with previous
studies (Dia et al., 1997; Atarhouch et al., 2003; Gutierrez et al., 2000) and is probably
related to the chronic nature of infection and possibility that antibodies persist after a
camel is treated. However, it was also noted that the camel owners prefer to graze calves
within the vicinity of human dwellings as opposed to older camels which are grazed and
watered in the open and hence have greater potential for contact with vectors. There is
insufficient data to explain the observed differences in the prevalence of infections
between males and female camels. One possibility is that hormonal differences may
influence vector behaviour and increase the likelihood of infection in male compared to
female camels.
Twenty-six animals were reported to have aborted between 1 and 6 months period prior
to this study. When camel keepers routinely treat these animals with trypanocides,
immediately an abortion occurs. Of these animals, 14/26 (53.8%) were still positive for T.
evansi with PCR (including 3 MHCT-positive cases) and the same number were
seropositive. Ten animals with active infection also were seropositive and eight animals
were negative with both PCR and CATT/T.evansi test. Active infection in these already
treated camels indicates either re-infection or treatment failure. Misuses of drugs through
under dosing (often self-administrated by the camel keepers without correct weight
adjustment or using a single vial to treat several animals) and fake drugs (Ngaira et al.,
2002) may have consequential effects on T. evansi prevalence and the development of
resistance.
There was a significant relationship between infection and low PCV. Previous authors
have tried to determine a cut-off value for PCVs that can be used for diagnostic purposes.
For example, <23% was proposed by Ngaira et al. (2002) in Kenya, 20% by Chartier et al.
(1986), in Mauritania and 18% by Diall et al. (1993) in Mali. Though anaemia could result
from T. evansi infection, other factors such as infection with Haemonchus spp and the
effects of drought could cause similar effects. In this study, we found that camels shown to
be PCR and MHCT-positive had significantly lower PCVs compared to uninfected camels.
 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199 197

We further found significant differences in PCV by locality, gender and age (Table 2).
Therefore, it is difficult to use PCV as the sole indicator of infection with T. evansi.
Trypanosomosis continues to pose a great risk to camel keeping in Kenya. Low
sensitivity of diagnostic techniques is a major factor impeding the control of this disease.
This study has shown that Surra is prevalent in all three districts sampled at significantly
different levels. The PCR test showed the best sensitivity compared with CATT/T. evansi
using MHCT positive samples as the gold standard. Noting the chronic nature of the
disease and apparent low sensitivity of CATT/T. evansi in Kenya, the use of PCR is
recommended for inclusion in survey and control programmes. In instances where
treatment has to be carried out immediately in the field, consideration of the farmers’
diagnosis with respect to documented signs by veterinarian is necessary. However, we
recommend a further comprehensive study on farmers’ diagnostic knowledge versus
disease prevalence in the camel herds. In cases where low PCV as a measure of infection is
used, considerations of other factors like age and genders are necessary.

Acknowledgements

The authors gratefully acknowledge the financial support from the International
Foundation for Science (IFS grant number B3372 to Z.K.Njiru), Kenya government and
Murdoch University. Supplemental funds were contributed by Western Australia
Biomedical Research Institute (WABRI). We also thank Dr. Thuita, Dr. Chemuliti,
Rashid Farah and Veterinary department, Isiolo district for helping with field sampling,
Purity Njoka, John Ndichu and Samuel Guya for excellent technical assistance.

References

Artama, W.T., Agey, M.W., Danelson, J.E., 1991. DNA comparison of Trypanosoma evansi (Indonesia) and
Trypanosoma brucei spp. Parasitology 104, 67–74.
Atarhouch, T., Rami, M., Bendahman, M.N., Dakkak, A., 2003. Camel trypanosomosis in Morocco 1: results of a
first epidemiological survey. Vet. Parasitol. 111, 277–286.
Bajyana Songa, E., Hamers, R., 1988. A card agglutination test (CATT) for veterinary use based on early VAT
RoTat 1.2 of Trypanosoma evansi. Ann. Soc. Belg. Med. Trop. 68, 233–240.
Borst, P., Fase-Fowler, F., Gibson, W.C., 1987. Kinetoplast DNA of Trypanosoma evansi. Mol. Biochem. Parasitol.
23, 31–38.
Clausen, P.H., Chuluun, S., Sodnomdarjaa, R., Greiner, M., Noeckler, K., Staak, C., Zessin, K.H., Schein, E., 2003.
A field study to estimate the prevalence of Trypanosoma equiperdum in Mongolian horses. Vet. Parasitol. 115,
9–18.
Chartier, C., Chartier, F., Lepers, J.P., Pesce, J.L., 1986. Preliminary studies of common blood parameters of the
Mauritanian dromedary (Camelus dromedaries). Rev. Elev. Med. Vet. Pays. Trop. 39, 395–401.
Chaudhary, Z.I., Iqbal, M.J., 2000. Incidence, biochemical and haematological alterations induced by natural
trypanosomosis in racing dromedary camels. Acta Trop. 77, 209–213.
Davison, H.C., Thrusfield, M.V., Muharsini, S., Husein, A., Partoutomo, S., Rae, P.F., Masake, R., Luckins, A.G.,
1999. Evaluation of antigen and antibody detection tests for Trypanosoma evansi infection of buffaloes in
Indonesia. Epidemiol. Infect. 123, 149–155.
Dia, M.L., Diop, C., Aminetou, M., Jacquiet, P., Thiam, A., 1997. Some factors affecting the prevalence of
Trypanosoma evansi in camels in Mauritania. Vet. Parasitol. 72, 111–120.
198 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199

Diall, O., Bocoum, Z., Diarra, B., Sanogo, Y., Coulibaly, Z., Waigalo, Y., 1993. Epidemiology of trypanosomosis
caused by T. evansi in camels in Mali: results of parasitological and clinical survey. Rev. Elev. Med. Vet. Pays.
Trop. 46, 455–461.
Dukes, P., Gibson, W.C., Gashumba, J.K., Hudson, K.M., Bromidge, T.J., Kaukus, A., Asonganyi, T., Magnus, E.,
1992. Absence of the LiTat 1.3 (CATT antigen) gene in Trypanosoma brucei gambiense stocks from
Cameroon. Acta Trop. 51, 123–134.
Elsaid, H.M., Nantulya, V.M., Hilali, M., 1998. Diagnosis of Trypanosoma evansi infection among Sudanese
camels imported to Egypt using card agglutination test (CATT) and antigen detection latex agglutination test
(Suratex). J. Protozool. Res. 8, 194–200.
Gibson, W.C., Wilson, A.J., Moloo, S.K., 1983. Characterization of Trypanosoma (Trypanozoon) evansi from
camels in Kenya using isoenzyme electrophoresis. Res. Vet. Sci. 34, 114–118.
Gutierrez, C., Juste, M.C., Corbera, J.A., Magnus, E., Verloo, D., Montoya, J.A., 2000. Camel Trypanosomosis in
the Canary Islands: assessment of seroprevalence and infection rates using the card agglutination test (CATT/
T. evansi) and parasite tests. Vet. Parasitol. 90, 155–159.
Holland, W.G., Claes, F., My, L.N., Thanh, N.G., Tam, P.T., Verloo, D., Buscher, P., Goddeeris, B., Vercruysse, J.,
2001. A comparative evaluation of parasitological tests and a PCR for Trypanosoma evansi diagnosis in
experimentally infected water buffaloes. Vet. Parasitol. 97, 23–33.
Hunter, A.G., 1986. Urine odour in a camel suffering from Surra T. evansi infection. Trop. Anim. Health Prod. 18,
146–148.
Anonymous, 1997. The Eighth National Development Plan, Government printers, Nairobi, Kenya, pp. 76–77.
Masiga, D.K., 1994. The Development and Application of the Polymerase Chain Reaction Methodology for the
Identification of African Trypanosomes, Ph.D. Thesis, University of Bristol.
Masiga, R.C., Nyang’ao, J.M., 2001. Identification of trypanosome species from camel using polymerase chain
reaction and procyclic transformation test. Camel Pract. Res. 8, 17–22.
Mahmound, M.M., Gray, A.R., 1980. Trypanosomosis due to T. evansi (Istell, 1885; Balbiani, 1885). A review of
recent research. Trop. Anim. Health Prod. 12, 35–47.
Moser, D.R., Cook, G.A., Ochs, D.E., Bailey, C.P., McKane, M.R., Donelson, J.E., 1989. Detection of
Trypanosoma congolense and T. brucei ssp by DNA amplification using the polymerase chain reaction.
Parasitology 99, 57–66.
Murray, M., Murray, P.K., McIntyre, I.M., 1977. An improved parasitological technique for the diagnosis of
African Trypanosomosis. Trans. R. Soc. Trop. Med. Hyg. 71, 325–326.
Nantulya, V.M., 1994. Suratex: a simple latex agglutination antigen test for diagnosis of Trypanosoma evansi
infections (Surra). Trop. Med. Parasitol. 45, 9–12.
Olaho-Mukani, W., Munyua, W.K, Mutugi, M.W., Njogu, A.R., 1993. Comparison of antigen and antibody
selection enzyme immunoassays for the diagnosis of Trypanosoma evansi infections in camels. Vet. Parasitol.
45, 231–240.
Ngaira, J.M., Bett, B., Karanja, S.M., 2002. Animal-level factors for Trypanosoma evansi infection in camels in
eastern and central parts of Kenya. Onderst. Vet. Res. 69, 263–271.
Ngaira, J.M., Bett, B., Karanja, S.M., Njagi, E.N.M., 2003. Evaluation of antigen and antibody rapid detection
tests for Trypanosoma evansi infection in camels in Kenya. Vet. Parasitol. 114, 131–141.
Ngaira, J.M., Njagi, E.N.M., Ngeranwa, J.J.N., Olembo, N.K., 2004. PCR amplification of Ro Tat 1.2 VSG gene in
Trypanosoma evansi isolates in Kenya. Vet. Parasitol. 120, 23–33.
Njiru, Z.K., Bett, B., Mapeny-Ole, I.M., Githiori, J.B., Ndung’u, J.M., 2002. Trypanosomosis and helminthosis in
camels: comparison of ranch and traditional camel management systems in Kenya. Camel Pract. Res. 9, 67–
71.
Omanwar, S., Rao, J.R., Basagoudanavar, S.H., Singh, R.K., Butchaiah, G., 1999. Direct and sensitive detection of
Trypanosoma evansi by polymerase chain reaction. Acta Vet. Hung. 47, 351–359.
Reid, S.A., Copeman, D.B., 2003. The development and validation of an antibody-ELISA to detect Trypanosoma
evansi infection in cattle in Australia and Papua New Guinea. Prev. Vet. Med. 61, 195–208.
Schwartz, H.J., Dolan, R.B., Wilson, A.J., 1983. Camel production in Kenya and its constraints. Trop. Anim.
Health Prod. 15, 169–178.
Verloo, D., Magnus, E., Buscher, P., 2001. General expression of Ro Tat variable antigen type in Trypanosoma
evansi isolates from different origin. Vet. Parasitol. 97, 183–189.
 Z.K. Njiru et al. / Veterinary Parasitology 124 (2004) 187–199 199

Ventura, R.M., Takeda, G.F., Silva, R.A.M.S., Nunes, V.L.B., Buck, G.A., Teixeira, M.M.G., 2002. Genetic
relatedness among Trypanosoma stocks by random amplification of polymorphic DNA and evaluation of a
synapomorphic DNA fragment for species-specific diagnosis. Int. J. Parasitol. 2, 53–63.
Woo, P.T.R., 1970. The haemotocrit centrifuge technique for the diagnosis of African trypanosomes. Acta Trop.
27, 384–386.
Wilson, A.J., Schwartz, H.J., Dolan, R., Olaho-Mukani, W., 1983. A simple classification of different types of
trypanosomosis occurring in four camel herds in selected areas of Kenya. Tropenmedizin und Parasitologie 34,
220–224.
Wuyts, N., Chokesajjawatee, N., Panyim, S., 1994. A simplified and highly sensitive detection of Trypanosoma
evansi by DNA amplification. S.E. Asian J. Trop. Med. Publ. Health 25, 266–271.