Zebra Fish PDF

FISH, FISHING AND FISHERIES
ZEBRAFISH
TOPICS IN REPRODUCTION,
TOXICOLOGY AND DEVELOPMENT
No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or
by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no
expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No
liability is assumed for incidental or consequential damages in connection with or arising out of information
contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in
rendering legal, medical or any other professional services.
Additional books in this series can be found on Nova‘s website

under the Series tab.
Additional e-books in this series can be found on Nova‘s website

under the e-book tab.
ZEBRAFISH
TOPICS IN REPRODUCTION,
TOXICOLOGY AND DEVELOPMENT
CHARLES A. LESSMAN
AND
ETHAN A. CARVER
EDITORS
New York
Copyright © 2014 by Nova Science Publishers, Inc.
All rights reserved. No part of this book may be reproduced, stored in a retrieval system or
transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical
photocopying, recording or otherwise without the written permission of the Publisher.
For permission to use material from this book please contact us:
Telephone 631-231-7269; Fax 631-231-8175
Web Site: http://www.novapublishers.com
NOTICE TO THE READER

The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or
implied warranty of any kind and assumes no responsibility for any errors or omissions. No
liability is assumed for incidental or consequential damages in connection with or arising out of
information contained in this book. The Publisher shall not be liable for any special,
consequential, or exemplary damages resulting, in whole or in part, from the readers‘ use of, or
reliance upon, this material. Any parts of this book based on government reports are so indicated
and copyright is claimed for those parts to the extent applicable to compilations of such works.
Independent verification should be sought for any data, advice or recommendations contained in
this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage
to persons or property arising from any methods, products, instructions, ideas or otherwise
contained in this publication.
This publication is designed to provide accurate and authoritative information with regard to the
subject matter covered herein. It is sold with the clear understanding that the Publisher is not
engaged in rendering legal or any other professional services. If legal or any other expert
assistance is required, the services of a competent person should be sought. FROM A
DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE
AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS.
Additional color graphics may be available in the e-book version of this book.
Library of Congress Cataloging-in-Publication Data
ISBN: (eBook)
Published by Nova Science Publishers, Inc. † New York

CONTENTS
Preface vii
Part 1: Reproduction 1
Chapter 1 Age Determination of Gonad Maturation and Puberty Onset
in the Transparent casper Zebrafish Juvenile 3
Kathryn D. Jones and Charles A. Lessman
Chapter 2 Ovarian Follicle Dynamics Assessed In Vivo by Intraperitoneal
(I.P.) Trypan Blue Uptake during Vitellogenin Endocytosis
in Adult Female Zebrafish (Danio rerio) 15
Gayathri Kaushik and Charles A. Lessman
Chapter 3 The Protein Phosphatase Inhibitor, Okadaic Acid, Elicits Several
Components of Zebrafish (Danio rerio) Oocyte Maturation In Vitro 39
Charles A. Lessman
Chapter 4 Get it Together: How RNA-Binding Proteins Assemble
and Regulate Germ Plasm in the Oocyte and Embryo 65
Odelya Hartung and Florence L. Marlow
Chapter 5 Zebrafish As a Model for Reproductive Biology
and Environmental Screening 107
Toshinobu Tokumoto
Chapter 6 Fecundity and Spawning Periodicity in Wild-Type Zebrafish
Mated Pairs: A Long-Term, Longitudinal Study 123
Charles A. Lessman
Part 2: Development 133
Chapter 7 Localization of the Sodium-Potassium-Chloride Cotransporter
(Slc12a2) during Zebrafish Embryogenesis and Myogenesis
and a Screen for Additional Antibodies to Study Zebrafish
Myogenesis 135
Ian Dew, Linda M. Sircy, Lauren Milleville, Michael R. Taylor,
Charles A. Lessman and Ethan A. Carver
vi Contents
Chapter 8 The Zebrafish Dead elvis (del) Mutant Encodes Titina 155
Ethan A. Carver, Lauren Milleville, Nominanda I. Barbosa,
Michael R. Taylor and Charles A. Lessman
Chapter 9 Renal System Development in the Zebrafish:
A Basic Nephrogenesis Model 179
Christina N. Cheng and Rebecca A. Wingert
Chapter 10 The Use of Whole Mount In Situ Hybridization Screening
to Understand the Developmental Toxicology of Environmental
Pollutants in Zebrafish Embryos 215
William K.F. Tse
Chapter 11 Using Zebrafish to Define Mechanisms of Lead (Pb)
Developmental Neurotoxicity 225
Sara E. Wirbisky and Jennifer L. Freeman
Chapter 12 The Embryonic Zebrafish as a Model System to Study
the Effects of Environmental Toxicants on Behavior 245
Holly Richendrfer, Robbert Creton and Ruth M. Colwill
Chapter 13 Acute Toxicity and Study of ―Biomarker of Effects‖ in
Zebrafish Embryos and Larvae Exposed to Selected Pesticides:
A Step towards Refined Risk Assessment of Chemical Agents 265
Wing Shan Chow and King Ming Chan
Index 295
PREFACE
This volume pulls together chapters running the gamut from gonad development, gamete
production, oocyte physiology, and endocrine disrupting chemicals to embryonic
development, toxicology and factors affecting behavior in juveniles and adults.
The first chapter introduces the double mutant transparent casper in a study of juvenile
gonad development and puberty onset. While zebrafish embryos and larvae are transparent,
the juveniles and adult develop pigment cells that obscure gonad development. This chapter
provides new data on puberty onset and gonad dynamics in casper zebrafish.
Chapter two describes new research using trypan blue as an endocytosis tracking marker
in zebrafish ovarian follicle vitellogenic growth. The results provide new data on ovarian
dynamics in vivo in this exciting model vertebrate.
In the third chapter, new research on protein phosphatase (PPase) inhibitors, including
okadaic acid, demonstrates that several components of zebrafish oocyte maturation in vitro
are induced by PPase inhibition. These data establish the zebrafish oocyte as a useful model
for study of signaling cascade factors involved in female gamete formation.
Chapter four reviews how RNA-binding proteins assemble and regulate germ plasm in
the zebrafish embryo and oocyte. The chapter illuminates the importance of a hitherto obscure
oocyte organelle, the Balbiani body, and how it relates to germ plasm.
Chapter five describes a transgenic, transparent zebrafish line as a potent model for
reproductive biology and environmental screening. The chapter puts forth new methodology
for assessing effects of endocrine-disrupting chemicals (EDCs) on reproductive biology in
this aquatic species.
The sixth chapter reports new data on fecundity and spawning frequency in wild-type
zebrafish mated pairs. The chapter provides a new experimental paradigm, namely a long-
term, longitudinal study that provides information about the reproductive cycle of this
important model species.
Chapter seven describes experiments involving the protein localization of the Sodium-
potassium-chloride cotransporter (Slc12a2) during both embryogenesis and myogenesis in
zebrafish. These findings illustrate the range of involvement this ion transporter has during
development of different organs. Also, this chapter summarizes a series of antibodies for use
in studying zebrafish myogenesis.
Chapter eight describes the characterization of the zebrafish dead elvis (del) mutant. This
mutant is characterized as a mobility mutant, and positional cloning and complementation
analysis indications it carries a mutation of the Titina gene. Whole-mount
viii Charles A. Lessman and Ethan A. Carver
immunohistochemistry using a variety of muscle specific antibodies reveal a lack of

sarcomere structure, indicative of the lack muscle contractibility seen the the del homozygous
mutants.
Chapter nine reviews the utility of the zebrafish as a basic model for kidney development.
This chapter discusses the conservation of nephron structures and how zebrafish have become
a useful model organism to study renal development. New technologies and established
research tools, including morpholinos, CRISPR-Cas, and TALENs, are discussed in light of
their usefulness in understanding nephogenesis in zebrafish.
Chapter ten examines toxicant screening involving zebrafish. Basic procedures for
toxicant testing are reviewed and elaborated upon. Organogenesis and finer points of
zebrafish development are discussed in relationship to providing a better understanding of the
toxicological effects of chemicals beyond a simple LC50 number.
Lead is a toxic heavy metal that historically has seen widespread usage and subsequent
human exposures. In Chapter eleven, researchers discuss research and the current
understanding of lead neurotoxicity. The use of model organisms; highlighted by the
zebrafish, are leading to a better understanding of lead neurotoxicity and providing a valuable
step to understanding the molecular mechanisms associated with lead exposure.
Chapter twelve highlights current research using zebrafish as a developmental model
system to study the effects of environmental toxicants on behavior. This chapter critically
reviews three different assays and their usage to screen for toxicant-induced behavioral
defects using zebrafish. These behavioral assays should provide insight into the mechanisms
that environmental toxicants use to influence human brain development and behavior.
In chapter thirteen researchers have developed a standard test procedure for using
zebrafish to better understand gene expression changes in response to pesticide exposures.
Zebrafish were tested for alteration of specific gene expression patterns in response to
different pesticides including: heptachlor, methoxychlor, endosulfan, chlorpyrifos, aldicarb,
and cypermethrin. This research should give scientists a better understanding of the effects of
pesticides and help in determining the permissible concentrations of pesticides in waters.
Ethan A. Carver and Charles A. Lessman, Editors

Thursday, January 30, 2014
PART 1: REPRODUCTION
In: Zebrafish ISBN: 978-1-63117-558-9
Editors: Charles A. Lessman and Ethan A. Carver © 2014 Nova Science Publishers, Inc.
Chapter 1
AGE DETERMINATION OF GONAD MATURATION

AND PUBERTY ONSET IN THE TRANSPARENT
CASPER ZEBRAFISH JUVENILE
Kathryn D. Jones and Charles A. Lessman*

Department of Biological Sciences, The University of Memphis,
Memphis, TN, US
ABSTRACT
The transparent double mutant zebrafish, casper, allows direct visualization of gonad
development and maturation (White et al. 2008). In this study juvenile casper were
imaged at weekly intervals beginning at 3 weeks post fertilization. Both sides of the fish
were imaged with transverse, reflected illumination and the images captured through a
dissecting microscope fitted with a digital camera. Swimbladder development,
bifurcation and fat deposition occurred prior to gonad appearance. Females were noted to
have an amorphous golden coloration in the area of subsequent gonad development,
while males had a milky-white cast to the mature gonad. Once the golden color in the
presumptive female gonad area appeared, well developed ovarian follicles formed within
a week in some females. This suggests that the vitellogenesis timeframe may be less than
one week in these pubescent animals. Puberty onset in six female juveniles occurred
between 87 and 122 dpf and averaged 104 dpf as assessed by attainment of 400 m
diameter by the largest ovarian follicle size class. Puberty in four casper males occurred
between 99 and 159 dpf and averaged 139 dpf as assessed in vivo by the opaque milky-
white appearance of the testis. The transparent casper zebrafish allows direct imaging of
the gonad and provides a remarkable model system to study in vivo gonadal dynamics.
Keywords: Ovary, testes, ovarian follicle, sexual maturity, gametes, gonads
*
Contact: Charles A. Lessman, Ph.D. Professor. Dept. of Biological Sciences, 223 Life Sciences, The University of
Memphis, Memphis, TN 38152. (901) 678-2963; FAX (901) 678-4457; Email: CLessman@memphis.edu;
http://umpeople.memphis.edu/clessman.
4 Kathryn D. Jones and Charles A. Lessman
INTRODUCTION
The zebrafish has become an increasingly important vertebrate model organism due to its
suitability for reverse and forward genetic procedures, including mutagenesis and morpholino
knockdown of gene expression. In addition, the abundant transparent embryos expressing
various reporter genes may be imaged and allow in vivo experimentation on many aspects of
embryonic development. Nevertheless, rather little is known about basic reproductive biology
in this species. While the embryos and larvae are transparent, the wild-type juveniles and
adults are not. The internal organs including the gonads are obscured in the juvenile and adult
by different pigment cells that provide the zebrafish with its name denoting horizontal dark
stripes on an iridescent background. Thus direct visualization of the developing gonad in the
juvenile wild-type to assess puberty onset is not feasible. Now a new line of mutant zebrafish
called casper has become available to allow direct visualization of the gonad dynamics in
adults and juveniles in vivo. The casper double mutant is the result of a cross between two
pigmentation mutants (White et al. 2008). The roy orbison mutant (roy-/-) lacks functional
iridiophores that normally, in the wild-type, contain a guanine-based pigment that is very
reflective and produces the silvery opaque appearance of the zebrafish. The iridiophores
obscure the content of the abdominal cavity and do not allow visualization of the gonads in
juveniles and adults. Thus in roy-/- phenotypes, the gonads are visible through the body wall,
although portions of the gonad may still be partially obscured by melanophores. Nacre is a
mutant of the Microphthalmia-Associated Transcription Factor (MITF) signaling system and
lacks functional melanophores. A cross between roy-/- and nacre-/- yields casper (i.e. roy-/- and
nacre-/-) that lacks both functional melanophores and iridiophores (White et al. 2008) and
allows visualization of the gonad in the living animal without dissection. The present study
takes advantage of the transparent nature of juvenile and adult casper to assess gonadal
development and puberty.
Previous studies of zebrafish gonad development depended on dissected specimens and
thus represent snapshots in time. From these types of preparations, the six stages of
folliculogenesis in the zebrafish ovary were defined as follows: Ia) primary growth (7 – 20
m), pre-follicle phase, Ib) primary growth (20 – 140 m), follicle phase, II) cortical alveolus
phase (140 – 340 m), III) vitellogenesis phase (340 – 690 m), IV) maturation (690 – 730
m), V) egg (730 – 750 m) (Selman et al. 1993). For this study, vitellogenic stage III
follicles of 400 m diameter are used to denote puberty onset in vivo since significant
estradiol activity, a benchmark of female puberty, is required to activate vitellogenin gene
transcription in the liver (Babin et al. 2007). Male zebrafish puberty is complicated somewhat
since oocytes are the default and oocyte apoptosis occurs in early diplotene oocytes by 29 dpf
before male sex determination occurs (Uchida et al. 2002). Kisspeptin is involved with
puberty onset in both sexes and it is implicated in gonadotropin releasing hormone (GnRH)
secretion; kisspeptin peaks in females after puberty (i.e., mature oocyte stage IV) while males
peak after 42 dpf when initial stages of spermatogenesis occurs (Biran, Ben-Dor & Levavi-
Sivan 2008). Here the opaque milky-white appearance of the testes is used as an in vivo
marker for male puberty.
Puberty in Transparent Juvenile Zebrafish 5
MATERIALS AND METHODS

Casper zebrafish were housed, individually or in pairs, in plastic containers (Aquatic
Habitats Inc.) filled with 1 L dechlorinated water and held in a thermostatically controlled
incubator (28ºC) with a 14 hr light: 10 hr dark photoperiod. All animals in this research were
used in accordance with an approved IACUC protocol (#0714). Fish were fed 1-2 times daily
a diet of 4:1 flaked fish food and brine shrimp flakes (http://www.aquaticeco.com). Rearing
tank water was changed weekly. Beginning at 21 days post fertilization (dpf), the fish were
anesthetized once a week, using 0.04% tricaine methane sulfonate solution. Pictures of both
the right and left side of the fish were taken using a Zeiss STEMI stereomicroscope and
captured with a 3 or 9 Mp Amscope eyepiece camera running Toupview image software.
Aeration of fresh water in a 1L beaker with an air stone promoted more rapid recovery of the
fish from anesthesia. Image analysis and image processing were carried out with ImageJ
software. Images of a stage micrometer, taken at the same resolution, were used to calibrate
ImageJ for follicle and girth diameter measurements. Random samples of ten largest follicles
were measured using the calibrated line tool in ImageJ from images of both sides of a female.
The girth diameter was measured from images by drawing a line perpendicular to the
anterior-posterior axis from the insertion of the pelvic fin to the dorsal body surface with the
line tool in ImageJ. Girth diameter was determined in females since increased abdominal size
and roundness have been commonly used as indicators of ovarian status in zebrafish
husbandry (Westerfield 2004).
RESULTS AND DISCUSSION

The area that eventually gives rise to the mature gonad lies between the ventral aspect of
the swimbladder and the gastrointestinal tract, approximately in the middle of the animal.
This central region of the fish was the focus of our imaging efforts to ascertain the first
appearance of the gonad. Larval casper zebrafish inflate a single-chambered swimbladder
shortly after hatching as do the wild-type. Casper larvae imaged after 21 dpf begin to form a
constriction in the single-chambered swim bladder found in the dorsal roof of the peritoneal
cavity (Figure 1). In addition to obvious adipocytes widely scattered in association with the
epidermis/dermis skin layers, clusters of adipocytes, characterized by their spherical shape,
featureless cytoplasm and refractility were found at the ventral side of the swim bladder and
along the mesentaries of the intestine. At this stage, no obvious gonad could be seen in vivo.
By 34 dfp, the swim bladder showed a distinct constriction dividing the structure into 2
connected chambers (Figure 1c). Adipose tissue was more abundant and filled in the area
ventral to the swim bladder extending to the intestine (Figure 1d). The adipocytes tend to be
spherical and could be confused with early ovarian follicles especially when visualized in
vivo. Adipocytes at 34 dpf had average diameters of 60.2 +/- 14.3 m (mean +/- standard
deviation; n = 13) determined from fresh dissected tissue with image analysis. Adipose tissue
was associated with the presumptive indifferent gonad dissected from 34 dpf casper (Figure
2); adipocytes were spherical and thus similar to early oocytes in outline, but lack the
complex internal structure typical of the oocyte. In addition, the adipocytes do not have the
yellow color seen in the ovary and the adipocytes do not increase in diameter to the extent
seen in ovarian follicles. Images were captured on a weekly basis for juvenile casper
zebrafish beginning about 6 weeks of development based on an earlier pilot study that started
at 18 dpf. Representative montages of female (Figure 3) and male (Figure 4) development
reveal gonad growth in vivo over time in the same individuals. In females, a remarkable
change in ovarian follicle size occurred from one week to the next; for example in female O,
ovarian follicles could not be observed at 84 dpf, but became obvious at 91 dpf and fully
grown by 98 dpf (Figure 3). Male R showed a similar rapid change in gonad appearance from
92 dpf to 99 dpf when an obvious opaque milky-white cast to the gonad occurred (Figure 4),
by contrast the female had a corresponding golden cast to the gonad. These gonad color
differences (i.e. golden for females, white for males) are noticeable by simple visual
inspection without magnification and are used to reliably sex individuals for mating in adult
casper in the Lessman lab. Growth in the largest size class of ovarian follicles was
determined by image analysis and plotted for each female over time dpf (Figure 5). The
minimum ovarian follicle diameter resolvable in vivo was about 100 m, with larger follicles
generally more readily discernible. While the six females varied in dpf for initial follicle
diameter growth of the largest size class, once growth began, it tended to be rapid with plots
showing a sigmoidal shape (Figure 5). Using these plots, the dpf that individual females
possessed ovarian follicles attaining 400 m in diameter was determined (Table 1). During
ovarian maturation and growth, females increase in girth diameter versus dpf (Figure 6). This
girth increase, while not surprising given the rapid growth of the ovarian follicles during
puberty, nevertheless, is a useful marker for sexual maturation in the female (Figure 6). The
girth diameter increase is actually quite conservative since the true growth is represented as a
volume or cubed dimension as opposed to the unit diameter dimension. This relationship
between the diameter of the largest ovarian follicle size class and girth diameter is positively
related; as follicle diameter increases so does girth diameter (Figure 7). Girth diameter
changes in males were less pronounced as might be expected during puberty since males are
characterized as having a slimmer body profile than females. While females tended to have
positive inflections of girth diameter increases at puberty (Figure 6), males showed no
consistent girth diameter changes with puberty (Figure 8).
Table 1. Puberty in female casper transparent zebrafish juveniles. Days post

fertilization (dpf) to attain 400 m ovarian follicles as largest size class
Female dpf
B 87
J 120
O 105
V 96
W 95
Z 122
Mean 104
Standard deviation 14
Figure 1. Changes in prepubescent casper zebrafish: adipose tissues and swim bladder. A) larvae at 18
days post fertilization (dpf), bar is 0.5 mm, B) larvae at 21 dpf, bar is 0.5 mm, C) larva at 34 dpf, note
double chambered swimbladder, bar is 0.5 mm, D) adipose tissue dissected from 34 dpf larva, bar is 0.5
mm.
Figure 2. Adipose tissue (a) associated with presumptive indifferent gonad (g) dissected from 34 dpf
casper. Bar equals 150m.
Figure 3. Representative montage of casper female during puberty time course. A through D depict the
same living animal (female O), both right and left sides at different days post fertilization (dpf). The
arrows indicate the location of the ovary (ov). The bar equals 1mm in all images.
Control of the germ line and sex determination in the zebrafish involves differential gene
expression of the ovary specific gene cyp19a1a (Siegfried, Nüsslein-Volhard 2008). In germ
line deficient animals, cyp19a1a is not expressed while sox9a and amh are expressed
resulting in a sterile testis phenotype. Zebrafish sex determination also involves ziwi, an
argonaute protein coded by the zebrafish piwi analog; loss of ziwi produces 100% sterile male
phenotypes (Houwing et al. 2007). While gene expression is important for sex determination,
it also is critical in heralding puberty. Thus puberty may be defined at different levels, for
example, during early development, pituitary expression of follicle-stimulating hormone
(fshb), luteinizing hormone (lhb) and growth hormone (gh) message have been determined by
qPCR (Chen & Ge 2012). While gh and fshb were expressed as early as 4 dpf, by contrast,
lhb was first expressed later at 25 dpf simultaneously with sex differentiation and lhb
expression was found to increase significantly about 45 dpf when puberty onset was detected.
However, these authors defined puberty as the transition from the primary follicle stage (stage
I) to previtellogenesis (stage II) and thus considerably earlier that the puberty definition used
in this chapter (i.e., stage III 400 m in diameter). Thus the difference between the puberty
onset given by these researchers and that given in this chapter reflects the different definitions
used to describe it. Even earlier, a number of genes are expressed specifically in germ cells
destined to become the gametes of the mature gonad; these include ziwi, the zebrafish
analogue of the Argonaut-class gene, piwi of Drosophila (Leu & Draper 2010), vasa (Draper
2012), and nanos (Beer & Draper 2013). Thus puberty may involve selective gene activation
in presumptive germ cells, activation of hypothalamic-pituitary-gonad axis, beginning with

gonadotropin-releasing hormone (GnRH), gonadotrophin production by the pituitary and
steroid hormone production in the gonad with final morphological events in the pubescent
gonad providing visible indication of puberty onset. Here a morphological criterion was used
to assess puberty attainment; in the female, puberty onset was defined by growth of ovarian
follicles to a size of 400 m denoting the vitellogenic phase (stage III) of oogenesis (Selman
et al. 1993). This morphological marker, readily demonstrable in the casper zebrafish, is the
culmination of a number of earlier molecular events leading to this physical ovarian state.
Using this morphological marker, female puberty occurred at an average of 104 dpf in the six
casper females studied in this time-course analysis. Males also exhibited puberty somewhat
later ranging from 99 to 159 dpf and averaged 139 dpf of 4 fish for first appearance of the
opaque milky-white cast to the testis. Of course, using other criteria, such as GnRH
production or other molecular markers, would likely result in puberty onset occurring earlier
or at some other time point. Thus for future studies in this area, it would be useful for
researchers to define the puberty benchmark used. Finally, the transparent casper juveniles
may provide a useful tool for developing panels of puberty-specific expressed genes.
Figure 4. Representative montage of casper male during puberty time course. A through E depict the
same living animal (male R); both right and left sides at different days post fertilization (dpf). The bar
equals 1mm for all images and the arrow (t) indicates the testes.
800
Average Ovarian Follicle Diameter (largest size class in

700
600
500
microns)
400
300
200
100
0
0 50 100 150 200
days post fertilization (dpf)
Female B female Z female W female O female J female V
Figure 5. Time course of ovarian follicle diameter changes in six different juvenile casper females.
Plots represent the mean +/- standard deviation (n = 20 follicles per female) of the largest size class of
follicles measured with ImageJ software versus days post fertilization (dpf).
4500
4000
3500
Girth Diameter (microns)
3000
2500
2000
1500
1000
500
0
0 20 40 60 80 100 120 140 160
female B female J female O female V female W female Z
Figure 6. The change in girth diameter with days post fertilization (dpf) in female juvenile casper
zebrafish. Girth diameter measured at the pelvic fin insertion from ventral to dorsal body surface.
4500
4000
3500
Girth Diameter (microns) 3000
2500
2000
1500
1000
500
0
0 100 200 300 400 500 600 700 800
Average Ovarian Follicle Diameter (largest size class)
casper B casper J casper O casper V casper W casper Z
Figure 7. Plot of girth diameter versus large follicle size class in female juvenile casper zebrafish.
4500
4000
3500
Girth Diameter (microns)
3000
2500
2000
1500
1000
500
0
0 50 100 150 200
male R male S male U male X
Figure 8. Plot of girth diameter versus days post fertilization (dpf) in male juvenile casper zebrafish.
Arrows denote the first appearance of the milky-white opaqueness of the maturing testis.
CONCLUSION
The transparent casper zebrafish was used to determine gonadal dynamics and puberty
onset in juveniles. Puberty onset, defined here as the largest ovarian follicle size class first
attaining an average diameter of 400 mm, ranged from 87 to 122 dpf in females and averaged
104 dpf. Puberty onset in males, defined here as the first opaque milky-white cast to the testis,
occurred between 99 and 159 dpf with an average of 139 dpf. This novel approach allows
unprecedented visualization of the living, developing, zebrafish gonad in young adults over
time.
ACKNOWLEDGEMENTS
The casper zebrafish line used in this study was a generous gift from Dr. Michael R.
Taylor, Department of Chemical Biology and Therapeutics, St. Jude Children‘s Research
Hospital, Memphis, TN. This research was supported in part by the Department of Biological
Sciences. We thank Mary E. Lessman for proofreading chapters.
REFERENCES
Babin, P.J., Carnevali, O., Lubzens, E. & Schneider, W.J., 2007, "Molecular aspects of oocyte
vitellogenesis in fish" in The Fish oocyte:, ed. P.J. Babin, Springer, pp. 39-76.
Beer, R.L. & Draper, B.W., 2013, "nanos3 maintains germline stem cells and expression of
the conserved germline stem cell gene nanos2 in the zebrafish ovary", Developmental
Biology, 374(2), 308-318.
Biran, J., Ben-Dor, S. & Levavi-Sivan, B., 2008, "Molecular identification and functional
characterization of the kisspeptin/kisspeptin receptor system in lower vertebrates",
Biology of Reproduction, 79(4), 776-786.
Chen, W. & Ge, W., 2012, "Ontogenic expression profiles of gonadotropins (fshb and lhb)
and growth hormone (gh) during sexual differentiation and puberty onset in female
zebrafish", Biology of Reproduction, 86(3), 73.
Draper, B.W., 2012, "Identification of Oocyte Progenitor Cells in the Zebrafish Ovary" in
Progenitor Cells Springer, pp. 157-165.
Houwing, S., Kamminga, L.M., Berezikov, E., Cronembold, D., Girard, A., van den Elst, H.,
Filippov, D.V., Blaser, H., Raz, E. & Moens, C.B., 2007, "A role for Piwi and piRNAs in
germ cell maintenance and transposon silencing in Zebrafish", Cell, 129(1), 69-82.
Leu, D.H. & Draper, B.W., 2010, "The ziwi promoter drives germline‐specific gene
expression in zebrafish", Developmental Dynamics, 239(10), 2714-2721.
Selman, K., Wallace, R.A., Sarka, A. & Qi, X., 1993, "Stages of oocyte development in the
zebrafish Brachydanio rerio.", Journal of Morphology, 218, 203–224.
Siegfried, K.R. & Nüsslein-Volhard, C., 2008, "Germ line control of female sex
determination in zebrafish", Developmental Biology, 324(2), 277-287.
Uchida, D., Yamashita, M., Kitano, T. & Iguchi, T., 2002, "Oocyte apoptosis during the
transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish",
Journal of Experimental Biology, 205(6), 711-718.
Westerfield, M., 2004, The zebrafish book. A guide for the laboratory use of zebrafish (Danio
rerio), 4th edn, Univ. of Oregon Press, Eugene.
White, R.M., Sessa, A., Burke, C., Bowman, T., LeBlanc, J., Ceol, C., Bourque, C., Dovey,
M., Goessling, W. & Burns, C.E., 2008, "Transparent adult zebrafish as a tool for in vivo
transplantation analysis", Cell Stem Cell, 2(2), 183-189.
Chapter 2
OVARIAN FOLLICLE DYNAMICS ASSESSED IN VIVO

BY INTRAPERITONEAL (I.P.) TRYPAN BLUE UPTAKE
DURING VITELLOGENIN ENDOCYTOSIS
IN ADULT FEMALE ZEBRAFISH (DANIO RERIO)
Gayathri Kaushik and Charles A. Lessman

Department of Biological Sciences,
The University of Memphis, Memphis, TN, US
ABSTRACT
The timeline of zebrafish follicle-enclosed oocyte growth and development is not
known. To establish the temporal stages of these basic processes, mature female
zebrafish, Danio rerio, were injected intraperitoneally (i.p.) with the marker trypan blue
(TB). Ovaries were removed at different times post injection. Then, oocyte diameter and
TB uptake were determined from brightfield and fluorescence microscopy images,
respectively. TB uptake increased steadily up to 48 hours post injection and declined
subsequently. TB fluorescence was highest in the vitellogenic stage III follicles (i.e. 350
– 600 m in diameter). TB is known to fluoresce when bound to proteins such as serum
albumin and the data presented here indicated labeling of serum vitellogenin that
subsequently was endocytosed into yolk vesicles of vitellogenic stage oocytes. Overall,
this chapter provides an initial study of oocyte growth and development using TB as a
cellular marker.
Keywords: Oogenesis, ovarian follicle, oocyte endocytosis, vitellogenin, ovarian cycle

Corresponding author: Charles A. Lessman; Department of Biological Sciences, The University of Memphis,
Memphis, TN 38152, Phone: (901) 678-2963, FAX: (901) 678-4457, Email: CLessman@memphis.edu
16 Gayathri Kaushik and Charles A. Lessman
INTRODUCTION
Oogenesis is a dynamic process that defines the various stages of follicle-enclosed oocyte
development leading to the formation of a mature egg (Lessman, 1999; Lessman, 2009;
Lubzens et al., 2010; Selman, 1993; Selman & Wallace, 1983; Wallace & Selman, 1985).
Several studies provide extensive information on the structural development of follicle-
enclosed oocytes and the role of various ovarian cells involved in teleost oogenesis (Davail et
al., 1998; Droller & Roth, 1966; Shaner et al., 2004; Wallace & Selman, 1985). Further, these
studies provide details on the role of hormones in follicle-enclosed oocyte development.
In teleost fish, follicle-enclosed oocyte development starts with the previtellogenic phase
(stages 1 and 2) and continues with the vitellogenic phase (stage 3). During the vitellogenic
phase, the yolk precursor, vitellogenin, and other nutrients are incorporated leading to a
significant increase in the size of the follicle-enclosed oocyte (Clelland & Peng, 2009;
Lessman, 1999; Lessman, 2009; Lubzens et al., 2010; Matsuda et al., 2011; Selman &
Wallace, 1983). Further growth of the follicle-enclosed oocyte results in its meiotic
maturation followed by ovulation and oviposition which prepares the female gamete for
fertilization (Lessman, 2009; Lubzens et al., 2010; Selman, 1993). However, the time course
of ovarian follicle development and vitellogenin uptake during the vitellogenic phase has not
been well defined. Vitellogenic phase includes the production of vitellogenin (Lessman,
2009; Polzonetti-Magni et al., 2004) and its incorporation into the follicle-enclosed oocyte
together with lipids and vitamins (Lubzens et al., 2010). Vitellogenin is a bulky
phospholipoglycoprotein (250-600KDa) molecule found in female teleosts and other
vertebrates that lay yolk-filled eggs. Vitellogenin is mainly synthesized in the liver, and in
small amounts in other organs such as the ovary (Lubzens et al., 2010; Wang et al., 2005).
After synthesis, vitellogenin reaches the ovaries via the blood stream. Follicle-enclosed
oocytes take up vitellogenin by receptor mediated endocytosis. The endocytic vesicles fuse
with lysosomes to form yolk globules, which have a crystalline core of lipovitellin and
phosvitin that have been processed from the endocytosed vitellogenin (Lessman, 2009;
Okumura et al., 2002; Wallace & Selman, 1985; Wallace & Selman, 1990). However, the
specific time course for vitellogenin uptake and incorporation during development of the
follicle-enclosed oocyte is not known. Uptake of vitellogenin into follicle-enclosed oocytes in
vivo occurs in an intact ovarian follicle that consists of a layer of follicle cells surrounding the
oocyte, which in turn is surrounded by a stromal layer of theca cells and an outer layer of
epithelial cells. The follicle and theca cells are involved in the synthesis of steroid hormones.
The ovarian follicle is surrounded by blood vessels, which assist in transporting vitellogenin
to the follicle for uptake into oocytes. Based on the above, the current understanding of
follicle-enclosed oocyte development is especially limited and thus, time-course of
vitellogenin uptake in follicle enclosed oocytes of different size classes needs further study.
These issues remain largely unexplored in zebrafish (Danio rerio), even though zebrafish
are touted as an important model organism. Hence, this study will help rectify this
discrepancy in an important animal model. Zebrafish is a tropical fish, native to India and
Burma. As adults reach lengths of 40 to 50 mm and weigh up to 1.5 g. Zebrafish are used
extensively in genetic, general and developmental biology research (Levi et al., 2009; Segner,
2009; Spitsbergen et al., 2009; Spitsbergen and Kent, 2003; Tong et al., 2004), particularly
because developing embryos can be observed readily through the transparent egg chorion
Ovarian Follicle Dynamics Assessed In Vivo by Intraperitoneal Trypan Blue Uptake ... 17
(Laale, 1977). Also, the zebrafish genome is sequenced and available online (http://www.
ncbi.nlm.nih.gov/genome?term=danio+rerio). Ovarian development in zebrafish is
asynchronous, where all stages of follicle development are present without a dominant
population (Lessman, 1999; Wallace & Selman, 1980). In asynchronous ovulators, also called
batch spawners, yolked oocytes ovulate and mature into eggs in several batches during the
spawning season. As a result, zebrafish produce small batches of eggs almost daily, and a
large number of eggs (>150 eggs) may be produced every 5 to 10 days. Zebrafish embryos
hatch in about 3 days at 28°C (Ankley & Johnson, 2004). These characteristics differ from
that of other teleost fish such as, killifish, trout, and medaka (Ankley & Johnson, 2004;
Lessman & Habibi, 1987; Selman & Wallace, 1983; Tong et al., 2004; Wallace & Selman,
1985). Thus, studies of the timeline of follicle-enclosed oocyte development in zebrafish will
add to our understanding of the reproductive biology of this important model organism.
Establishing the time course of vitellogenin endocytosis in various size classes of follicle-
covered oocytes requires a marker that allows visualization of uptake by the zebrafish oocyte.
Trypan blue (TB) is a vital stain that is blue under brightfield conditions. TB can also bind to
proteins, and under these conditions fluoresces red when excited with green light (i.e,
Rhodamine filter set) and has diminished red fluorescence under blue light stimulation (i.e.,
FITC filter set). The dye is generally used to distinguish live from dead cells due to its
inability to enter most live cells. When visualized under bright field conditions, TB-stained
dead cells would appear blue. Yet, exposing live vitellogenic ovarian follicles to TB causes its
incorporation into oocytes (Anderson & Telfer, 1970; Danilchik & Denegre, 1991). In
addition, in these follicles, TB is also present between epithelial cells, suggesting that the dye
follows the path used by vitellogenin (Anderson & Telfer, 1970) through the various layers of
the ovarian follicle. Though the studies have been done using insect (Anderson & Telfer,
1970) and frog oocytes (Danilchik & Denegre, 1991), the rapid uptake of TB from the
maternal blood circulation and its deposition in oocytes in a manner similar to vitellogenin,
suggest that TB enters the follicle-enclosed oocyte with vitellogenin. Preliminary data in
zebrafish indicated that TB fluorescence was restricted to yolk vesicles with no detectable
signal in the oocyte cytosol, and in resulting embryos the yolk cell fluoresces while the non-
yolky portions do not fluoresce.

Animals
Adult wild-type (Danio rerio) were reared at 28°C on a 14 hr photoperiod cycle, and fed
Tetramin daily, supplemented with freeze-dried brine shrimp (Artemia). The water in the
spawning tanks was changed daily. Male and female fish were housed together in the
spawning tanks. Spawning was checked daily and embryos were collected. All animals in this
research were used in accordance with an approved IACUC protocol #0677 and #0714.
In addition, a GFP-transgenic Tg(fli1:EGFP)y1 zebrafish line, obtained as a gift from Dr.
Michael R. Taylor, St. Jude Children‘s Research Hospital, Memphis, TN was also reared for
the present studies. The endothelial cells of this transgenic fish express green fluorescent
protein (GFP) and hence, can be visualized by fluorescence microscopy (Lawson &
Weinstein, 2002). Maintenance and breeding of the Tg(fli1:EGFP)y1 zebrafish was carried
out as described for wild-type zebrafish.
Intraperitoneal (i.p.) Injection
Adult female zebrafish in spawning condition were anesthetized with 0.04% tricaine
methanesulfonate (0.1 mg in 250 ml) in egg water (reverse osmosis purified water containing
3 drops 1% methylene blue per 4L) and weighed. The fish were positioned in a custom-made
device consisting of a plastic dropper cut lengthwise and attached to a microscope slide with
cyanoacrylic adhesive (superglue). This slide was then placed in the bottom of a 100mm Petri
dish filled with saline. A syringe filled with the injectate was fitted with a 30 gauge needle
and the assembly was placed in a micromanipulator. With the aid of a dissecting microscope,
the needle was inserted into the peritoneal cavity of the anesthetized zebrafish. The chemical
was then injected i.p., dental adhesive powder was placed over the injection site as a wound
dressing, and the fish was allowed to recover from anesthesia in fresh aerated water and
returned to its tank.
Markers that were injected into the zebrafish are described below. The fluorescent
marker, trypan blue (Sigma Aldrich, St. Louis, MO) (0.2 grams) was dissolved in 20 ml
Cortland‘s fish saline (Wolf, 1969) containing 29 gram NaCl, 0.92 gram CaCl2, 1.52 gram
KCl2, and 0.92 gram MgSO4, pH 7.4 adjusted with HCl and NaHCO3. The 1% solution
(1gm TB dissolved in 100ml Cortland‘s saline) was transferred to a dialysis tube and dialyzed
overnight against Cortland‘s saline to remove small impurities. Prior to injecting TB into
zebrafish, the 1% stock solution of TB in some experiments was diluted 1:1 (0.5%) or 1:4
(0.25%) with Cortland‘s saline.
Other fluorescent markers used include FITC-lectin (0.1 mg/ml; Maclura pomifera
galactose-binding lectin) from EY Labs (San Mateo, CA), FITC-casein (0.5 mg/ml) from
Anaspec Inc. (Freemont, CA), and mCherry (1 mg/ml) from BioVision Inc (Milpitas, CA).
These markers were also dissolved in Cortland‘s saline and injected as described above.
Microscopy
To visualize zebrafish ovaries, the fluorescent-marker-treated zebrafish were anesthetized

in tricaine methanesulfonate and sacrificed by decapitation. The ovaries were removed and
placed on a glass depression slide filled with Cortland‘s saline. Brightfield microscopy: Slides
were placed on a Nikon upright microscope (Eclipse E400) trans-illuminated by a halogen
lamp and viewed with either a 4x air objective (NA 0.13) or a 10x objective (NA 0.25).
Images were captured using a Canon digital camera attached to the camera port of the
microscope. Fluorescence microscopy: For fluorescence visualization of zebrafish ovary, the
epi-illumination setup on the Nikon microscope was used, which included a mercury lamp
and interchangeable UV, blue and green interference filter sets. This allowed excitation of the
ovaries in slides with either UV (wavelength about 350 nm), blue (wavelength about 485 nm)
or green (wavelength about 540 nm) light. The blue, green or red emission, respectively, was
viewed using either the 4 or 10X air objective and the images captured with a Canon digital
camera. The excitation and emission filter sets used for the various fluorescent markers are
noted below.
Fluorescent marker excitation filter set emission filter set

Trypan blue green red
FITC-lectin blue green
FITC-casein blue green
mCherry green red
Estimating Protein-Trypan Blue Binding
An in vitro assay was performed to determine TB binding to proteins. Different

concentrations of TB were mixed in a 96-well plate with different concentrations of bovine
serum albumin (BSA). Then, the plate was visualized with the green excitation filter set of an
epifluorescence microscope and observed with a 4x objective. A Canon camera was used to
capture the emitted fluorescence and the same exposure setting was used for all the wells. The
fluorescence intensity in each well was determined using ImageJ and the results were plotted.
Analysis Methods
The brightfield and fluorescence digital images from the Canon digital camera were
downloaded into a computer as .jpg files. These image files were analyzed using ImageJ
image analysis software (http://rsb.info.nih.gov/ij/). To quantify distances, an image of a stage
micrometer was captured and used to calibrate length in ImageJ. Fluorescence digital images
were split into red, blue and green channels in ImageJ. It is possible that fluorescence
emission in a specific channel is contaminated by emission in other channels. Hence,
separating the channels and using only the color channel specific to a fluorescent marker may
minimize this contamination.
Ovarian Follicle Diameter Measurement
Ovarian follicular diameter was determined from brightfield images. In these images,
ovarian follicles that were in sharp focus were selected. At the maximum diameter location, a
line was drawn across the ovarian follicle using a calibrated Line Tool in ImageJ. The length
of the line was then calculated from ImageJ and recorded in Microsoft Excel as the diameter
of the ovarian follicle.
Ovarian Follicle Fluorescence Intensity Measurement
The fluorescence intensity within ovarian follicles was determined from the respective
channel of the fluorescence image. Fluorescence intensity of TB in ovarian follicles was
determined using the red channel after splitting the 24-bit RGB fluorescence image as
described above yielding an 8-bit image (i.e., 0 is equal to no signal and 255 is maximal
signal or saturation). A line was drawn across an oocyte at midline with the calibrated line
tool in ImageJ. The average fluorescence intensity along that line was recorded in Microsoft
Eexcel from ImageJ as the mean fluorescence intensity of that ovarian follicle. For FITC-
lectin and FITC-casein, the green channel was used, while for mCherry the red channel was
used.
RESULTS
Trypan Blue (TB) Uptake in Wildtype Zebrafish as a Function of Ovarian
Follicle Diameter (Size Class)
Wildtype zebrafish injected with TB were sacrificed at 1, 24, 48, and 96 hour post-
injection. The ovary was then removed, and both bright-field and fluorescence images of
follicle-enclosed oocytes were taken, as shown for representative follicle-enclosed oocytes in
Figure 1. From these images, the diameter and TB fluorescence intensity of the follicle-
enclosed oocytes were determined as described in Materials and Methods.
100 µm
100 µm
Figure 1. Trypan blue uptake in zebrafish oocytes. Representative fluorescence (top) and brightfield
(bottom) images show trypan blue uptake into oocytes at 48 hours after TB treatment. Note trypan blue
stained oocytes appear blue in the brightfield image. Arrows show examples of oocyte diameter
measurement sites marked using the calibrated Line Tool in ImageJ.
Figure 1.
100 µm 100 µm
300
linear fit
trypan blue fluorescence intensity
oocyte diameter vs trypan blue intensity

95% confidence band
250
r = 0.27177
200
(gray levels)
150
100
50
0
0 200 400 600 800
oocyte diameter (microns)
Figure 2. Background fluorescence in zebrafish ovarian follicles. A: Brightfield (left) and fluorescence
(right) images of ovarian follicles from fish not subjected to any injection. Arrows show examples of
oocyte diameter measurement sites marked using the calibrated Line Tool in ImageJ. B: Plot at bottom
shows fluorescence in ovarian follicles as a function of their diameter.
To determine
Figure 2.
background fluorescence in follicle-enclosed oocytes, bright-field and
fluorescence images were obtained using wildtype zebrafish that did not receive any TB
injection (Figure 2A). From the images in Figure 2, it can be seen that background
fluorescence was low. Background fluorescence plotted as a function of oocyte diameter
showed that the fluorescence was low across all size classes of follicle-enclosed oocytes
(Figure 2B).
In wildtype zebrafish injected with TB and sacrificed at 1 hour post-injection, the
fluorescence of TB was detectable in follicle-enclosed oocytes (Figure 3A). However, the TB
fluorescence was higher than background only in a small number of follicle-enclosed oocytes.
Also, the fluorescence remained low across all size classes of follicle-enclosed oocytes and
did not vary as a function of their diameter (Figure 3B).
100 µm 100 µm
B
300
linear fit

95% confidence band
250
r = 0.01202
200
(gray levels)
150
100
50
0
0 200 400 600 800
Figure 3. Trypan blue fluorescence at 1 hour post injection. A: Brightfield (left) and fluorescence (right)
images of ovarian follicles in an ovary examined 1 hour after trypan blue injection into the zebrafish.
Arrows show examples of oocyte diameter measurement sites marked using the calibrated Line Tool in
ImageJ. B: Plot at bottom shows fluorescence in ovarian follicles as a function of their diameter.
In follicle-enclosed
Figure 3. oocytes dissected 24 hours after TB injection, the TB fluorescence
was seen in a larger number of oocytes than compared to those dissected at 1 hour (Figure
4A). However, the fluorescence increase was small (<2x background) and limited to a small
proportion of oocytes. Interestingly, small, intensely blue structures with irregular outlines
were present and appeared to be atretic follicles that did not fluoresce. The fluorescence also
did not vary much as a function of follicle-enclosed oocyte diameter (Figure 4B).
In contrast, in follicle-enclosed oocytes examined 48 hours after TB injection, the TB
fluorescence was prominent (some close to maximum signal of 255) and visible in a larger
proportion of oocytes (Figure 5A).
This higher fluorescence was seen over a wider range of oocyte diameters. Also, the
fluorescence increase with diameter was highly correlated (r = 0.75) (Figure 5B). Most of the
follicle-enclosed oocytes that exhibited high fluorescence were in the 300-500 micron
diameter range. At 96 hours post TB injection, the fluorescence decreases overall and this
decrease is seen for follicle-enclosed oocytes of all diameters (Figure 6).
100 µm 100 µm
B
300
linear fit

95% confidence band
250
r = 0.20005
200
(gray levels)
150
100
50
0
0 200 400 600 800
Figure 4. Trypan blue fluorescence at 24 hour post injection. A: Brightfield (left) and fluorescence
(right) images of ovarian follicles in an ovary dissected 24 hours after trypan blue injection into the
zebrafish. Arrows show examples of oocyte diameter measurement sites marked using the calibrated
Line Tool in ImageJ. Intensely blue labeled irregular structures, visible in brightfield but not in
fluorescent image, are probably atretic follicles. B: Plot at bottom shows fluorescence in ovarian
Figure
follicles as 4.
a function of their diameter.
100 µm 100 µm
B
300
linear fit

95% confidence band
250
r = 0.74983
200
(gray levels)
150
100
50
0
0 200 400 600 800
(right) images of ovarian follicles in an ovary dissected 48 hours after trypan blue injection into the
Line Tool in ImageJ. B: Plot at bottom shows fluorescence in ovarian follicles as a function of their
diameter.
Figure 5.
TB Uptake in Tg(fli1:EGFP)y1 Zebrafish
Similar to observations in wildtype zebrafish, the background fluorescence was very low
in ovarian follicles dissected from Tg(fli1:EGFP)y1 zebrafish not administered any TB
(Figure 7). At 24 hours post injection, the TB fluorescence was higher than background and
similar across various follicle-enclosed oocyte diameters (Figure 8). In this and other similar
experiments, data from fish treated similarly were pooled together as variations in responses
among fish were small. However, at 48 hours post injection TB fluorescence was high and
approached saturation (i.e., signal of 255) in several oocytes (Figure 9). The highest
fluorescence was mainly evident in follicle-enclosed oocytes in the diameter range of 300-500
microns (Figure 9). Also, the increase in fluorescence with oocyte diameter was steep
(r=0.76), suggesting that the fluorescence was highest in oocytes that were in the vitellogenic
phase. In follicle-enclosed oocytes examined 96 hours after TB injection, fluorescence in all
follicles declined as compared to that in oocytes examined 48 hours post injection (Figure
10). Moreover, the highest fluorescence was also lower. This result suggested that the highest
TB fluorescence was evident in follicle-enclosed oocytes examined at 48 hours after TB
A
injection.
100 µm 100 µm
100 µm 100 µm
B
B
300
300 linear fit
linear fit
levels) intensity

95%oocyte diameterband
confidence vs trypan blue intensity
250 95% confidence band
250 r = 0.69047
r = 0.69047
200200
fluorescence
(gray levels)
150150
(gray
100100
trypan blue
50
50
0
0 0 200 400 600 800
0 200 400 (microns) 600
oocyte diameter 800
(right) images of ovarian follicles in an ovary dissected 4 days after trypan blue injection into the
Line Tool in ImageJ. B: Plot at bottom shows fluorescence in ovarian follicles as a function of their
diameter. Figure 6.
Figure 6.
In addition, TB fluorescence was determined in follicle-enclosed oocytes 8 and 14 days

after injection in Tg(fli1:EGFP)y1 zebrafish. At both these time points the fluorescence in
ovarian follicles had declined further (Figures 11 and 12). By 14-days, the fluorescence was
close to background levels.
300
linear fit
95% confidence band

250
r = 0.39973
200
(gray levels)
150
100
50
0
0 200 400 600 800
Figure 7. Background fluorescence Tg(fli1:EGFP)y1 zebrafish. Fluorescence in ovarian follicles from
Tg(fli1:EGFP)y1 zebrafish that were not injected with any trypan blue. Graph shows fluorescence in
ovarian follicles as a function of their diameter.
300
linear fit

95% confidence band
Figure 7 250
r = 0.24476
200
(gray levels)
150
100
50
0
0 200 400 600 800
Figure 8. Fluorescence in Tg(fli1:EGFP)y1 zebrafish ovarian follicles removed 24 hours after trypan
blue injection. Graph shows fluorescence in ovarian follicles as a function of their diameter. (n = 3
zebrafish).
Figure 8.
300
linear fit

95% confidence band
250
200
(gray levels)
150
100
50
r = 0.77551
0
0 200 400 600 800
Figure 9. Fluorescence from Tg(fli1:EGFP)y1 zebrafish ovarian follicles examined 48 hours after
trypan blue injection. Graph shows fluorescence in ovarian follicles as a function of their diameter. (n =
2 zebrafish).
300
linear fit
Figure 9.
95% confidence band
250
200
(gray levels)
150
100
50
r = 0.72925
0
0 200 400 600 800
Figure 10. Fluorescence from Tg(fli1:EGFP)y1 zebrafish ovarian follicles examined 96 hours after
trypan blue injection. Graph shows fluorescence in ovarian follicles as a function of their diameter.
300
linear fit

95% confidence band
250
200
(gray levels)
150
100
50
r = 0.69983
0
0 200 400 600 800
Figure 11. Fluorescence from Tg(fli1:EGFP)y1 zebrafish ovarian follicles examined 8 days after trypan
blue injection. Graph shows fluorescence in ovarian follicles as a function of their diameter.
300
linear fit

95% confidence band
250
r = 0.11991
200
(gray levels)
Figure 11. 150
100
50
0
0 200 400 600 800
Figure 12. Fluorescence from Tg(fli1:EGFP)y1 zebrafish ovarian follicles examined 14 days after
trypan blue injection. Graph shows fluorescence in ovarian follicles as a function of their diameter.
Trypan Blue Binding to Proteins
Injection of TB into the peritoneal cavity of zebrafish resulted in an increase in

fluorescence in the follicle-enclosed oocytes. An in vitro assay of TB-bovine serum albumin
Figure 12.
binding was performed to determine if the fluorescence increase was due to native unbound
TB or protein-bound TB. Changes in TB fluorescence as a function of albumin concentration
were plotted for various TB concentrations (Figure 13). From the plot itis can be seen that
when no TB is present, no fluorescence was evident at all BSA concentrations indicating that
albumin had no native fluorescence. Similarly, when no albumin was present in the solution,
the trypan fluorescence was low and similar to background at all TB concentrations indicating
that TB does not fluoresce in the absence of BSA. However, in the presence of TB in the
solution, the fluorescence increases steadily with increasing BSA concentrations.
Rhodamine
channel
FITC channel
300
250
200 zero trypan blue

0.0156% TB
Intesity
150 0.0313% TB
0.0625% TB
100 0.125% TB
0.25% TB
0.5% TB
50
1% TB
BSA mg/ml
Figure 13. Trypan blue binding to bovine serum albumin. Different concentrations of trypan blue were
mixed with bovine serum albumin (BSA) in a 96-well plate as in Figure 13 and the fluorescence of each
well was read. The image shows raw fluorescence in the wells taken using the rhodamine filter (above
dotted line) and FITC filter (below dotted line). Note no fluorescence was detectable in the FITC
Figure 13.
channel. The plot shows changes in trypan blue fluorescence (rhodamine channel) as a function of BSA
concentration.
Other Fluorescent Markers Are Not Endocytosed
Injection of i.p. mCherry protein, fluoroscein-conjugated casein (FITC-casein) or FITC-

lectin into adult females produced negligible fluorochrome uptake in the ovarian follicles of
all size classes after 24 hr incubation (Figure 14). While mCherry did not accumulate in
ovarian follicles, it did appear at high levels in the kidney tubules. These results indicate the
specificity of endocytotic uptake of substances by the ovarian follicles and suggest those
molecules introduced i.p. are not automatically endocytosed.
A
mCherry
brightfield red channel green channel
200 µm 200 µm 200 µm
200 µm 200 µm 200 µm
B
FITC-casein
brightfield red channel green channel
200 µm 200 µm 200 µm
Figure 14. Uptake of other fluorescent probes. A: Top two image sets show oocytes dissected from
mCherry injected wildtype zebrafish. mCherry fluorescence should be visible in the red channel
(center). Green channel indicates fluorescence spills over into that channel. B: Bottom images show
oocytes dissected from FITC-casein injected wildtype zebrafish. FITC-lectin fluorescence should be
visible in the green channel (far right).
Figure 14.
Fluorescent Trypan Blue Localizes to Yolk Vesicles
Optical sections of ovarian follicles after TB administration in vivo indicated trypan blue
fluorescence restricted to the follicle-oocyte surface and to membrane bound yolk vesicles
(Figure 15). The ooplasm between yolk vesicles was free of fluorescent label, further
suggesting the endocytotic uptake of TB along with vitellogenin. In addition, embryos from
TB labeled females revealed TB fluorescent yolk cells, while embryonic cells were free of
label (Figure 16). The labeling in the yolk persisted into the larval stage (Figure 17).
Figure 15. Optically sectioned zebrafish ovarian follicles after trypan blue i.p. administration. Label is
localized to oocyte surface and yolk vesicles (arrows).
Yolk cell
Embryonic cells
Figure 16. Brightfield and fluorescent images of cleavage-stage embryos from mother injected ip. with
trypan blue.
Figure 16
Figure 17. Brightfield and fluorescent images of larval-stage offspring from mother injected ip. with
trypan blue.
DISCUSSION
Evidence in Support ofFigure
Trypan17 Blue as a Vitellogenin Endocytosis Probe
In the present experiments, TB was used as a fluorescent marker for oocyte growth and
development. TB has been used extensively for decades as a marker for cell viability
(Hathaway et al., 1964; Pachman et al., 1971; Ward & Becker, 1967). Thus, TB exclusion
assay is a standard way to distinguish between healthy, and damaged or dead cells.
Paradoxically, TB incorporates into vertebrate oocytes as previously reported (Anderson &
Telfer, 1970; Callebaut et al., 1981; Selman & Wallace, 1983). These studies also suggest that
incorporation of TB into living oocytes is linked to oocyte uptake of vitellogenin and the
inclusion of TB into oocytes does not simply imply damaged or dead oocytes. This
conclusion is supported by preliminary experiments that show injection of TB into gravid
female zebrafish, results in oviposition of TB-containing eggs which when fertilized, develop
into healthy embryos. Importantly, in the embryos, TB is localized to the yolk cell and
excluded from the embryonic cells (Figure 16). This localization continues into the larval
stage (Figure 17).
Confocal images of the embryos indicate the typical red fluorescence only in the yolk
globules (Figure 15) and not in the ooplasm of the oocyte. These results support the
hypothesis that TB incorporation is primarily coupled with vitellogenin uptake in oocytes and
the TB appears to colocalize with the processed vitellogenin (i.e. lipovitellin and phosvitin) in
membrane enclosed yolk vesicles. Further, these experiments also show that TB uptake itself
does not limit oocyte growth or embryonic development and thus is non-toxic to the animal
and its cells.
Thus, broadly it appears that TB has contrasting functions. The marker reports the extent
of cell damage and death in one assay, while it reports growth and development in another
assay. This difference could be explained via the duration for which the two assays are
performed. For TB exclusion assay, the typical incubation time of the cells with the marker is
15 minutes or less (Hathaway et al., 1964; Pachman et al., 1971; Ward & Becker, 1967).
Accordingly, in the present studies no TB fluorescence was evident in oocytes dissected at 1
hour post TB injection. This clearly suggests that the oocytes were not damaged or dead and
the intact living cell excluded short-term TB uptake. In contrast, TB fluorescence was high in
oocytes dissected after several hours or days post injection. Thus, over longer durations in the
hours or days range, TB likely works as a marker of protein uptake via receptor-mediated
endocytosis, as evidenced by its specific localization in vitellogenic membrane-bound yolk
vesicles. Thus, the contrasting results obtained with TB depends on whether its presence
inside cells is detected within minutes, indicating reduced cell membrane continuity, or over
hours and days, indicating endocytotic activity.
Trypan Blue Uptake into Follicle-Enclosed Oocytes
In both wild-type and Tg(fli1:EGFP)y1 zebrafish, intraperitoneal injection of TB resulted

in a maximum increase in fluorescence in follicle-enclosed oocytes at 48 hours post injection.
Both at earlier and later time points, the fluorescence in follicle-enclosed oocytes was less
than at 48 hours. Consequently, measurements made before 48 hours showed that the
fluorescence increased gradually with time, while those made after 48 hours showed that the
fluorescence declined gradually with time post injection. Therefore, taken over the entire
duration, the data suggest that injection of TB led to a gradual increase in follicle-enclosed
oocyte fluorescence that peaked at 48 hours, followed by a decline.
The increase in fluorescence in follicle-enclosed oocytes following TB injection suggests
uptake of TB into the oocytes. TB has been used extensively as a marker for oocyte
development in several other vertebrates (Callebaut et al., 1981; Gutzeit & Arendt, 1994;
Harrisson et al., 1981; Selman & Wallace, 1983; Isayeva et al., 2004; Wajc et al., 1977).
Exposing live ovarian follicles to TB causes its incorporation into oocytes (Anderson &
Telfer, 1970; Danilchik & Denegre, 1991). Using Japanese quail, it was shown that even at
low concentrations, TB is taken up into oocytes (Harrisson et al., 1981). Further, the same
study also showed that TB fluorescence in oocytes is concentration dependent (Harrisson et
al., 1981). The in vitro assay in the present study also showed that TB fluorescence increases
with concentration. Also, TB fluorescence was detectable only when the marker was bound to
a protein and increased with increasing protein concentration. Therefore, high TB
fluorescence in follicle-enclosed oocytes suggests high incorporation of TB and its high
association with yolk proteins in the oocyte.
The time-dependent increase in TB fluorescence up to 48 hours suggests a time-
dependent increase in TB incorporation into the follicle-enclosed oocytes. TB incorporation
in oocytes of other vertebrates is linked to uptake of the yolk protein, vitellogenin into the
oocytes (Anderson & Telfer, 1970; Callebaut et al., 1981; Gutzeit & Arendt, 1994; Selman &
Wallace, 1983). Therefore, an increase in vitellogenin accumulation can lead to increase in
TB accumulation, and increased TB fluorescence. During development of follicle-enclosed
oocytes, vitellogenin accumulation and increase in oocyte size is highest during stage 3
(Clelland & Peng, 2009; Lessman, 1999; Lessman, 2009; Lubzens et al., 2010; Matsuda et al.,
2011; Selman & Wallace, 1983). The results in this study show that TB fluorescence was
highest in 300-500 micron diameter oocytes. Oocytes in this diameter range are likely to be in
stage 3 in teleost fish (Lessman, 1999, Lessman, 2009, Selman & Wallace, 1983). Hence in
the present study, it is likely that follicle-enclosed oocytes with high TB fluorescence were in
the vitellogenic phase. So it follows that the gradual increase in TB fluorescence is a direct
indication of the gradual development of vitellogenin accumulation in follicle-enclosed
oocytes. In other words, the temporal sequence of changes in TB fluorescence in follicle-
enclosed oocytes provides a new method to establish the time line of development of these
oocytes. Thus, the current studies suggest that vitellogenin uptake reaches a maximum in
oocytes presumably at 48 hours after introduction via ip injection. These time-line data match
findings reported in a recent publication showing uptake of FITC-labeled goldfish
vitellogenin into zebrafish ovarian follicles (Matsuda et al., 2011). The similar TB uptake
characteristics in both wild-type and Tg(fli1:EGFP)y1 zebrafish indicate that ovarian
development in transgenic zebrafish was similar to that in the wildtype zebrafish. Hence,
other ovarian development data obtained using Tg(fli1:EGFP)y1 zebrafish in the present set
of studies should be representative for zebrafish in general.
In addition, the TB fluorescence was also lower in follicle-enclosed oocytes dissected at
time points after 48 hours. The cause for this decline is not clear. It may be that TB
dissociates from vitellogenin, during the enzymatic processing of vitellogenin in the endo-
lysosome vesicles. The gradual decline in fluorescence may be due to the gradual breakdown
of vitellogenin by enzymatic processing. In addition, with increasing time, vitellogenin may
migrate deeper into follicle-enclosed oocytes as it is processed into lipovitellin and phosvitin
and stored in membrane-bound yolk vesicles. Hence, TB associated with vitellogenin also
moves to those deeper layers as vesicle trafficking occurs. Thus, the excitation light and
emission fluorescence must travel longer distances through the yolk-filled ooplasm and
hence, the TB fluorescence at the surface of follicle-enclosed oocytes may appear low.
Additional studies are needed to further determine which of the above two possibilities
contribute to the decline in TB fluorescence at time points beyond 48 hours after TB
injection.
While TB injection into zebrafish caused an increase in fluorescence in follicle-enclosed
oocytes, FITC-casein, FITC-lectin, and mCherry injection did not cause any change in
fluorescence. These results suggest that only TB was taken up into oocytes, and the other
markers were not. In previous studies, TB was present between the follicular epithelial cells,
suggesting that the dye moves through the various layers of the ovarian follicle via a similar
path used by vitellogenin (Anderson & Telfer, 1970). The exact reason for non-uptake of the
other markers needs additional studies, but endocytotic receptor specificity is a likely factor.
CONCLUSION
Trypan blue i.p. injection into adult female zebrafish was used to track ovarian follicle
dynamics including growth, atresia and vitellogenin incorporation. Trypan blue appeared in
yolk vesicles and fluoresced in the rhodamine channel upon binding to protein. Maximal
labeling with trypan blue occurred 48 hr post injection, while minimal labeling occurred 1 hr
post injection indicating the incorporation was a time-dependent mechanism likely linked to
vitellogenin receptor-mediated endocytosis. These data provide the first use of trypan blue to
elucidate ovarian dynamics in the zebrafish model organism and helps define a time line for
follicle-enclosed oocyte growth and development.
ACKNOWLEDGMENTS
The GFP-transgenic Tg(fli1:EGFP)y1 zebrafish line was a gift from Dr. Michael R.
Taylor, St. Jude Children‘s Research Hospital, Memphis, TN. We thank the University of
Memphis Department of Biological Sciences for their support of this research and Dr.
Kaushik Parthasarathi for helpful advice..
REFERENCES
Anderson, L. M. & Telfer, W. H., 1970. "Trypan blue inhibition of yolk deposition--a clue to
follicle cell function in the cecropia moth" J. Embryol. Exp. Morphol., 23, 35-52.
Ankley, G. T. & Johnson, R. D., 2004. "Small fish models for identifying and assessing the
effects of endocrine-disrupting chemicals" ILAR J., 45, 469-83.
Callebaut, M., Harrisson, F. & Vakaet, L., 1981. "Peripheral avian yolk assemblage and its
persistence in the blastoderm, studied by trypan blue-induced fluorescence" Anat.
Embryol. (Berl), 163, 55-69.
Clelland, E. & Peng, C., 2009. "Endocrine/paracrine control of zebrafish ovarian
development" Mol. Cell Endocrinol., 312, 42-52.
Danilchik, M. V. & Denegre, J. M., 1991. "Deep cytoplasmic rearrangements during early
development in Xenopus laevis" Development, 111, 845-56.
Davail, B., Pakdel, F., Bujo, H., Perazzolo, L. M., Waclawek, M., Schneider, W. J. & Le
menn, F., 1998. "Evolution of oogenesis: the receptor for vitellogenin from the rainbow
trout" J. Lipid Res., 39, 1929-37.
Droller, M. J. & Roth, T. F., 1966. "An electron microscope study of yolk formation during
oogenesis in Lebistes reticulatus guppyi" J. Cell Biol., 28, 209-32.
Gutzeit, H. O. & Arendt, D., 1994. "Blocked endocytotic uptake by the oocyte causes
accumulation of vitellogenins in the haemolymph of the female-sterile mutants quit PX61
and stand still PS34 of Drosophila" Cell Tissue Res., 275, 291-8.
Harrisson, F., Callebaut, M. & Vakaet, L. 1981., "Microspectrographic analysis of trypan

blue-induced fluorescence in oocytes of the Japanese quail" Histochemistry, 72, 563-78.
Hathaway, W. E., Newby, L. A. & Githens, J. H., 1964. "The Acridine Orange Viability Test
Applied to Bone Marrow Cells. I. Correlation with Trypan Blue and Eosin Dye Exclusion
and Tissue Culture Transformation" Blood, 23, 517-25.
Isayeva, A., Zhang, T. & Rawson, D. M., 2004. "Studies on chilling sensitivity of zebrafish
(Danio rerio) oocytes" Cryobiology, 49, 114-22.
Laale, H. W., 1977. "The biology and use of zebrafish, Branchydanio rerio, in fisheries
research. A literature review" J. Fish Biol. 10, 121-173.
Lessman, C. A., 1999. "Oogenesis, in Nonmammalian Vertebrates." Encyclopedia of
Reproduction, 3, 498-508.
Lessman, C. A., 2009. "Oocyte maturation: converting the zebrafish oocyte to the fertilizable
egg" Gen Comp Endocrinol, 161, 53-7.
Lessman, C. A. & Habibi, H. R. 1987. "Estradiol-17 beta Silastic implants suppress oocyte
development in the brook trout, Salvelinus fontinalis" Gen. Comp. Endocrinol., 67, 311-
23.
Levi, L., Pekarski, I., Gutman, E., Fortina, P., Hyslop, T., Biran, J., Levavi-Sivan, B. &
Lubzens, E., 2009. "Revealing genes associated with vitellogenesis in the liver of the
zebrafish (Danio rerio) by transcriptome profiling" BMC Genomics, 10, 141.
Lubzens, E., Young, G., Bobe, J. & Cerda, J., 2010. Oogenesis in teleosts: how eggs are
formed. Gen. Comp. Endocrinol., 165, 367-89.
Matsuda, Y., Ito, Y., Hashimoto, H., Yokoi, H. & Suzuki, T., 2011. "Detection of vitellogenin
incorporation into zebrafish oocytes by FITC fluorescence" Reprod. Biol. Endocrinol., 9,
45.
Okumura, H., Todo, T., Adachi, S. & Yamauchi, K., 2002. "Changes in hepatic vitellogenin
mRNA levels during oocyte development in the Japanese eel, Anguilla japonica" Gen.
Comp. Endocrinol., 125, 9-16.
Pachman, L. M., Esterly, N. B. & Peterson, R. D., 1971. "The effect of salicylate on the
metabolism of normal and stimulated human lymphocytes in vitro" J. Clin. Invest., 50,
226-30.
Polzonetti-Magni, A. M., Mosconi, G., Soverchia, L., Kikuyama, S. & Carnevali, O., 2004.
"Multihormonal control of vitellogenesis in lower vertebrates" Int. Rev. Cytol., 239, 1-46.
Segner, H., 2009. "Zebrafish (Danio rerio) as a model organism for investigating endocrine
disruption" Comp. Biochem. Physiol. C. Toxicol. Pharmacol., 149, 187-95.
Selman, K. & Wallace, R. A., 1983. "Oogenesis in Fundulus heteroclitus. III. Vitellogenesis"
J Exp Zool, 226, 441-57.
Selman, K., Wallace, R.A., Sarka, A., & Qi, X. 1993., "Stages of Oocyte Development in the
Zebrafish, Brachydanio rerio" J. Morphology, 218, 203-224.
Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N., Palmer, A. E. & Tsien, R.
Y., 2004. "Improved monomeric red, orange and yellow fluorescent proteins derived
from Discosoma sp. red fluorescent protein" Nat. Biotechnol., 22, 1567-72.
Spitsbergen, J. M., Blazer, V. S., Bowser, P. R., Cheng, K. C., Cooper, K. R., Cooper, T. K.,
Frasca, S., JR., Groman, D. B., Harper, C. M., Law, J. M., Marty, G. D., Smolowitz, R.
M., St Leger, J., Wolf, D. C. & Wolf, J. C., 2009. "Finfish and aquatic invertebrate
pathology resources for now and the future" Comp. Biochem. Physiol. C. Toxicol.
Pharmacol., 149, 249-57.
Spitsbergen, J. M. & Kent, M. L., 2003. "The state of the art of the zebrafish model for
toxicology and toxicologic pathology research--advantages and current limitations"
Toxicol. Pathol., 31 Suppl, 62-87.
Tong, Y., Shan, T., Poh, Y. K., Yan, T., Wang, H., Lam, S. H. & Gong, Z., 2004. "Molecular
cloning of zebrafish and medaka vitellogenin genes and comparison of their expression in
response to 17beta-estradiol" Gene, 328, 25-36.
Wajc, E., Bakker-Grunwald, T. & Applebaum, S. W., 1977. "Binding and uptake of trypan
blue by developing oocytes of Locusta migratoria migratorioides" J. Embryol. Exp.
Morphol., 37, 1-11.
Wallace, R. A. & Selman, K., 1980. "Oogenesis in Fundulus heteroclitus. II. The transition
from vitellogenesis into maturation" Gen. Comp. Endocrinol., 42, 345-54.
Wallace, R. A. & Selman, K., 1985. "Major protein changes during vitellogenesis and
maturation of Fundulus oocytes" Dev Biol, 110, 492-8.
Wallace, R. A. & Selman, K., 1990. "Ultrastructural aspects of oogenesis and oocyte growth
in fish and amphibians" J. Electron Microsc. Tech., 16, 175-201.
Wang, H., Tan, J. T., Emelyanov, A., Korzh, V. & Gong, Z., 2005. "Hepatic and extrahepatic
expression of vitellogenin genes in the zebrafish, Danio rerio" Gene, 356, 91-100.
Ward, P. A. & Becker, E. L., 1967. "Mechanisms of the inhibition of chemotaxis by
phosphonate esters" J. Exp. Med., 125, 1001-20.
Chapter 3
THE PROTEIN PHOSPHATASE INHIBITOR, OKADAIC

ACID, ELICITS SEVERAL COMPONENTS
OF ZEBRAFISH (DANIO RERIO) OOCYTE
MATURATION IN VITRO
Charles A. Lessman
Department of Biological Sciences, The University of Memphis, Memphis, TN, US
ABSTRACT
In vitro treatment of fully grown immature zebrafish oocytes with 17-, 20-
dihydroxyprogesterone (DHP) resulted in germinal vesicle migration (GVM) and
breakdown or dissolution (GVD), ooplasmic clearing (OC, as assessed by CAMMA,
Lessman et al., 2007 Mol. Reprod. Dev. 74:97-107), yolk protein changes (YP), and
blastodisc formation (BF).
Experiments were conducted to study the effect of okadaic acid (OA), a specific
inhibitor of protein phosphatase 1 (PP1) and protein phosphatase 2A (PP2A), on
zebrafish oocyte maturation. Immature oocytes treated with OA (1 g/ml) alone, showed
GVM and GVD, OC, YP, and BF. The GVD ED 50 for OA was 29.9 nM, for cantharidin
the ED50 was 213.6 nM, and for calyculin the ED50 was 23.9 nM. These ED50s are
consistent with the higher doses required for PP1 inhibition compared with 10-100 fold
lower doses for PP2A inhibition. The time course for maturation with OA was delayed
relative to DHP-induced maturation. In addition, OA-matured oocytes exhibited an
intermediate level of YP compared to DHP. OA and DHP were synergistic in promoting
oocyte maturation.
Microarray data indicated the presence of PP1 and PP2A mRNA in follicle-enclosed
oocytes. Column chromatography, dot and western blots indicated the presence of PP2A
subunit B contained within large complexes in homogenates of ovary, large ovarian
follicles and eggs. Together, these data support the hypothesis of PP1 and/or PP2A
involvement in oocyte maturation.

Contact: Charles A. Lessman, Ph.D. Department of Biological Sciences, The University of Memphis, 223 Life
Sciences Bldg. Memphis, TN 38152. Telephone: (901) 678-2963. FAX: (901) 678-4457. EMAIL:
CLessman@memphis.edu.
40 Charles A. Lessman
Keywords: Germinal vesicle, steroid, blastodisc, yolk proteins, meiosis, progestogen, okadaic
acid, cantharidin, calyculin
INTRODUCTION
Oocytes of the zebrafish, Danio rerio, are arrested in prophase I of meiosis as they
develop and grow within ovarian follicles (Selman et al. 1993). Once they reach a specific
size (>0.600-0.625mm) they acquire the capacity to undergo maturation in response to a
maturation inducing steroid (Selman, Petrino & Wallace 1994). During the course of
maturation, oocytes undergo drastic morphological changes associated with progression of
the meiotic cell cycle. The germinal vesicle (GV, nucleus) of the oocyte, which is centrally
located in immature oocytes, migrates to the periphery (future animal pole) and nuclear
envelope dissolution occurs (GVD). GVD occurring at the metaphase/anaphase transition is
usually considered a hallmark of the progression of oocyte maturation (Selman et al. 1993).
Prematurational follicles are opaque and during maturation the oocytes become translucent.
This change is correlated with yolk processing (YP) that results in changes in the size of
major yolk proteins, especially lipovitellin (Selman et al. 1993; Wallace & Selman 2002).
Both the loss of opacity and dissolution of the GV occur concomitantly and are reliable
markers of oocyte maturation (Selman, Petrino & Wallace 1994). Computer assisted meiotic
maturation assay (CAMMA) can be used to track density changes in individual oocytes over
time (Lessman et al. 2007). In addition to quantifying the translucency change or oocyte
clearing (OC), CAMMA also provides the basic information on GVM, GVD, and blastodisc
formation (BF) (Lessman et al. 2007). The blastodisc is a relatively yolk-free cap of ooplasm
that forms the animal pole of the teleost egg and contains the meiotic spindle and the
micropyle or sperm entry site (Lessman & Huver 1981; Lessman 1999). The oocytes
complete the first meiotic division and arrest at the second meiotic metaphase; at this point
the matured oocyte becomes an activatible/fertilizable egg (Selman & Wallace 1989).
Zebrafish oocytes provide an excellent experimental system to investigate the molecular
mechanisms controlling meiosis. 17-, 20- dihydroxyprogesterone (DHP) is the most
effective physiological steroid for inducing oocyte maturation in vitro (Selman, Petrino &
Wallace 1994). In contrast to intracellular, cytoplasmic steroid receptor-mediated cell
responses, DHP interacts with a membrane-associated progestin receptor (mPR) to induce
oocyte maturation. Microinjection of zebrafish oocytes with antisense oligonucleotides to the
homologous zebrafish mPR cDNA, blocked the development of maturation competence in
response to DHP and provided preliminary evidence that mPR is involved in the induction of
oocyte maturation in this species (Thomas et al. 2004; Zhu et al. 2003). DHP binding to the
receptor causes rapid activation of the intracellular signaling pathways. The mPR activates an
inhibitory G protein decreasing cyclic AMP levels (Zhu et al. 2003). Maturation promoting
factor (MPF) is a heterodimeric protein complex that consists of protein kinase p34cdc2
(CDK) and a regulatory subunit called cyclin B. In zebrafish, DHP has been shown to induce
oocyte maturation by stimulating the de novo synthesis of cyclin B, a regulatory subunit of
MPF by causing translation of the mRNA (Kondo et al. 1997). The appearance of MPF
activity ultimately leads to a major burst in protein phosphorylation, approximately coincident
with GVD (Ozon et al. 1987). Several distinct protein kinase activities are enhanced at the
PPase Inhibition Induces Zebrafish Oocyte Maturation 41
time of the appearance of MPF (Cicirelli, Pelech & Krebs 1988). MPF phosphorylates
specific substrates, such as histone H1, lamins, vimentin, cyclins and microtubule associated
proteins, explaining the initiation of mitotic processes such as nuclear breakdown,
chromosome condensation and spindle formation. Elucidating the regulatory mechanisms
involved in oocyte meiosis is imperative to fully understand this complex process and to
allow for optimization of in vitro maturation systems.
Reversible protein phosphorylation is an essential regulatory mechanism in many cellular
processes. In general, cells use this post-translational modification to alter the properties
(activity, localization, etc.) of key regulatory proteins involved in specific pathways. While in
the past much attention has been paid to the regulation of protein kinases, it is now apparent
that protein phosphatases (PPases) like their counterparts, the kinases, are highly regulated
enzymes that play an equally important role in the control of protein phosphorylation (Shi
2009). Many processes in cell cycle progression are regulated by intracellular
phosphorylation/dephosphorylation events. Numerous kinases have been investigated and
implicated in oocyte meiotic regulation, especially maturation promoting factor (MPF) and
mitogen-activated protein kinase (MAPK) have been studied extensively while the role of
specific protein phosphatases (PP) has largely been overlooked (Abrieu, Doree & Fisher
2001).
The two most abundant serine/threonine protein phosphatases (PP) in eukaryotic cells are
PP1 and PP2A (Virshup & Shenolikar 2009). Among the phosphatases, protein phosphatase
2A is a major serine/threonine protein phosphatase present in the cytoplasm of mammalian
cells (Cohen 1989; Shenolikar & Nairn 1991) and is involved in a variety of cellular
processes (Walter & Mumby 1993; Wera & Hemmings 1995) such as signal transduction,
DNA replication, transcription, translation, apoptosis and the cell cycle (Janssens & Goris
2001; Sontag 2001). Okadaic acid (OA), a polyether 38 carbon monocarboxylic acid, is a
potent and selective inhibitor of PP1 and PP2A (Bialojan & Takai 1988; Hescheler et al.
1988; Haystead et al. 1989). Of the remaining two major protein phosphatases, PP2B is only
weakly inhibited, and PP2C is not affected. PP2A is completely inhibited by 1nM OA, while
PP1 is unaffected at this concentration, its IC50 being higher at 10-15nM (Cohen, Klumpp &
Schelling 1989). PP1 and PP2A are structurally related enzymes showing 50% amino acid
sequence identity in the catalytic domain. The sensitivities of both PP1 and PP2A to OA have
been remarkably conserved in eukaryotic cells and this observation is consistent with the
extreme structural similarity that emerged from cDNA analyses (Klumpp, Cohen & Schultz
1990). OA is a powerful tool for the study of biological processes mediated by protein
phosphorylation. It was initially isolated from the marine sponges Halichondria okadaii and
H. melanodocia (Tachibana et al. 1981) but later found to actually come from certain varieties
of dinoflagellates (marine plankton) and to accumulate in sponges and bivalves through filter
feeding. OA is the causative chemical agent of diarrhetic seafood poisoning, a serious illness
resulting from the ingestion of contaminated shellfish.
The implication of PP2A in the regulation of the G2/M transition was initially suggested
through experiments using OA. Injection of OA into Xenopus (Goris et al. 1989) or starfish
(Picard et al. 1989) oocytes induced the formation of active MPF, resulting in meiotic
maturation. In starfish oocytes, activation of MPF requires a nuclear component that inhibits
PP2A, and which can be bypassed by addition of OA (Picard et al. 1991). OA, but not the PP-
1 inhibitors I-1 and I-2, induced Cdc2 kinase activation in interphase extracts (Felix, Cohen &
Karsenti 1990). OA induces GVD and chromosome condensation when microinjected into
denuded mouse oocytes (Gavin, Tsukitani & Schorderet-Slatkine 1991; Schwartz & Schultz
1991). Like the protein kinases, the type 2A phosphatases also undergo changes in their
activity during early mammalian development (Winston & Maro 1999). OA accelerates
germinal vesicle breakdown and overcomes cycloheximide- and 6-dimethylaminopurine
block in cattle and pig oocytes (Kalous et al. 1993). Furthermore it prematurely induces
various mitotic phenotypes like chromosome condensation and formation of mitotic asters
(Sun et al. 2002). OA stimulated GVD by promoting MPF and/or MAPK activity (Rime et al.
1990). Further, OA reverses the inhibitory effect of cAMP and PKC activation on meiotic
resumption and MAPK phosphorylation (Lu et al. 2001). Evidence for a possible interaction
between OA sensitive protein phosphatases and MAPK during oocyte maturation was
established in the catfish Heteropneustes fossilis (Mishra & Joy 2006).
To investigate the possibility that inhibition of OA sensitive protein phosphatases would
be capable of inducing the maturation of zebrafish oocytes, we incubated fully grown
immature oocytes in OA. Here we report that OA caused GVM, GVD, OC, YP, and BF
suggesting that it induced some of the major indicators of oocyte maturation in zebrafish.

Animals
Adult wild-type zebrafish (Danio rerio) were reared at 28oC with a 14hr photoperiod, and
fed Tetramin daily, supplemented with frozen and dried brine shrimp. All animals in this
research were used in accordance with approved IACUC protocols (#0677 and #0714). Males
and females were housed together in 10L tanks with a daily exchange of 10% water. Gravid
females were selected and sacrificed by decapitation; ovaries were immediately removed to
modified 100% Cortland‘s solution (Wolf & Quimby 1969) containing (gm/L): NaCl 7.25,
CaCl2 0.23, MgSO4 0.23, KCl 0.38, HEPES acid 1.9, HEPES salt 3.1, penicillin 30 mg/L, and
streptomycin 50 mg/L (pH 7.8).
Ovarian Follicles
Large follicles (~0.5-0.7mm) were dissected from the ovary with watchmaker forceps,
aided by a stereo dissecting microscope. Follicles were pooled and allowed to preincubate for
30min; follicles, that remained intact without apparent damage, were placed singly in round-
bottom wells of a 96 multiwell plate containing 200 l Cortland‘s solution per well.
Computer-Aided Meiotic Maturation Assay (CAMMA)
The systems used are adapted from those first described for Computer Aided Screening
(CAS) developed for Zebrafish (Lessman et al. 2007,;Lessman 2002; Lessman et al. 2010).
Hewlett-Packard scan jets with transparency adapters were interfaced to Pentium computers
running MS Windows, HP scan jet pro and macro scheduler programs (www.mjtnet.com ).
Loaded multiwell plates were placed singly onto the scanner bed. A clear plastic cover was
placed over the bed and the bed temperature monitored by thermistor probe; temperature
varied less than 1oC from 28.5oC for these experiments. Plates were automatically scanned at
1200dpi, 8-bit grayscale at 10min intervals and the resulting files saved automatically to disk
by macro programming.
Experimental Treatments
17-, 20-dihydroxyprogesterone (DHP), (Steraloids.Inc) and okadaic acid (OA),

(A.G.Scientific Inc.) were dissolved in steroid vehicle (EtOH: propylene glycol, 1:1). Stock
concentrations (1mg/ml) of both DHP and OA were prepared. Aliquots of both DHP and OA
stock dilutions were added to 200 l of 100% Cortland‘s solution in wells of a 96-well plate
to produce a final concentration ranging from 1 - 100 ng/ml DHP and 0.01 - 100 nM OA.
Calyculin A (Cell Signalling Inc.) and cantharidin (Merck Chemicals) were dissolved in
steroid vehicle as a stock 10 fold dilution series; aliquots were dispensed into 200ul of
Cortland‘s solution in wells of 96-well plates to give final concentrations of 0.01 – 100 nM
calyculin A and 0.1 – 1000 nM cantharidin.
Image Analysis
Images were stacked and animated in ImageJ (http://rsb.info.nih.gov/ij/) to allow a

qualitative visual assessment of the treatment effects. In order to obtain quantitative data, the
image stack was opened in ImageJ, the grayscale adjusted to full 8-bit scale (i.e., 0 = black,
255 = white) by using the ―auto‖ function from the ―adjust image‖ menu, and a region of
interest (ROI) was defined for each oocyte using the ROI manager tool in the ―analyze‖
menu. The average intensity was automatically computed for all ROIs in the entire stack.
Data were saved in MS Excel, which was used to calculate means and standard errors. Data
were plotted in SigmaPlot 8.0 (Jandel Scientific) and statistical analysis was performed using
SigmaStat (Jandel Scientific).
RNA Isolation and Microarray
Tissue samples (100 mg) were homogenized in 1 ml of RNA STAT-60 (Tel-Test Inc.)
reagent using a glass- Teflon homogenizer. The homogenate was stored at room temperature
for 5-10 min and then mixed with 200 μl of chloroform. The sample tube was capped tightly,
shaken vigorously for 15 seconds and stored at room temperature for 5 min. Then the mixture
was centrifuged at 12,000xg for 45 min at 4 °C. The colorless upper aqueous phase was
transferred to a fresh tube and mixed with isopropanol (500 μl isopropanol per 1 ml STAT-60
used in the original homogenization). The sample was stored at room temperature for 30 min
and centrifuged at 12,000xg for 45 min at 4 °C. The supernatant was carefully removed and
the white RNA pellet was washed once with 80 % ethanol (1 ml ethanol per 1 ml STAT-60
used in the original homogenization). The washed RNA pellet was collected by centrifugation
at 7,500xg for 10 min at 4 °C. After the ethanol was discarded, the RNA pellet was air dried,
dissolved in RNase-free water and stored at -80 °C for microarray analysis.
Microarray analysis was carried out on Affymetrix zebrafish genome arrays in the W.
Harry Feinstone Center for Genomic Research at The University of Memphis using MIAME
protocols. Briefly, total RNA (8 g) was synthesized to cDNA using the Superscript Double-
Stranded cDNA synthesis kit (Invitrogen Corp, Carlsbad, CA) and poly T-nucleotide primers
that contain a sequence recognized by T7 RNA polymerase. The newly synthesized cDNA
was used as a template to generate biotin-labeled in vitro transcribed (IVT) cRNA using the
Bio-Array High Yield RNA transcript labeling kit (Enzo Diagnostics, Inc, Farmingdale, NY).
Twenty micrograms of the cRNA was fragmented to strands of 35 to 200 bases in length. The
fragment cRNA was hybridized to an Affymetrix GeneChip Zebrafish Genome Array at 450C
with rotation for 16 h (Affymetrix GeneChip Hybridization Oven 320). The GeneChip arrays
were washed and stained (streptavidin phycoerythrin) on an Affymetrix Fluidics Station 400,
followed by scanning.
Column Chromatography
Samples of 200 immature oocytes or 200 mature oocytes (eggs) were homogenized in
400 ml of 0.15M NaCl 50mM Tris buffer (pH 7.4) the samples were then centrifuged at
1000xg to spin down yolk. Samples of 400 ml of each supernatant were run on a Superose 6B
column (1.5 x 30 cm) and 1ml fractions were collected. Pooled zebrafish ovary tissue
weighing 135 mg from gravid females was homogenized in 270 ml of 0.15 mM NaCl 50mM
Tris buffer. The sample was then centrifuged at 1000xg to spin down yolk. A supernatant
sample of 270 ml was run on a Superose 6B column. Proteins were eluted in 0.154 M NaCl
50mM Tris buffer at the rate of 1 ml per tube and collected with a model 2110 fraction
collector (Bio-Rad). MW standards were eluted as follows: blue dextran (2mDa) fraction 18,
thyroglobulin (669 kDa) fractions 25-26, apoferritin (443 kDa) fractions 28-29 and bovine
serum albumin (68 kDa) fractions 31-32.
Phosphatase 2A Antibody
Anti serine/ threonine protein phosphatase 2A/B is a rabbit polyclonal antibody (Exalpha
Biologicals. Inc., P165P). This antibody is specific to pp2A/B isoforms. The immunogen was
the purified peptide sequence NH2-VSSPHFQVAERALY-COOH (14 amino acid peptide
corresponding to positions 352-365) conjugated to KLH.
Dot Blot
Aliquots (100l) were spotted onto nitrocellulose using a Milli-D 96-well dot blot
system (Millipore Co) starting from fraction 16, even-numbered fractions up to the 50th
fraction, were blotted. After sample loading, the membrane was washed with blotting buffer
(14.4g glycine, 3.03g Tris base in 200ml methanol and 800ml double distilled water, pH 8.3)
under vacuum. The membrane was incubated with 10 ml of 5% nonfat milk (Carnation) PBS
solution (KCl, 0.2 g/l; KH2PO4, 0.2 g/l; NaCl, 8 g/l; Na2HPO4, 2.16 g/l; pH 7.4) in a zip-lock
bag for 30 minutes at room temperature to block nonspecific signals. The membrane was
washed three times with PBS and then probed with (1:200) rabbit anti serine/threonine PP
2A/B (Exalpha P165P) overnight. The membrane was washed three times again with PBS
and incubated with 1:100 dilution of colloidal gold conjugated goat anti-rabbit IgG (GAR)
overnight. The membrane was then washed three times with PBS and the gold probes were
silver enhanced with Intense II (Amersham Co. Arlington Height, IL).
Electrophoresis
For the yolk protein modification experiment, single oocytes were homogenized in 10l
of urea solubilization buffer (10M urea, 5% mercaptoethanol, 4Mm EDTA, 5% sodium
dodecyl sulphate (SDS) and 10% glycerol) using a Teflon pestle for microcentrifuge tubes.
The resulting homogenate was heated for 2 min in a boiling water bath and stored at –20oC
until further use. Individual oocyte samples were then loaded into separate lanes of a SDS-
PAGE gel. Sodium dodecyl sulphate- polyacrylamide gel electrophoresis was performed
according to the procedure of Laemmli (Laemmli 1970) using a 7% 0.5mm thick separating
gel and a 3.5% stacking gel in a mini gel apparatus (Hoefer Scientific, San Francisco, CA).
Gels were stained with Coomassie blue using standard protocols (Harlow & Lane 1999). The
samples were then centrifuged at 16,000xg for 5 minutes. Samples were mixed with loading
buffer and 40 ml of the supernatant from each sample was run on a 1mm thick SDS-PAGE
10% gel. Prestained molecular marker mixture (Sigma Chem.Co., St.Louis, MO) was used as
a standard. A sample of adult zebrafish brain was run as a positive control.
Western (Immunoblot) Blot
The gel was electroblotted for 2 hr onto nitrocellulose using a "Genie" electroblotter (Idea
Scientific Co.). The membrane was incubated with 10 ml of 5% nonfat milk (Carnation) PBS
solution (KCl, 0.2 g/l; KH2PO4, 0.2 g/l; NaCl, 8 g/l; Na2HPO4, 2.16 g/l; pH 7.4.) in a zip-lock
bag for 30 minutes at room temperature to block nonspecific signals. The blotted gel was
stained to determine the extent of the transfer. The membrane was washed three times with
PBS and then probed with 1:250 dilution of rabbit anti serine/threonine PP 2A/B (Exalpha
P165P) overnight. The membrane was washed three times again with PBS and incubated with
1:100 dilution of colloidal gold conjugated goat anti-rabbit IgG (GAR) overnight The
membrane was then washed three times with PBS and the gold probes were silver enhanced
with Intense II (Amersham Co.Arlington Height, IL).
Statistics
Summary data are presented as Mean ± SEM. The significance between multiple groups
of data was evaluated using analysis of variance (ANOVA). Student's t-test was used to
determine the statistical significance of data. Data differences were considered significant at P
< 0.05. Probit analysis was used to determine ED50 and T50 values.
RESULTS
OA Caused Oocyte Clearing: Time Course
Oocyte clearing (OC) as assessed by investigator observation via microscope has been
used as a traditional method to score oocytes undergoing maturation (Selman, Petrino &
Wallace 1994). Automation of OC is now possible using CAMMA to track density changes
in individual oocytes over time (Lessman et al. 2007). CAMMA has the capability to produce
quantitative data for oocyte clearing when stacks of time-course images are analyzed by
digital densitometry (Lessman et al. 2007). CAMMA was used to assess the maturation
inducing activity of OA (1g/ml; 1.2 uM) on zebrafish follicle-enclosed oocytes in vitro. The
clearing of oocytes with DHP (1 g/ml) was used as a positive control while those treated
with steroid vehicle served as negative controls. Follicle arrays were automatically scanned at
10min intervals and the resulting images were archived to disk.
Figure 1. Computer-Aided Meiotic Maturation Assay (CAMMA). Comparison of CAMMA assay of

individual oocytes treated with steroid vehicle (A), DHP (1 g/ml) (B) and okadaic acid (1 g/ml) (C)
for 8 hours. Oocytes treated with DHP clear at a faster rate without an initial lag period. Oocytes treated
with okadaic acid clear after an initial lag period. CAMMA uses an 8-bit grayscale with 0 = black
(opaque) and 255 = white (clear) as this relates to the y-axis.
Figure 2. Graph comparing the average intensities and time course for clearing of oocytes treated with
steroid vehicle, DHP (1 g/ml) and okadaic acid (1 g/ml). Data presented as mean +/- SEM and n =
40. Oocytes incubated in respective treatments were followed by CAMMA for 8 hours. The images
from CAMMA were stacked and analyzed using Image J. Okadaic acid takes a longer time to cause
clearing of the oocytes than DHP; i.e. the incubation time in minutes to produce a 50% clearing (T50)
was significantly more for OA versus DHP.
Images were submitted to ImageJ for image analysis to determine the optical density
(signal intensity) for each oocyte. CAMMA uses an 8-bit grayscale with 0 = black (greatest
density or opaque) and 255 = white (least density or increased clearing), thus OC is denoted
by an increase in signal intensity. Results for a typical experiment are shown in Figure 1; OC
is represented as an increase in intensity (i.e., a decrease in optical density) in these plots from
ten individual oocytes per treatment tracked over 8 hr. DHP treated oocytes showed a higher
degree of synchronous OC changes that occurred earlier compared to individual OA-treated
oocytes.
In subsequent replicate experiments, pooled results revealed that OA treated oocytes
started OC around 120 minutes on average; OA-induced OC gradually increased in the time
range of 200-300 min (Figure 2). In contrast, DHP treated oocytes started OC much earlier
around 50-60 min and showed a much steeper increase in OC over time (Figure 2). Maximal
OC occurred by approximately 480 min in all the oocytes treated with OA and was not
significantly different from maximal DHP-induced OC. However, in DHP treated oocytes
maximal OC occurred much earlier around 240 min. The time to produce 50% density change
(T50) in OA treated oocytes was 246.8 min, while for DHP treated oocytes T50 = 115.6 min.
Steroid vehicle treated oocytes generally did not clear significantly as a group during the
times investigated (T50 > 480 min).
Synergistic Effect of Subthreshold Dose of DHP with OA
Can OA act synergistically with DHP to cause OC? To address this question, fully grown
immature oocytes were incubated in subthreshold doses of the two compounds: 0.05ng/ml of
DHP, 0.5 g/ml OA or 0.05 ng/ml + 0.5 g/ml OA.
Figure 3. Graph comparing the average intensity and time course for clearing of the oocytes treated
with steroid vehicle, very low doses of DHP (0.05 ng/ml) alone, okadaic acid g/ml) alone, and
very low dose of DHP (0.05 ng/ml) combined with okadaic acid (0.5 g/ml). Data presented as mean
+/- SEM intensity with n = 40. Oocytes treated with steroid vehicle, very low dose of DHP, or okadaic
acid alone did not clear. Oocytes treated with 0.05 ng/ml of DHP and 0.5 g/ml of okadaic acid cleared
indicating that they are synergistic in action. (+) superscript indicates the combined treatment is
significantly different from other groups at the same time of incubation using the Students T-test (p <
0.05).
The oocytes were followed by CAMMA and the image data were analyzed by ImageJ.
Oocytes in the DHP 0.05 ng/ml or OA 0.5 g/ml treatment groups did not show OC (Figure
3). However oocytes in the combined treatment group, DHP 0.05 ng/ml + OA 0.5 g/ml,
showed significant OC indicating that OA can act synergistically with DHP. The synergistic
time course for the two compounds together was more similar to the high OA dose (i.e. 1
g/ml) alone than the 10 ng/ml DHP treatments (compare Figure 2 & 3).
OA Causes Blastodisc Formation during Oocyte Clearing
DHP induces formation of blastodisc during oocyte maturation (Selman et al. 1993). The
formation of the blastodisc can be tracked by CAMMA (Lessman et al. 2007). In order to
determine if OA treated oocytes form blastodiscs during the clearing process, individual
oocytes were treated with OA, DHP and steroid vehicle and scanned at 10 minute intervals.
DHP cleared oocytes formed blastodiscs which were evident by about 210 minutes after
initial treatment. OA cleared oocytes also formed blastodiscs which were evident by about
360 minutes after initial treatment. Vehicle treated oocytes remained opaque throughout the
assay (data for vehicle not shown). However, the size and extent of blastodiscs formed in OA
cleared oocytes were less compared to the blastodiscs formed in the DHP treated oocytes
(Figure 4).
Figure 4. Time course of DHP and okadaic acid induced oocyte clearing and blastodisc formation (bf)
as assessed by computer-aided meiotic maturation assay (CAMMA). Large well formed blastodisc (B)
appears at the presumptive animal pole.
Okadaic Acid Causes Germinal Vesicle Migration and Breakdown

in Zebrafish Oocytes
The nucleus or germinal vesicle (GV) of the oocyte is centrally located in immature
oocytes; during oocyte maturation the GV migrates to the periphery (GVM) and nuclear
envelope dissolution occurs (GVD). To determine if OA causes GVM and GVD, oocytes
were incubated in steroid vehicle, DHP (1g/ml) and OA (1g/ml) and replicate groups were
followed by time-lapse photomicrography with a stereoscope mounted camera.
Representative oocytes, treated with OA and imaged with a high resolution stereoscope
mounted camera, show GVM occurring at 120 min with subsequent GVD and blastodisc
formation (BF) occurring about 320 min (Figure 5). DHP treated oocytes showed GVM and
GVD as described previously, while vehicle had no effect (data not shown) (Lessman et al.
2007).
Figure 5. Time course of germinal vesicle migration (GVM) and GV breakdown (GVD) in two
representative oocytes treated with okadaic acid. At 120 min of treatment the germinal vesicle (gv)
moves to presumptive animal pole. At 320 min of treatment the germinal vesicle has undergone
dissolution and a blastodisc (b) has formed.
OA Causes Yolk Protein Changes during Oocyte Clearing
Yolk proteins undergo apparent remodeling (Lessman et al. 2007; Selman et al. 1993)
during the DHP induced clearing process. A relatively minor yolk protein (~90kD) becomes
the predominate protein in oocytes corresponding to the maximal clearing seen via CAMMA,
while the major protein (~105kD) in prematuration opaque oocytes correspondingly decreases
in abundance.
Figure 6. Individual oocyte protein profiles on SDS-PAGE after treatment with okadaic acid, DHP or
steroid vehicle. Zebrafish oocytes were treated with steroid vehicle, DHP (1µg/ml), or okadaic acid
(1µg/ml) for 8 hours. Each oocyte was then homogenized in 10 l of urea solubilization buffer. 10 l of
each individual oocyte sample was then loaded into separate lanes of a SDS-PAGE 7% 0.5mm thick
gel. Gels were stained with Coomassie blue. The higher molecular weight (110 kDa) yolk band
predominates in oocytes treated with steroid vehicle (A). The lower molecular weight (90 kDa) band
predominates in oocytes treated with DHP (B) suggesting yolk processing during maturation. Both the
higher and the lower molecular weight bands are found in approximately equal proportions in the
oocytes treated with okadaic acid (C) suggesting the yolk processing is intermediate to that for DHP.
(D) Graph comparing the ratio of yolk proteins of individual oocytes treated with steroid vehicle, DHP
(1 g/ml), and okadaic acid (1 g/ml) for 8 hours. The yolk protein ratios were obtained by dividing the
total signal from the higher molecular weight band (110 kDa) band with total signal from the lower
molecular weight band (90 kDa). Oocytes treated with steroid vehicle have high yolk protein ratios i.e.
>>1. Oocytes treated with DHP have low yolk protein ratios i.e. <<1. Oocytes treated with okadaic acid
have intermediate yolk protein ratios.
Changes in the molecular weight profiles of yolk protein were correlated with
maturational clearing and may provide a useful biochemical marker for meiotic maturation in
zebrafish (Lessman et al. 2007). In order to determine if the changes in major yolk proteins
occur during OA induced oocyte clearing, individual oocytes were treated with OA, DHP and
steroid vehicle and scanned at 10 minute intervals, then immediately prepared for SDS-
PAGE, one oocyte per lane. From the resulting gels (Figure 6), the yolk ratio was computed
and plotted against signal intensity for the same oocyte. Steroid vehicle treated oocytes had
high yolk protein ratios after 8 hrs (i.e., negligible yolk processing). DHP cleared oocytes had
yolk protein ratios less than one (i.e., high levels of yolk processing). However OA treated
oocytes had yolk protein ratios that were intermediate to the steroid vehicle and DHP treated
oocytes (Figure 6).
Evidence for Coincident Oocyte Clearing (OC) and Yolk Processing (YP)
in DHP and OA Treated Oocytes
Large oocytes were incubated with DHP, OA or vehicle and representative oocytes were
imaged with CAMMA, removed at 0, 60, 120, 180, 240 or 300 min, fixed with acetic acid to
assess GVD, then the same oocyte was solubilized and run on SDS-PAGE to determine its
yolk ratio. The results are summarized in Figure 7. The vehicle control oocytes all had optical
density (OD) values between 34 and 87 as determined by CAMMA and all contained a GV
(Figure 7A). The control yolk ratios were also consistently high (>4) indicating no yolk
processing. DHP treated oocytes showed characteristic OC with the OD increasing rapidly at
120 min concomitant with GVD as determined with acetic acid fixation (Figure 7B). YP
occurred subsequently at 160 min with a yolk ratio less than 4. OA treated oocytes showed
OC beginning at 180 min and GVD at 240 min; YP also did not occur until 240 min (Figure
7C).
Comparison of PPase Inhibitors on Induction of Oocyte Clearing (OC)
Cantharidin, calyculin and OA were incubated with oocytes at 10-fold serially diluted
doses and the Effective Dose to elicit OC in 50% of the oocytes (ED50) was determined
(Table 1). The results are more consistent with ED50s for PP1 (i.e., 10 fold higher than those
for PP2A).
Evidence for the Presence of Protein Phosphatase (PP1 and PP2A)

Transcripts in Zebrafish Oocytes
Microarray was conducted to see whether protein phosphatase 1 and 2A transcripts were
present in the fully grown immature and mature oocytes. The data showed that both PP1 and
PP2A transcripts were present in both immature and mature oocytes (Table 21). DHP-mature
oocytes are represented by egg sample and immature oocytes are represented by the ovary
sample. The most abundant phosphatase in both samples is PP1.
Evidence for the Presence of Phosphatase 2A (PP2A) Protein in Zebrafish

Oocyte
In order to determine if zebrafish oocytes contain the protein products of the identified
transcripts, dot blot analysis of fractions from Superose 6 B column of fully grown, immature
oocytes, mature oocytes and ovary was conducted (Figure 8B and C). Primary antibodies
against the regulatory subunit of PP2A revealed the presence of PP2A from the 18th fraction.
The intensity of signal was very high in the initial fractions (i.e., approx. 2 MDa) and later
decreased in subsequent fractions.
Figure 7. Comparison of yolk ratio plots with individual oocytes treated with vehicle (A), DHP (B) or
OA (C). Upper row of each panel is the actual signal intensity or optical density (OD) for each live
oocyte determined by CAMMA. The next row is the image of the live oocyte scanned, while the third
row shows the same oocyte after clearing-fixing agent was added to visualize the GV presence (+) or
absence (-).
Table 1. Protein phosphatase 1 and 2a inhibitor effects on zebrafish oocyte maturation

in vitro
Compound ED50 95% Confidence Interval
Calyculin A 23.9 nM 12.8 – 44.6 nM
Okadaic acid 29.9 nM 12.1 – 44.3 nM
Cantharidin 213.6 nM 128.0 – 356.5 nM
DHP 2.6 nM 1.6 – 4.1 nM
Data presented as the concentration of compound to elicit clearing in 50% of the oocytes (ED 50) in
vitro. Four females tested with 20 oocytes used per dilution (i.e., 240 oocytes for each compound).
DHP is 17 20 dihydroxyprogesterone used as a control.
Table 2. Microarray data for transcripts of protein phosphatases in Zebrafish mature

oocytes (eggs) and ovary (containing predominately fully grown. immature oocytes)
ratio egg/ accession

egg ovary protein phosphatase (annotation)
ovary number
4629 5690 0.8 dual specificity phosphatase 1 BC045494.1
3388 4763 0.7 protein phosphatase 1, regulatory (inhibitor) subunit 5 BC067184
protein phosphatase 1G (formerly 2C), magnesium-
1675 1345 1.2 BC052132.1
dependent, gamma isoform
1673 1150 1.5 protein phosphatase 1 nuclear targeting subunit BC048892.1
1579 1203 1.3 phosphoprotein phosphatase 2-alpha regulatory chain
strong similarity to protein pdb:1JK7 (H.sapiens) A Chain A,
1383 1376 1.0 Crystal Structure Of The Tumor-Promoter Okadaic Acid BC070008
Bound To Protein Phosphatase-1
17-kDa PKC-potentiated inhibitory protein of PP1; protein
1382 1331 1.0
phosphatase 1
1362 1178 1.2 Protein phosphatase 2C beta isoform (PP2C-beta)
protein phosphatase 2 (formerly 2A), catalytic subunit, alpha
1295 990 1.3 BC045892.1
isoform,
1082 895 1.2 Protein phosphatase 2A, regulatory B subunit, B56 BC067382
1081 1133 1.0 protein phosphatase 1D magnesium-dependent, delta isoform, BC045471.1
Serinethreonine protein phosphatase 2A, 65 kDa regulatory
954 1444 0.7
subunit A
942 987 1.0 Dual specificity protein phosphatase 5
941 755 1.2 Dual specificity protein phosphatase 3
899 711 1.3 protein tyrosine phosphatase 1b (ptp1b) NM_130924.1
817 1093 0.7 protein phosphatase 1D magnesium-dependent, delta isoform, BC045471.1
794 971 0.8 protein tyrosine phosphatase, non-receptor type 2 BC044373.1
766 660 1.2 protein tyrosine phosphatase SH-PTP2 BC045328.1
656 552 1.2 pdp2 pyruvate dehydrogenase phosphatase isoenzyme 2
629 1192 0.5 protein phosphatase inhibitor 2 BC065600
556 615 0.9 pp2cb protein phosphatase type 2C beta
dual specificity phosphatase 5; VH1-like phosphatase 3;
469 ND protein tyrosine phosphatase; serinethreonine specific protein
phosphatase
461 322 1.4 TAK1-binding protein 1 BC058295
446 340 1.3 TAK1-binding protein 1
Table 2. (Continued)
ratio egg/ accession

egg ovary protein phosphatase (annotation)
ovary number
protein phosphatase 1, regulatory subunit 15A; growth arrest
444 334 1.3
and DNA-damage-inducible 34
441 333 1.3
Protein phosphatase 2C delta isoform (PP2C-delta) (p53-
407 481 0.8 induced protein phosphatase 1) (Protein phosphatase
magnesium-dependent 1 delta)
395 697 0.6 phosphoprotein phosphatase 2A regulatory chain, 74K BC067382
376 878 0.4 Protein phosphatase 2C beta isoform (PP2C-beta)
BC044398.1
360 1140 0.3 Protein phosphatase 2A, regulatory B subunit, B56
AY150214.1
340 ND Dual specificity protein phosphatase
protein phosphatase 2, regulatory subunit B (B56), epsilon BC048034.1
312 373 0.8
isoform, AY150215.1
protein tyrosine phosphatase, non-receptor type 11 (Noonan
308 460 0.7 BC045328.1
syndrome 1)
280 460 0.6 protein phosphatase type 2C alpha 2
279 252 1.1 pp2ca1 protein phosphatase type 2C alpha 1
249 ND
Protein phosphatase 2C alpha isoform (PP2C-alpha) (IA)
249 486 0.5
(Protein phosphatase 1A)
protein phosphatase 3 (formerly 2B), catalytic subunit, beta
244 214 1.1 isoform (calcineurin A beta); Protein phosphatase-3
(formerly 2B), catalytic subunit, beta isoform
Protein-tyrosine phosphatase, non-receptor type 2 (T-cell
223 254 0.9 BC055169
protein-tyrosine phosphatase) (TCPTP)
ND 335 protein phosphatase inhibitor 2 BC065600
ND 373 protein phosphatase 4, regulatory subunit 1 BC048878.1
ND 226 protein phosphatase 1, regulatory (inhibitor) subunit 5
ND ND Tyrosine specific protein phosphatase BC066385
ND ND protein tyrosine phosphatase, receptor type, A (ptpra) NM_131888.1
ND ND
protein phosphatase 1, regulatory (inhibitor) subunit 12A;
ND ND
myosin phosphatase, target subunit 1
ND ND protein phosphatase
ND ND Dual specificity protein phosphatase BC066600
Serine-threonine protein phosphatase 2A, 55 KDA regulatory
ND ND
subunit B, alpha isoform
ND ND protein tyrosine phosphatase, non-receptor type 6 BC044414.1
ND ND Tyrosine specific protein phosphatase BC055139
Data presented as normalized signal; ND denotes signal below 200 and thus not different from
background. Ratio egg/ovary shows the relationship between mature oocytes and immature
oocytes. Accession number indicates gene database identity where known.
The large oocyte and egg samples had similar dot blot profiles with a large signal at 2
MDa (i.e. fraction 18) and a second peak between fractions 26 and 32 (i.e., in range of 66 –
669 KDa).
To determine the molecular weights of PP2A subunit B in zebrafish oocytes, western blot
analysis was conducted on the supernatants of large immature oocytes, mature oocytes (i.e.,
eggs) and ovarian extracts. Primary antibodies against the regulatory subunit of PP2A subunit
B revealed the presence of a 55-60 KDa protein in all three samples (Figure 8 A). Brain
extracts from zebrafish adults were used as positive controls.
Figure 8. Dot and western blots of phosphatase 2a regulatory subunit from Superose 6B column
fractions of homogenates from immature oocytes, mature oocytes, and ovary of zebrafish. (A) Western
blot for phosphatase 2a in the ovary, immature, and mature oocytes. Samples of 30 immature oocytes,
30 mature oocytes, and 95 mg of ovary of zebrafish were homogenized in 60, 60, 190 l of 0.15M
NaCl 50mM Tris buffer respectively. The samples were then centrifuged at 16000xg for 5 minutes.
Samples were mixed with loading buffer and 40 ml of the supernatant from each sample was run on a
1mm thick SDS-PAGE 10% gel. Western blot was performed on the resulting nitrocellulose membrane
as described above for probing dot blots. MW = prestained molecular weight standards (kDa). A
sample of adult zebrafish brain was run as a positive control. (B) Samples of 200 immature oocytes or
200 mature oocytes (eggs) were homogenized in 400 l of 0.15M NaCl 50mM Tris buffer. Pooled
zebrafish ovary weighing 135 mg from gravid females was homogenized in 270 l of 0.15 mM NaCl
50mM Tris buffer. The samples were then centrifuged 5 min at 1000xg to spin down yolk. Samples of
400 l of oocyte and egg and 270 ml of ovary supernatant were run on a Superose 6B column and 1 ml
fractions were collected. MW standards were eluted as follows: 2mDa fraction 18, 669 kDa fraction 25-
26, 443 kDa fraction 28-29 and 68 kDa fraction 31-32. (C) Aliquots (100 l) were spotted using a
Milli-D dot blot system from every other fraction starting from the 16th fraction up to 50th fraction.
The nitrocellulose membrane was blocked, probed with rabbit anti-serine/threonine PP 2A/B (Exalpha
P165P), then reacted with gold-labelled goat anti-rabbit IgG (GAR) and visualized with IntenSE II
(GE/Amersham).
DISCUSSION
The regulation of oocyte meiotic resumption involves multiple phosphorylation and
dephosphorylation events. Although much research has focused on identification of specific
protein kinases involved in oocyte meiosis, their counterparts, PPs, have received
significantly less attention. Here we report that zebrafish oocyte contains both PP1 and PP2A
transcripts. We have demonstrated that OA, a specific inhibitor of PP2A produces many of
the changes accompanying oocyte maturation. These data extend our understanding of the
possible roles of PP2A during the G2/M cell-cycle transition during oocyte meiotic
resumption.
The microarray data indicated the presence of both PP1 and PP2A transcripts in the fully
grown immature oocytes and mature eggs of zebrafish. This is in agreement with the data
from mouse oocytes (Smith et al. 1998).
Fully grown immature oocytes of the zebrafish are opaque and during the process of
maturation they become translucent (Selman et al. 1993). Immature oocytes contain yolk
bodies that have crystalline inclusions, but as the oocytes proceed through maturation, yolk
bodies lose their crystalline inclusions and become homogeneous. It was suggested that this
morphological transformation of the crystalline yolk is responsible for the clearing of the
oocytes during maturation (Selman et al. 1993; Selman, Wallace & Cerda 2001; Carnevali et
al. 2006). Incubation of the fully grown immature oocytes in OA also caused clearing of the
oocytes. However, the time course for the clearing of OA incubated oocytes differed from
that of DHP; OA treated oocytes have a longer lag period before they start clearing compared
to DHP treated oocytes. OA cleared oocytes take a longer time to reach the maximal
translucency state compared to the DHP cleared oocytes. Moreover, the maximal
translucency of OA cleared oocytes is somewhat less than that of the DHP cleared oocytes.
Our data also suggest that OA can act synergistically with subthreshold levels of DHP to
cause clearing of the oocyte. Considerable variation in OA sensitivity was apparent from
ovarian follicles from different females suggesting that gene expression of the PPases varied.
Increased PPase levels would decrease sensitivity to OA in a stoichiometrio fashion.
It is known that during DHP induced oocyte maturation the germinal vesicle migrates to
the periphery and dissolves (Selman et al. 1993; Selman, Petrino & Wallace 1994; Lessman et
al. 2007). OA also caused the dissolution of the GV in zebrafish oocytes. This information is
in good correlation with the GVD by OA in other organisms like catfish (Mishra & Joy
2006), Xenopus (Goris et al. 1989; Rime et al. 1990), starfish (Picard et al. 1989; Picard et al.
1991), mouse (Schwartz & Schultz 1991; Swain et al. 2003), pig (Sun et al. 2002; Kalous et
al. 1993), and Rhesus Macaque (Smith, Sadhu & Wolf 1998).
The blastodisc is a small lens shaped thickening of yolk free ooplasm at the animal pole
containing the maternal pronucleus. Blastodisc formation begins during oocyte maturation.
Activation causes further segregation of ooplasm, reorganization of endoplasmic lacunae, and
blastodisc growth. Ooplasmic streaming which results in blastodisc formation, begins during
oocyte maturation and continues for the first five cell division cycles (Hisaoka & Firlit 1960;
Beams et al. 1985). The formation of blastodisc is under the influence of cytoskeleton (both
microfilaments and microtubules) (Beams et al. 1985; Fernandez et al. 2006). Actin filaments
are involved in blastodisc formation during fertilization as cytochalasin B inhibits its
enlargement. Actin microfilaments have been identified in the subplasmalemmal cortex by
both scanning electron microscopy (Katow 1983) and transmission electron microscopy
(Fernandez et al. 2006). In the ascidian Molgula occidentalis, the microtubule and
microfilament systems appear to operate independent of one another and their combined
actions result in the completion of ooplasmic segregation (Sawada & Schatten 1989). In the
cyprinid Catostomus commersoni, the blastodisc was found to be associated with the
micropyle and the meiotic spindle in the unfertilized egg (Lessman & Huver 1981). In OA
cleared oocytes the blastodisc formation begins at about 360 minutes. However, the final
volume or size of the blastodisc is smaller compared to the DHP induced blastodisc.
Moreover, the ooplasmic streaming which is very much evident in the DHP cleared oocytes is
not prominent in the OA cleared oocytes. PP2A is important for the functional integrity of the
cytoskeleton, which participates in modulation of cell motility, differentiation, and
cytokinesis. Genetic studies in yeast have proven that deregulation of PP2A induces defects in
the actin and microtubule cytoskeleton (Kinoshita et al. 1996; Lin & Arndt 1995; Evans,
Stark 1997). OA and phoslactomycins induce disorganization of actin filaments (Usui et al.
1999; Menzel et al. 1995; Downey et al. 1993; Kreienbuhl, Keller & Niggli 1992; Yano et al.
1995; Shinoki et al. 1995; Maier et al. 1995). OA promotes PP2A-mediated microtubule
destabilization and phosphorylation of PP2A-sensitive microtubule-associated proteins
(Sontag et al. 1996; Sontag et al. 1999; Merrick, Demoise & Lee 1996,; Merrick, Trojanowski
& Lee 1997; Maier et al. 1995). As OA inhibits PP2A, the alterations in the cytoskeleton
might be responsible for the reduced blastodisc formation in OA cleared oocytes.
In zebrafish, oocyte maturation occurs concomitantly with the second yolk proteolytic
process (Selman et al. 1993; Lessman et al. 2007). Electrophoretic analysis (SDS–PAGE) of
DHP matured oocytes after 8 hours of incubation revealed a drastic reduction of the major
component of the yolk protein (110 kDA) stainable with Coomassie blue. While the minor
(90kDa) component was present in a very modest amount in immature oocyte, it became
more prevalent in translucent oocytes. As the oocytes mature, the ratio of the larger molecular
weight band to the smaller molecular weight band decreases. However, in the OA cleared
oocytes, even after 8 hours of incubation the amount of the yolk proteolysis is much less
compared to the yolk proteolysis of the DHP cleared oocytes. The yolk protein ratios of the
OA cleared oocytes are intermediate to those of the steroid vehicle incubated oocytes and the
DHP matured oocytes. Recently, the involvement of the lysosomal cathepsins B and L in the
yolk proteolysis during oocyte maturation has been suggested for zebrafish (Carnevali et al.
2006).
OA produces many of the changes that accompany oocyte maturation. What is the
molecular pathway of oocyte maturation with OA? Where do PP1 or PP2A fit in this
pathway? Oocyte maturation is triggered by the activation in the oocyte cytoplasm of
maturation promoting factor which consists of cdc2 (catalytic subunit) and cyclin B
(regulatory subunit). Immature zebrafish and goldfish oocytes contain inactive monomeric
cdc2 and do not stockpile cyclin B (Kondo et al. 1997; Katsu et al. 1993; Yamashita et al.
1995). Cyclin B mRNA was found to be exclusively localized as an aggregation along the
cytoplasm at the animal pole of fully grown immature oocytes. This aggregation of cyclin B
mRNA was maintained by a meshwork of microfilaments. Disruption of the microfilaments
results in the dispersion and translational activation of the cyclin B mRNA (Kondo, Kotani &
Yamashita 2001). The translated cyclin B binds with cdc2 which enables cdk7 to
phosphorylate cdc2 on T161. The resulting cyclin B bound cdc2 is phosphorylated on T161 is
active and promotes all the changes accompanying oocyte maturation. The three mechanisms
by which OA can cause cyclin B synthesis are: 1) PP1 and PP2A are important for the
functional integrity of cytoskeleton including both actin and tubulin. Okadaic acid by
inhibiting PPases can disrupt microfilaments resulting in the dispersion of aggregated Cyclin
B mRNA and formation of active MPF. 2) After the formation of cyclin B and cdc2 complex,
cdc2 is phosphorylated by cdk7 (Kondo et al. 1997). PP1 and PP2A might be involved in the
dephosphorylation and inactivation of cdk7. OA, by inhibiting PP1 and PP2A, keeps cdk7 in
the active phosphorylated form which would then activate cdc2. 3) PP1 and PP2A, are also
implicated in the exit from mitosis, since cyclin degradation and the subsequent inactivation
of MPF at the metaphase-anaphase transition are affected by an OA-sensitive PPase (Felix,
Cohen & Karsenti 1990; Yamashita et al. 1990). Low OA concentrations result in a
metaphase-like mitotic block of a pig kidney cell line, suggesting the involvement of PP2A in
the transition from metaphase to anaphase (Vandre & Wills 1992). Moreover, maintenance of
cyclin B destruction during G1 requires the activity of a PP2A-like PPase, since OA, but not
I-2, blocked destruction of cyclin B in G1 extracts (Hunter et al. 1999). So PP2A might be
involved in the activation of proteolysis of cyclin B and OA by inhibiting PP2A inhibits
cyclin B proteolysis. The low basal level of translation of cyclin B mRNA results in enough
protein to form an active MPF. The time taken for the build up of cyclin B could explain the
lag period before the oocytes start maturing.
CONCLUSION
This chapter demonstrates the involvement of PP1 and/or PP2A in zebrafish oocyte
maturation, including meiotic events of GVM and GVD, increased translucency (OC),
blastodisc formation (BF) and yolk processing (YP). The higher transcript abundance and
inhibitor ED50s suggest that PP1 plays a more dominant role in oocyte maturation than PP2A.
These results provide a foundation for further work elucidating the complex events
controlling formation of the female gamete.
ACKNOWLEDGMENTS
This research was supported in part by a USDA-SRAC grant. Technical assistance was
provided by Ravikcanth Nathani and Titolola Afolabi. The microarray data were produced
with the assistance of Drs. Thomas Sutter and Shirlean Goodwin of the Feinstone Center for
Functional Genomics at the University of Memphis, Memphis, TN.
REFERENCES
Abrieu, A., Doree, M. & Fisher, D., 2001, "The interplay between cyclin-B-Cdc2 kinase
(MPF) and MAP kinase during maturation of oocytes", Journal of cell science, 114(Pt 2),
257-267.
Beams, H.W., Kessel, R.G., Shih, C.Y. & Tung, H.N., 1985, "Scanning electron microscope
studies on blastodisc formation in the zebrafish, Brachydanio rerio", Journal of
Morphology, 184(1), 41-49.
Bialojan, C. & Takai, A., 1988, "Inhibitory effect of a marine-sponge toxin, okadaic acid, on
protein phosphatases. Specificity and kinetics", The Biochemical journal, 256(1), 283-
290.
Carnevali, O., Cionna, C., Tosti, L., Lubzens, E. & Maradonna, F., 2006, "Role of cathepsins
in ovarian follicle growth and maturation", General and comparative endocrinology,
146(3), 195-203.
Cicirelli, M.F., Pelech, S.L. & Krebs, E.G., 1988, "Activation of multiple protein kinases
during the burst in protein phosphorylation that precedes the first meiotic cell division in
Xenopus oocytes", The Journal of biological chemistry, 263(4), 2009-2019.
Cohen, P., 1989, "The structure and regulation of protein phosphatases", Annual Review of
Biochemistry, 58, 453-508.
Cohen, P., Klumpp, S. & Schelling, D.L., 1989, "An improved procedure for identifying and
quantitating protein phosphatases in mammalian tissues", FEBS letters, 250(2), 596-600.
Downey, G.P., Takai, A., Zamel, R., Grinstein, S. & Chan, C.K., 1993, "Okadaic acid-
induced actin assembly in neutrophils: role of protein phosphatases", Journal of cellular
physiology, 155(3), 505-519.
Evans, D.R. & Stark, M.J., 1997, "Mutations in the Saccharomyces cerevisiae type 2A protein
phosphatase catalytic subunit reveal roles in cell wall integrity, actin cytoskeleton
organization and mitosis", Genetics, 145(2), 227-241.
Felix, M.A., Cohen, P. & Karsenti, E., 1990, "Cdc2 H1 kinase is negatively regulated by a
type 2A phosphatase in the Xenopus early embryonic cell cycle: evidence from the
effects of okadaic acid", The EMBO journal, 9(3), 675-683.
Fernandez, J., Valladares, M., Fuentes, R. & Ubilla, A., 2006, "Reorganization of cytoplasm
in the zebrafish oocyte and egg during early steps of ooplasmic segregation",
Developmental dynamics : an official publication of the American Association of
Anatomists, 235(3), 656-671.
Gavin, A.C., Tsukitani, Y. & Schorderet-Slatkine, S., 1991, "Induction of M-phase entry of
prophase-blocked mouse oocytes through microinjection of okadaic acid, a specific
phosphatase inhibitor", Experimental cell research, 192(1), 75-81.
Goris, J., Hermann, J., Hendrix, P., Ozon, R. & Merlevede, W., 1989, "Okadaic acid, a
specific protein phosphatase inhibitor, induces maturation and MPF formation in
Xenopus laevis oocytes", FEBS letters, 245(1-2), 91-94.
Harlow, E. & Lane, D., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratory Press Cold Spring Harbor, NY.
Haystead, T.A., Sim, A.T., Carling, D., Honnor, R.C., Tsukitani, Y., Cohen, P. & Hardie,
D.G., 1989, "Effects of the tumour promoter okadaic acid on intracellular protein
phosphorylation and metabolism", Nature, 337(6202), 78-81.
Hescheler, J., Mieskes, G., Ruegg, J.C., Takai, A. & Trautwein, W., 1988, "Effects of a
protein phosphatase inhibitor, okadaic acid, on membrane currents of isolated guinea-pig
cardiac myocytes", Pflugers Archiv : European journal of physiology, 412(3), 248-252.
Hisaoka, K.K. & Firlit, C.F., 1960, "Further studies on the embryonic development of the
zebrafish, Brachydanio rerio (Hamilton-Buchanan)", Journal of Morphology, 107(2),
205-225.
Hunter, T., Bastians, H., Topper, L.M., Gorbsky, G.L. & Ruderman, J.V., 1999, "Cell Cycle-
regulated Proteolysis of Mitotic Target Proteins", Molecular biology of the cell, 10(11),
3927-3941.
Janssens, V. & Goris, J., 2001, "Protein phosphatase 2A: a highly regulated family of
serine/threonine phosphatases implicated in cell growth and signalling", Biochem. J., 353,
417-439.
Kalous, J., Kubelka, M., Rimkevicova, Z., Guerrier, P. & Motlik, J., 1993, "Okadaic acid
accelerates germinal vesicle breakdown and overcomes cycloheximide- and 6-
dimethylaminopurine block in cattle and pig oocytes", Developmental biology, 157(2),
448-454.
Katow, H., 1983, "Obstruction of blastodisc formation by cytochalasin B in the zebrafish,
Brachydanio rerio", Develop. Growth Differ., 25, 477-484.
Katsu, Y., Yamashita, M., Kajiura, H. & Nagahama, Y., 1993, "Behavior of the components
of maturation-promoting factor, cdc2 kinase and cyclin B, during oocyte maturation of
goldfish", Developmental biology, 160(1), 99-107.
Kinoshita, K., Nemoto, T., Nabeshima, K., Kondoh, H., Niwa, H. & Yanagida, M., 1996,
"The regulatory subunits of fission yeast protein phosphatase 2A (PP2A) affect cell
morphogenesis, cell wall synthesis and cytokinesis", Genes to cells : devoted to
molecular & cellular mechanisms, 1(1), 29-45.
Klumpp, S., Cohen, P. & Schultz, J.E., 1990, "Okadaic acid, an inhibitor of protein
phosphatase 1 in Paramecium, causes sustained Ca2(+)-dependent backward swimming
in response to depolarizing stimuli", The EMBO journal, 9(3), 685-689.
Kondo, T., Kotani, T. & Yamashita, M., 2001, "Dispersion of cyclin B mRNA aggregation is
coupled with translational activation of the mRNA during zebrafish oocyte maturation",
Developmental biology, 229(2), 421-431.
Kondo, T., Yanagawa, T., Yoshida, N. & Yamashita, M., 1997, "Introduction of cyclin B
induces activation of the maturation-promoting factor and breakdown of germinal vesicle
in growing zebrafish oocytes unresponsive to the maturation-inducing hormone",
Kreienbuhl, P., Keller, H. & Niggli, V., 1992, "Protein phosphatase inhibitors okadaic acid
and calyculin A alter cell shape and F-actin distribution and inhibit stimulus-dependent
increases in cytoskeletal actin of human neutrophils", Blood, 80(11), 2911-2919.
Laemmli, U.K., 1970, "Cleavage of structural proteins during the assembly of the head of
bacteriophage T4", Nature, 227(5259), 680-685.
Lessman, C.A., 2002, "Use of Computer-Aided Screening for Detection of Motility Mutants
in Zebrafish Embryos", Real-Time Imaging, 8(3), 189-201.
Lessman, C.A., Taylor, M.R., Orisme, W. & Carver, E.A., 2010, "Use of Flatbed
Transparency Scanners in Zebrafish Research: Versatile and Economical Adjuncts to
Traditional Imaging Tools for the Danio rerio Laboratory", Methods in cell biology, 100,
295-322.
Lessman, C.A., 1999, "Oogenesis, in nonmammalian vertebrates" in Encyclopedia of
Reproduction, eds. E. Knobil & J.D. Neill, Academic Press, NY, pp. 498-508.
Lessman, C.A. & Huver, C.W., 1981, "Quantification of fertilization-induced gamete changes
and sperm entry without egg activation in a teleost egg", Developmental biology;
Lessman, C.A., Nathani, R., Uddin, R., Walker, J. & Liu, J., 2007, "Computer-aided meiotic
maturation assay (CAMMA) of zebrafish (Danio rerio) oocytes in vitro", Molecular
reproduction and development, 74, 99-109.
Lin, F. & Arndt, K., 1995, "The role of Saccharomyces cerevisiae type 2A phosphatase in the
actin cytoskeleton and in entry into mitosis.", EMBO J, 14(12), 2745-2759.
Lu, Q., Smith, G.D., Chen, D.Y., Yang, Z., Han, Z.M., Schatten, H. & Sun, Q.Y., 2001,
"Phosphorylation of mitogen-activated protein kinase is regulated by protein kinase C,
cyclic 3',5'-adenosine monophosphate, and protein phosphatase modulators during
meiosis resumption in rat oocytes", Biology of reproduction, 64(5), 1444-1450.
Maier, G.D., Wright, M.A., Lozano, Y., Djordjevic, A., Matthews, J.P. & Young, M.R., 1995,
"Regulation of cytoskeletal organization in tumor cells by protein phosphatases-1 and -
2A", International journal of cancer. Journal international du cancer, 61(1), 54-61.
Menzel, D., Vugrek, O., Frank, S. & Elsner-Menzel, C., 1995, "Protein phosphatase 2A, a
potential regulator of actin dynamics and actin-based organelle motility in the green alga
Acetabularia", European journal of cell biology, 67(2), 179-187.
Merrick, S.E., Demoise, D.C. & Lee, V.M., 1996, "Site-specific dephosphorylation of tau
protein at Ser202/Thr205 in response to microtubule depolymerization in cultured human
neurons involves protein phosphatase 2A", The Journal of biological chemistry, 271(10),
5589-5594.
Merrick, S.E., Trojanowski, J.Q. & Lee, V.M., 1997, "Selective destruction of stable
microtubules and axons by inhibitors of protein serine/threonine phosphatases in cultured
human neurons", The Journal of neuroscience : the official journal of the Society for
Neuroscience, 17(15), 5726-5737.
Mishra, A. & Joy, K.P., 2006, "2-Hydroxyestradiol-17beta-induced oocyte maturation:
involvement of cAMP-protein kinase A and okadaic acid-sensitive protein phosphatases,
and their interplay in oocyte maturation in the catfish Heteropneustes fossilis", The
Journal of experimental biology, 209(Pt 13), 2567-2575.
Ozon, R., Mulner, O., Boyer, J. & Belle, R., (eds) 1987, Molecular regulation of nuclear
events in mitosis and meiosis, Academic Press, New York.
Picard, A., Capony, J.P., Brautigan, D.L. & Doree, M., 1989, "Involvement of protein
phosphatases 1 and 2A in the control of M phase-promoting factor activity in starfish",
The Journal of cell biology, 109(6 Pt 2), 3347-3354.
Picard, A., Labbe, J.C., Barakat, H., Cavadore, J.C. & Doree, M., 1991, "Okadaic acid
mimics a nuclear component required for cyclin B-cdc2 kinase microinjection to drive
starfish oocytes into M phase", The Journal of cell biology, 115(2), 337-344.
Rime, H., Huchon, D., Jessus, C., Goris, J., Merlevede, W. & Ozon, R., 1990,
"Characterization of MPF activation by okadaic acid in Xenopus oocyte", Cell
differentiation and development : the official journal of the International Society of
Developmental Biologists, 29(1), 47-58.
Sawada, T. & Schatten, G., 1989, "Effects of cytoskeletal inhibitors on ooplasmic segregation
and microtubule organization during fertilization and early development in the ascidian
Molgula occidentalis", Developmental biology, 132(2), 331-342.
Schwartz, D.A. & Schultz, R.M., 1991, "Stimulatory effect of okadaic acid, an inhibitor of
protein phosphatases, on nuclear envelope breakdown and protein phosphorylation in
mouse oocytes and one-cell embryos", Developmental biology, 145(1), 119-127.
Selman, K., Petrino, T.R. & Wallace, R.A., 1994, "Experimental conditions for oocyte
maturation in the zebrafish, Brachydanio rerio", J Exp Zool, 269, 538-550.
Selman, K. & Wallace, R.A., 1989, "Cellular Aspects of Oocyte Growth in Teleosts",
Zoological Science, 6(2), 211-231.
Selman, K., Wallace, R.A., Sarka, A. & Qi, X., 1993, "Stages of oocyte development in the
zebrafish Brachydanio rerio.", Journal of Morphology, 218, 203–224.
Selman, K., Wallace, R.A. & Cerda, J., 2001, "Bafilomycin A1 inhibits proteolytic cleavage
and hydration but not yolk crystal disassembly or meiosis during maturation of sea bass
oocytes", The Journal of experimental zoology, 290(3), 265-278.
Shenolikar, S. & Nairn, A.C., 1991, "Protein phosphatases: recent progress", Advances in
Second Messenger and Phosphoprotein Research, 23, 1-121.
Shi, Y., 2009, "Serine/threonine phosphatases: mechanism through structure", Cell, 139(3),
468.
Shinoki, N., Sakon, M., Kambayashi, J., Ikeda, M., Oiki, E., Okuyama, M., Fujitani, K.,
Yano, Y., Kawasaki, T. & Monden, M., 1995, "Involvement of protein phosphatase-1 in
cytoskeletal organization of cultured endothelial cells", Journal of cellular biochemistry,
59(3), 368-375.
Smith, G.D., Sadhu, A., Mathies, S. & Wolf, D.P., 1998, "Characterization of protein
phosphatases in mouse oocytes", Developmental biology, 204(2), 537-549.
Smith, G.D., Sadhu, A. & Wolf, D.P., 1998, "Transient exposure of rhesus macaque oocytes
to calyculin-A and okadaic acid stimulates germinal vesicle breakdown permitting
subsequent development and fertilization", Biology of reproduction, 58(4), 880-886.
Sontag, E., 2001, "Protein phosphatase 2A: the Trojan Horse of cellular signaling", Cellular
signalling, 13(1), 7-16.
Sontag, E., Nunbhakdi-Craig, V., Lee, G., Bloom, G.S. & Mumby, M.C., 1996, "Regulation
of the phosphorylation state and microtubule-binding activity of Tau by protein
phosphatase 2A", Neuron, 17(6), 1201-1207.
Sontag, E., Nunbhakdi-Craig, V., Lee, G., Brandt, R., Kamibayashi, C., Kuret, J., White,
C.L.,3rd, Mumby, M.C. & Bloom, G.S., 1999, "Molecular interactions among protein
phosphatase 2A, tau, and microtubules. Implications for the regulation of tau
phosphorylation and the development of tauopathies", The Journal of biological
chemistry, 274(36), 25490-25498.
Sun, Q.Y., Wu, G.M., Lai, L., Bonk, A., Cabot, R., Park, K.W., Day, B.N., Prather, R.S. &
Schatten, H., 2002, "Regulation of mitogen-activated protein kinase phosphorylation,
microtubule organization, chromatin behavior, and cell cycle progression by protein
phosphatases during pig oocyte maturation and fertilization in vitro", Biology of
reproduction, 66(3), 580-588.
Swain, J.E., Wang, X., Saunders, T.L., Dunn, R. & Smith, G.D., 2003, "Specific inhibition of
mouse oocyte nuclear protein phosphatase-1 stimulates germinal vesicle breakdown",
Molecular reproduction and development, 65(1), 96-103.
Tachibana, K., Scheuer, P.J., Tsukitani, Y., Kikuchi, H., Van Engen, D., Clardy, J.,
Gopichand, Y. & Schmitz, F.J., 1981, "Okadaic acid, a cytotoxic polyether from two
marine sponges of the genus Halichondria", Journal of the American Chemical Society,
103(9), 2469-2471.
Thomas, P., Pang, Y., Zhu, Y., Detweiler, C. & Doughty, K., 2004, "Multiple rapid progestin
actions and progestin membrane receptor subtypes in fish", Steroids, 69(8-9), 567-573.
Usui, T., Marriott, G., Inagaki, M., Swarup, G. & Osada, H., 1999, "Protein phosphatase 2A
inhibitors, phoslactomycins. Effects on the cytoskeleton in NIH/3T3 cells", Journal of
Biochemistry, 125(5), 960-965.
Vandre, D.D. & Wills, V.L., 1992, "Inhibition of mitosis by okadaic acid: possible
involvement of a protein phosphatase 2A in the transition from metaphase to anaphase",
Journal of cell science, 101 ( Pt 1)(Pt 1), 79-91.
Virshup, D.M. & Shenolikar, S., 2009, "From promiscuity to precision: protein phosphatases
get a makeover", Molecular cell, 33(5), 537-545.
Wallace, R.A. & Selman, K., 2002, "Cellular and Dynamic Aspects of Oocyte Growth in
Teleosts 1", Integrative and Comparative Biology, 21(2), 325-343.
Walter, G. & Mumby, M., 1993, "Protein serine/threonine phosphatases and cell
transformation", Biochimica et biophysica acta, 1155(2), 207-226.
Wera, S. & Hemmings, B.A., 1995, "Serine/threonine protein phosphatases", The
Biochemical journal, 311 ( Pt 1)(Pt 1), 17-29.
Winston, N.J. & Maro, B., 1999, "Changes in the activity of type 2A protein phosphatases
during meiotic maturation and the first mitotic cell cycle in mouse oocytes", Biology of
the cell / under the auspices of the European Cell Biology Organization, 91(3), 175-183.
Wolf, K. & Quimby, M.C., (eds) 1969, Fish cell and tissue culture. In: Fish Physiology,
Academic Press, New York.
Yamashita, K., Yasuda, H., Pines, J., Yasumoto, K., Nishitani, H., Ohtsubo, M., Hunter, T.,
Sugimura, T. & Nishimoto, T., 1990, "Okadaic acid, a potent inhibitor of type 1 and type
2A protein phosphatases, activates cdc2/H1 kinase and transiently induces a premature
mitosis-like state in BHK21 cells", The EMBO journal, 9(13), 4331-4338.
Yamashita, M., Kajiura, H., Tanaka, T., Onoe, S. & Nagahama, Y., 1995, "Molecular
mechanisms of the activation of maturation-promoting factor during goldfish oocyte
maturation", Developmental biology, 168(1), 62-75.
Yano, Y., Sakon, M., Kambayashi, J., Kawasaki, T., Senda, T., Tanaka, K., Yamada, F. &
Shibata, N., 1995, "Cytoskeletal reorganization of human platelets induced by the protein
phosphatase 1/2 A inhibitors okadaic acid and calyculin A", The Biochemical journal,
307 ( Pt 2)(Pt 2), 439-449.
Zhu, Y., Rice, C.D., Pang, Y., Pace, M. & Thomas, P., 2003, "Cloning, expression, and
characterization of a membrane progestin receptor and evidence it is an intermediary in
meiotic maturation of fish oocytes", Proceedings of the National Academy of Sciences of
the United States of America, 100(5), 2231-2236.
Chapter 4
GET IT TOGETHER: HOW RNA-BINDING PROTEINS

ASSEMBLE AND REGULATE GERM PLASM
IN THE OOCYTE AND EMBRYO
Odelya Hartung1 and Florence L. Marlow1,2

1
Department of Developmental and Molecular Biology,
Albert Einstein College of Medicine, Yeshiva University. Bronx, New York, US
2
Department of Neuroscience; Albert Einstein College of Medicine Yeshiva University.
Bronx, New York, US
ABSTRACT
In zebrafish, the sequential processes of oocyte maturation, egg fertilization, and
early embryonic development take place while the genome is transcriptionally silent.
Proper development and patterning of the oocyte and embryo requires that the numerous
gene products (RNAs and proteins) that regulate oocyte and early embryonic
development are produced prior to genome inactivation and are preserved and utilized in
the time and place where they are needed. During this period the oocyte and eventual
embryo relies on posttranscriptional and posttranslational mechanisms. Prominent
regulators are the various RNA-binding proteins (RNAbps) that assemble their RNA
targets into ribonucleoprotein (RNP) granules where they are localized, protected,
translated or degraded. In oocytes and embryos, these RNP granules are enriched in an
electron-dense portion of cytoplasm termed germ plasm, so-called because its contents
include the molecules that induce formation of future germ cells. In this chapter, we will
review the roles of RNAbps and posttranscriptional regulation in the germ plasm of
developing zebrafish oocytes and embryonic primordial germ cells.
Keywords: Germ plasm, Balbiani body, Germ granule, Oocyte, Primordial Germ Cell, RNA
binding protein, Vasa, Nanos3, Dead End, Bucky ball, Dazl

Corresponding author: Florence L. Marlow Ph.D. Associate Professor of Developmental and Molecular Biology,
Associate Professor of Neuroscience, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx,
NY 10461, office phone: (718) 430-4208 lab phone: (718) 430-4209, fax: (718) 430-8567.
66 Odelya Hartung and Florence L. Marlow
INTRODUCTION
Germ cells are specialized stem cells that must simultaneously propagate and protect the
genetic material of the organism. In order to accomplish this through successive generations,
germ cells have acquired several specialized properties to insulate their nuclear contents.
These properties include protection from transposable elements, silencing of gene
transcription (during maturation), and post-transcriptional gene regulation by cytosolic RNA-
binding proteins (RNAbps). Intrinsic to these specialized germ cell features is a unique
substance first described more than 150 years ago: electron-dense granular cytoplasm that is
passed from egg to embryo in a cyclical and immortal fashion (reviewed in (Eddy, 1975)).
This specialized cytoplasm, later identified as germ plasm or nuage, contains the molecules
that function in the above-mentioned protective capacities, and guide germ cell development.
The presence of germ plasm has been observed in dozens of organisms ranging from rotifers
and insects to fish and amphibians (reviewed in (Eddy, 1975)). In these animals, germ plasm
is necessary for formation of the germ line, as seen in the subfertile and sterile phenotypes of
animals in which germ plasm has been ablated or disturbed (reviewed in (Eddy, 1975)).
Conversely, transplantation of germ plasm from one embryo to another, or to ectopic
embryonic sites, is sufficient to induce chimeric and ectopic germ cells, respectively
(Ikenishi, 1987; Illmensee and Mahowald, 1974; Illmensee and Mahowald, 1976) and
reviewed in (Eddy, 1975; Saffman and Lasko, 1999). Thus, the contents of the germ plasm
include the determinants of future germ cells.
Some of the first hints toward understanding the contents of germ plasm resulted from
ultrastructural examinations of Drosophila oocytes and embryos more than fifty years ago.
These studies determined that the electron-dense quality of germ plasm could be attributed to
small spherical organelles called ―germ granules‖ within it (Eddy, 1975; Mahowald, 1962).
More recent ultrastructural studies have demonstrated that inside and surrounding the germ
granules (also called P granules in C. elegans and polar granules in Drosophila) are
distinctive proteins and RNAs, many of which encode for RNA-binding proteins that are
necessary for embryonic patterning and germ cell development (Schisa et al., 2001;
Kobayashi and Okada, 1989; Kloc et al., 2002; Jongens et al., 1992). This chapter will focus
on the recent advances in the identification of specific RNAs and RNAbps present in the
germ plasm of zebrafish (and other animals where noted) and their roles in maintaining and
propagating germ cell identity.
Lifecycle of the Zebrafish Germ Plasm
Zebrafish germ plasm exists continuously throughout embryogenesis and oogenesis.

Nonetheless, fertilization seems an appropriate starting point to begin a description of its
lifecycle, since it is commonly perceived as the beginning of the life of the organism. When
the egg is fertilized (or activated), the germ plasm RNAs and proteins that have been stored in
the egg are brought to the animal pole of the embryo by mechanisms that involve nonspecific
movement of cytoplasm and microtubule-dependent translocation (Figure 1; (Fuentes and
Fernandez, 2010; Leung et al., 2000; Solnica-Krezel and Driever, 1994) and reviewed in
(Abrams and Mullins, 2009; Marlow, 2010)). Once at the animal pole, the germ plasm
becomes further restricted by tightly associating with the cleavage furrows of the dividing
blastomeres (Theusch et al., 2006; Yoon et al., 1997; Knaut et al., 2000). Association with the
RNAbps and Germ Plasm 67
furrows is maintained for the first two cell divisions, however at the eight-cell stage, only four
cleavage furrows maintain germ plasm (Yoon et al., 1997). As in other animals, removal of
the cytoplasm from the cleavage furrows results in severely reduced primordial germ cell
numbers in zebrafish embryos (Hashimoto et al., 2004; Eddy, 1975). In addition to
transporting cargo to the animal pole during egg activation, microtubules are also important in
germ plasm recruitment to the furrow. This has been demonstrated by studies of a maternal
effect mutant in the zebrafish gene nebel. Embryos of nebel mutant mothers have a reduced
furrow microtubule array (FMA), and therefore cannot maintain the germ plasm RNA vasa
within their cleavage furrow (Theusch et al., 2006; Pelegri et al., 1999).
The mechanism by which microtubules regulate germ plasm RNP recruitment to the
furrow has been further elucidated by investigation of the maternal-effect mutant, motley, in
the birc5b gene, previously called survivin (Nair et al., 2013). In all dividing cells, centrioles
are surrounded by a star-like arrangement of microtubules (called aster microtubules) that
function to segregate the duplicated chromosomes to opposite sides. As the aster microtubules
grow radially from the centrosome to the cortex of cleaving blastomeres of 2-8 cell zebrafish
embryos, they seem to physically push the germ plasm RNPs toward the cleavage furrow
(Nair et al., 2013; Eno and Pelegri, 2013). The Birc5b protein is associated with microtubule
plus ends, where it may link with RNPs and aid in directing them towards the cleavage
furrows (Nair et al., 2013). Quantitative analysis of germ plasm RNPs indicates that their
overall numbers remain constant from the 2-cell stage to the 8-cell stage, but the number of
RNPs associated with each furrow is halved during every cell division (Eno and Pelegri,
2013). Contrary to previous reports, the 8-cell embryo appears to initially have RNP
enrichment at all cleavage furrows, but stabilizes them in a size-dependent manner at only 4
furrow planes (Eno and Pelegri, 2013). These studies suggest that microtubule asters promote
aggregation of RNPs in the cleavage furrows, where they multimerize and are stabilized.
During embryonic cleavage stages, likely sometime between the 16-cell and 32-cell
stage, the furrow-associated germ plasm is stabilized and sequestered into four primordial
germ cells (PGCs) ((Lin et al., 1992; Walker and Streisinger, 1983) and reviewed in (Raz,
2003)). Following the specification of these four cells, the germ plasm is asymmetrically
inherited into only one daughter cell of the dividing PGCs, so that PGC number does not
increase between the 16-cell and 1,000-cell stage of embryogenesis (Walker and Streisinger,
1983). The constancy of PGC number was demonstrated by irradiating wild-type embryos at
various stages prior to gastrulation, and then assaying the proportion of germline mutations
induced at a specific locus. The authors found that when embryos were irradiated at stages
prior to activation of the zygotic genome (e.g. before the 1000-cell stage, about (3hrs), they
had similar proportions of germline mutations. If germ cells had been amplifying between 8
and 1000-cell stages, then embryos mutated at later stages would be expected to show fewer
mutations (Walker and Streisinger, 1983). These findings were later confirmed by examining
the expression of the conserved germline specific marker vasa, which encodes an RNAbp and
RNA helicase, in 1000-cell stage embryos (Yoon et al., 1997; Knaut et al., 2000). It is worth
noting that while a low level of germ plasm RNAs like vasa and nanos3 (previously called
nanos1) can be detected outside of the four established PGCs, these RNAs are gradually
cleared from the somatic cells (Yoon et al., 1997; Mishima et al., 2006). The clearance of
germ plasm in the soma comes at a critical time-point, the maternal-zygotic transition (MZT),
during which the embryo activates transcription from its formerly silent genome. Zygotic
transcription of miRNA effectors permits clearance of maternal germ plasm from somatic
cells through RNA-induced silencing, while zygotic transcription of germline determinants in
the PGCs ensures they persist where necessary. Thus, while the initial specification of the
germ line relies on maternal transcripts, maintenance of the germ line after MZT relies on
both protection of maternal germ plasm, and zygotic transcription.
Germ cell specification occurs prior to and outside of the site of the future gonad. Thus,
PGCs must migrate towards the gonad anlage to establish interactions with somatic support
cells that regulate their maintenance and differentiation into gametes. Throughout gastrulation
and somiatogenesis the PGCs migrate toward their destination at the prospective gonad. The
process of migration to the gonadal region requires dead end (dnd)at least one, an RNAbp of
the germ plasm component, the RNAbp dead end (dnd). Embryos depleted of dnd by
injection of modified antisense oligonucleotide (morpholino) have PGCs that are unable to
migrate, and eventually are not maintained (Weidinger et al., 2003). Similarly, PGCs in
nanos3 morphants (embryos injected with a blocking morpholino) and maternal zygotic
mutants also fail to migrate and are not maintained (Draper et al., 2007; Koprunner et al.,
2001). Like other migrating cells such as neurons, PGCs require chemotactic signaling
molecules for their migration, for example the chemokine stromal cell-derived factor 1 (sdf1)
and its receptor cxcr4 (Raz, 2003; Doitsidou et al., 2002; Knaut et al., 2003). Knockdown of
these two factors by morpholino injection causes various germ cell migration defects
including migration of PGCs to the embryonic head. The requirement of a signaling gradient
of sdf1 also demonstrates that guiding migration relies on the function of the surrounding
somatic tissues (Reichman-Fried et al., 2004).
The Balbiani Body
Throughout primordial germ cell development and during the proliferative (mitotic)
stages of oogenesis, zebrafish germ plasm can be observed (by electron microscopy, (EM)) as
a hazy ring surrounding the nuclear membrane (Braat et al., 1999; Selman et al., 1993). This
symmetrical arrangement of germ plasm is disrupted by the formation of the Balbiani body
(also referred to as the mitochondrial cloud) adjacent to the nucleus of stage I oocytes. The
Balbiani body (Bb) is a unified subcellular structure that aggregates germ granules, germ
plasm, other patterning molecules, and organelles such as endoplasmic reticulum and
mitochondria ((Kloc et al., 2004; Kloc et al., 2002; Kloc and Etkin, 1995;) and reviewed in
(Marlow, 2010)). The Bb is the first morphological marker of the vegetal pole of the animal-
vegetal axis of the oocyte in frogs and fish (Kloc et al., 2004; Kloc et al., 2002; Kloc and
Etkin, 1995; Marlow and Mullins, 2008). A well-conserved structure, the Bb is present
throughout the animal kingdom in species as diverse as spiders (in which the structure was
first identified), fish, and even humans (von Wittich, 1845; Marlow and Mullins, 2008;
Bontems et al., 2009; Kosaka et al., 2007; Marinos, 1981; Hertig and Adams, 1967). The Bb
exists only transiently in stage I oocytes, and is promptly remodeled and disassembled in
subsequent stages (Figure 2) (Kloc et al., 2004). Although many RNAs and a few proteins
have been identified within the Balbiani body, the mechanisms that govern its assembly and
disassembly remain elusive. Only one gene in vertebrates has been shown to play a role in
Balbiani body assembly- the zebrafish bucky ball gene. Oocytes deficient in bucky ball lack a
Balbiani body and do not specify the animal-vegetal axis (Bontems et al., 2009; Dosch et al.,
2004; Marlow and Mullins, 2008). Unlike wild-type eggs that have asymmetric accumulation
of cytoplasm at only one side, the animal pole, Subsequently, their activatedbuc eggs have
ectopic animal poles and unlike wild-type eggs that have asymmetric accumulation of
cytoplasm at only one side, the animal pole, the egg cytoplasm of buc zygotes is distributed
radially around the yolk (Dosch et al., 2004; Marlow and Mullins, 2008). Buc protein is
vertebrate specific and highly conserved, yet the mechanism by which Buc mediates its
function is not known due to the lack of identifiable protein domains that might elucidate its
role (Bontems et al., 2009). However, recent reports indicate that Bucky ball proteins of
zebrafish and Xenopus (known as Velo) interact with a conserved RNA binding protein, thus
permitting Buc to coordinate germ plasm RNA recruitment to the Balbiani body (Heim et al.,
in press2014; Nijjar and Woodland, 2013).
Figure 1. Lifecycle of the germ plasm. The localization pattern of germ plasm is represented throughout
embryogenesis and early oogenesis by green-colored portions of cytoplasm or cells. The grey ring
contains the phase of the germ cell lifecycle (e.g. Recruitment), and the wedged portion of the circle
just medial to this indicates which genes are essential for that phase of germ line development, as
shown by loss-of-function studies (mutants or morphants). The schematic drawings represent the
following developmental stages: A) fertilized/activated egg, B) 2-cell stage embryo, C, C‘) 4-cell stage
embryo, D, D‘) 8-cell stage embryo, E, E‘) 1000-cell stage embryo, F, F‘) shield stage embryo, G) 24
hour post fertilization embryo, H) juvenile fish, I) male adult fish, J) female adult fish, K) stage I
oocyte, L) stage II oocyte, and M) stage III oocyte. A-F) The schematic drawings of embryonic stages
are drawn with the animal pole oriented up with the exception of C‘, D‘, E‘ and F‘, that are drawn with
the animal pole viewed from above. G-J) Schematics are lateral views drawn with the anterior portion
of the embryo or fish (head) to the left, and posterior to the right. K-M) The oocytes represent stages of
oogenesis present in the adult female, all drawn with the animal pole oriented up. L) Stage II and (M)
stage III oocytes have their cytoplasm colored with yellow, purple, or blue for different domains of
RNA expression of the corresponding germ plasm RNA (see key). Abbreviations: Sex. Diff.= sexual
differentiation, Bb= Balbiani body, FCs= Follicle cells, n=nucleus, CGs= cortical granules.
Figure 2. Balbiani body assembly and translocation. A-F) Early oocytes stained with the fluorescent
dye DiOC6, which labels endoplasmic reticulum, vesicles, and mitochondria, and is therefore enriched
in the Balbiani body. A-D) successive stages of Balbiani body growth in maturing stage I oocytes.
Balbiani body assembly is a Bucky ball dependent process. E and F) show the translocation of the
Balbiani body from its perinuclear location to the vegetal cortex in stage II oocytes. The process of
Balbiani body translocation is dependent on Microtubule-Actin Crosslinking Factor 1 (MACF1), also
known as Magellan in zebrafish. n= nucleus. Scale bar represents 20 μm.
In Xenopus, the Balbiani body and its germ plasm components are disassembled and
translocated in stage II oocytes to the vegetal cortex. This translocation relies on microtubules
for movement of Bb components, and actin microfilaments for tethering to the cortex (Kloc
and Etkin, 1995; Yisraeli et al., 1990; Kosaka et al., 2007). The translocation pathway, called
METRO for messenger transport organizer, appears to function similarly in zebrafish (Kosaka
et al., 2007). For example, a zebrafish mutant in microtubule actin crosslinking factor 1
(macf1), also called magellan, is able to assemble the Balbiani body and recruit germ plasm
components, but the Balbiani body does not translocate to the cortex and consequently is not
disassembled (Gupta et al., 2010). Because the Balbiani body components do not reach the
vegetal cortex in magellan oocytes, embryos of magellan mutant mothers lack an animal-
vegetal axis and their eggs show cytoplasmic segregation defects reminiscent of buc mutant
eggs (Figure 2; ) (Gupta et al., 2010). Therefore, failure to disassemble the Balbaini body
after stage II indicates that the translocation and delivery of Bb-components is an essential
aspect of the vegetal localization pathway.
After translocation to the vegetal cortex, the germ plasm RNAs are temporarily separated
into different expression domains in stage III oocytes. Specifically, whereas the germ plasm
RNA dazl is vegetally localized in stage II oocytes, the germ plasm RNA nanos3 becomes
diffusely distributed throughout the cytoplasm (Kosaka et al., 2007). The germ plasm RNA
vasa is vegetally localized; however, it is associated with a much broader portion of the
vegetal cortex than dazl (Braat et al., 1999; Kosaka et al., 2007). Later, in stage III oocytes,
vasa RNA spreads around the cortex, and dazl remains at the vegetal pole (Figure 1; (Braat et
al., 1999; Kosaka et al., 2007;) and reviewed in (Abrams and Mullins, 2009)). The reasons for
these differential distribution patterns are not known, but are particularly intriguing given that
upon egg activation, all of these germ plasm RNAs rejoin at the animal pole where they
coalesce in the cell cleavage furrows discussed above (Figure 1).
Adding another layer of complexity, the process of rejoining germ plasm at the animal
pole upon egg activation appears to require more than one mechanistic pathway. For example,
Theusch et al. has shown by careful tracking of RNA distribution patterns in the freshly laid
egg that two distinct patterns exist in the recruitment of germ plasm RNAs to the animal pole
(Theusch et al., 2006). Whereas vasa, nanos3 and dead end RNAs already exist at the base of
the animal-pole positioned blastodisc in the freshly laid egg, dazl RNA translocates along the
egg cortex throughout the first 45 minutes after egg activation (Theusch et al., 2006).
One possibility for the varied localizations of germ plasm in maturing oocytes and freshly
laid eggs is that their dispersal from the Balbiani body facilitates sorting of germ plasm RNAs
from other patterning molecules that are also stored in the Balbiani bodythere. Thus, the
animal-vegetal distribution of the germ plasm components in the later oocyte may facilitate
their recruitment and assembly in the proper order in the zygote. However, this hypothesis
remains to be experimentally determined.
Although many RNAs in the zebrafish Balbiani body are germ plasm RNAs, mRNAs
encoding dorsal patterning molecules are also a major component of the Bb. In the Xenopus
Balbiani body, components of the Wnt signaling pathway specify the dorsal-ventral axis of
the embryo (Weaver and Kimelman, 2004). Similarly, Wnt signaling governs dorsal-ventral
patterning in zebrafish and wnt8a mRNA is a component of the Balbiani body (Kelly et al.,
2000; Mizuno et al., 1999; Ober and Schulte-Merker, 1999; Lu et al., 2011). Moreover, the
mRNA encoding a microtubule-associated protein involved in tethering regulators of dorsal-
ventral pattern formation, syntabulin, localizes to the Balbiani body (Nojima et al., 2010;
Nojima et al., 2004).
Syntabulin protein links cargo to the microtubule network via its association with Kinesin
1—embryos lacking Syntabulin lack dorsal structures and are ventralized (Nojima et al.,
2010; Nojima et al., 2004). Another patterning molecule whose RNA is localized to the
Balbiani body is foxH1, a transcription co-factor that is involved in Nodal signaling and also
modulates expression of cytokeratin intermediate filaments (Pei et al., 2007). Knock-down of
FoxH1 by injection of translation-blocking morpholino causes severe defects in epiboly and
convergence movements during embryonic gastrulation, eventually leading to embryonic
arrest by the end of the first day of development (Pei et al., 2007).
Germ Plasm Components are Shared Between the Oocyte and Embryo
Given that maternal germ plasm persists throughout the many stages of oogenesis and
embryonic germ cell specification, it is not surprising that many germ plasm components
have been identified in distinct stage-specific RNP particles. For the purpose of this chapter
we will highlight four RNP structures: the perinuclear granules of early oocytes, the Balbiani
body of stage I oocytes, the granule aggregates of embryonic cleavage furrows, and the germ
granules of PGCs (Figure 3).
In early oocytes, prior to and including the Balbiani body stage oocytes, small granules
can be visualized surrounding the oocyte nucleus. The Vasa, Tdrd1 and Zili proteins are the
only component so far identified in these small perinuclear granules, and their function there
remains mysterious (Knaut et al., 2000; Huang et al., 2011). In contrast, many components
have been identified in the zebrafish Balbiani body including the germ plasm RNAs vasa,
dazl, and nanos3 (Draper et al., 2007; Knaut et al., 2000; Kosaka et al., 2007), and the RNA
and protein of the zebrafish germ plasmBalbiani body organizer, bucky ball (Bontems et al.,
2009; Heim et al., 2014). Additionally, the RNAbp Rbpms2 isis localized to the Balbiani
body (Kosaka et al., 2007).
Figure 3. Germ plasm components are shared between various RNP particles throughout development
of the germline. The top left corner depicts a cross section of an early oocyte with small perinuclear
granules. The schematic in the top right corner is a cross section of a stage I oocyte with the Balbiani
body—a structure that includes numerous aggregated RNPs and marks the vegetal pole. In the bottom
right, the cleavage furrows of the early embryo (4-cell embryo, viewed from the animal pole) also
contain multimerized aggregates of RNP particles. Finally, pictured in the bottom left is a cross-section
of a primordial germ cell from a 24hpf embryo. The wedges within the circle adjacent to each stage
indicate the components of germ plasm that have been reported in that particular RNP structure. The
components labeled with FP in brackets have been reported to localize in the corresponding germ plasm
structure though overexpression studies in which RNA containing a fluorescent tag conjugated to the
protein of interest was injected into a 1-cell stage embryo. FP= Fusion Protein.
The three Bb-localized RNAs vasa, dazl, and nanos3, in addition to dead end, granulito,
and tdrd7 are enriched in RNP aggregates of the cleavage furrows of 2 to 8-cell stage
zebrafish embryos (Kosaka et al., 2007; Strasser et al., 2008; Theusch et al., 2006; Weidinger
et al., 2003). Finally, the germ granules of PGCs in 24hpf embryos are known to contain the
endogenous proteins Vasa and Ziwi (Braat et al., 2000; Houwing et al., 2007). The PGCs of
24hpf embryos also contain the RNAs vasa, nanos3, dead end, granulito, and tdrd7;
however, subcellular distribution of these RNAs to germ granules has not been observed
(Koprunner et al., 2001; Mickoleit et al., 2011; Strasser et al., 2008; Weidinger et al., 2003;
Yoon et al., 1997). Additionally, many of the components discussed above have been injected
into 1-cell embryos as engineered RNAs harboring fluorescent protein fusions; these fusion
proteins are expressed in the germ granules, often co-localizing with endogenous Vasa
(Mickoleit et al., 2011; Strasser et al., 2008; Weidinger et al., 2003; Wiszniak et al., 2011).
Drawing comparisons between these many different RNP granules is challenging because in
many cases, an RNP component has been identified in one particular RNP structure, but was
has not been examined in the others. Despite this gap in knowledge, the currently available
data points to overlapping sets of RNP components in the oocyte and PGCs, suggesting that
these RNA binding proteins may have intersecting functions in the oocyte and the primordial
germ cells (Figure 3).
Differentiation of the Gonad and Oogenesis
Zebrafish sex is not determined by inheritance of sex specific chromosomes as in

mammals or Drosophila. Prior to sexual differentiation, all juvenile zebrafish develop ovary-
like gonads regardless of their ultimate sex (Takahashi, 1977). These bipotential juveniles
will continue to produce early stage oocytes until about 30 days of age, at which point their
oocytes will either continue to mature as the surrounding somatic tissue forms an ovary, or
undergo apoptosis and be replaced by spermatocytes as the somatic tissue becomes a testis
(Figure 1; ((Uchida et al., 2002; Slanchev et al., 2005; Siegfried and Nusslein-Volhard, 2008).
Both spermatogonia and oocytes have nuage; however, the female germ line will be the focus
of this chapter. It has been demonstrated that a critical number of germ cells are required to
form an ovary, and in the absence of germ cells, zebrafish develop as phenotypic (albeit
sterile) males. Furthermore, adult female zebrafish will revert to sterile males if their numbers
of oocytes fall below a certain threshold, or as sterile males if they lose their germ cells
altogether (Dranow et al., 2013). In support of this hypothesis, zebrafish females homozygous
for mutations disrupting the germ plasm RNAbp nanos3 are able to produce eggs as young
adults, but lose their germ cells by 5 months of age due to inability to maintain the oogonial
stem cell compartment (Dranow et al., 2013; Draper et al., 2007). These 5-month-old nanos3
mutant females revert their sex to sterile males, as judged by their pigmentation, and exhibit
male behaviors as evidenced by their ability to induce spawning of females (Dranow et al.,
2013). Homozygous mutants of another germ plasm RNAbp, ziwi, undergo germ cell
apoptosis during juvenile stages and consequently display a ―sterile male‖ phenotype
(Houwing et al., 2007).
The zebrafish ovary contains all stages of oocytes, which are continually produced by an
active oogonial stem cell (OSC) compartment, as judged by the presence of mitotic nuclei and
the identification of an oogonial stem cell niche. These OSCs are marked by the expression of
the RNAbps nanos2 and vasa, and presumably account for the high fecundity of female
zebrafish (Beer and Draper, 2013). After completing several rounds of mitosis to produce a
germ cell cyst, the oogonia initiate meiosis, thereby entering stage I of oocyte development
(Figure 4; (Marlow and Mullins, 2008)). There are five stages of zebrafish oogenesis
previously defined (Selman et al., 1993), culminating in stage V which is the ovulated egg.
Stage I oocytes progress through the early meiotic stages before arresting in diplotene
(Selman et al., 1993). Stage I of oogenesis has been divided into two subparts: in stage Ia, the
oocyte lies in a nest of several stage Ia oocytes, all encased by a common layer of somatic
support cells known as follicle cells (Selman et al., 1993). Stage Ia oocytes progress through
zygotene and pachytene stages of meiotic prophase I until they reach stage Ib (Draper, 2012).
In stage Ib, the oocyte breaks free from the nest and becomes encased in its own independent
layer of follicle cells. Stage Ib oocytes begin undergoing the process of nuclear
decondensation prerequisite for diplotene, and particularly important when considering the
germ plasm, they also assemble the Balbiani body (Selman et al., 1993).
Figure 4. Maturing oocytes and early embryos rely on posttranscriptional regulation of gene products.
The stages of female germ cell development from the PGC to the mature egg, followed by early
embryonic development, are picture from left to right. Each stage has the corresponding mitotic or
meiotic phase indicated above the drawing, and the approximate diameter of each cell or embryostage
indicated below the drawing. The green bars span the developmental time points during which maternal
transcription and zygotic transcription are active. The red bar spans a period of transcriptional silence,
during which the maturing egg and early embryo rely solely on posttranscriptional and posttranslational
control of gene products. The inlay demonstrates a typical example of posttranscriptional control by
stimulatory (top), or inhibitory (bottom) RNA binding proteins. Stimulatory RNAbps may positively
regulate translation of their RNA targets by recruiting polyadenylation machinery, recruiting ribosomes,
or localizing RNAs to stabilize them and prevent their degradation or promote their expression.
Inhibitory RNAbps may negatively regulate translation of their RNA targets by preventing association
with polyadenylation machinery, recruiting deadenylases, preventing ribosome association, or
localizing RNAs to target them for degradation. The stages of oogenesis pictured are based on Selman
et al.. All drawings are shown with the animal pole oriented up from stage I oocytes through shield
stage of embryogeneis. Abbreviations: PGC=primordial germ cell, OSC= oogonial stem cell, N=
nucleus, FCs= Follicle cells, Bb= Balbiani body, CGs= Cortical granules, YGs=Yolk granules, MZT=
Maternal-zygotic transition.
Oocytes remain arrested in diplotene of prophase I until stage IV when they undergo
maturation. The hallmark of stage II oocytes is the development of cortical granules, whereas
the hallmark of stage III oocytes is a tremendous increase in volume due to the accumulation
of yolk granules (Selman et al., 1993).
Stage IV of oogenesis marks the beginning of the maturation phase of oocyte
development and resumption of meiosis. Maturation-competent oocytes translocate their
nucleus, known as the germinal vesicle, toward the animal pole of the egg (Fabritius et al.,
2011). Following translocation, stage IV oocytes undergo germinal vesicle break down
(GVBD) and remodeling of the nuclear chromatin such that it becomes highly condensed and
transcriptionally silenced.
Interestingly, in mammals, chromatin condensation and transcriptional silencing are not
interdependent, as mouse mutants defective for nucleoplasmin can silence transcription
without changing their nuclear morphology (De La Fuente et al., 2004; and reviewed in
Marlow, 2010). Beginning from maturation and continuing throughout ovulation,
fertilization, and zygotic genome activation, all the ensuing developmental processes must be
coordinated independently from nuclear instructions. Therefore, the maternal deposition of
RNAbps that can modulate RNAs encoding germ plasm and regulators of cell fate is of
critical importance to controlling the timing and location of translation.
Conserved Nuage Components in Mammals
Unlike the germ cells of most invertebrates and non-mammalian vertebrates, mammalian
germ cells are not maternally inherited through germ plasm, but rather are induced by signals
from surrounding tissues ((Fujiwara et al., 2001) and reviewed in (Nguyen-Chi and Morello,
2011; Zhao and Garbers, 2002)). In mice for example, PGCs are only first distinguishable at
embryonic day 7.5, and arise from within the extraembryonic mesoderm (reviewed in (Zhao
and Garbers, 2002)).
Mouse germline induction depends on the secretion of BMP ligands from an adjacent
tissue, the extraembryonic ectoderm ((Lawson et al., 1999; Fujiwara et al., 2001) and
reviewed in (Ying et al., 2002)). Despite the differences in the origins of mammalian PGCs,
recent evidence indicates that mouse germ cells also contain germ granules and RNPs, and
the components of this nuage include many highly conserved RNAbps that are ubiquitous in
the germ plasm of lower vertebrates and invertebrates (Lim et al., 2013). For example mouse
oogonia and spermatogonia contain homologs of zebrafish Vasa (MVH), Dead End (DND),
Ziwi (MIWI), Zili (MILI), Dazl (DAZL), and others (Bhattacharya et al., 2007; Carmell et al.,
2007; Chuma et al., 2006; Cook et al., 2011; Ding et al., 2013; Kuramochi-Miyagawa et al.,
2004; Kuramochi-Miyagawa et al., 2008; Nguyen Chi et al., 2009; Ruggiu et al., 1997; Shoji
et al., 2009; Tanaka et al., 2000).
Mouse nuage components such as MVH, MILI and ELAVL1 are expressed in both male
and female gametes; however, loss-of-function studies in mouse suggest that these genes are
only essential for spermatogenesis (Chi et al., 2011; Kuramochi-Miyagawa et al., 2004;
Tanaka et al., 2000).
The basis of the sexual dimorphism in mouse gametogenesis phenotypes is largely
unexplored; however, recent reports propose that spermatogenesis may be more sensitive to
defects in meiotic processes (Lim et al., 2013). Adding to the complexity, mutant alleles
disrupting the corresponding Drosophila genes result in female-specific sterility while
spermatogenesis is unaffected (Kim-Ha et al., 1999; Schupbach and Wieschaus, 1989).
Illuminating the functions of germ plasm components in zebrafish germ cells should further
our understanding of the RNAbps and their essential roles in gametogenesis of both sexes.
Small Noncoding RNAs in the Germ Line and Soma
Small noncoding RNAs, in coordination with RNA binding proteins, play important roles
in promoting germ cell specification and protecting germ cell genomes. There are three major
classes of small RNAs: microRNAs (miRNAs), Piwi-interacting RNAs (piRNAs), and small
interfering endogenous RNAs (endo-siRNAs) (reviewed in (Banisch et al., 2012)). Of these
three classes, only miRNAs and piRNAs have been reported in zebrafish (Houwing et al.,
2007; Wei et al., 2012; Wienholds et al., 2003). Zebrafish miRNAs are essential for
embryonic development, and are also utilized in the specification of primordial germ cells
(Giraldez et al., 2005; Giraldez et al., 2006; Mishima et al., 2006; Schier and Giraldez, 2006;
Wienholds et al., 2003). Zebrafish piRNAs, as in other organisms, are expressed specifically
in the germline and are necessary for survival of the gametes (Deng and Lin, 2002; Houwing
et al., 2007; Lin and Spradling, 1997). The functions of these small RNAs demonstrate the
robust mechanisms the germ line employs to distinguish itself from the soma, and protect
itself against DNA damage.
miRNAs encompass a very large evolutionarily-conserved family of small RNAs, 21-25
nucleotides long, that function in post-transcriptional regulation of mRNA translation and
stability (reviewed in (Huntzinger and Izaurralde, 2011)). The biogenesis of miRNAs
involves several steps and has been extensively reviewed elsewhere (Krol et al., 2010; Winter
et al., 2009). In short, the process of making a mature miRNA begins with transcription of a
precursor RNA that is subsequently folded into a hairpin structure (Krol et al., 2010; Winter
et al., 2009). This hairpin is cleaved and modified by the RNAse proteins Drosha, DGCR8
(also known as Pasha or Partner of Drosha in flies) and Dicer to generate the mature miRNA
(Banisch et al., 2012; Winter et al., 2009). Finally, the mature form of the miRNA is loaded
onto an Argonaute protein to form the RNA Induced Silencing Complex (RISC). Silencing
activity of the RISC complex is directed by the mature miRNA, which meditates target-
substrate recognition via complementary base-pairing (Winter et al., 2009).
The zebrafish miRNA repertoire becomes increasingly diverse during zygotic stages of
embryogenesis where miRNAs have been shown to play a key role in developmental
transitions, including the maternal-zygotic transition, the developmental time point when
embryos shift from reliance on maternal transcripts to production of transcripts from their
own genome (Giraldez, 2010; Wei et al., 2012; Wienholds et al., 2005; Chen et al., 2005;
Thatcher et al., 2007). For example, the miRNA miR-430 aids in the maternal-zygotic
transition by targeting maternal transcripts for degradation (Giraldez et al., 2005; Giraldez et
al., 2006; Mishima et al., 2006; Schier, 2007; Wei et al., 2012; Soni et al., 2013). The role of
miRNAs in zebrafish development and specification of the germline has been elucidated
through studies of fish mutated in the enzyme Dicer, which is required for processing of
mature miRNAs (Giraldez et al., 2005; Giraldez et al., 2006; Mishima et al., 2006; Wienholds
et al., 2005; Wienholds et al., 2003). Because the dicer mutation is embryonic lethal (Giraldez
et al., 2005; Wienholds et al., 2003), the authors used a technique known as germline
replacement to produce embryos whose germ lines lack Dicer (Ciruna et al., 2002). They
eradicated the germ cells of a wild-type host embryo using dead end morpholino, and
replaced them with germ cells from dicer mutant embryos. This resulted in chimeric embryos
that have normal somatic cells, but dicer mutant germ cells (Giraldez et al., 2005). When
raised to adulthood, fish whose germ lines are deficient in dicer appear to have normal
spermatogenesis/oogenesis and fertility, demonstrating that the miRNA pathway is not
essential for oogenesis (Giraldez et al., 2005). This is somewhat surprising given that mature
miRNAs appear to be required for normal germ cell development in both fruit flies and mice
(Banisch et al., 2012; Megosh et al., 2006; West et al., 2009).
Although not essential to gametogenesis, the miR-430 family of miRNAs does play a role
in restricting the expression of germ plasm to the primordial germ cells of the developing
embryo (Kedde et al., 2007; Mickoleit et al., 2011; Mishima et al., 2006). Maternally supplied
germ plasm RNAs are highly enriched in embryonic germ cells, but are also present in low
amounts throughout the soma, particularly prior to the MZT (Braat et al., 1999; Koprunner et
al., 2001). In order to ensure that germ plasm is active only in specified germ cells, zebrafish
have evolved several, likely redundant mechanisms to restrict germ plasm mRNA translation
(Mishima et al., 2006). These include mechanisms mediating recruitment of germ plasm
RNAs, active repression of translation in the soma, and degradation of transcripts and protein
produced outside of the primordial germ cells (Mishima et al., 2006). Mishima et al. have
shown through elaborate studies of the nanos3 3‘UTR that cis-acting elements within this
region are targeted by miRNAs of the miR-430 class which promote deadenylation of the
mRNA and translational repression (Giraldez et al., 2006; Mishima et al., 2006). However,
the activity of the miR-430 miRNAs is counteracted in the germ cells, causing tissue-specific
gene expression of germ plasm RNAs (Figure 5; ) (Mishima et al., 2006). Whereas miR-430
targeted deadenylation was demonstrated for the 3‘ untranslated regions of nanos3, tdrd7, and
elavl2 mRNAs (Mickoleit et al., 2011; Mishima et al., 2006), vasa 3‘UTR polyadenylation is
independent of miRNA activity (Mishima et al., 2006).
Figure 5. Mechanisms of sequestering the germ plasm in the oocyte mirror mechanisms utilized in the
embryo to sequester germline from soma. A) Representation of a female zebrafish (the ovary is colored
green). The inset depicts a stage I oocyte with a Balbiani body. In this context, the germ plasm RNAs
(green) are sequestered in the Balbiani body where they are protected from degradation. When germ
plasm RNAs are not localized to the Balbiani body, for example in bucky ball mutants, they are not
maintained. B) Drawing of a 24-hour post fertilization embryo, with PGCs (green), with representative
RNAs pictured for the somatic cells (top) and PGCs (bottom). At this stage, miRNAs play a critical role
in restricting germ plasm expression to the PGCs. For example, the top transcript represents a germ
plasm RNA in a somatic cell that is being targeted for translational repression and degradation by the
miRNA-mediated RISC complex. In contrast, a germ plasm RNA present in the PGC is protected from
such repression and degradation by the RNA binding proteins Dead End and Dazl, that bind the 3‘UTR
thus rendering the transcript inaccessible to RISC complex-mediated silencing. RISC= RNA induced
silencing complex, PGC= primordial germ cell, ATG= translation start site.
Although not restricted to germ plasm messages, follow-up studies using ribosome
profiling compared wild-type and miRNA-deficient zebrafish embryos, to study the
mechanisms by which miR-430 represses its targets (Bazzini et al., 2012). In this study,
Bazzini et al. found miR-430 reduces the number of ribosomes on its target mRNAs, and that
this translational repression occurs before and independently from complete deadenylation
(Figure 5; ) (Bazzini et al., 2012). The authors therefore concluded that miR-430 is able to
regulate translation of its target mRNAs prior to inducing mRNA decay during zebrafish
development (Bazzini et al., 2012). Thus, miR-430 may similarly repress germ plasm
translation.
Although germ plasm 3‘UTRs are protected from miRNA repression in the germ cells,
this is not because miRNAs are excluded from the PGCs, but rather because their repressive
activities are not effective there (Mishima et al., 2006). This posed the hypothesis that
perhaps germ cell specific RNA-binding proteins associate with the 3‘UTRs of germ plasm
RNAs, thus preventing their association with miRNAs (Kedde et al., 2007; Mickoleit et al.,
2011; Mishima et al., 2006). This hypothesis was supported by the observation that regions in
the 3‘UTRs in close proximity to miRNA sites are conserved between transcripts, and may
therefore represent binding sites of conserved RNA-binding proteins (Kedde et al., 2007). It
was subsequently shown through overexpression and loss of function experiments, that the
RNA binding protein Dead End could protect nanos3, tdrd7, and elavl2 RNAs from miRNA-
mediated degradation, thereby stabilizing these transcripts in the PGCs (Figure 5; ) (Kedde et
al., 2007; Mickoleit et al., 2011). Likewise, it appears the RNAbp Dazl may also protect some
transcripts from miR-430 degradation (Figure 5; ) (Wiszniak et al., 2011). Through these
studies, it has become apparent that miRNAs and RNA binding proteins make up a major
component of the regulatory machinery in zebrafish that restricts germ plasm activity and fate
to the primordial germ cells.
Unlike miRNAs, piRNAs are essential for development of the zebrafish germline
(Houwing et al., 2007; Houwing et al., 2008). piRNAs are small noncoding RNAs, slightly
larger than miRNAs (24-30nt), that map to distinctive genomic regions with repetitive
sequences otherwise identified as transposons (Aravin et al., 2006; Houwing et al., 2007).
piRNAs, or ―Piwi-interacting RNAs‖, derive their name from the Piwi protein first discovered
in Drosophila (Aravin et al., 2006; Lin and Spradling, 1997). Loss of Piwi in the Drosophila
germline causes severe defects in spermatogenesis, a function conserved in mice whose
genomes encode three Piwi homologs, MIWI, MIWI2 and MILI (Carmell et al., 2007; Deng
and Lin, 2002; Kuramochi-Miyagawa et al., 2001; Lin and Spradling, 1997). In zebrafish,
piRNAs are expressed in both the male and female gonad, in contrast to their mammalian
counterparts, which show sexually dimorphic expression (Houwing et al., 2007; Kuramochi-
Miyagawa et al., 2004). Zebrafish have two Piwi homologs, Ziwi and Zili (Houwing et al.,
2008; Houwing et al., 2007). Mutation of zebrafish ziwi causes apoptosis of the germ cells
before sexual differentiation of the gonad, and consequently all mutants develop as sterile
males (Houwing et al., 2007). By contrast, zili mutant germ cells persist past the stage of the
bipotential gonad, but are ultimately unable to undergo meiosis and differentiate, leading to
sterility by 7 weeks of age (Houwing et al., 2008). Although zili mutant gonad development
progresses to sexual differentiation, zili mutants never develop an ovary (Houwing et al.,
2008); a result that is consistent with the previously discussed hypothesis that oocytes are
required for female development.
One major function of piRNAs is to prevent the mobility of transposable elements in the
genome; piRNAs likely fulfill this role by affecting genome remodeling via DNA methylation
and histone modification (Aravin et al., 2006; Banisch et al., 2012; Brower-Toland et al.,
2007; Kuramochi-Miyagawa et al., 2008; Pal-Bhadra et al., 2004). Piwi proteins are PAZ
domain containing proteins in the same family as Argonaute proteins (PAZ is named for the
proteins Piwi, Argonaute and Zwille), (reviewed in (Zamore and Haley, 2005)). Argonaute
and Piwi proteins have two conserved protein domains, the PAZ domain and the Piwi domain
(reviewed in (Lingel and Sattler, 2005)). The PAZ domain binds to small RNAs (miRNA in
the case of Argonaute, piRNAs in the case of Piwi), while the Piwi domain has enzymatic
RNA hydrolysis activity (reviewed in (Lingel and Sattler, 2005)). Thus, the protein structure
of Piwis suggests that in addition to silencing transposable elements, Piwi proteins may have
an additionala role in RNA silencing, much like their cousins the Argonaute proteins. In fact,
in Drosophila, evidence suggests that piRNAs may silence some germ plasm RNAs such as
vasa and nanos by recruiting the CCR4 deadenylation complex to these RNAs (Nishida et al.,
2007; Rouget et al., 2010). In C. elegans, recent studies support the hypothesis that piRNAs
and their associated Piwi proteins are capable of silencing expression of foreign sequences,
while simultaneously protecting and promoting expression of germline-expressed genes (Lee
et al., 2012; Seth et al., 2013; Shirayama et al., 2012; Wedeles et al., 2013). Overall, it is
likely that germline piRNAs have two functions, the first is to silence exogenous sequences
like the transposable elements from which they derive, and the second is to modulate the
expression of developmentally important germline RNAs such as nanos and vasa (Nishida et
al., 2007; Rouget et al., 2010; Lee et al., 2012; Seth et al., 2013; Shirayama et al., 2012;
Wedeles et al., 2013).
RNA Binding Proteins of the Germ Plasm
RNA binding proteins account for approximately 1-2% of all gene products in eukaryotic
organisms (reviewed in (Elliot, 2011; Glisovic et al., 2008)). This may not be surprising when
we consider that as soon as nascent RNA molecules are transcribed, they are loaded with
RNA binding proteins that facilitate their processing, nuclear export, localization and
translational regulation (reviewed in (Lunde et al., 2007)). This great diversity of RNAbp
functions might lead one to expect a correspondingly large diversity of protein structures.
Yet, the many different roles of RNAbps are achieved by a relatively small number of RNA
binding protein motifs that are present in the RNAbp as an individual domain or in multiple
copies (Figure 6; reviewed in (Lunde et al., 2007)). These modular RNA binding domains can
be arranged in many combinations with or without auxiliary domains, allowing for a large
assortment of RNAbp targets and functions (reviewed in (Elliot, 2011; Glisovic et al., 2008;
Lunde et al., 2007)). Many of the most common and well-characterized RNA binding
domains are present in germ plasm RNA binding proteins. These domains include the RNA
Recognition Motif (RRM) of Dead End, Dazl, and ELAV proteins, the zinc-finger domain
present in Nanos proteins, the DEAD box domain of Vasa proteins, and the PAZ and Piwi
domains of Ziwi and Argonaute family members (Figure 6; (Good, 1995; Hashimoto et al.,
2010; Maegawa et al., 2002; Sengoku et al., 2006; Slanchev et al., 2005; Slanchev et al.,
2009) and reviewed in (Elliot, 2011; Glisovic et al., 2008; Lingel and Sattler, 2005; Zamore
and Haley, 2005)).
Figure 6. The modular and conserved nature of RNA binding domains highlights structural similarities
between germ plasm RNAbps. Pictured to scale are the various RNA binding proteins of zebrafish
germ plasm, with RNA binding domains shown in colored blocks, and auxiliary (non-RNA binding)
domains shown in grey. To the right of the schematic drawings, we have listed known RNA targets for
each RNAbp in zebrafish, and pertinent targets reported for the corresponding homologs in Drosophila.
Abbreviations: Helicase/ATP bd= Helicase and ATP binding domain, HC= Helicase C domain, D=
DAZ (Deleted in Azoospermia) domain, TD= Tudor domain, PAZ= Piwi Argonaute Zwille domain,
DEAD= DEAD (asp-glu-ala-asp) box domain, RRM= RNA Recognition Motif, OST-HTH=
Oskar/TDRD5/TDRD7 Helix Turn Helix domain.
RNA helicases are a special class of RNA binding proteins that not only bind RNA, but
are able to catalyze its unwinding (reviewed in (Elliot, 2011)). Helicase activity is required to
unfold the complex structure of RNA, and thereby to reveal a stretch of single stranded RNA
that is permissive for translation, splicing, modifications, and other aspects of RNA
biogenesis. The prototypical RNA helicase is eIF4A; eIF4A contains a DEAD-box motif,
which is an acronym for the four amino acid residues within the motif (asp-glu-ala-asp) that
mediate nucleic acid binding (reviewed in (Elliot, 2011)). eIF4A shares the DEAD-box motif
with the RNA helicase Vasa, a germ plasm component that is conserved among numerous
organisms (Figure 6; reviewed in (Gustafson and Wessel, 2010; Lasko and Ashburner,
1988)).
Members of the Nanos family of RNA binding proteins possess two zinc-finger RNA
binding domains (Hashimoto et al., 2010). These domains, which are characterized by a zinc
ion that coordinates a combination of four amino acid residues (usually cysteines and
histidines), are best known for their ability to bind to DNA, but can also bind RNA or other
proteins (reviewed in (Elliot, 2011). Interestingly, the zinc-finger containing transcription
factor TFIIIA has been reported to specifically bind both RNA and DNA molecules from the
same zinc-finger domains using in vitro assays with purified protein (Theunissen et al., 1992).
Using TFIIIA as a paradigm for the zinc finger interactions between the two different types of
nucleic acids, it was found that zinc-fingers often bind their DNA targets in a sequence-
specific manner, but their interactions with RNA are dependent on RNA secondary and
tertiary structures ((Theunissen et al., 1992) and reviewed in (Elliot, 2011)).
The RNA recognition motif, present in Dead End, Dazl, and Elav proteins is the most
common RNA binding domain (Figure 6; ) (Good, 1995; Maegawa et al., 2002; Slanchev et
al., 2009). The main feature of the RNA recognition motif (RRM) is its ability to recognize
specific RNA sequences of 2-6 base pairs (reviewed in (Elliot, 2011)). The presence of
multiple RRMs in a single RNAbp can provide additional versatility and specificity of target
recognition by aligning the 2-6 base pairs recognized by each RRM and creating an overall
recognition site of 6-18 base pairs on the target RNA (reviewed in (Elliot, 2011; Lunde et al.,
2007)). The contribution of germ plasm RNA binding proteins to the mechanisms that guide
germ cell development is examined in detail in the following sections of this chapter.
Vasa
The RNA-helicase vasa is an evolutionarily conserved germ plasm component that is

expressed during germ cell development in most, if not all, animals including humans
((Castrillon et al., 2000) and reviewed in (Gustafson and Wessel, 2010)). First identified
through a maternal-effect screen in Drosophila, flies lacking vasa produce oocytes without
polar plasm (Drosophila germ plasm), and subsequently embryos with a deficiency of germ
cells (Schupbach and Wieschaus, 1986). The vasa gene seems to have evolved from the RNA
helicase PL-10 in animals after the diversion of fungi and plants. Even in the earliest animals,
hydra, vasa-like genes are strongly expressed in the germ line (Mochizuki et al., 2001). This
suggests that vasa and related genes are likely universal in the germ lines of all metazoans,
highlighting its ancient and fundamental role in gametogenesis (Mochizuki et al., 2001).
Although vasa is expressed in the germ cells of both ovary and testis, vasa deficiency in
Drosophila results in female-specific sterility ((Schupbach and Wieschaus, 1986), and
reviewed in (Raz, 2000)). And while Vasa expression in the gonads of both sexes is
conserved in mice, Vasa-null mice have male-specific sterility (Tanaka et al., 2000). The
discrepancy between the fly and mouse vasa-null phenotypes has been the subject of much
speculation about the possible species-specific and sex-specific roles of vasa (reviewed in
(Gustafson and Wessel, 2010)). Contemplation of the incongruity of such sex-specific
sterility phenotypes has led to two proposed models about RNA helicase function in the germ
line. According to one model, closely related helicases may substitute for vasa function in the
testis or ovary—for example, in Drosophila the PL-10 homolog, belle, is required for male
fertility and not female fertility, the opposite phenotype of Drosophila vasa mutants
(Johnstone et al., 2005). The second hypothesis is that vasa itself has different RNA targets in
male and female germ line cell types, and thus the consequence of losing vasa function
depends on the requirements of its target RNAs in ovary or testis (reviewed in (Gustafson and
Wessel, 2010)). Ultimately, the sex-specific differences in sterility phenotypes may be caused
by a combination of both helicase redundancy and target specificity, but this remains to be
experimentally determined. Better understanding of Vasa targets, and a comprehensive
investigation of vasa null phenotypes in other animals is likely to elucidate the conserved and
species-specific roles of Vasa protein.
The identification of vasa, the first germ plasm component described in zebrafish (Yoon
et al. 1997), permitted the first characterization of zebrafish primordial germ cell development
(Yoon et al., 1997). Using in situ hybridization Yoon et al. were able to pinpoint the temporal
and spatial origins of the zebrafish germ line. This original description revealed the
enrichment of maternal germ plasm at the zygotic cleavage furrows, followed by specification
of the first four PGCs of 1000-cell stage embryos, and ultimately, based on the localization of
the PGCs, identified the gonad anlage above the intersection of the yolk and yolk extension
(Yoon et al., 1997). Subsequent studies employed electron microscopy to show that the vasa
positive cells (putative PGCs) also display the ―classical‖ ultra-structural characteristics of
germ cells, namely electron-dense nuage (Braat et al., 1999; Knaut et al., 2000). Analysis of
vasa RNA distribution in the ovary revealed that vasa is very strongly expressed throughout
the cytoplasm of small germ cells of the ovary, presumably oogonia and early oocytes, and is
in close association with the cortex of later stage oocytes (Braat et al., 1999). The vasa RNA
transcript was also reported in an ―asymmetric subcellular localization‖ in small oocytes that
was postulated to represent an association with the mitotic spindle, but we now know is vasa
RNA localized to the Balbiani body (Braat et al., 1999).
Soon after these studies, two independent groups developed zebrafish anti-Vasa
antibodies that allowed for visualization of the Vasa protein product in the oocyte and
throughout germ cell development (Braat et al., 2000; Knaut et al., 2000). Surprisingly, close
examination of Vasa protein distribution in zebrafish oocytes revealed that Vasa protein
localizes in a granular ring around the oocyte nucleus, a pattern distinct from germ plasm
RNAs, including vasa (Knaut et al., 2000). Similarly, Vasa protein does not segregate with
the germ plasm in the cleavage furrows of early embryos (Braat et al., 2000). Instead, Vasa
localizes in a punctate manner near the center of each blastomere, in a pattern resembling
centrosomes (Braat et al., 2000). Vasa protein maintains this pattern throughout morula stages
and in contrast to vasa RNA is not restricted to only 4 cells (Braat et al., 2000). Nonetheless,
Vasa becomes enriched in PGCs of shield stage embryos, and by 24 hours post fertilization,
Vasa clearly marks the primordial germ cells (Braat et al., 2000). In zebrafish and other
animals including medaka, mice and humans, Vasa is commonly used as a marker for
oogonial stem cells (OSCs), although its expression domain likely includes OSCs and early
stage oocytes ((Beer and Draper, 2013; Johnson et al., 2004; Nakamura et al., 2010).
In the primordial germ cells of 24hpf zebrafish embryos, Vasa protein localizes to
cytoplasmic granules, reminiscent of the polar granules of Drosophila pole/germ cells (Braat
et al., 2000; Knaut et al., 2000). These granules are closely associated with the nuclear
envelope; however, zebrafish Vasa granules do not co-localize with nuclear pore complexes
as was reported for C. elegans (Knaut et al., 2000; Pitt et al., 2000). Subsequent studies have
used fluorescent protein-tagged RNA constructs to determine the subcellular localization of
numerous germ plasm components including dead end, dazl, elavl2, tdrd7, granulito and
vasa. These studies show that the translated products of these exogenously provided RNAs
also localize to perinuclear granules in PGCs of 24hpf zebrafish embryos (Mickoleit et al.,
2011; Strasser et al., 2008; Weidinger et al., 2003; Wiszniak et al., 2011). The function of the
perinuclear granules within PGCs is poorly understood in zebrafish; however, the analogous
structures in C. elegans, called P-granules, have been implicated in various aspects of RNA
metabolism including translation, polaydenylation, deadenylation, decapping and degradation
(reviewed in (Updike and Strome, 2010)). On the other hand, in zebrafish PGCs of 24hpf
embryos, co-staining of vasa RNA and protein demonstrated that vasa RNA is present in
cytoplasmic patches that do not precisely correspond to the Vasa-containing germ granules
(Knaut et al., 2000). This disjunction between vasa RNA and protein localization raises
questions about the hypothesis that zebrafish perinuclear granules are responsible for RNA
metabolism; however, this question clearly warrants further study with more RNAs and
higher resolution techniques.
Braat and colleagues used a morpholino knock-down approach to interrogate the role of
Vasa in zebrafish embryos (Braat et al., 2001). Although the morpholino effectively
eliminated Vasa protein in embryos from 24hpf up to 4 days (as judged by antibody staining
and Western blot), the morpholino-treated embryos had normal germline establishment (Braat
et al., 2001). Thus, the authors concluded that zygotic Vasa is not required in the period
between PGC specification and day 4 of embryogenesis. However, due to the inability of
morpholinos to eliminate maternal proteins and the transient nature of morpholinos in vivo,
the maternal contribution of vasa or its later requirements during gametogenesis could not be
determined (Braat et al., 2001). It would be very surprising if zebrafish vasa were not
essential for some aspect of germ cell development, given the sterility phenotypes of vasa-
null fruit flies and mice. A mutant disrupting zebrafish vasa is necessary to address the
functional requirement of this germ plasm component.
The effects Vasa exerts on its target RNAs have been extensively studied in Drosophila.
Vasa is an RNA-helicase of the DEAD-box family, and contains seven conserved motifs
responsible for RNA binding, ATP binding and ATP hydrolysis (Figure 6; and reviewed in
(Gustafson and Wessel, 2010; Parsyan et al., 2011)). The core of Drosophila Vasa has been
co-crystallized with an RNA substrate and ATP homolog to determine, by X-ray
crystallography, that Vasa likely unwinds the secondary structure of its RNA targets by
creating a bend to disrupt continuous base-pairing (Sengoku et al., 2006). This mechanism of
Vasa-mediated RNA unwinding is distinct from other canonical helicases that unwind the
double stranded region of nucleic acid by first binding one strand, and then translocating on
that strand with several rounds of ATP hydrolysis (Sengoku et al., 2006). Despite this
mechanistic difference, Vasa shares structural and functional similarity with the prototypical
DEAD-box helicase eukaryotic translation initiation factor 4A, eIF4A (Lasko and Ashburner,
1988). Based on this homology, it would seem logical that Vasa may also function to promote
translation. In fact, this hypothesis is supported by the observation that Drosophila Vasa
physically interacts with eukaryotic translation initiation factor 5B, eIF5B, to promote the
recruitment of the 60s ribosomal subunit and subsequent translation of interacting RNAs
((Johnstone and Lasko, 2004 and) reviewed in (Parsyan et al., 2011)). Interestingly, using a
mutant Vasa transgene incapable of interacting with eIF5B, Johnstone and Lasko
demonstrated that interaction between Vasa and eIF5B is required for oogenesis, and for the
translation and accumulation of the Drosophila patterning molecule Gurken (Johnstone and
Lasko, 2004). A subsequent study using Drosophila identified mei-P26 RNA as direct target
of Vasa binding (the only direct target identified to date), and also showed that Vasa binding
was mediated by a U-rich motif in the 3‘ untranslated region of the mei-P26 RNA (Liu et al.,
2009b). This finding is significant both because it demonstrates that Vasa can directly interact
with target RNAs, and also because the U-rich Vasa binding motif suggested a possible
mechanism for Vasa target recognition and specificity (reviewed in (Gustafson and Wessel,
2010)). The Drosophila studies demonstrate that Vasa can directly mediate translation of its
RNA targets, and given the high degree of conservation among animals, Vasa likely has a
similar function in the germ cells of zebrafish and other vertebrates.
Nonetheless, the function of translational activation likely accounts for only one of
Vasa‘s (potentially numerous) roles. In Drosophila and mice, studies have uncovered
translation-independent roles of Vasa as a modulator of the piRNA pathway discussed earlier
above (Kuramochi-Miyagawa et al., 2010; Lim et al., 2013; Pek and Kai, 2011). For example,
in flies Vasa was demonstrated to localize to mitotic chromosomes by a mechanism that is
dependent on a subset of piRNA pathway components Aubergine and Spindle-E (Pek and
Kai, 2011). In the mouse male germ line, spermatogenesis defects of mice deficient in Vasa
(MVH) closely resemble those of MILI- and MIWI2-deficient mice (Kuramochi-Miyagawa et
al., 2010). As in MILI and MIWI2 knock-outs, MVH-deficient mice have defective DNA
methylation, presumably caused by aberrant piRNA function (Kuramochi-Miyagawa et al.,
2010). Thus, the molecular functions of Vasa likley include translational activation in
addition to the translation-independent piRNA-related functions of transposon silencing and
DNA methylation.
Nanos
First identified in Drosophila, the germ plasm component nanos is a multifunctional

RNA binding protein that is required for several processes including embryonic patterning,
germ cell survival and oocyte maintenance. Of these three functions, only the latter two are
conserved in vertebrates: nanos homologs regulate the survival of migrating primordial germ
cells in Drosophila, zebrafish and mice (Draper et al., 2007; Kobayashi et al., 1996;
Koprunner et al., 2001; Tsuda et al., 2003). Additionally, nanos and its vertebrate homologs
are required to maintain the germline stem cells that renew the germ cell population in
Drosophila, zebrafish and mice (Bhat, 1999; Draper et al., 2007; Forbes and Lehmann, 1998;
Tsuda et al., 2003). Even in human germ cell lines (derived from embryonic stem cells),
NANOS3 regulates germ cell numbers and pluripotency marker expression (Julaton and Reijo
Pera, 2011). Unique to Drosophila, nanos appears to have a role in embryonic patterning;
nanos RNA localizes to the posterior region of the Drosophila egg chamber (analogous to
vegetal localization in vertebrate oocytes), and is required for pattern formation of the
embryonic abdomen (Wang and Lehmann, 1991). Although Drosophila has only one nanos
gene, zebrafish and other vertebrates have three nanos homologs, nanos1, nanos2, and
nanos3 (Beer and Draper, 2013; Julaton and Reijo Pera, 2011; Haraguchi et al., 2003; Tsuda
et al., 2003). Whereas nanos1 is primarily expressed in the nervous system (Haraguchi et al.,
2003; Rauch, 2003), nanos2 and nanos3 are expressed specifically in the germline ((Beer and
Draper, 2013; Draper et al., 2007; Koprunner et al., 2001) and reviewed in (Saga, 2008)).
Publications prior to 2013 referred to zebrafish nanos3 as nanos1; however, it has since been
renamed nanos3 to reflect the conserved protein structure and functions with its mammalian
orthologs (Beer and Draper, 2013).
Zebrafish nanos3 was identified in a whole-mount in situ hybridization screen for genes
expressed in the primordial germ cells (Koprunner et al., 2001). In this study and subsequent
studies the nanos3 expression pattern was found to largely overlap with those of the germ
plasm RNAs dazl and vasa; nanos3 RNA localizes to the Balbiani body of stage I oocytes, is
dispersed in the oocyte cytoplasm at later stages, and is then recruited to the cleavage furrows
of embryos before being restricted to the primordial germ cells (Draper et al., 2007;
Koprunner et al., 2001; Kosaka et al., 2007). Unlike vasa, however, which is continuously
expressed throughout germ cell development and is expressed in the germ cells of both sexes
(Braat et al., 2000; Braat et al., 1999; Yoon et al., 1997), nanos3 is expressed in the PGCs
until 5 days post fertilization and then resumes expression in ovaries but not in testis of 3
week old fish (Draper et al., 2007).
To study the function of nanos3 in primordial germ cells, Koprunner et al. injected
fertilized eggs with antisense oligonucleotides against nanos3. Using this approach, the
authors found that blocking translation of nanos3 did not affect PGC formation or
specification, but disrupted PGC migration to the gonad anlage, resulting in mislocalized
germ cells within the head and somites of one day old fish (Koprunner et al., 2001). While
other studies have shown that germ cells in ectopic locations can survive and maintain germ
cell marker expression for several days (Weidinger et al., 1999) nanos3-depleted ectopic
germ cells die between 11 and 24 hours post fertilization. This suggests that loss of germ cell
identity precedes or causes failed migration and loss of nanos3 morphant PGCs, rather than a
lack of permissive factors for PGC survival in ectopic locations (Koprunner et al., 2001).
Importantly, because the interference strategy utilized could not target maternally deposited
protein, it remained to be determined if nanos3 had an earlier role in PGC specification
(Koprunner et al., 2001). An independent study of embryos derived from nanos3 mutant
mothers, which cannot provide maternal nanos3, also observed that embryonic PGCs are
specified but mis-localized (Draper et al., 2007). In addition, they found that loss of PGCs
occurred regardless of the paternal genotype, indicating that only the maternal nanos3 product
is required for PGC specification and migration, and that zygotic transcription of nanos3
occurs too late or is not sufficient to rescue the phenotype (Draper et al., 2007). When raised
to adulthood, embryos lacking maternal nanos3 are sterile, owing to a lack of PGCs, whereas
many of the adult nanos3 morphants are fertile, consistent with a maternal store of Nanos3
protein and incomplete depletion of nanos3 in the morphants (Draper et al., 2007; Koprunner
et al., 2001). nanos3 is also expressed in the migrating primordial germ cells of mice, and
germ cells are absent from adult nanos3 knockout mice of both sexes (Tsuda et al., 2003).
These studies clearly point to a conserved role for nanos3 in primordial germ cell survival
and migration in vertebrates (Draper et al., 2007; Koprunner et al., 2001; Tsuda et al., 2003).
One major difference in the germline establishment of zebrafish and mice is that maternal
nanos3 is sufficient for PGC migration and ovary formation in zebrafish, whereas mice
require zygotic transcription of nanos3 for proper establishment of the germ line (Draper et
al., 2007; Koprunner et al., 2001; Tsuda et al., 2003). This difference creates a unique
opportunity to study the role of nanos3 in the established gonad (i.e. in adult germ cells). By
examining zebrafish devoid of zygotic nanos3 Draper et al. determined that nanos3 mutant
females are initially fertile, but rapidly lose their ability to lay eggs (Draper et al., 2007).
Normally, zebrafish reach sexual maturity at approximately 2.5 months of age and reliably
lay eggs until they are two years old; however, nanos3 mutant females prematurely stop
laying eggs at 5-6 months (Draper et al., 2007). Consistent with the oocyte-specific
expression of nanos3, mutant males are fertile and otherwise normal (Draper et al., 2007).
Histological examination to understand the basis of the premature infertility in females
revealed that 6 month old nanos3 mutant ovaries were devoid of oocytes, accounting for their
lack of fertility. Earlier, at stages when nanos3 mutant females are fertile (2.5 months), their
ovaries contain almost exclusively advanced stage oocytes (Draper et al., 2007). Thus, nanos3
is required for continued production of oocytes, and likely maintains the oocyte stem cells in
the adult ovary of zebrafish (Beer and Draper, 2013; Draper et al., 2007).
Unlike nanos3, zebrafish nanos2 is not maternally provided, and its expression cannot be
detected in the primordial germ cells of embryos in the first 24 hours (Beer and Draper,
2013). Instead, nanos2 expression is first detected in the bipotential gonad of 21 day old fish
in a rare population of germ cells that persist throughout the zebrafish lifetime in both males
and females (Beer and Draper, 2013). Further characterization determined that these rare
nanos2 expressing cells are a small subset of the vasa-expressing cells in male and female
gonads that have DNA morphology consistent with pre-meiotic germ cells (Beer and Draper,
2013). Beer and Draper also evaluated the expression of nanos2 in the nanos3 mutant ovary,
and discovered that maintenance of nanos2-expressing cells requires nanos3 (Beer and
Draper, 2013). In mice NANOS2 is necessary and sufficient to maintain spermatagonial stem
cells (Sada et al., 2009). Taken together, these observations support the notion that zebrafish
nanos2 is a marker for oogonial stem cells, and that nanos3 is required to maintain the
oogonial stem cell population (Beer and Draper, 2013).
Nanos proteins likely function as translational regulators of select RNA targets. As noted
previously, Nanos proteins contain two zinc finger motifs in their C-terminal regions that are
responsible for the interactions between Nanos and its RNA targets (Figure 6; ) (Curtis et al.,
1997). In Drosophila, the zinc finger motif is essential to Nanos function as was
demonstrated by the inability of Nanos truncations lacking the C-terminal region to rescue the
aberrant abdominal patterning of nanos mutant embryos (Curtis et al., 1997). The same
Drosophila study also demonstrated that the interaction between Nanos and its RNA targets,
which include the abdominal patterning RNA hunchback and the mitotic regulator RNA
cyclinB, is not sequence specific, as the nucleotides required for binding can be mutated with
little effect on Nanos binding affinity (Curtis et al., 1997; Irish et al., 1989;
Kadyrova et al., 2007).
The functional domains and RNA targets of zebrafish Nanos proteins have not been
extensively characterized; however, the zebrafish nanos3 mutant disrupts the Zinc Finger
domains, indicating that if a truncated protein is produced it is not sufficient for Nanos
function (Draper et al., 2007). Moreover, because of tight structure conservation, it is
assumed that the zinc finger motifs are required for zebrafish Nanos function (Hashimoto et
al., 2010). Notably, the only crystal structure of a Nanos protein was performed on the zinc
finger domains of zebrafish Nanos3 (Hashimoto et al., 2010). This crystal structure revealed
that the zinc finger region is composed of two zinc-finger lobes (one from each zinc finger),
and that the lobes create a positively charged cleft—composed of many highly conserved
basic residues (Hashimoto et al., 2010). This ―basic‖ cleft appears to be important for RNA
binding since mutation of three of the conserved residues causes loss of binding in
electrophoretic mobility shift assays (Hashimoto et al., 2010). The activity of Nanos binding
to its RNA targets has not been described in zebrafish; however, studies in both Drosophila
and mice indicate Nanos homologs act as repressors of RNA translation (Curtis et al., 1997;
Parker and Sheth, 2007; Suzuki et al., 2010). For example, in flies, Nanos negatively
regulates hunchback mRNA, as is demonstrated by the expanded expression domain of
hunchback in nanos mutants (Irish et al., 1989; Tautz, 1988). Evidence from studies in mice
that NANOS2 acts by repression of translation includes NANOS2 co-immunoprecipitation
with members of the CCR4-NOT deadenylation complex, and the in vitro deadenylase
activity of the NANOS2/CCR4-NOT complex (Suzuki et al., 2010). Thus, it is reasonable to
hypothesize that in zebrafish Nanos homologs also carry out their germ cell functions by
promoting deadenylation of their target RNAs to promote RNA destabilization and/or

translational repression.
Dazl
Dazl and related proteins have been implicated in various roles that promote fertility. The
Dazl family of RNA binding proteins was first discovered when a group investigating the
causes of infertility in men observed that some patients had overlapping deletions in a portion
of their Y-chromosomes (Reijo et al., 1995). This group determined that the aberrantly
deleted chromosomal segment contains a gene cluster of four nearly identical genes which the
authors named Deleted in AZoospermia, or DAZ (Kee et al., 2009; Reijo et al., 1996; Reijo et
al., 1995). The evolution of the human DAZ family of genes, which includes four DAZ genes
and two autosomal genes DAZL and BOULE, is fascinating because these genes have evolved
at several phylogenetic turning points from invertebrates, to vertebrates and even primates.
The most evolutionarily ancient member of the DAZ family is the autosomal gene BOULE,
which is present in the invertebrate Drosophila, and has orthologs in many vertebrates
(Eberhart et al., 1996; Xu et al., 2001; Xu et al., 2009). The other autosomal homolog of DAZ,
DAZ-Like, or DAZL, appears to have evolved specifically in vertebrates (Xu et al., 2001).
Finally, the genomes of great apes (including humans), contain multiple copies of DAZ on
their Y chromosomes, a feature that likely resulted from transposition of the DAZL gene and
subsequent duplication (Yu et al., 2008).
All DAZ family genes encode RNA binding proteins with a single RNA recognition
motif, and one or multiple DAZ motifs that mediate protein-protein interactions (Reijo et al.,
1995; Tsui et al., 2000a). DAZ, DAZL and BOULE share homology in their RRM domains
that is not shared with other RRM containing RNA-binding proteins, suggesting there may be
something unique about the RNA binding mechanism of the DAZ family proteins (Burd and
Dreyfuss, 1994; Xu et al., 2001). DAZL is 95% homologous to DAZ, except that DAZL
contains only one DAZ motif (Xu et al., 2001). Although homologs of DAZ proteins are
present in diverse organisms, the consequence of their null mutations is somewhat variable
from species to species (Xu et al., 2001). For example, disruption of Drosophila boule causes
meiotic arrest in male germ cells, whereas mutation of the C. elegans homolog of DAZ
causes oogenesis-specific meiotic arrest (Eberhart et al., 1996; Karashima et al., 2000). In
mice, disruption of Dazl results in complete loss of germ cells and gametes of both sexes
(Ruggiu et al., 1997). These divergent phenotypes may be partially explained by the slightly
different roles for each DAZ family member; for example, it appears that BOULE has a role
in meiosis, whereas DAZL is required in pre-meiotic germ cells for establishment of the
germline (Houston and King, 2000; Ruggiu et al., 1997; Xu et al., 2001). DAZ seems to be
important but not essential for meiosis during spermatogenesis, since complete deletion of the
DAZ gene cluster includes phenotypes such as low numbers of sperm (Reijo et al., 1996;
Reijo et al., 1995; Xu et al., 2001; Kee et al., 2009). Alternatively, it is possible that particular
DAZ family proteins have sex-specific expression as has been proposed for Vasa, or similarly
that these proteins have different RNA targets in different tissues or cell stages.
It appears that zebrafish contain only one known DAZ homolog, dazl, although a boule
homolog has been identified in the closely related teleost fish medaka (Xu et al., 2001; Xu et
al., 2009). Zebrafish dazl is expressed exclusively in the germline, and follows the typical
localization pattern of germ plasm RNAs: dazl is localized to the Balbiani body in stage I
oocytes, the vegetal cortex in later stage oocytes, and is restricted to the cleavage furrows and
subsequent PGCs of the embryo (Kosaka et al., 2007; Takeda et al., 2009; Theusch et al.,
2006). To date a loss-of-function analysis of the role of dazl in germ cell development has not
been reported in zebrafish. However, in Xenopus, depletion of dazl using antisense
oligonucleotides results in complete loss or severely reduced numbers of primordial germ
cells in embryos, as well as a late PGC migration defect (Houston and King, 2000).
A role for Dazl in promoting translation of germ plasm RNAs was uncovered by
Maegawa and colleagues, who used a combination of biochemical techniques and cell culture
analysis to examine the activity of zebrafish Dazl protein (Maegawa et al., 2002). Using
tagged Dazl protein, the authors ―pulled down‖ and sequenced fragments of RNA bound to
Dazl, and identified the sequence ―GUUC‖ as a consensus binding site for Dazl recognition
(Maegawa et al., 2002). The authors also used this approach to pinpoint the functionally
important regions by substituting wild-type Dazl with truncated and mutated Dazl, and
thereby found that the Dazl RNA recognition motif is necessary and sufficient for RNA
binding, and that the DAZ motif is not required for this activity (Maegawa et al., 2002). In
order to test how Dazl affects the post-transcriptional regulation of its targets, the authors
used a known RNA interactor of Drosophila Boule, the twine RNA, which contains multiple
―GUUC‖ sequences in its 3‘UTR (Maegawa et al., 2002; Maines and Wasserman, 1999).
Drosophila twine encodes a cell cycle phosphatase required for meiotic entry, in agreement
with the hypothesis that the major function of Boule is to regulate meiotic events (Alphey et
al., 1992; Courtot et al., 1992; Maines and Wasserman, 1999). Maegawa et al. constructed a
luciferase reporter fused to the 3‘UTR of twine, and a similar reporter fused to the 3‘UTR of
dazl itself, which also contains multiple ―GUUC‖ sequences (Maegawa et al., 2002). When
these reporter plasmids were co-transfected into mammalian cells with various levels of an
expression vector containing tagged Dazl protein, the authors found that there was a dose-
dependent increase in luciferase activity that was also dependent on intact ―GUUC‖
sequences (Maegawa et al., 2002). Maegawa and colleagues went on to demonstrate that
zebrafish Dazl interacts with polysomes through its DAZ motif (Maegawa et al., 2002).
Consistent with a conserved role for Dazl in regulating translation, mouse DAZL protein also
associates with actively translating polysomes in spermatogenic tissues (Maegawa et al.,
2002; Tsui et al., 2000b). Thus, it seems likely that zebrafish Dazl promotes translation of its
targets by binding specific sequences in the 3‘UTR, and recruiting ribosomes to the transcript.
Zebrafish Dazl has been reported to counteract miRNA activity and promote
polyadenylation of the germ plasm RNA tdrd7 (Takeda et al., 2009). In that study, the authors
used fluorescent reporters injected into zebrafish embryos to show that a GFP fusion with the
tdrd7 3‘UTR is stabilized in a ―GUUC‖ dependent manner when coexpressed with Dazl
(Takeda et al., 2009).
Furthermore, co-injection of the tdrd7 3‘UTR reporter with Dazl results in increased
polyadenylation of GFP-tdrd7 3‘UTR independent of active translation (Takeda et al., 2009).
The authors used a segment of the nanos3 3‘UTR that they had previously demonstrated is
normally repressed by miR-430 to study the possible interplay between miRNAs and Dazl
regulation of germ plasm RNA stability (Giraldez et al., 2006; Mishima et al., 2006;
Takeda et al., 2009).
The nanos3 3‘UTR is stabilized by overexpression of Dazl, in a ―GUUC‖ sequence
dependent manner (Giraldez et al., 2006; Mishima et al., 2006; Takeda et al., 2009). Taken
together, these two reports indicate that zebrafish Dazl may utilize multiple pathways to
stabilize and promote translation of its targets including recruitment of polysomes, promotion
of polyadenylation, and protection from miRNA repression (Maegawa et al., 2002; Takeda et
al., 2009).
Dead End
The RNA binding protein Dead End is an essential regulator of PGC development that
was first discovered in a large-scale zebrafish screen to identify genes with PGC-specific
expression patterns (Weidinger et al., 2003). Like other germ plasm RNAs, dead end (dnd) is
provided maternally, enriched in the embryonic cleavage furrows, and is present in the
primordial germ cells of 24 hpf embryos (Weidinger et al., 2003). A GFP-tagged Dead End
fusion protein localizes to the perinuclear granules of 24hpf embryos, where fluorescent-
tagged Vasa is also localized (Weidinger et al., 2003). This implies that, like many other germ
plasm components, Dead End is a component of the ribonucleoprotein complexes present in
the germ granules of zebrafish PGCs. The search for dead end orthologs in other species
revealed that several vertebrates including Xenopus laevis, chicks, mice and humans possess
genomic sequence and expressed sequence tags that share homology with zebrafish dead end
(Weidinger et al., 2003). Similar to zebrafish morphants, mouse Ter (DND) mutants show
germ cell deficits (Youngren et al., 2005), thus confirming a conserved role for dead end in
germ cell function (Horvay et al., 2006; Kedde et al., 2007; Koebernick et al., 2010; Liu et al.,
2009a; Youngren et al., 2005). Interestingly, no orthologs of Dead End have been identified
in Drosophila or C. elegans, raising the possibility that dead end is a vertebrate-specific germ
plasm component (Weidinger et al., 2003).
Loss of function studies using dead end morpholino revealed that dead end is necessary
for migration of the primordial germ cells (Weidinger et al., 2003). Normal migration of
primordial germ cells begins shortly before gastrulation at which time the PGCs sit adjacent
to the yolk syncytial layer (YSL) (Braat et al., 1999; Weidinger et al., 2003). However, at the
same stage in dead end morphants, the PGCs are not associated with the YSL, and instead are
floating above and detached from this layer (Weidinger et al., 2003). Although not described
prior to the discovery of dead end, PGC association with the deep cell layers adjacent to the
YSL may represent a zone where germ cell migration is initiated (Weidinger et al., 2003).
The detachment from the YSL is the first manifestation of the dead end morphant migration
defect that ultimately results in a complete absence of PGCs from the gonadal anlage, and
subsequent apoptosis of these unlocalized cells (Weidinger et al., 2003). This migration
phenotype is distinct from migration phenotypes caused by deficient CXCR4b signaling, as
embryos lacking cxcr4b have PGCs that are motile and migratory, but do not reach their
proper destination (Doitsidou et al., 2002; Knaut et al., 2003; Weidinger et al., 2003). Thus,
Dead End may be required for initiation of PGC migration in a manner independent from
chemokine signaling.
The RNA binding function of Dead End is required for germ cell migration. The
zebrafish Dead End protein contains one canonical RNA recognition motif (RRM) near the
N-terminus (Figure 6; ) (Slanchev et al., 2009; Liu and Collodi, 2010). A study that examined
the function of zebrafish Dead End protein employed truncation mapping, creating
successively smaller fragments of the C-terminal side of the protein, to identify functionally
relevant regions of the protein (Slanchev et al., 2009). From this analysis Slanchev et al.
concluded that the RNA recognition motif is essential to dead end activity, as judged by the
ability of truncations containing the RRM to partially rescue the PGC deficiency caused by
dnd morpholinos (Slanchev et al., 2009). They also determined that the amino terminal region
of Dead End 3‘ to theadjacent to the RNA recognition motif is required for proper
localization of the protein to the perinuclear granules of primordial germ cells (Slanchev et
al., 2009). The authors identified 6/31 positions that are conserved between the zebrafish and
mouse orthologs of Dnd that are essential for rescue of PGC formation in dead end
morphants, 5 of which are in the RNA recognition motif (Slanchev et al., 2009). Based on
this data, the authors used computer homology modeling to predict the structure of the RRM
of Dead End protein, and found that the five essential residues reside on parts of the protein
domain that are likely to interact directly with the RNA molecule (Slanchev et al., 2009).
Surprisingly, tagged versions of Dnd proteins with mutations in these essential residues of the
RRM did not localize to the perinuclear granules of PGCs (Slanchev et al., 2009). Instead,
these mutant proteins were restricted to the germ cell nuclei, despite their lacking a canonical
nuclear localization signal (Slanchev et al., 2009).
Due to this perplexing localization phenotype, the authors speculated that shuttling of
Dead End protein to the perinuclear granules of the germ cell cytoplasm might require pre-
loading with its target RNAs in the nucleus (Slanchev et al., 2009). Therefore, the Dead End
RRM seems to carry out most of the protein‘s activity, and the requirement for RNA binding
to reach the perinuclear granules of the cytoplasm suggests that this activity is strictly
regulated.
Dead End possesses many of the hallmarks of RNA binding proteins that bind to uridine-
rich regions (URRs) of single stranded RNAs (Handa et al., 1999; Kedde et al., 2007). In fact,
mutation of these uridine sites on Dead End target RNAs demonstrated that Dead End
interaction depends on URR motifs in the 3‘ untranslated region (Kedde et al., 2007). Kedde
and colleagues used fluorescent reporters of the 3‘UTR regions of nanos3 and TDRD7 (two
RNAs previously demonstrated by Mishima et al. to accumulate in PGCs as the result of
miR-430 mediated repression specifically in the soma discussed earlier) (Mishima et al.,
2006)) to study the possible role of Dead End in miRNA-mediated repression.
The authors examined the effect of knocking-down Dead End on the level of fluorescent
reporter signal, and found that fluorescencet intensity was diminished in this context,
consistent with Dead End having a stabilizing effect on these two 3‘ UTRs (Kedde et al.,
2007). The authors attributed this effect to miR-430 by demonstrating that fluorescence could
be restored when the miR-430 seed sequences on the reporter 3‘UTRs are mutated (Kedde et
al., 2007). The same effect on the human Dnd1 target p27 was demonstrated in human cell
lines (Kedde et al., 2007).
Therefore, it can be concluded that a major function of Dead End is to stabilize its target
mRNAs by prohibiting miRNA mediated gene suppression (Kedde et al., 2007).
In addition to RNA-binding capabilities, Dead End possesses ATPase activity (Liu and
Collodi, 2010). Employing a similar domain mapping approach to Slanchev et al., Liu and
Collodi found that the C-terminal region of Dead End, which contains the ATPase activity, is
required for full PGC rescue of dead end morphants (Liu and Collodi, 2010). Because Dead
End appears to contain both an RNA recognition motif and an ATPase domain, it seems
plausible that Dead End may function as an RNA-helicase; however, this has not been
experimentally determined (Liu and Collodi, 2010).
Dead End catalyzes ATP hydrolysis at a similar rate to other RNA helicases such as
eIF4A and Vasa (Liu and Collodi, 2010). However, unlike eIF4A and Vasa, Dead End
ATPase activity is not stimulated by the presence of RNA (Liu and Collodi, 2010). It will be
interesting to see what role, if any, the Dead End ATPase activity plays in the function of this
protein during germ cell development.
Other RNA Binding Proteins of the Germ Plasm
Aside from Vasa, Nanos3, Dazl and Dead End, there are numerous other RNA binding
proteins in the germ plasm that may play important roles in the regulation of RNAs during
germ cell development. One such RNAbp, Tdrd7 (Tudor domain containing protein 7), was
discovered as a component of zebrafish germ plasm through a microarray screen to identify
transcripts enriched in the primordial germ cells (Strasser et al., 2008). Like vasa and nanos,
tudor was first identified in Drosophila among the canonical ―posterior group‖ mutant class
which produce oocytes deficient in posterior pole plasm, and embryos that lack germ cells
(Boswell and Mahowald, 1985). The Tudor domain protein motif present in Drosophila
Tudor, and Tudor-domain containing proteins like Tdrd7, has been implicated in protein-
protein interactions with methylated protein substrates (Arkov et al., 2006). The predicted
RNA binding domain of Tdrd7 is a recently described novel domain called OST-HTH, for
Oskar/TDRD5/TDRD7 Helix Turn Helix (Anantharaman et al., 2010). Loss-of-function
morpholino studies targeting tdrd7 in zebrafish indicate that zygotic Tdrd7 protein is not
essential in primordial germ cell survival or germline development; however, aberrant
perinuclear granules in tdrd7-morpants suggests that Tdrd7 function may be required in the
maintenance of germ granule integrity (Strasser et al., 2008). This role seems conserved based
on analysis of a collection of point mutant alleles within the 11 Tudor domains of Drosophila
Tudor, some of which are required for polar granule architecture (Arkov et al., 2006). Taken
together it appears that zebrafish Tdrd7 may serve as a docking protein that can both bind
mRNAs and regulate perinuclear granule assembly (Arkov et al., 2006; Strasser et al., 2008).
The role of Tdrd7 in aggregating germ plasm components is echoed by a similar role for
its family member Tdrd1 (Huang et al., 2011). Zebrafish tdrd1 mutant gonads do not
complete sexual maturation similar to the zili and ziwi mutants (Houwing et al., 2008;
Houwing et al., 2007; Huang et al., 2011); however, primordial oocytes from 3-week old
trdrd1 mutants appear to be defective in nuage accumulation. The similar phenotypes
between ziwi, zili and tdrd1 mutants led the authors to propose that these genes act in the
same piRNA pathway (Huang et al., 2011). Although Tdrd1 does not directly bind RNA, it
has been found in complexes that contain the piRNA binding proteins Ziwi and Zili, (Huang
et al., 2011). In conjunction with murine data of Piwi protein interaction with Tudor proteins,
these data suggest that Zebrafish Tdrd7 and Tdrd1 may act to promote aggregation of nuage
as molecular scaffolding proteins for piRNA components (Huang et al., 2011; Vagin et al.,
2009; Strasser et al., 2008).
The ELAV proteins, also known as Hu proteins, are additional RNAbps that may play a
role in development of the zebrafish germline. ELAV proteins, named for Drosophila mutants
with an Embryonic Lethal Abnormal Vision phenotype, are RNA-binding proteins comprised
of three RNA recognition motifs and have been implicated in numerous post-transcriptional
functions (Reviewed in (Keene, 2001)). In zebrafish, the ELAV family contains five
members; two are neuron-specific (HuC/elavl3 and HuD/elavl4), two are expressed
ubiquitously (HuR/elavl1 and HuG), and only one has both neuron and germ cell
expression—HuB otherwise known as elavl2 (Thisse, 2004). The elalvl2 RNA is broadly
expressed during gastrulation stages, and becomes restricted to the neural tissues and
primordial germ cells of 24hpf embryos (Mickoleit et al., 2011). In addition, protein produced
from RNA constructs harboring a fluorescent protein fused to the elavl2 coding sequence
accumulates in the perinuclear granules of PGCs (Mickoleit et al., 2011). In an independent
study, the authors mapped the relevant region of the 3‘UTR to the last 144 nucleotides of
elavl2 and provided evidence for a mechanism that involves Dazl mediated stabilization and
translation of elavl2 transcripts (Wiszniak et al., 2011). The expression of elavl2 and
localization of its fusion protein suggest it may play a role in zebrafish germ cell
development; however, little is known about the function of this protein in this context. The
Drosophila homolog of elavl2, Rbp9, is required for differentiation of oocyte progenitors
(Kim-Ha et al., 1999), while mouse ELAV1/HuR is necessary for meiotic events in
spermatogenesis (Chi et al., 2011). Rbpms2 (RNA binding protein with multiple splicing 2) is
the zebrafish homolog of Xenopus Hermes, and is the only known RNAbp to localize to the
Balbiani body of zebrafish stage I oocytes (Kosaka et al., 2007). Recently, reports in both
Xenopus and zebrafish have demonstrated physical interaction between Rbpms2 and an
essential regulator of Balbiani body formation and a Balbiani body-localized protein, Bucky
ball (Nijjar and Woodland, 2013; Heim et al., 2014 in press). Bucky ball, a protein with no
recognizable functional domains, is required in zebrafish oogenesis for assembly of the
Balbiani body and subsequent establishment of the animal-vegetal axis in the oocyte and
embryo (Bontems et al., 2009; Marlow and Mullins, 2008). Owing to its lack of functional
domains, it is not clear how Bucky ball mediates Balbiani body formation. However, recent
reports demonstrating the conserved interaction between Bucky ball and Rbpms2 suggest that
Buc may recruit germ plasm RNAs to the Balbiani body by physical interaction with RNA
binding proteins (Heim et al., 2014, in press; Nijjar and Woodland, 2013). Determining if
Rbpms2 is essential for oocyte polarity and germ plasm assembly awaits generation of
mutants disrupting the zebrafish rbpms2 genes. Rbpms2 interactions with Buc and RNAs that
localize to the Balbiani body, including buc RNA of zebrafish and nanos RNA of frogs,
provide evidence for a possible mechanism to recruit RNA components of the Balbiani body
(Heim et al., 2014 in press; Song et al., 2007) (Song et al., 2007). However, the region of buc
RNA that is bound by Rbpms2 is unknown, and full rescue of buc mutants requires transgenic
versions of buc with introns (Heim et al., 2014in press). Similarly, the zebrafish syntabulin
RNA localizes to the Balbiani body and syntabulin mutant phenotypes require syntabulin
transgenes containing the first intron for phenotypic rescue (Nojima et al., 2010). Such a
requirement for exon:intron structure has been well-characterized for the transcript oskar, the
Drosophila germ plasm organizer, which also requires the first intron for transgenic rescue of
the mutant phenotypes (Hachet and Ephrussi, 2001). Therefore, the exon junction complex
may have a function in directing posttranscriptional regulation (e.g. localization or
translational control of transcripts). In support of this hypothesis, several protein components
of the exon junction complex are required for oskar mRNA transport in the oocyte (Hachet
and Ephrussi, 2001; Mohr et al., 2001; Newmark and Boswell, 1994; Palacios et al., 2004).
Thus, it appears that exon-junction proteins may interact with RNA binding proteins or
translational machinery by an unknown mechanism to precisely control the timing and
location of translation.
CONCLUSION
In zebrafish, RNA binding proteins are essential to mediating the post-transcriptional
regulation of RNAs during the long period of transcriptional silence spanning from oocyte
maturation to early embryonic development. Some of the RNA binding proteins discussed
herein, including zebrafish Dead End and Nanos3, have essential zygotic (and maternal in the
case of nanos3) roles in germ cell development; however, the others are implicated based on
their localization to germ plasm or PGCs, and mutant phenotypes in other organisms.
Although RNA binding proteins are expected to be essential to the process of maternal germ
plasm-mediated PGC specification and development, very few have been functionally
assessed in zebrafish because the relevant genes remain unknown and maternal-effect mutants
have not been available. Recent advances in reverse genetics technology now make it possible
to systematically mutate and investigate the essential functions of candidate RNA binding
proteins that are compelling germ plasm regulators based on their spatiotemporal localization
or affinity for known germ plasm components. Such an approach will greatly improve our
understanding of RNA metabolism, post-transcriptional regulation, and fate determination in
the germline. Significantly, even in animals that do not use germ plasm to specify their
germline, loss of RNA binding protein genes functions areis known to result in various germ
cell defects ranging from mild meiotic phenotypes to complete sterility. Thus, understanding
the functions of RNA binding proteins within the germ plasm, which likely play conserved
roles in the gametogenesis of all animals, has important implications for the basis of fertility
and infertility in vertebrates.
ACKNOWLEDGMENTS
We would like to thank Dr. Bruce Draper for critical reading of this manuscript and his
helpful suggestions. Odelya Hartung is supported by T32-GM007288 and research on oocyte
polarity and the germ line in the Marlow lab is supported by NIHRO1GM089979 and start-up
funds to FLM.
REFERENCES
Abrams, E. W. & Mullins, M. C. 2009. "Early zebrafish development: it's in the maternal
genes". Curr. Opin. Genet. Dev., 19, 396-403.
Alphey, L.; Jimenez, J.; White-Cooper, H.; Dawson, I.; Nurse, P. & Glover, D. M. 1992.
"twine, a cdc25 homolog that functions in the male and female germline of Drosophila".
Cell, 69, 977-88.
Anantharaman, V.; Zhang, D. & Aravind, L. 2010. "OST-HTH: a novel predicted RNA-
binding domain". Biol. Direct., 5, 13.
Aravin, A.; Gaidatzis, D.; Pfeffer, S.; Lagos-Quintana, M.; Landgraf, P.; Iovino, N.; Morris,
P.; Brownstein, M. J.; Kuramochi-Miyagawa, S.; Nakano, T.; Chien, M.; Russo, J. J.; Ju,
J.; Sheridan, R.; Sander, C.; Zavolan, M. & Tuschl, T. 2006. "A novel class of small
RNAs bind to MILI protein in mouse testes". Nature, 442, 203-7.
Arkov, A. L.; Wang, J. Y.; Ramos, A. & Lehmann, R. 2006. "The role of Tudor domains in
germline development and polar granule architecture". Development, 133, 4053-62.
Banisch, T. U.; Goudarzi, M. & Raz, E. 2012. "Small RNAs in germ cell development". Curr.
Top Dev. Biol., 99, 79-113.
Bazzini, A. A.; Lee, M. T. & Giraldez, A. J. 2012. "Ribosome profiling shows that miR-430
reduces translation before causing mRNA decay in zebrafish". Science, 336, 233-7.
Beer, R. L. & Draper, B. W. 2013. "nanos3 maintains germline stem cells and expression of
the conserved germline stem cell gene nanos2 in the zebrafish ovary". Dev. Biol., 374,
308-18.
Bhat, K. M. 1999. "The posterior determinant gene nanos is required for the maintenance of
the adult germline stem cells during Drosophila oogenesis". Genetics, 151, 1479-92.
Bhattacharya, C.; Aggarwal, S.; Zhu, R.; Kumar, M.; Zhao, M.; Meistrich, M. L. & Matin, A.
2007. "The mouse dead-end gene isoform alpha is necessary for germ cell and embryonic
viability". Biochem. Biophys. Res. Commun., 355, 194-9.
Bontems, F.; Stein, A.; Marlow, F.; Lyautey, J.; Gupta, T.; Mullins, M. C. & Dosch, R. 2009.
"Bucky ball organizes germ plasm assembly in zebrafish". Curr. Biol., 19, 414-22.
Boswell, R. E. & Mahowald, A. P. 1985. "tudor, a gene required for assembly of the germ
plasm in Drosophila melanogaster". Cell, 43, 97-104.
Braat, A. K.; Van De Water, S.; Goos, H.; Bogerd, J. & Zivkovic, D. 2000. "Vasa protein
expression and localization in the zebrafish". Mech. Dev., 95, 271-4.
Braat, A. K.; Van De Water, S.; Korving, J. & Zivkovic, D. 2001. "A zebrafish vasa
morphant abolishes vasa protein but does not affect the establishment of the germline".
Genesis, 30, 183-5.
Braat, A. K.; Zandbergen, T.; Van De Water, S.; Goos, H. J. & Zivkovic, D. 1999.
"Characterization of zebrafish primordial germ cells: morphology and early distribution
of vasa RNA". Dev. Dyn., 216, 153-67.
Brower-Toland, B.; Findley, S. D.; Jiang, L.; Liu, L.; Yin, H.; Dus, M.; Zhou, P.; Elgin, S. C.
& Lin, H. 2007. "Drosophila PIWI associates with chromatin and interacts directly with
HP1a". Genes. Dev., 21, 2300-11.
Burd, C. G. & Dreyfuss, G. 1994. "Conserved structures and diversity of functions of RNA-
binding proteins". Science, 265, 615-21.
Carmell, M. A.; Girard, A.; Van De Kant, H. J.; Bourc'his, D.; Bestor, T. H.; De Rooij, D. G.
& Hannon, G. J. 2007. "MIWI2 is essential for spermatogenesis and repression of
transposons in the mouse male germline". Dev. Cell, 12, 503-14.
Castrillon, D. H.; Quade, B. J.; Wang, T. Y.; Quigley, C. & Crum, C. P. 2000. "The human
VASA gene is specifically expressed in the germ cell lineage". Proc. Natl. Acad. Sci. U S
A, 97, 9585-90.
Chen, P. Y.; Manninga, H.; Slanchev, K.; Chien, M.; Russo, J. J.; Ju, J.; Sheridan, R.; John,
B.; Marks, D. S.; Gaidatzis, D.; Sander, C.; Zavolan, M. & Tuschl, T. 2005. "The
developmental miRNA profiles of zebrafish as determined by small RNA cloning".
Genes. Dev., 19, 1288-93.
Chi, M. N.; Auriol, J.; Jegou, B.; Kontoyiannis, D. L.; Turner, J. M.; De Rooij, D. G. &
Morello, D. 2011. "The RNA-binding protein ELAVL1/HuR is essential for mouse
spermatogenesis, acting both at meiotic and postmeiotic stages". Mol. Biol. Cell, 22,
2875-85.
Chuma, S.; Hosokawa, M.; Kitamura, K.; Kasai, S.; Fujioka, M.; Hiyoshi, M.; Takamune, K.;
Noce, T. & Nakatsuji, N. 2006. "Tdrd1/Mtr-1, a tudor-related gene, is essential for male
germ-cell differentiation and nuage/germinal granule formation in mice". Proc. Natl.
Acad. Sci. U S A, 103, 15894-9.
Ciruna, B.; Weidinger, G.; Knaut, H.; Thisse, B.; Thisse, C.; Raz, E. & Schier, A. F. 2002.
"Production of maternal-zygotic mutant zebrafish by germ-line replacement". Proc. Natl.
Acad. Sci. U S A, 99, 14919-24.
Cook, M. S.; Munger, S. C.; Nadeau, J. H. & Capel, B. 2011. "Regulation of male germ cell
cycle arrest and differentiation by DND1 is modulated by genetic background".
Development, 138, 23-32.
Courtot, C.; Fankhauser, C.; Simanis, V. & Lehner, C. F. 1992. "The Drosophila cdc25
homolog twine is required for meiosis". Development, 116, 405-16.
Curtis, D.; Treiber, D. K.; Tao, F.; Zamore, P. D.; Williamson, J. R. & Lehmann, R. 1997. "A
CCHC metal-binding domain in Nanos is essential for translational regulation". EMBO
J., 16, 834-43.
De La Fuente, R.; Viveiros, M. M.; Wigglesworth, K. & Eppig, J. J. 2004. "ATRX, a member
of the SNF2 family of helicase/ATPases, is required for chromosome alignment and
meiotic spindle organization in metaphase II stage mouse oocytes". Dev. Biol., 272, 1-14.
Deng, W. & Lin, H. 2002. "miwi, a murine homolog of piwi, encodes a cytoplasmic protein
essential for spermatogenesis". Dev. Cell, 2, 819-30.
Ding, X.; Guan, H. & Li, H. 2013. "Characterization of a piRNA binding protein Miwi in
mouse oocytes". Theriogenology, 79, 610-5 e1.
Doitsidou, M.; Reichman-Fried, M.; Stebler, J.; Koprunner, M.; Dorries, J.; Meyer, D.;
Esguerra, C. V.; Leung, T. & Raz, E. 2002. "Guidance of primordial germ cell migration
by the chemokine SDF-1". Cell, 111, 647-59.
Dosch, R.; Wagner, D. S.; Mintzer, K. A.; Runke, G.; Wiemelt, A. P. & Mullins, M. C. 2004.
"Maternal control of vertebrate development before the midblastula transition: mutants
from the zebrafish I". Dev. Cell, 6, 771-80.
Dranow, D. B.; Tucker, R. P. & Draper, B. W. 2013. "Germ cells are required to maintain a
stable sexual phenotype in adult zebrafish". Dev. Biol, 376, 43-50.
Draper, B. W. 2012. "Identification of oocyte progenitor cells in the zebrafish ovary".
Methods Mol. Biol., 916, 157-65.
Draper, B. W.; McCcallum, C. M. & Moens, C. B. 2007. "nanos1 is required to maintain
oocyte production in adult zebrafish". Dev. Biol., 305, 589-98.
Eberhart, C. G.; Maines, J. Z. & Wasserman, S. A. 1996. "Meiotic cell cycle requirement for
a fly homologue of human Deleted in Azoospermia". Nature, 381, 783-5.
Eddy, E. M. 1975. "Germ plasm and the differentiation of the germ cell line". Int. Rev. Cytol.,
43, 229-80.
Elliot, D. L., Michael 2011. The RNA-binding proteins. Molecular Biology of RNA, First
Edition. Oxford, England: Oxford University Press.
Eno, C. &a. Pelegri., F. 2013. "Gradual recruitment and selective clearing generate germ
plasm aggregates in the zebrafish embryo". BioArchitecture, 3, 1-6.
Fabritius, A. S.; Ellefson, M. L. & Mcnally, F. J. 2011. "Nuclear and spindle positioning
during oocyte meiosis". Curr. Opin. Cell. Biol., 23, 78-84.
Forbes, A. & Lehmann, R. 1998. "Nanos and Pumilio have critical roles in the development
and function of Drosophila germline stem cells". Development, 125, 679-90.
Fuentes, R. & Fernandez, J. 2010. "Ooplasmic segregation in the zebrafish zygote and early
embryo: pattern of ooplasmic movements and transport pathways". Dev. Dyn., 239, 2172-
89.
Fujiwara, T.; Dunn, N. R. & Hogan, B. L. 2001. "Bone morphogenetic protein 4 in the
extraembryonic mesoderm is required for allantois development and the localization and
survival of primordial germ cells in the mouse". Proc. Natl. Acad. Sci. U S A, 98, 13739-
44.
Giraldez, A. J. 2010. "microRNAs, the cell's Nepenthe: clearing the past during the maternal-
to-zygotic transition and cellular reprogramming". Curr. Opin. Genet. Dev., 20, 369-75.
Giraldez, A. J.; Cinalli, R. M.; Glasner, M. E.; Enright, A. J.; Thomson, J. M.; Baskerville, S.;
Hammond, S. M.; Bartel, D. P. & Schier, A. F. 2005. "MicroRNAs regulate brain
morphogenesis in zebrafish". Science, 308, 833-8.
Giraldez, A. J.; Mishima, Y.; Rihel, J.; Grocock, R. J.; Van Dongen, S.; Inoue, K.; Enright, A.
J. & Schier, A. F. 2006. "Zebrafish MiR-430 promotes deadenylation and clearance of
maternal mRNAs". Science, 312, 75-9.
Glisovic, T.; Bachorik, J. L.; Yong, J. & Dreyfuss, G. 2008. "RNA-binding proteins and post-
transcriptional gene regulation". FEBS Lett, 582, 1977-86.
Good, P. J. 1995. "A conserved family of elav-like genes in vertebrates". Proc. Natl. Acad.
Sci. U S A, 92, 4557-61.
Gupta, T.; Marlow, F. L.; Ferriola, D.; Mackiewicz, K.; Dapprich, J.; Monos, D. & Mullins,
M. C. 2010. "Microtubule actin crosslinking factor 1 regulates the Balbiani body and
animal-vegetal polarity of the zebrafish oocyte". PLoS Genet., 6, e1001073.
Gustafson, E. A. & Wessel, G. M. 2010. "Vasa genes: emerging roles in the germ line and in
multipotent cells". Bioessays, 32, 626-37.
Hachet, O. & Ephrussi, A. 2001. "Drosophila Y14 shuttles to the posterior of the oocyte and
is required for oskar mRNA transport". Curr. Biol., 11, 1666-74.
Handa, N.; Nureki, O.; Kurimoto, K.; Kim, I.; Sakamoto, H.; Shimura, Y.; Muto, Y. &
Yokoyama, S. 1999. "Structural basis for recognition of the tra mRNA precursor by the
Sex-lethal protein". Nature, 398, 579-85.
Haraguchi, S.; Tsuda, M.; Kitajima, S.; Sasaoka, Y.; Nomura-Kitabayashid, A.; Kurokawa,
K. & Saga, Y. 2003. "nanos1: a mouse nanos gene expressed in the central nervous
system is dispensable for normal development". Mech. Dev., 120, 721-31.
Hashimoto, H.; Hara, K.; Hishiki, A.; Kawaguchi, S.; Shichijo, N.; Nakamura, K.; Unzai, S.;
Tamaru, Y.; Shimizu, T. & Sato, M. 2010. "Crystal structure of zinc-finger domain of
Nanos and its functional implications". EMBO Rep., 11, 848-53.
Hashimoto, Y.; Maegawa, S.; Nagai, T.; Yamaha, E.; Suzuki, H.; Yasuda, K. & Inoue, K.
2004. "Localized maternal factors are required for zebrafish germ cell formation". Dev.
Biol., 268, 152-61.
Heim, A. E. H., O.; Rothhamel, S.; Ferreira, E.; Jenny, A. And Marlow, F.L. 2014in press.
"Oocyte polarity requires a Bucky ball dependent feedback amplification loop".
Development. 141, 842-54.
Hertig, A. T. & Adams, E. C. 1967. "Studies on the human oocyte and its follicle. I.
Ultrastructural and histochemical observations on the primordial follicle stage". J. Cell
Biol., 34, 647-75.
Horvay, K.; Claussen, M.; Katzer, M.; Landgrebe, J. & Pieler, T. 2006. "Xenopus Dead end
mRNA is a localized maternal determinant that serves a conserved function in germ cell
development". Dev. Biol., 291, 1-11.
Houston, D. W. & King, M. L. 2000. "A critical role for Xdazl, a germ plasm-localized RNA,
in the differentiation of primordial germ cells in Xenopus". Development, 127, 447-56.
Houwing, S.; Berezikov, E. & Ketting, R. F. 2008. "Zili is required for germ cell
differentiation and meiosis in zebrafish". EMBO J, 27, 2702-11.
Houwing, S.; Kamminga, L. M.; Berezikov, E.; Cronembold, D.; Girard, A.; Van Den Elst,
H.; Filippov, D. V.; Blaser, H.; Raz, E.; Moens, C. B.; Plasterk, R. H.; Hannon, G. J.;
Draper, B. W. & Ketting, R. F. 2007. "A role for Piwi and piRNAs in germ cell
maintenance and transposon silencing in Zebrafish". Cell, 129, 69-82.
Huang, H. Y.; Houwing, S.; Kaaij, L. J.; Meppelink, A.; Redl, S.; Gauci, S.; Vos, H.; Draper,
B. W.; Moens, C. B.; Burgering, B. M.; Ladurner, P.; Krijgsveld, J.; Berezikov, E. &
Ketting, R. F. 2011. "Tdrd1 acts as a molecular scaffold for Piwi proteins and piRNA
targets in zebrafish". EMBO J., 30, 3298-308.
Huntzinger, E. & Izaurralde, E. 2011. "Gene silencing by microRNAs: contributions of
translational repression and mRNA decay". Nat. Rev. Genet., 12, 99-110.
Ikenishi, K. 1987. "Functional gametes derived from explants of single blastomeres
containing the "germ plasm" in Xenopus laevis: a genetic marker study". Dev. Biol., 122,
35-8.
Illmensee, K. & Mahowald, A. P. 1974. "Transplantation of posterior polar plasm in
Drosophila. Induction of germ cells at the anterior pole of the egg". Proc. Natl. Acad. Sci.
U S A, 71, 1016-20.
Illmensee, K. & Mahowald, A. P. 1976. "The autonomous function of germ plasm in a
somatic region of the Drosophila egg". Exp. Cell Res., 97, 127-40.
Irish, V.; Lehmann, R. & Akam, M. 1989. "The Drosophila posterior-group gene nanos
functions by repressing hunchback activity". Nature, 338, 646-8.
Johnson, J.; Canning, J.; Kaneko, T.; Pru, J. K. & Tilly, J. L. 2004. "Germline stem cells and
follicular renewal in the postnatal mammalian ovary". Nature, 428, 145-50.
Johnstone, O.; Deuring, R.; Bock, R.; Linder, P.; Fuller, M. T. & Lasko, P. 2005. "Belle is a
Drosophila DEAD-box protein required for viability and in the germ line". Dev. Biol.,
277, 92-101.
Johnstone, O. & Lasko, P. 2004. "Interaction with eIF5B is essential for Vasa function during
development". Development, 131, 4167-78.
Jongens, T. A.; Hay, B.; Jan, L. Y. & Jan, Y. N. 1992. "The germ cell-less gene product: a
posteriorly localized component necessary for germ cell development in Drosophila".
Cell, 70, 569-84.
Julaton, V. T. & Reijo Pera, R. A. 2011. "NANOS3 function in human germ cell
development". Hum. Mol. Genet., 20, 2238-50.
Kadyrova, L. Y.; Habara, Y.; Lee, T. H. & Wharton, R. P. 2007. "Translational control of
maternal Cyclin B mRNA by Nanos in the Drosophila germline". Development, 134,
1519-27.
Karashima, T.; Sugimoto, A. & Yamamoto, M. 2000. "Caenorhabditis elegans homologue of
the human azoospermia factor DAZ is required for oogenesis but not for
spermatogenesis". Development, 127, 1069-79.
Kedde, M.; Strasser, M. J.; Boldajipour, B.; Oude Vrielink, J. A.; Slanchev, K.; Le Sage, C.;
Nagel, R.; Voorhoeve, P. M.; Van Duijse, J.; Orom, U. A.; Lund, A. H.; Perrakis, A.;
Raz, E. & Agami, R. 2007. "RNA-binding protein Dnd1 inhibits microRNA access to
target mRNA". Cell, 131, 1273-86.
Kee, K.; Angeles, V. T.; Flores, M.; Nguyen, H. N. & Reijo Pera, R. A. 2009. "Human
DAZL, DAZ and BOULE genes modulate primordial germ-cell and haploid gamete
formation". Nature, 462, 222-5.
Keene, J. D. 2001. "Ribonucleoprotein infrastructure regulating the flow of genetic
information between the genome and the proteome". Proc. Natl. Acad. Sci. U S A, 98,
7018-24.
Kelly, C.; Chin, A. J.; Leatherman, J. L.; Kozlowski, D. J. & Weinberg, E. S. 2000.
"Maternally controlled (beta)-catenin-mediated signaling is required for organizer
formation in the zebrafish". Development, 127, 3899-911.
Kim-Ha, J.; Kim, J. & Kim, Y. J. 1999. "Requirement of RBP9, a Drosophila Hu homolog,
for regulation of cystocyte differentiation and oocyte determination during oogenesis".
Mol. Cell Biol., 19, 2505-14.
Kloc, M.; Bilinski, S. & Etkin, L. D. 2004. "The Balbiani body and germ cell determinants:
150 years later". Curr. Top Dev. Biol., 59, 1-36.
Kloc, M.; Dougherty, M. T.; Bilinski, S.; Chan, A. P.; Brey, E.; King, M. L.; Patrick, C. W.,
Jr. & Etkin, L. D. 2002. "Three-dimensional ultrastructural analysis of RNA distribution
within germinal granules of Xenopus". Dev. Biol., 241, 79-93.
Kloc, M. & Etkin, L. D. 1995. "Two distinct pathways for the localization of RNAs at the
vegetal cortex in Xenopus oocytes". Development, 121, 287-97.
Knaut, H.; Pelegri, F.; Bohmann, K.; Schwarz, H. & Nusslein-Volhard, C. 2000. "Zebrafish
vasa RNA but not its protein is a component of the germ plasm and segregates
asymmetrically before germline specification". J. Cell Biol., 149, 875-88.
Knaut, H.; Werz, C.; Geisler, R.; Nusslein-Volhard, C. & Tubingen Screen, C. 2003. "A
zebrafish homologue of the chemokine receptor Cxcr4 is a germ-cell guidance receptor".
Nature, 421, 279-82.
Kobayashi, S. & Okada, M. 1989. "Restoration of pole-cell-forming ability to u.v.-irradiated
Drosophila embryos by injection of mitochondrial lrRNA". Development, 107, 733-42.
Kobayashi, S.; Yamada, M.; Asaoka, M. & Kitamura, T. 1996. "Essential role of the posterior
morphogen nanos for germline development in Drosophila". Nature, 380, 708-11.
Koebernick, K.; Loeber, J.; Arthur, P. K.; Tarbashevich, K. & Pieler, T. 2010. "Elr-type
proteins protect Xenopus Dead end mRNA from miR-18-mediated clearance in the
soma". Proc. Natl. Acad. Sci. U S A, 107, 16148-53.
Koprunner, M.; Thisse, C.; Thisse, B. & Raz, E. 2001. "A zebrafish nanos-related gene is
essential for the development of primordial germ cells". Genes. Dev., 15, 2877-85.
Kosaka, K.; Kawakami, K.; Sakamoto, H. & Inoue, K. 2007. "Spatiotemporal localization of
germ plasm RNAs during zebrafish oogenesis". Mech Dev, 124, 279-89.
Krol, J.; Loedige, I. & Filipowicz, W. 2010. "The widespread regulation of microRNA
biogenesis, function and decay". Nat. Rev. Genet., 11, 597-610.
Kuramochi-Miyagawa, S.; Kimura, T.; Ijiri, T. W.; Isobe, T.; Asada, N.; Fujita, Y.; Ikawa,
M.; Iwai, N.; Okabe, M.; Deng, W.; Lin, H.; Matsuda, Y. & Nakano, T. 2004. "Mili, a
mammalian member of piwi family gene, is essential for spermatogenesis". Development,
131, 839-49.
Kuramochi-Miyagawa, S.; Kimura, T.; Yomogida, K.; Kuroiwa, A.; Tadokoro, Y.; Fujita, Y.;
Sato, M.; Matsuda, Y. & Nakano, T. 2001. "Two mouse piwi-related genes: miwi and
mili". Mech. Dev., 108, 121-33.
Kuramochi-Miyagawa, S.; Watanabe, T.; Gotoh, K.; Takamatsu, K.; Chuma, S.; Kojima-Kita,
K.; Shiromoto, Y.; Asada, N.; Toyoda, A.; Fujiyama, A.; Totoki, Y.; Shibata, T.; Kimura,
T.; Nakatsuji, N.; Noce, T.; Sasaki, H. & Nakano, T. 2010. "MVH in piRNA processing
and gene silencing of retrotransposons". Genes. Dev., 24, 887-92.
Kuramochi-Miyagawa, S.; Watanabe, T.; Gotoh, K.; Totoki, Y.; Toyoda, A.; Ikawa, M.;
Asada, N.; Kojima, K.; Yamaguchi, Y.; Ijiri, T. W.; Hata, K.; Li, E.; Matsuda, Y.;
Kimura, T.; Okabe, M.; Sakaki, Y.; Sasaki, H. & Nakano, T. 2008. "DNA methylation of
retrotransposon genes is regulated by Piwi family members MILI and MIWI2 in murine
fetal testes". Genes. Dev., 22, 908-17.
Lasko, P. F. & Ashburner, M. 1988. "The product of the Drosophila gene vasa is very similar
to eukaryotic initiation factor-4A". Nature, 335, 611-7.
Lawson, K. A.; Dunn, N. R.; Roelen, B. A.; Zeinstra, L. M.; Davis, A. M.; Wright, C. V.;
Korving, J. P. & Hogan, B. L. 1999. "Bmp4 is required for the generation of primordial
germ cells in the mouse embryo". Genes. Dev., 13, 424-36.
Lee, H. C.; Gu, W.; Shirayama, M.; Youngman, E.; Conte, D., Jr. & Mello, C. C. 2012. "C.
elegans piRNAs mediate the genome-wide surveillance of germline transcripts". Cell,
150, 78-87.
Leung, C. F.; Webb, S. E. & Miller, A. L. 2000. "On the mechanism of ooplasmic segregation
in single-cell zebrafish embryos". Dev. Growth Differ., 42, 29-40.
Lim, A. K.; Lorthongpanich, C.; Chew, T. G.; Tan, C. W.; Shue, Y. T.; Balu, S.; Gounko, N.;
Kuramochi-Miyagawa, S.; Matzuk, M. M.; Chuma, S.; Messerschmidt, D. M.; Solter, D.
& Knowles, B. B. 2013. "The nuage mediates retrotransposon silencing in mouse
primordial ovarian follicles". Development, 140, 3819-25.
Lin, H. & Spradling, A. C. 1997. "A novel group of pumilio mutations affects the asymmetric
division of germline stem cells in the Drosophila ovary". Development, 124, 2463-76.
Lin, S.; Long, W.; Chen, J. & Hopkins, N. 1992. "Production of germ-line chimeras in
zebrafish by cell transplants from genetically pigmented to albino embryos". Proc. Natl.
Acad. Sci. U S A, 89, 4519-23.
Lingel, A. & Sattler, M. 2005. "Novel modes of protein-RNA recognition in the RNAi
pathway". Curr. Opin. Struct. Biol., 15, 107-15.
Liu, L.; Hong, N.; Xu, H.; Li, M.; Yan, Y.; Purwanti, Y.; Yi, M.; Li, Z.; Wang, L. & Hong,
Y. 2009a. "Medaka dead end encodes a cytoplasmic protein and identifies embryonic and
adult germ cells". Gene. Expr. Patterns, 9, 541-8.
Liu, N.; Han, H. & Lasko, P. 2009b. "Vasa promotes Drosophila germline stem cell
differentiation by activating mei-P26 translation by directly interacting with a (U)-rich
motif in its 3' UTR". Genes. Dev., 23, 2742-52.
Liu, W. & Collodi, P. 2010. "Zebrafish dead end possesses ATPase activity that is required
for primordial germ cell development". FASEB J., 24, 2641-50.
Lu, F. I.; Thisse, C. & Thisse, B. 2011. "Identification and mechanism of regulation of the
zebrafish dorsal determinant". Proc. Natl. Acad. Sci. U S A, 108, 15876-80.
Lunde, B. M.; Moore, C. & Varani, G. 2007. "RNA-binding proteins: modular design for
efficient function". Nat. Rev. Mol. Cell Biol., 8, 479-90.
Maegawa, S.; Yamashita, M.; Yasuda, K. & Inoue, K. 2002. "Zebrafish DAZ-like protein
controls translation via the sequence 'GUUC'". Genes. Cells, 7, 971-84.
Mahowald, A. P. 1962. "Fine structure of pole cells and polar granules in Drosophila
Melanogaster". J. Exp. Zool., 151, 201-215.
Maines, J. Z. & Wasserman, S. A. 1999. "Post-transcriptional regulation of the meiotic Cdc25
protein Twine by the Dazl orthologue Boule". Nat. Cell Biol., 1, 171-4.
Marinos, E. a. B., F.S. 1981. "Mitochondrial number, cytochrome oxidase and succinic
dehydrogenase activity in Xenopus laevis oocytes.". J. Embryol. Exp. Morph., 395-409.
Marlow, F. L. 2010. Maternal Control of Development in Vertebrates: My Mother Made Me
Do It! San Rafael (CA).
Marlow, F. L. & Mullins, M. C. 2008. "Bucky ball functions in Balbiani body assembly and
animal-vegetal polarity in the oocyte and follicle cell layer in zebrafish". Dev. Biol, 321,
40-50.
Megosh, H. B.; Cox, D. N.; Campbell, C. & Lin, H. 2006. "The role of PIWI and the miRNA
machinery in Drosophila germline determination". Curr. Biol., 16, 1884-94.
Mickoleit, M.; Banisch, T. U. & Raz, E. 2011. "Regulation of hub mRNA stability and
translation by miR430 and the dead end protein promotes preferential expression in
zebrafish primordial germ cells". Dev. Dyn, 240, 695-703.
Mishima, Y.; Giraldez, A. J.; Takeda, Y.; Fujiwara, T.; Sakamoto, H.; Schier, A. F. & Inoue,
K. 2006. "Differential regulation of germline mRNAs in soma and germ cells by
zebrafish miR-430". Curr. Biol., 16, 2135-42.
Mizuno, T.; Yamaha, E.; Kuroiwa, A. & Takeda, H. 1999. "Removal of vegetal yolk causes
dorsal deficencies and impairs dorsal-inducing ability of the yolk cell in zebrafish".
Mech. Dev, 81, 51-63.
Mochizuki, K.; Nishimiya-Fujisawa, C. & Fujisawa, T. 2001. "Universal occurrence of the
vasa-related genes among metazoans and their germline expression in Hydra". Dev.
Genes. Evol., 211, 299-308.
Mohr, S. E.; Dillon, S. T. & Boswell, R. E. 2001. "The RNA-binding protein Tsunagi
interacts with Mago Nashi to establish polarity and localize oskar mRNA during
Drosophila oogenesis". Genes. Dev., 15, 2886-99.
Nair, S.; Marlow, F.; Abrams, E.; Kapp, L.; Mullins, M. C. & Pelegri, F. 2013. "The
chromosomal passenger protein birc5b organizes microfilaments and germ plasm in the
zebrafish embryo". PLoS Genet., 9, e1003448.
Nakamura, S.; Kobayashi, K.; Nishimura, T.; Higashijima, S. & Tanaka, M. 2010.
"Identification of germline stem cells in the ovary of the teleost medaka". Science, 328,
1561-3.
Newmark, P. A. & Boswell, R. E. 1994. "The mago nashi locus encodes an essential product
required for germ plasm assembly in Drosophila". Development, 120, 1303-13.
Nguyen Chi, M.; Chalmel, F.; Agius, E.; Vanzo, N.; Khabar, K. S.; Jegou, B. & Morello, D.
2009. "Temporally regulated traffic of HuR and its associated ARE-containing mRNAs
from the chromatoid body to polysomes during mouse spermatogenesis". PLoS One, 4,
e4900.
Nguyen-Chi, M. & Morello, D. 2011. "RNA-binding proteins, RNA granules, and gametes: is
unity strength?". Reproduction, 142, 803-17.
Nijjar, S. & Woodland, H. R. 2013. "Protein Interactions in Xenopus Germ Plasm RNP
Particles". PLoS One, 8, e80077.
Nishida, K. M.; Saito, K.; Mori, T.; Kawamura, Y.; Nagami-Okada, T.; Inagaki, S.; Siomi, H.
& Siomi, M. C. 2007. "Gene silencing mechanisms mediated by Aubergine piRNA
complexes in Drosophila male gonad". RNA, 13, 1911-22.
Nojima, H.; Rothhamel, S.; Shimizu, T.; Kim, C. H.; Yonemura, S.; Marlow, F. L. & Hibi,
M. 2010. "Syntabulin, a motor protein linker, controls dorsal determination".
Nojima, H.; Shimizu, T.; Kim, C. H.; Yabe, T.; Bae, Y. K.; Muraoka, O.; Hirata, T.; Chitnis,
A.; Hirano, T. & Hibi, M. 2004. "Genetic evidence for involvement of maternally derived
Wnt canonical signaling in dorsal determination in zebrafish". Mech Dev, 121, 371-86.
Ober, E. A. & Schulte-Merker, S. 1999. "Signals from the yolk cell induce mesoderm,
neuroectoderm, the trunk organizer, and the notochord in zebrafish". Dev. Biol., 215,
167-81.
Pal-Bhadra, M.; Leibovitch, B. A.; Gandhi, S. G.; Chikka, M. R.; Bhadra, U.; Birchler, J. A.
& Elgin, S. C. 2004. "Heterochromatic silencing and HP1 localization in Drosophila are
dependent on the RNAi machinery". Science, 303, 669-72.
Palacios, I. M.; Gatfield, D.; St Johnston, D. & Izaurralde, E. 2004. "An eIF4AIII-containing
complex required for mRNA localization and nonsense-mediated mRNA decay". Nature,
427, 753-7.
Parker, R. & Sheth, U. 2007. "P bodies and the control of mRNA translation and
degradation". Mol Cell, 25, 635-46.
Parsyan, A.; Svitkin, Y.; Shahbazian, D.; Gkogkas, C.; Lasko, P.; Merrick, W. C. &
Sonenberg, N. 2011. "mRNA helicases: the tacticians of translational control". Nat. Rev.
Mol. Cell Biol., 12, 235-45.
Pei, W.; Noushmehr, H.; Costa, J.; Ouspenskaia, M. V.; Elkahloun, A. G. & Feldman, B.
2007. "An early requirement for maternal FoxH1 during zebrafish gastrulation". Dev.
Biol., 310, 10-22.
Pek, J. W. & Kai, T. 2011. "A role for vasa in regulating mitotic chromosome condensation in
Drosophila". Curr. Biol., 21, 39-44.
Pelegri, F.; Knaut, H.; Maischein, H. M.; Schulte-Merker, S. & Nusslein-Volhard, C. 1999.
"A mutation in the zebrafish maternal-effect gene nebel affects furrow formation and
vasa RNA localization". Curr. Biol., 9, 1431-40.
Pitt, J. N.; Schisa, J. A. & Priess, J. R. 2000. "P granules in the germ cells of Caenorhabditis
elegans adults are associated with clusters of nuclear pores and contain RNA". Dev. Biol.,
219, 315-33.
Rauch, G. J., Lyons, D.A., Middendorf, I., Friedlander, B., Arana, N., Reyes, T. And Talbot,
W.S. 2003. Submission and Curation of Gene Expression Data. ZFIN Direct Data
Submission.
Raz, E. 2000. "The function and regulation of vasa-like genes in germ-cell development".
Genome Biol, 1, REVIEWS1017.
Raz, E. 2003. "Primordial germ-cell development: the zebrafish perspective". Nat. Rev.
Genet., 4, 690-700.
Reichman-Fried, M.; Minina, S. & Raz, E. 2004. "Autonomous modes of behavior in
primordial germ cell migration". Dev. Cell, 6, 589-96.
Reijo, R.; Alagappan, R. K.; Patrizio, P. & Page, D. C. 1996. "Severe oligozoospermia
resulting from deletions of azoospermia factor gene on Y chromosome". Lancet, 347,
1290-3.
Reijo, R.; Lee, T. Y.; Salo, P.; Alagappan, R.; Brown, L. G.; Rosenberg, M.; Rozen, S.; Jaffe,
T.; Straus, D.; Hovatta, O. & Et al. 1995. "Diverse spermatogenic defects in humans
caused by Y chromosome deletions encompassing a novel RNA-binding protein gene".
Nat. Genet., 10, 383-93.
Rouget, C.; Papin, C.; Boureux, A.; Meunier, A. C.; Franco, B.; Robine, N.; Lai, E. C.;
Pelisson, A. & Simonelig, M. 2010. "Maternal mRNA deadenylation and decay by the
piRNA pathway in the early Drosophila embryo". Nature, 467, 1128-32.
Ruggiu, M.; Speed, R.; Taggart, M.; Mckay, S. J.; Kilanowski, F.; Saunders, P.; Dorin, J. &
Cooke, H. J. 1997. "The mouse Dazla gene encodes a cytoplasmic protein essential for
gametogenesis". Nature, 389, 73-7.
Sada, A.; Suzuki, A.; Suzuki, H. & Saga, Y. 2009. "The RNA-binding protein NANOS2 is
required to maintain murine spermatogonial stem cells". Science, 325, 1394-8.
Saffman, E. E. & Lasko, P. 1999. "Germline development in vertebrates and invertebrates".
Cell Mol. Life Sci., 55, 1141-63.
Saga, Y. 2008. "Mouse germ cell development during embryogenesis". Curr. Opin. Genet.
Dev., 18, 337-41.
Schier, A. F. 2007. "The maternal-zygotic transition: death and birth of RNAs". Science, 316,
406-7.
Schier, A. F. & Giraldez, A. J. 2006. "MicroRNA function and mechanism: insights from
zebra fish". Cold Spring Harb Symp Quant Biol, 71, 195-203.
Schisa, J. A.; Pitt, J. N. & Priess, J. R. 2001. "Analysis of RNA associated with P granules in
germ cells of C. elegans adults". Development, 128, 1287-98.
Schupbach, T. & Wieschaus, E. 1986. "Germline autonomy of maternal-effect mutations
altering the embryonic body pattern of Drosophila". Dev. Biol., 113, 443-8.
Schupbach, T. & Wieschaus, E. 1989. "Female sterile mutations on the second chromosome
of Drosophila melanogaster. I. Maternal effect mutations". Genetics, 121, 101-17.
Selman, K. W., R.A.; Sarka, A. &And Qi, X. 1993. "Stages of Oocyte Development in the
Zebrafish, Brachydanio rerio". Journal of Morphology, 218, 203-224.
Sengoku, T.; Nureki, O.; Nakamura, A.; Kobayashi, S. & Yokoyama, S. 2006. "Structural
basis for RNA unwinding by the DEAD-box protein Drosophila Vasa". Cell, 125, 287-
300.
Seth, M.; Shirayama, M.; Gu, W.; Ishidate, T.; Conte, D., Jr. & Mello, C. C. 2013. "The C.
elegans CSR-1 Argonaute Pathway Counteracts Epigenetic Silencing to Promote
Germline Gene Expression". Dev. Cell.
Shirayama, M.; Seth, M.; Lee, H. C.; Gu, W.; Ishidate, T.; Conte, D., Jr. & Mello, C. C. 2012.
"piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline".
Cell, 150, 65-77.
Shoji, M.; Tanaka, T.; Hosokawa, M.; Reuter, M.; Stark, A.; Kato, Y.; Kondoh, G.; Okawa,
K.; Chujo, T.; Suzuki, T.; Hata, K.; Martin, S. L.; Noce, T.; Kuramochi-Miyagawa, S.;
Nakano, T.; Sasaki, H.; Pillai, R. S.; Nakatsuji, N. & Chuma, S. 2009. "The TDRD9-
MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse
male germline". Dev. Cell, 17, 775-87.
Siegfried, K. R. & Nusslein-Volhard, C. 2008. "Germ line control of female sex
determination in zebrafish". Dev. Biol., 324, 277-87.
Slanchev, K.; Stebler, J.; De La Cueva-Mendez, G. & Raz, E. 2005. "Development without
germ cells: the role of the germ line in zebrafish sex differentiation". Proc. Natl. Acad.
Sci. USA, 102, 4074-9.
Slanchev, K.; Stebler, J.; Goudarzi, M.; Cojocaru, V.; Weidinger, G. & Raz, E. 2009.
"Control of Dead end localization and activity--implications for the function of the
protein in antagonizing miRNA function". Mech. Dev., 126, 270-7.
Solnica-Krezel, L. & Driever, W. 1994. "Microtubule arrays of the zebrafish yolk cell:
organization and function during epiboly". Development, 120, 2443-55.
Song, H. W.; Cauffman, K.; Chan, A. P.; Zhou, Y.; King, M. L.; Etkin, L. D. & Kloc, M.
2007. "Hermes RNA-binding protein targets RNAs-encoding proteins involved in
meiotic maturation, early cleavage, and germline development". Differentiation, 75,
519-28.
Soni, K.; Choudhary, A.; Patowary, A.; Singh, A. R.; Bhatia, S.; Sivasubbu, S.;
Chandrasekaran, S. & Pillai, B. 2013. "miR-34 is maternally inherited in Drosophila
melanogaster and Danio rerio". Nucleic Acids Res, 41, 4470-80.
Strasser, M. J.; Mackenzie, N. C.; Dumstrei, K.; Nakkrasae, L. I.; Stebler, J. & Raz, E. 2008.
"Control over the morphology and segregation of Zebrafish germ cell granules during
embryonic development". BMC Dev. Biol., 8, 58.
Suzuki, A.; Igarashi, K.; Aisaki, K.; Kanno, J. & Saga, Y. 2010. "NANOS2 interacts with the
CCR4-NOT deadenylation complex and leads to suppression of specific RNAs". Proc.
Natl. Acad. Sci. U S A, 107, 3594-9.
Takahashi, H. 1977. "Juvenile hermaphroditism in the zebrafish Brachydanio rerio". Bulletin
of the Faculty of Fisheries Hokkaido University, 28, 57-65.
Takeda, Y.; Mishima, Y.; Fujiwara, T.; Sakamoto, H. & Inoue, K. 2009. "DAZL relieves
miRNA-mediated repression of germline mRNAs by controlling poly(A) tail length in
zebrafish". PLoS One, 4, e7513.
Tanaka, S. S.; Toyooka, Y.; Akasu, R.; Katoh-Fukui, Y.; Nakahara, Y.; Suzuki, R.;
Yokoyama, M. & Noce, T. 2000. "The mouse homolog of Drosophila Vasa is required
for the development of male germ cells". Genes Dev, 14, 841-53.
Tautz, D. 1988. "Regulation of the Drosophila segmentation gene hunchback by two maternal
morphogenetic centres". Nature, 332, 281-4.
Thatcher, E. J.; Flynt, A. S.; Li, N.; Patton, J. R. & Patton, J. G. 2007. "MiRNA expression
analysis during normal zebrafish development and following inhibition of the Hedgehog
and Notch signaling pathways". Dev. Dyn., 236, 2172-80.
Theunissen, O.; Rudt, F.; Guddat, U.; Mentzel, H. & Pieler, T. 1992. "RNA and DNA binding
zinc fingers in Xenopus TFIIIA". Cell, 71, 679-90.
Theusch, E. V.; Brown, K. J. & Pelegri, F. 2006. "Separate pathways of RNA recruitment
lead to the compartmentalization of the zebrafish germ plasm". Dev. Biol., 292, 129-41.
Thisse, B., Thisse, C. 2004. Fast Release Clones: A High Throughput Expression Analysis.
ZFIN Direct Data Submission.
Tsuda, M.; Sasaoka, Y.; Kiso, M.; Abe, K.; Haraguchi, S.; Kobayashi, S. & Saga, Y. 2003.
"Conserved role of nanos proteins in germ cell development". Science, 301, 1239-41.
Tsui, S.; Dai, T.; Roettger, S.; Schempp, W.; Salido, E. C. & Yen, P. H. 2000a. "Identification
of two novel proteins that interact with germ-cell-specific RNA-binding proteins DAZ
and DAZL1". Genomics, 65, 266-73.
Tsui, S.; Dai, T.; Warren, S. T.; Salido, E. C. & Yen, P. H. 2000b. "Association of the mouse
infertility factor DAZL1 with actively translating polyribosomes". Biol. Reprod., 62,
1655-60.
Uchida, D.; Yamashita, M.; Kitano, T. & Iguchi, T. 2002. "Oocyte apoptosis during the
transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish".
J. Exp. Biol., 205, 711-8.
Updike, D. & Strome, S. 2010. "P granule assembly and function in Caenorhabditis elegans
germ cells". J. Androl., 31, 53-60.
Vagin, V. V.; Hannon, G. J. & Aravin, A. A. 2009. "Arginine methylation as a molecular
signature of the Piwi small RNA pathway". Cell Cycle, 8, 4003-4.
Von Wittich, W. H. 1845. Observationes quaedam de aranearum ex ovo evolutione, Halle,
Germany.
Walker, C. & Streisinger, G. 1983. "Induction of Mutations by gamma-Rays in Pregonial
Germ Cells of Zebrafish Embryos". Genetics, 103, 125-36.
Wang, C. & Lehmann, R. 1991. "Nanos is the localized posterior determinant in Drosophila".
Cell, 66, 637-47.
Weaver, C. & Kimelman, D. 2004. "Move it or lose it: axis specification in Xenopus".
Wedeles, C. J.; Wu, M. Z. & Claycomb, J. M. 2013. "Protection of Germline Gene
Expression by the C. elegans Argonaute CSR-1". Dev. Cell.
Wei, C.; Salichos, L.; Wittgrove, C. M.; Rokas, A. & Patton, J. G. 2012. "Transcriptome-wide
analysis of small RNA expression in early zebrafish development". RNA, 18, 915-29.
Weidinger, G.; Stebler, J.; Slanchev, K.; Dumstrei, K.; Wise, C.; Lovell-Badge, R.; Thisse,
C.; Thisse, B. & Raz, E. 2003. "dead end, a novel vertebrate germ plasm component, is
required for zebrafish primordial germ cell migration and survival". Curr. Biol, 13, 1429-
34.
Weidinger, G.; Wolke, U.; Koprunner, M.; Klinger, M. & Raz, E. 1999. "Identification of
tissues and patterning events required for distinct steps in early migration of zebrafish
primordial germ cells". Development, 126, 5295-307.
West, J. A.; Viswanathan, S. R.; Yabuuchi, A.; Cunniff, K.; Takeuchi, A.; Park, I. H.; Sero, J.
E.; Zhu, H.; Perez-Atayde, A.; Frazier, A. L.; Surani, M. A. & Daley, G. Q. 2009. "A role
for Lin28 in primordial germ-cell development and germ-cell malignancy". Nature, 460,
909-13.
Wienholds, E.; Kloosterman, W. P.; Miska, E.; Alvarez-Saavedra, E.; Berezikov, E.; De
Bruijn, E.; Horvitz, H. R.; Kauppinen, S. & Plasterk, R. H. 2005. "MicroRNA expression
in zebrafish embryonic development". Science, 309, 310-1.
Wienholds, E.; Koudijs, M. J.; Van Eeden, F. J.; Cuppen, E. & Plasterk, R. H. 2003. "The
microRNA-producing enzyme Dicer1 is essential for zebrafish development". Nat.
Genet., 35, 217-8.
Winter, J.; Jung, S.; Keller, S.; Gregory, R. I. & Diederichs, S. 2009. "Many roads to
maturity: microRNA biogenesis pathways and their regulation". Nat. Cell Biol., 11, 228-
34.
Wiszniak, S. E.; Dredge, B. K. & Jensen, K. B. 2011. "HuB (elavl2) mRNA is restricted to
the germ cells by post-transcriptional mechanisms including stabilisation of the message
by DAZL". PLoS One, 6, e20773.
Xu, E. Y.; Moore, F. L. & Pera, R. A. 2001. "A gene family required for human germ cell
development evolved from an ancient meiotic gene conserved in metazoans". Proc. Natl.
Acad. Sci. U S A, 98, 7414-9.
Xu, H.; Li, Z.; Li, M.; Wang, L. & Hong, Y. 2009. "Boule is present in fish and bisexually
expressed in adult and embryonic germ cells of medaka". PLoS One, 4, e6097.
Ying, Y.; Qi, X. & Zhao, G. Q. 2002. "Induction of primordial germ cells from pluripotent
epiblast". ScientificWorldJournal, 2, 801-10.
Yisraeli, J. K.; Sokol, S. & Melton, D. A. 1990. "A two-step model for the localization of
maternal mRNA in Xenopus oocytes: involvement of microtubules and microfilaments in
the translocation and anchoring of Vg1 mRNA". Development, 108, 289-98.
Yoon, C.; Kawakami, K. & Hopkins, N. 1997. "Zebrafish vasa homologue RNA is localized
to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial
germ cells". Development, 124, 3157-65.
Youngren, K. K.; Coveney, D.; Peng, X.; Bhattacharya, C.; Schmidt, L. S.; Nickerson, M. L.;
Lamb, B. T.; Deng, J. M.; Behringer, R. R.; Capel, B.; Rubin, E. M.; Nadeau, J. H. &
Matin, A. 2005. "The Ter mutation in the dead end gene causes germ cell loss and
testicular germ cell tumours". Nature, 435, 360-4.
Yu, Y. H.; Lin, Y. W.; Yu, J. F.; Schempp, W. & Yen, P. H. 2008. "Evolution of the DAZ
gene and the AZFc region on primate Y chromosomes". BMC Evol. Biol., 8, 96.
Zamore, P. D. & Haley, B. 2005. "Ribo-gnome: the big world of small RNAs". Science, 309,
1519-24.
Zhao, G. Q. & Garbers, D. L. 2002. "Male germ cell specification and differentiation". Dev.
Cell, 2, 537-47.
Chapter 5
ZEBRAFISH AS A MODEL
FOR REPRODUCTIVE BIOLOGY
AND ENVIRONMENTAL SCREENING
Toshinobu Tokumoto
Integrated Bioscience Section, Graduate School of Science and Technology,
National University Corporation Shizuoka University,
Suruga-ku, Shizuoka, Japan
ABSTRACT
Although Zebrafish have been used mainly as a model animal for vertebrate
development, it is also good model for reproduction. In zebrafish, full-grown oocytes
which can be induced to undergo oocyte maturation by maturation-inducing hormone
(MIH) are collectable in all seasons. In vitro assays using oocytes dissected from ovaries
have shown that some endocrine disruptors (EDCs) induce or inhibit this biological
process. Recently in vivo assays using living fish have demonstrated that externally
applied EDCs, as well as natural occurring steroid hormones, could induce or prevent
oocyte maturation and ovulation. An ovarian fluorescent and transparent transgenic
zebrafish line TG (β-actin:EGFP);roy-/- was established; the effects of EDCs can be
monitored in living fish using this line. The in vivo assay may provide a new system for
discovering genes essential for ovulation and other aspects of reproductive biology.
In this chapter, we introduce zebrafish as an experimental model for analyzing the
basic molecular mechanisms of oocyte maturation and ovulation and evaluation of the
various effects of EDCs on reproduction in this species.
Keywords: Oocyte maturation, ovulation, EDCs, in vivo assay, transparent transgenic line

Tel. No. 81-54-238-4778. Fax No. 81-54-238-4778. e-mail: sbttoku@ipc.shizuoka.ac.jp.
108 Toshinobu Tokumoto
INTRODUCTION
Oocyte development in fish is divided into the phases of oocyte growth and oocyte
maturation. Vitellogenesis plays an important role in oocyte growth. Vitellogenesis and
oocyte maturation are regulated by gonadotropins secreted from the pituitary. The point of
oocyte meiotic cell division at which oocytes become fertilizable is called oocyte maturation.
The diploid oocyte will be reduced to a haploid state, before oocytes become fertilizable.
After fertilization, the diploid state is restored by combination with the haploid sperm. The
process of oocyte maturation has attracted a great deal of attention as an important
prerequisite to fertilization and embryonic development of organisms. Much of the research
to understand the basic mechanism of oocyte maturation has been conducted mainly in frogs.
However, molecular mechanisms of fish oocyte maturation have been analyzed in goldfish, a
species closely related to zebrafish. An assay of fish oocyte maturation provides an
appropriate experimental system to investigate the hormonal actions of chemical agents on
this critical event in reproduction.
Zebrafish have become increasingly important as an animal model for vertebrate
development. The genome has been sequenced in this fish, thus it is the excellent model in
understanding the molecular mechanisms of reproduction and development at the genetic
level. As a small fish model, zebrafish have become important worldwide. However zebrafish
have not been widely used for the study of oocyte maturation because of the relatively small
number of oocytes compared to frog species such as Xenopus. Advantages of zebrafish
compared to other models include rapid development, only two days are necessary for
hatching, oocyte maturation of zebrafish completes very rapidly taking just 2-3 hours, and
morphological changes of oocytes during oocyte maturation from opaque to transparent are
obvious. Furthermore zebrafish has almost weekly reproducing cycle and spawning can be
inducible artificially. From these characteristics, zebrafish should be a good model for study
oocyte maturation and ovulation. By classical in vitro oocyte culture assay, we demonstrated
the effects of endocrine disruptors on fish oocyte maturation in zebrafish. Recently we
established a new way to induce oocyte maturation and ovulation by simply adding steroid
into the water. By using the new technique, we showed in vivo effects of EDCs on oocyte
maturation and ovulation in fish. To investigate the effects more clearly, we established an
ovarian fluorescent and transparent zebrafish. In this chapter, I would like to introduce the
zebrafish as a suitable study model for oocyte development and for evaluating the effects of
EDCs.
ESTABLISHMENT OF OVARIAN FLUORESCENT TRANSPARENT STRAIN

We established ovarian fluorescent and transparent transgenic zebrafish lines to allow us
to monitor the changes in the ovaries of living fish. The original transgenic (TG) line with
ovarian fluorescence was established by Hsiao et al. (Hsiao & Tsai 2003). Although the
cDNA integrated in this strain was constructed for the expression of EGFP driven by the
medaka β-actin promoter, the expression of EGFP is restricted to the oocytes and gills in
adult fish. In oocytes of this TG line, GFP is loosely bound to the nucleus (germinal vesicles);
thus, the germinal vesicles fluoresce bright green. However the bodies of wild type fish are
Reproductive Toxicology in Zebrafish 109
opaque, and internal ovaries are not visible from the outside. This makes noninvasive studies
of internal ovaries difficult even in the TG line. In zebrafish, several types of mutant strains
for pigment production were isolated. Iridophores exhibit various structural colors and
iridescence through the reflection of light from the surface of orderly distributed organelles
called reflecting platelets. The organelles contain guanine as the main component, although it
is not a true pigment. A roy-/- mutant zebrafish, which is deficient in the production of
iridescent color exhibited by iridophores, resulting in a transparent body, was isolated. We
crossed the roy and ovarian fluorescent TG strains to establish strains that enable the direct
observation of oocytes in living fish. The strain of roy-/- is highly transparent and oocytes are
easily observed in living fish. Then we set an object as establishment of TG (β-
actin:EGFP);roy-/-. Establishing this line of fish would permit tracing oocyte development in
the whole life cycle, for example oogenesis, ovulation, and also the strain will be applicable
for analysis of the long time influence of chemicals on oocyte development.
Figure 1. Ovarian fluorescent and transparent transgenic zebrafish. (A) The panels show the full view of
adult female (upper) and male (lower) TG(β-actin:EGFP);roy-/-, respectively. Side views taken under
brightfield and GFP filter views of the trunk are shown.
Figure 2. Identification of ovulated female by the changes in ovarian fluorescence in transgenic

zebrafish. Females induced to ovulate by normal pairing or in vivo treatment with steroids were
analyzed by observation of ovarian fluorescent. Fluorescence of ovulated eggs became lower than
immature oocytes. Also ovulated eggs accumulated to posterior side of ovary. Therefore fluorescence in
the posterior side of ovary become dark. By this observation it can be evaluated whether that female
ovulated or not.
To generate the ovarian fluorescent transparent zebrafish, normal mating techniques were
used. First, transgenic fish and roy (roy-/- / roy-/-) were mated to produce the wild-type F1
offspring of the genotype TG (β-actin:EGFP);roy-/+. Among the F2 offspring were roy-
mutant fish (roy-/- / roy-/-) with the ovarian fluorescent, and this phenotype bred true in the
F3 generation and beyond. This stock was named β-roy, TG (β-actin:EGFP);roy (ovarian
fluorescent transparent zebrafish), and maintained as a closed colony for use. In this stage, we
found that long-fin phenotype is linked to transgene and we can identify TG fish only by
observe the long-fin phenotype by the naked eye. The strain of the ovarian fluorescent
transparent zebrafish has been bred for generations over 5 years after their establishment. The
β-roy strain is healthy and fertile and reaches the adult stage in three months after hatching as
wild type strains of zebrafish.
In the transgenic (β-actin:EGFP) line with ovarian fluorescence, EGFP is loosely bound
to the nucleus (germinal vesicles); thus, the germinal vesicles fluoresce bright green. As this
fluorescence is relatively strong in small oocytes, this property was well suited for monitoring
ovarian retraction in the study such as sex-change experiment (Takatsu et al. 2013).
Continuous observations of ovaries are possible in the same individual throughout life, as
shown in observations of ovarian retraction during the sex-change study. Oocyte maturation
and ovulation in living fish is detectable by the observation of the abdomen as described in a
later section (Figure 2).
This fish is also a useful alternative model to decrease the number of animals used for
experiments, because many types of experiments can be conducted without having to kill the
animals. By using large-scale mutagenesis, great success has been achieved in screening
mutations that affect early developmental processes in the zebrafish (Haffter & Nusslein-
Volhard 1996). The transparency in these fish makes the screening of an enormous number of
embryos possible. The use of ovarian fluorescent transparent zebrafish opens up the
possibility of large-scale screen affecting postembryonic or late-onset biomedical phenomena
because of the transparency in the adult stage.
Furthermore, the ovarian fluorescent transparent zebrafish will also be an attractive viable
model for classroom lessons in anatomy, physiology, and other biological subjects, because
vital and dynamic activities of internal organs can be visualized easily in living fish.
IN VITRO OOCYTE MATURATION ASSAY

FOR NONGENOMIC STEROID ACTIONS
An assay of fish oocyte maturation provides an appropriate experimental system with

which to investigate the hormonal actions of chemical agents. Several factors responsible for
the regulation of oocyte maturation in fresh water fish have been identified. These include the
isolation and characterization of a fish maturation-inducing hormone (MIH), 17α, 20β-
dihydroxy-4-pregnen-3-one (17,20β-DHP) (Nagahama & Adachi 1985), and the components
of maturation-promoting factor (MPF) (cdc2, the catalytic subunit, and cyclin B, the
regulatory subunit) (Hirai et al. 1992; Yamashita et al. 1992; Yamashita et al. 1995). In the
first stage of oocyte maturation, a surge in luteinizing hormone (LH) release from the
pituitary provides follicle cells with the ability to produce MIH. By histological observation,
follicle cells may be separated into two distinct cell types, theca cells form the outer layer and
granulose cells exist in the inner layer. A two-cell type model has been proposed for the
production of steroids, where the theca cells provide the precursor steroids, and the granulosa
cells produce the two steroidal mediators under the direct influence of LH. A distinct shift in
steroidogenesis from estradiol to 17,20β-DHP as well as the steroidogenic enzyme genes
from ovarian cytochrome P450 aromatase (P450arom) to 20β-hydroxysteroid dehydrogenase,
occurs in the granulosa layers of ovarian follicles prior to oocyte maturation (Nagahama et al.
1995).
In zebrafish, LH-surge begins during mid-night the day before spawning and spawning
begins early in the morning after sunrise. During this time the oocyte also acquires the ability
to respond to MIH, an event termed maturational competence (Patino et al. 2001). Oocyte
maturation in fish is triggered by MIH, which acts on progestin receptors located on the
oocyte membrane and induces the activation of MPF in the oocyte cytoplasm (Tokumoto et
al. 2004; Tokumoto et al. 2006). During the course of maturation, oocytes undergo drastic
morphological changes associated with the progression of the meiotic cell cycle, among
which include breakdown of the oocyte nuclear envelope (germinal vesicle breakdown,
GVBD) occurring at the prophase/metaphase transition and is usually regarded as a hallmark
of the progress of oocyte maturation (Lessman & Kavumpurath 1984). Oocyte maturation
involves the resumption of meiosis, in which the oocyte proceeds from prophase I to
metaphase II (Nagahama & Yamashita 2008).
The study of fish oocyte maturation has provided important contributions for
understanding steroid hormone mechanism of action. In the case of oocyte maturation, steroid
hormone MIH acts on the cell surface through its membrane receptor. Generally, it is well
known that steroid hormones act on intracellular receptors, i.e. nuclear receptors (nPR), and
activate genomic pathways, which include transcription of responsible genes to induce de
novo synthesis of proteins. Newly synthesized proteins cause changes in functions of cells.
However protein synthesis is not necessary to induce oocyte maturation. Thus it is thought
that main pathways to induce oocyte maturation are activated by MIH through nongenomic
pathway, which induce post-translational modifications to activate enzymes or factors
responsible for oocyte maturation. Therefore in vitro assay of oocyte maturation in fish is a
good model for study of the mechanism of nongenomic actions of steroid hormone. In 2003,
the existence of a membrane receptor for MIH was reported (Zhu et al. 2003b; Zhu et al.
2003a). In the study, oocytes from zebrafish were used to demonstrate the role of mPR in
oocyte maturation. The role and gene expression analysis of zebrafish mPR subtypes were
described (Hanna et al. 2006; Hanna & Zhu 2009; Hanna et al. 2010).
Figure 3. GVBD observation in transgenic zebrafish. The morphology of oocytes after three hours of
each treatment was recorded. Panels on the left indicate oocytes in zebrafish Ringer‘s solution. Oocytes
remained opaque after EtOH treatment, whereas they became transparent after 17,20β-DHP or DES
treatments. Germinal vesicles were seen near the center of oocytes after EtOH treatment whereas they
disappeared after 17,20β-DHP or DES treatments. As in this figure germinal vesicle can be observed in
live oocytes by using the transgenic strain.
As described in the above section, a transgenic zebrafish line with fluorescent oocytes
was produced (Hsiao & Tsai 2003). As shown in the figure 3, fluorescence in the transgenic
oocytes is concentrated on the periphery of germinal vesicles. Furthermore, the fluorescence
diffuses throughout the mature oocyte after germinal vesicle breakdown (GVBD). Thus,
GVBD in this strain is clearly observed using the fluorescent microscope. Germinal vesicles
were seen near the center of oocytes before and after EtOH treatment, whereas the signal
disappeared after the 17,20β-DHP and diethylstilbestrol (DES) treatments (Figure. 3). Also,
17,20β-DHP and DES treated oocytes became transparent. DES induced GVBD in zebrafish
oocytes in the same manner as the naturally occurring hormone 17,20β-DHP.
We started to investigate the effects of endocrine-disrupting chemicals, or EDCs, on fish
oocyte maturation from 2000. In initial phases of analysis, we used this well-established
classical cell-based assay (Tokumoto et al. 2004; Tokumoto et al. 2005).
Several EDCs, such as Kepon and o,p-DDD, have been reported to antagonize MIH-
induced meiotic maturation of fish oocytes in vitro (Das & Thomas 1999). EDCs such as
methoxychlor and ethynyl estradiol also antagonize frog oocyte maturation (Pickford, Morris
1999). By initial screening, we found that treatment of oocytes with DES alone induced
maturation in goldfish and zebrafish (Tokumoto et al. 2004). The maturation-inducing
activity of DES was also reported in a marine fish, goby (Baek et al. 2007). One EDC,
diethylstilbestrol (DES), is a nonsteroidal substance, which was prescribed during the late
1940s to early 1970s to pregnant women to prevent abortion, preeclampsia, and other
complications of pregnancy. Male and female offspring exposed in utero to DES may develop
multiple dysplastic and neoplastic lesions of the reproductive tract, along with other changes,
during development (Bern 1992). Furthermore, a potent inhibitory effect of
pentachlorophenol (PCP) was demonstrated on oocyte maturation induced by MIH and DES
(Tokumoto et al. 2005). PCP is a widely used biocide that has been employed as a wood
preservative, herbicide, and defoliant. Its extensive use and persistence have resulted in
significant environmental contamination and potential exposure of the general population.
Due to its highly persistent nature, PCP is still one of the dominant phenolic compounds in
blood (Sandau et al. 2002). It was demonstrated that PCP was resistant for sulfonation, which
is an important pathway in the biotransformation of a wide range of endogenous compounds
and xenobiotics, in polar bears (Sacco & James 2005). The carcinogenic effects of PCP have
been evaluated in several animal bioassays (McConnell et al. 1991), and PCP levels in fish
are used as a biomarker of contamination (Rogers et al. 1990). A relationship between PCP
levels in women with reproductive and other endocrine problems was reported (Peper et al.
1999; Guvenius et al. 2003). Thus, PCP is an important organic chemical for environmental
studies and various kinds of degradation technologies for PCP have been tried. The treatment
of wastewater containing organic carbon has been one of the most important subjects in
environmental protection. A rapidly increasing number of chemicals, or their degradation
products, are being recognized as possessing estrogenic activity, albeit usually weak. It has
been found that effluent from sewage treatment works contains a chemical, or mixture of
chemicals, that induces vitellogenin synthesis in male fish maintained in the effluent, thus
indicating that the effluent is estrogenic (Sumpter & Jobling 1995). Thus, the development of
effective treatment technologies for eliminating chemical agents from the waste stream at its
source is now the subject of considerable concern. We examined the effectiveness of
sonophotocatalysis in diminishing the hormonal activity of DES and antagonistic activity of
PCP on fish oocyte maturation as a model of water pollutant chemicals (Tokumoto et al.
2008). By the GVBD assay using oocytes from ovarian fluorescent strain, we demonstrated
that sonophotocatalysis is an effective technology for eliminating chemical agents, especially
for endocrine-disrupting chemicals (Eren 2012).
IN VIVO SCREENING FOR CHEMICAL EFFECTS ON FISH

REPRODUCTION - AN ASSAY FOR NONGENOMIC STEROID ACTIONS
Given the sequential timing of oocyte maturation and ovulation it seems likely that these
events are closely integrated and may be regulated by the same suite of hormones (Clelland &
Peng 2009; Patino et al. 2003). Mature oocytes are then ovulated or released from the
follicular layer and are ready to be spawned and fertilized. Both oocyte maturation and
ovulation are ultimately regulated by luteinizing hormone (LH), by its resulting product, MIH
and by many locally produced peptide growth factors. Oocyte maturation and ovulation in
fish are normally induced by the injection of human chorionic gonadotropin (hCG) into the
abdomen of fully-grown female. Injection of hCG is effective in a wide variety of vertebrates
and is used widely for induction of ovulation. In eel, a MIH, 17,20β-DHP is used as hormone
to induce oocyte maturation and ovulation (Kagawa et al. 2013). 17,20β-DHP injected eel
spawn after 18 hrs.
Figure 4. Two different pathways of steroid actions are involved in induction of oocyte maturation and
ovulation. Although oocyte maturation and ovulation are physiological processes that occur in a serial
manner in order to produce fertilizable eggs, it is apparent that oocyte maturation is induced by
nongenomic steroid actions through mPRs whilst ovulation is induced by genomic actions through nPR.
17,20-DHP is secreted from follicular cells (red oval above the oocyte plasma membrane) and acts on
mPRs upon the plasma membrane of oocytes to induce oocyte maturation via nongenomic actions.
Ovulation-inducing pathway is thought to be activated by genomic actions by 17,20-DHP through
nPR. Matured oocytes ovulate by the disruption of follicle cells surrounding the oocytes. If the ovulated
eggs are put into the water, fertilization membrane will be developed. DES only interacts with mPR and
induce oocyte maturation.
Figure 5. In vivo assay of oocyte maturation and ovulation. Gravid female zebrafish possessing full-
grown immature oocytes were selected from a mixed group of 10-50 males and females. Females were
transferred into a glass case containing 100 ml of water per fish. Fish were exposed to agents in vivo by
adding each agent into the water (from a 10,000-fold stock in ethanol) at 28.5 ˚C. After incubation,
zebrafish ovaries were isolated from sacrificed females. GVBD was assessed by scoring the oocytes
that became transparent (Lessman, Kavumpurath 1984). Ovulation was assessed by scoring oocytes that
showed a clear fertilization membrane. Like DES, the chemical compound that only induces oocyte
maturation is only acting on the nongenomic pathway. When a compound induced ovulation, it is
suggested that the compound has the ability to activate both nongenomic and genomic pathways.
Inhibitory effects for these pathways can be evaluated by adding compounds with DES or 17,20β-DHP.
Oocyte maturation and ovulation can be induced by the treatment with 17,20β-DHP in
follicle-enclosed oocytes of Medaka fish in vitro. Thus it seems like that maturation-inducing
hormone, 17,20β-DHP is a main activator for induction of both oocyte maturation and
ovulation (Figure 4).
Although in vitro induction of oocyte maturation in zebrafish can be induced relatively
easily by 17,20β-DHP as described above, in vitro induction of ovulation is not normally
induced. There are several reports about in vitro induction of zebrafish ovulation (Seki et al.
2008). However the protocols require a competent skilled worker to carry out the procedure
efficiently. Occasionally, we found that zebrafish spawning is also inducible by 17,20β-DHP.
To address the effects of endocrine-disrupting chemicals (EDCs) in vivo, we examined the
effects of externally applied EDCs or steroid hormones in zebrafish by simply adding the
agents into water. The results of that study showed that externally applied EDCs, as well as
steroids for induction of oocyte maturation in fish, could induce or prevent oocyte maturation
and ovulation in living fish. As a result, we established a method for the induction of fish
ovulation in vivo by simple addition of maturation-inducing steroid, 17,20β-DHP into the
water (Tokumoto et al. 2011). The addition of steroids into surrounding water induces oocyte
maturation within several hours in zebrafish. Even in the case of 17,20β-DHP directly applied
to oocytes in vitro, it takes 2 to 3 hours to induce oocyte maturation. In this case 17,20β-DHP
acts on mPR very rapidly (within several minutes) and activates nongenomic actions. Oocyte
maturation was induced in vivo assay within several hours (2 hours by 17,20β-DHP and 3
hours by DES), as in vitro studies. In the case of in vivo assay, steroids penetrate fish body
very rapidly and induce nongenomic action in the ovary. Thus we concluded that the effects
of hormones or EDCs on nongenomic actions through mPR could be evaluated by oocyte
maturation in the in vivo assay using zebrafish as well as genomic actions through nPR by
scoring ovulation (Figure 5). In fact, the usefulness of this procedure is demonstrated by the
effect of PCP. As described above PCP showed a potent inhibitory effect in vitro oocyte
maturation of fish. PCP also prevented oocyte maturation in vivo when applied topically.
Thus, it is suggested that environmental EDCs disrupt oocyte maturation of fish by affecting
the pathway for nongenomic actions of steroids. The new simple method may be applicable to
evaluate the effect of environmental endocrine disrupting chemicals (EEDCs) upon
nongenomic actions of progestins by the assessment of fish oocyte maturation (Figure 5).
As a positive control we investigated the effect of the natural MIH, 17,20β-DHP, upon in
vivo oocyte maturation. 17,20β-DHP also induced oocyte maturation in vivo. Furthermore, we
found that prolonged incubation with 17,20β-DHP induced ovulation in vivo. Matured eggs
can be squeezed from zebrafish, which have been treated with 17,20β-DHP for more than 4
hours (Figure 6). Squeezed oocytes were successfully fertilized by in vitro fertilization
treatment. This procedure can be used as a new technique for artificial induction of ovulation
in fish.
Zebrafish has a short generation time, is polytelic and produces broods of eggs at
intervals of as short as 3-7 days at 28.5 ˚C.. Sexually mature zebrafish spawn roughly at week
intervals. Thus the timeframe of oocyte development occurs within a week. However there
was no report about determination of the spawning cycle of zebrafish. We assessed the time
length to prepare for spawning from previous spawning in the case of artificial induction by
in vivo stimulation by 17,20β-DHP (Tokumoto et al. 2011). By this treatment, whole full-
grown oocytes were ovulated and small oocytes under stage III remained in the ovary. We
kept spawned females separately and determined the date that a female can be induced to
subsequently spawn (Figure 7).
Figure 6. Externally applied 17,20β-DHP induced natural spawning. As shown in this picture, eggs can
be squeezed from females treated with 17,20β-DHP in vivo for more than 4 hours. Ovulated eggs stay
in the abdomen until spawning. Fertilizable eggs can be obtained until 8 hours after the addition of
17,20β-DHP.
Figure 7. Estimation of reproductive cycle of oocytes in the zebrafish ovary. Left panel; At day 0,
females were treated with in vivo 17,20β-DHP. Post-ovulated females were separated and treated again
with DHP at the represented date after initial treatment. For each date, more than four fishes are used
for treatment. Percentage of spawned females among those tested at each date is represented. Red bar
indicates the percentage of degenerated eggs among spawned eggs. Right panel; Schematic diagram of
changes in the ovary during the experiment.
As shown in Figure 7, zebrafish became ready for spawning at 8 days after previous
spawning. This result clearly demonstrated that it takes 7 days for oocyte growth in zebrafish.
Thus spawning cycle of zebrafish should be 7 days. However in naturally induced spawning
by pairing in the tank, just 2 or 3 days is enough for pairing intervals in the case of an active
female. It is thought that there should be a more refined regulation to select the largest
oocytes to be spawned in vivo. In fact relatively small numbers of eggs are ovulated in the
case of normal pairing than artificial induction by steroid. If the zebrafish will not spawn
more than 13 days after previous spawning, degenerated oocytes appeared. The result showed
that full-grown oocytes can be kept healthy for development for about 4 days (between 8 to
12 days after treatment).
In summary, a conceptually new approach to distinguish between the genomic and
nongenomic actions induced by steroids was explored. The assay described in this chapter can
be applied to screens of progestin-like effects upon oocyte maturation and ovulation for small
molecules of pharmacological agents or EDCs. The method also can be applied as a new way
to induce ovulation in zebrafish. Recently it was demonstrated that the method can be applied
to the aquatic frog, Xenopus laevis (Ogawa et al. 2011). Furthermore the method of treatment
with steroid from surrounding water is effective for male frogs. Finally a new mating
procedure using sex steroid without hCG-injection was established (Miyazaki & Tokumoto
2013).
Figure 8. Schematic diagram of the course of sex change from female to male zebrafish by the
treatment with aromatase inhibitor.
SEX-REVERSAL IN ADULT FEMALE -

PRESENCE OF UNDIFFERENTIATED STEM CELLS
FOR THE GERMLINE IN ADULT ZEBRAFISH
Undifferentiated ovary-like gonads are initially developed during gonadal development in

juvenile zebrafish, regardless of genotypic sex (Orban et al. 2009). In genotypic male
zebrafish, all oocytes disappear from the gonad by 30 days post-hatching, and spermatocytes
develop concomitant with testicular differentiation (Takahashi 1977). In contrast, oocytes in
the female ovaries continue to grow to maturation. Various genetic and molecular approaches
have been used to investigate the mechanisms of sex determination, gonadal sex
differentiation, and sex change in fish. Female-to-male sex change is associated with a
decrease in estrogen levels, followed by an increase in androgen levels (Bhandari et al. 2003).
Estrogens are produced by the conversion of aromatizable androgens by cytochrome P450
aromatase (P450arom), and the actions of P450arom are essential for sex differentiation and
ovarian development in fish and other vertebrates (Young et al. 1983; Desvages & Pieau
1992). Recent studies showed that sex change could be induced in many types of fish by
aromatase inhibitor (AI) treatment during sex differentiation. In zebrafish, the gonadal
masculinization of genetic juvenile females can be induced by the dietary administration of an
aromatase inhibitor AI (fadrozole) (Uchida et al. 2004). However whether sex plasticity
persists in adult zebrafish following sex differentiation remained unresolved.
We examined whether AI (fadrozole) treatment induces a sex change in adult zebrafish
using the transgenic -roy line. The fish strain allowed monitoring the changes in the ovaries
of living fish during fadrozole administration (Takatsu et al. 2013). The ovaries of the
fadrozole-treated fish gradually reduced in size. After five months, the ovaries retracted
completely, and the fluorescence-expressing oocytes had disappeared in all treated fish.
Finally cyst structures filled with different stages of spermatozoa-like cells were observed in
fadrozole-treated fish at 8 weeks after replacing the AI food with the control treatment
(Figure 8). Artificial fertilization using these sperm and eggs from an untreated female was
successful, and juveniles developed normally. The results suggested the possibility that the
capacity for sex change remained in the adult fish of species such as zebrafish that are not
known to undergo sex change in nature. Our results demonstrated that sexual plasticity
persists in adult zebrafish following sex differentiation, indicating that undifferentiated stem
cells are maintained in adult fish that do not undergo sex change under natural conditions.
Our result suggested that there is a possibility that all fishes have undifferentiated stem cells
of the germ line. If these stem cells can be isolated and cultured, this would pave the way to
induce differentiation of sperm or oocytes in vitro. The technology would be a new way for
conservation of species.
CONCLUSION
This chapter introduces the zebrafish as a model for reproductive biology and its
application of environmental screening. Zebrafish have been selected as test animals for the
assessment of chemicals for endocrine disruption in OECD test guidelines, for example Fish
Sexual Development Test (FSDT), Fish Lifecycle Toxicity Test (FLCTT) in TG229. Also the
effects of EDCs on progesterone receptors have been studied (Diamanti-Kandarakis et al.
2009; LeBlanc et al. 2011). Furthermore application of zebrafish for the screening of
pharmaceuticals is developing and its usefulness may be widespread. The potential of the
zebrafish as an experimental model has been greatly improved by the generation of the
transparent zebrafish. The ovarian fluorescent transparent zebrafish has advantages in
research applications to noninvasive studies of oogenesis, oocyte maturation and ovulation or
other alterations caused by exposure to chemical substances including endocrine disrupters.
Continuous observations of ovaries are possible in the same individual throughout the life
cycle, as shown in observations of ovarian retraction during the sex-change study. As used in
developmental biology, zebrafish is a suitable vertebrate model for reproductive biology and
for applied science such as screening of pharmaceuticals and EDCs.
ACKNOWLEDGMENTS
I wish to thank Dr. N. Sakai, Dr. K. Kawakami and Dr. M. Tokumoto for their support
and encouragement throughout the study. This work was supported by Grants-in-Aid for
Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports,
Science and Technology of Japan and grants from The Naito Foundation (to T.T.), Japanese
Environmental Agency (ExTEND2005 FS to T.T.) and a SUNBOR grant from Suntory
Institute For Bioorganic Research (to T.T.).
REFERENCES
Baek HJ, Hwang IJ, Kim KS, Lee YD, Kim HB & Yoo MS., 2007, "Effects of BPA and DES
on longchin goby (Chasmichthys dolichognathus) in vitro during the oocyte maturation",
Mar. Environ. Res., 64(1), 79-86.
Bern HA., 1992, "Chemically induced alterations in sexual and functional development: The
Wildlife/Human Connection". Mehlman MA, editor: Princeton Sci. Pub. pp. 9-15.
Bhandari RK, Komuro H, Nakamura S, Higa M & Nakamura M., 2003, "Gonadal
restructuring and correlative steroid hormone profiles during natural sex change in
protogynous honeycomb grouper (Epinephelus merra)", Zoolog. Sci., 20(11), 1399-1404.
Clelland E. & Peng C., 2009, "Endocrine/paracrine control of zebrafish ovarian
development", Mol. Cell Endocrinol., 312(1-2), 42-52.
Das S. & Thomas P., 1999, "Pesticides interfere with the nongenomic action of a progestogen
on meiotic maturation by binding to its plasma membrane receptor on fish oocytes",
Endocrinology, 140(4), 1953-1956.
Desvages G. & Pieau C., 1992, "Aromatase activity in gonads of turtle embryos as a function
of the incubation temperature of eggs", J. Steroid Biochem. Mol. Biol., 41(3-8), 851-853.
Diamanti-Kandarakis E, Bourguignon JP, Giudice LC, Hauser R, Prins GS, Soto AM, Zoeller
RT & Gore AC., 2009, "Endocrine-disrupting chemicals: an Endocrine Society scientific
statement", Endocr. Rev., 30(4), 293-342.
Eren Z., 2012, "Ultrasound as a basic and auxiliary process for dye remediation: a review", J
Environ Manage, 104, 127-141.
Guvenius DM, Aronsson A, Ekman-Ordeberg G, Bergman A & Noren K., 2003, "Human
prenatal and postnatal exposure to polybrominated diphenyl ethers, polychlorinated
biphenyls, polychlorobiphenylols, and pentachlorophenol", Environ. Health Perspect.,
111(9), 1235-1241.
Haffter P. & Nusslein-Volhard C., 1996, "Large scale genetics in a small vertebrate, the
zebrafish", Int. J. Dev. Biol., 40(1), 221-227.
Hanna R, Pang Y, Thomas P. & Zhu Y., 2006, "Cell-surface expression, progestin binding,
and rapid nongenomic signaling of zebrafish membrane progestin receptors alpha and
beta in transfected cells", J. Endocrinol., 190(2), 247-260.
Hanna RN, Daly SC, Pang Y, Anglade I, Kah O, Thomas P & Zhu Y., 2010,
"Characterization and expression of the nuclear progestin receptor in zebrafish gonads
and brain", Biol. Reprod., 82(1), 112-122.
Hanna RN & Zhu Y., 2009, "Expression of membrane progestin receptors in zebrafish (Danio
rerio) oocytes, testis and pituitary", Gen. Comp. Endocrinol., 161(1), 153-157.
Hirai T, Yamashita M, Yoshikuni M, Lou YH & Nagahama Y., 1992, "Cyclin B in fish
oocytes: its cDNA and amino acid sequences, appearance during maturation, and
induction of p34cdc2 activation", Mol. Reprod. Dev., 33(2), 131-140.
Hsiao CD & Tsai HJ., 2003, "Transgenic zebrafish with fluorescent germ cell: a useful tool to
visualize germ cell proliferation and juvenile hermaphroditism in vivo", Dev. Biol.,
262(2), 313-323.
Kagawa H, Sakurai Y, Horiuchi R, Kazeto Y, Gen K, Imaizumi H & Masuda Y., 2013,
"Mechanism of oocyte maturation and ovulation and its application to seed production in
the Japanese eel", Fish Physiol. Biochem., 39(1), 13-17.
LeBlanc GA, Kullman SW, Norris DO, Baldwin WS, Kloas W & Greally JM., 2011. Draft
Detailed Review Paper State of the Science on Novel In Vitro and In Vivo Screening and
Testing Methods and Endpoints for Evaluating Endocrine Disruptors. pp. 1-149.
Lessman CA & Kavumpurath S., 1984, "Cytological analysis of nuclear migration and
dissolution during steroid-induced meiotic maturation in vitro of follicle-enclosed
oocytes of the goldfish (Carassius auratus)", Gamete Res., 1021-29.
McConnell EE, Huff JE, Hejtmancik M, Peters AC & Persing R., 1991, "Toxicology and
carcinogenesis studies of two grades of pentachlorophenol in B6C3F1 mice", Fundam.
Appl. Toxicol., 17(3), 519-532.
Miyazaki T. & Tokumoto T., 2013, "A novel method for induction of pairing in Xenopus by
addition of steroids into the water", Zoolog. Sci., 30(7), 565-569.
Nagahama Y. & Adachi S., 1985, "Identification of maturation-inducing steroid in a teleost,
the amago salmon (Oncorhynchus rhodurus)", Dev. Biol., 109(2), 428-435.
Nagahama Y. & Yamashita M., 2008, "Regulation of oocyte maturation in fish", Dev. Growth
Differ., 50 Suppl 1S, 195-219.
Nagahama Y, Yoshikuni M, Yamashita M, Tokumoto T. & Katsu Y., 1995, "Regulation of
oocyte growth and maturation in fish", Curr. Top Dev. Biol., 30, 103-145.
Ogawa A, Dake J, Iwashina YK & Tokumoto T., 2011, "Induction of ovulation in Xenopus
without hCG injection: the effect of adding steroids into the aquatic environment",
Reprod. Biol. Endocrinol., 9, 11.
Orban L, Sreenivasan R. & Olsson PE., 2009, "Long and winding roads: testis differentiation
in zebrafish", Mol. Cell Endocrinol., 312(1-2), 35-41.
Patino R, Thomas P. & Yoshizaki G., 2003, "Ovarian follicle maturation and ovulation: an
integrated perspective", Fish Physiology and Biochemistry, 28(1-4), 305-308.
Patino R, Yoshizaki G, Thomas P. & Kagawa H., 2001, "Gonadotropic control of ovarian
follicle maturation: the two-stage concept and its mechanisms", Comp. Biochem. Physiol.
B Biochem. Mol. Biol., 129(2-3), 427-439.
Peper M, Ertl M. & Gerhard I., 1999, "Long-term exposure to wood-preserving chemicals
containing pentachlorophenol and lindane is related to neurobehavioral performance in
women", Am. J. Ind. Med., 35(6), 632-641.
Pickford DB & Morris ID., 1999, "Effects of endocrine-disrupting contaminants on
amphibian oogenesis: methoxychlor inhibits progesterone-induced maturation of
Xenopus laevis oocytes in vitro", Environ. Health Perspect., 107(4), 285-292.
Rogers IH, Birtwell IK & Kruzynski GM., 1990, "The Pacific eulachon (Thaleichthys
pacificus) as a pollution indicator organism in the Fraser River estuary, Vancouver,
British Columbia", Sci. Total Environ., 97-98, 713-727.
Sacco JC & James MO., 2005, "Sulfonation of environmental chemicals and their metabolites
in the polar bear (Ursus maritimus)", Drug Metab. Dispos., 33(9), 1341-1348.
Sandau CD, Ayotte P, Dewailly E, Duffe J. & Norstrom RJ., 2002, "Pentachlorophenol and
hydroxylated polychlorinated biphenyl metabolites in umbilical cord plasma of neonates
from coastal populations in Quebec", Environ. Health Perspect., 110(4), 411-417.
Seki S, Kouya T, Tsuchiya R, Valdez DM, Jr., Jin B, Hara T, Saida N, Kasai M & Edashige
K., 2008, "Development of a reliable in vitro maturation system for zebrafish oocytes",
Reproduction, 135(3), 285-292.
Sumpter JP & Jobling S., 1995, "Vitellogenesis as a biomarker for estrogenic contamination
of the aquatic environment", Environ. Health Perspect., 103 Suppl 7, 173-178.
Takahashi H., 1977, "Juvenile hermaphroditism in the zebrafish, Brachydanio rerio", Bull.
Fac. Fish. Hokkaido Univ., 2857-65.
Takatsu K, Miyaoku K, Roy SR, Murono Y, Sago T, Itagaki H, Nakamura M & Tokumoto
T., 2013, "Induction of Female-to-Male Sex Change in Adult Zebrafish by Aromatase
Inhibitor Treatment", Sci. Rep., 3, 3400.
Tokumoto M, Nagahama Y, Thomas P. & Tokumoto T., 2006, "Cloning and identification of
a membrane progestin receptor in goldfish ovaries and evidence it is an intermediary in
oocyte meiotic maturation", Gen. Comp. Endocrinol., 145(1), 101-108.
Tokumoto T, Ishikawa K, Furusawa T, Ii S, Hachisuka K, Tokumoto M, Tsai HJ, Uchida S.
& Maezawa A., 2008, "Sonophotocatalysis of endocrine-disrupting chemicals", Mar.
Environ. Res., 66(3), 372-377.
Tokumoto T, Tokumoto M, Horiguchi R, Ishikawa K. & Nagahama Y., 2004,
"Diethylstilbestrol induces fish oocyte maturation", Proc. Natl. Acad. Sci. U. S. A.,
101(10), 3686-3690.
Tokumoto T, Tokumoto M & Nagahama Y., 2005, "Induction and inhibition of oocyte
maturation by EDCs in zebrafish", Reprod. Biol. Endocrinol., 3, 69.
Tokumoto T, Yamaguchi T, Ii S & Tokumoto M., 2011, "In vivo induction of oocyte
maturation and ovulation in zebrafish", PLoS One, 6(9), e25206.
Uchida D, Yamashita M, Kitano T. & Iguchi T., 2004, "An aromatase inhibitor or high water
temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the
gonads of genetic female zebrafish during sex-reversal", Comp. Biochem. Physiol. A Mol.
Integr. Physiol., 137(1), 11-20.
Yamashita M, Fukada S, Yoshikuni M, Bulet P, Hirai T, Yamaguchi A, Lou YH, Zhao Z &
Nagahama Y., 1992, "Purification and characterization of maturation-promoting factor in
fish", Dev. Biol., 149(1), 8-15.
Yamashita M, Kajiura H, Tanaka T, Onoe S. & Nagahama Y., 1995, "Molecular mechanisms
of the activation of maturation-promoting factor during goldfish oocyte maturation", Dev.
Biol., 168(1), 62-75.
Young G, Kagawa H. & Nagahama Y., 1983, "Evidence for a decrease in aromatase activity
in the ovarian granulosa cells of amago salmon (Oncorhynchus rhodurus) associated with
final oocyte maturation", Biol. Reprod., 29(2), 310-315.
Zhu Y, Bond J. & Thomas P., 2003a, "Identification, classification, and partial
characterization of genes in humans and other vertebrates homologous to a fish
membrane progestin receptor", Proc. Natl. Acad. Sci. U. S. A., 100(5), 2237-2242.
Zhu Y, Rice CD, Pang Y, Pace M. & Thomas P., 2003b, "Cloning, expression, and
characterization of a membrane progestin receptor and evidence it is an intermediary in
meiotic maturation of fish oocytes", Proc. Natl. Acad. Sci. U. S. A., 100(5), 2231-2236.
Chapter 6
FECUNDITY AND SPAWNING PERIODICITY

IN WILD-TYPE ZEBRAFISH MATED PAIRS:
A LONG-TERM, LONGITUDINAL STUDY
Charles A. Lessman
Department of Biological Sciences,
The University of Memphis, Memphis, TN, US
ABSTRACT
In order to gain insight into the reproductive cycle of the zebrafish, Danio rerio, 70
mated pairs of wild-type adults were followed daily for spawning over a month, on
average, and in some cases for more than four months. Different sets of mated pairs were
followed over a 5 year period and each spawn was imaged by transparency scanner and
quantified by image analysis using imageJ software. The 70 pairs produced a total of
37,711 embryos in 952 spawns over the course of 2,727 spawn-days. This gave an
average spawning periodicity of 2.86 days and an average clutch size of 39.6 embryos.
Considerable variation in spawning periodicity and clutch size occurred, in spite of
constant environmental and nutritional conditions. Some mated pairs were consistently
short periodicity spawners, while others exhibited intermediate or long periodicity.
Spawning periodicity did not correlate well with clutch size, i.e., long periodicity
spawning pairs were not necessarily producing larger clutch sizes. These data provide a
foundation for study of the reproductive cycle of the zebrafish, an increasingly important
model system.
Keywords: Clutch size, oviposition, image analysis, embryo counts

Corresponding author: Charles A. Lessman, Ph.D. Department of Biological Sciences, The University of
Memphis, 3774 Walker Ave., Room 223 Life Science Bldg., Memphis, TN 38152, US. Phone: (901) 678-
2963, Fax: (901) 678-4457, E-mail: Clessman@memphis.edu.
INTRODUCTION
The zebrafish has become an important developmental biology model organism since two
large-scale ENU-mutagenesis projects produced a large variety of mutants. Methods to
manipulate gene expression have been developed and the transparent embryos are amenable
to microinjection and imaging procedures.
However, since most zebrafish investigators are interested in steady, plentiful embryo
production, most strains of inbred fish have been selected for these traits. Our lab is interested
in the regulation of the ovary and in oocyte maturation; therefore we have undertaken a long-
term study to investigate variation in the spawning cycle of wild-type fish, not previously
selected for high fecundity.
In order to study the ovarian cycle of the zebrafish, the embryo output was determined in
mated pairs of wild-type zebrafish followed daily over several weeks to several months.
Partitions and rock refugia were used to prevent undue aggression. Normal laboratory
conditions were maintained (i.e.14 hr photoperiod, 28C, flake food fortified with dried brine
shrimp fed once a day, and a complete fresh water change daily). Resulting embryos were
scanned on a transparency flatbed scanner at 1200 dpi and imageJ was used to count embryos
(Lessman et al. 2010).
Relatively little recent data are available about zebrafish ovarian cycle and spawning.
Two early papers provide some background; a 1962 paper reported a spawning cycle of 5
days at 26C and about 2 days at 29C while spawning ceased at 22.5C (Hisaoka and Firlit
1962). A 1974 paper, by contrast reported a cycle of 1.9 days at 26-27C, while the same fish,
3 months later, lengthened their spawning periodicity to 2.7 days (Eaton and Farley 1974).
The differences found between these studies may be due to genetic strain effects, food, water
quality and the relatively small number of fish used in each study (approximately a dozen
pairs). More recently, a 2008 report described trials that followed 34 groups of 6 pairs each
for 20 days and found several patterns of embryo production highlighting the variation
present in the wik lab strain used (Paull et al. 2008). The current study is unique since it
provides data on individual mated pairs followed continuously in a longitudinal study design.

Animals
A colony of wild-type adult zebrafish (Danio rerio) was initiated from a founder group of
about 50 adults obtained from local pet stores. Both short tail (similar to AB lab strain
morphologically) and long tail (similar to TL) stocks were obtained (Figure 1). All animals in
this research were used in accordance with approved IACUC protocols (#0677 and #0714).
Random outcross matings were used to establish and expand the colony. Embryos were
reared on site to adulthood in a dedicated fish room thermostatically controlled at 28C, with
a 14 hr photoperiod (14 hr light: 10 hr dark) and fed flaked tropical fish food supplemented
4:1 with brine shrimp flakes (http://www.Aquaticeco.com). Fish were housed in racks of 10L
plastic tanks with daily exchange of 10% fresh dechlorinated Memphis municipal water
(system water).
Spawning in Long-Term Mated Zebrafish Pairs 125
Figure 1. Typical examples of adult wild-type zebrafish pairs used in this study. Both short-tail (AB-
like) and long-tail (TL-like) animals were used from several local pet stores in Memphis, TN US. Males
are topmost and the female below the male for each of the 4 pairs shown. The black bar is 1 cm.
Header tanks were filled each day with city water (~1 ppm chlorine) which was
dechlorinated to 0 ppm chlorine with sodium thiosulfate and Amquel (http://www.
Aquaticeco.com). The tank system allows gravity flow from header tanks through distribution
hoses fitted with drippers permitting equilibrium of gases and heat as fresh water drips into
fish tanks then to drains, i.e. water was not recycled or pumped reducing contamination and
gas super saturation between rearing tanks.
Spawning Pairs
Pairs of females and males, approximately 9 – 15 months old were selected from the
mixed sex tanks and individual pairs placed together in spawning tanks fitted with perforated
inner tanks (Aquatic habitats Inc.) to allow settling of embryos out of reach of adults.
Outcrossing was the preferred method of mate selection and crossing of siblings was
avoided in this study. Spawning tanks also contained 2-3 pieces of granite (2-3 cm diameter)
as refugia and were filled with approximately 1L of system water. Pairs were checked daily
about 3 hr after lights on for spawning as follows: the inner chamber was removed containing
the adults, it was briefly jet-rinsed with egg water allowing any trapped embryos to fall into
the bottom chamber and the inner chamber was placed in a fresh outer tank with new system
water. The original bottom tank was emptied through a sieve of nitex cloth to collect embryos
along with a jet-rinse of the tank. The embryos were jet-rinsed from the sieve into 100 mm
petri dishes and scanned on a transparency scanner (Lessman et al. 2010). Only pairs that
successfully spawned were used in this study. Pairs were followed for up to 4 months;
generally 8 - 20 sets of pairs were followed at a time and the study extended over a five year
period.

A total of 70 mated pairs of adult wild-type zebrafish were placed into individual false-
bottomed spawning boxes and checked every midday for embryos. Embryos obtained were
scanned with a flatbed transparency scanner and the number of embryos determined by image
analysis using Image J.
A total of 37,711 embryos were obtained from 952 clutches representing 2,727 spawn-
days (i.e. a spawn-day is equivalent to one pair crossed for one day). Calculations using these
total values result in average clutch size of 39.6 embryos and a spawning periodicity of 2.86
days. Considerable inter-pair variation in spawning periodicity was found; when periodicity
was plotted against frequency, the most frequent periodicity was every 2-3 days (Figure 2).
However, some pairs, termed intermediate to long periodicity spawners, spawned every 5
– 14 days. The most frequent clutch size was found to be 30 – 40 embryos (Figure 3).
Nevertheless, some pairs produced only a few embryos on average, while others produced
over 200 embryos on average. To determine if clutch size was related to spawning periodicity
(i.e. do long periodicity spawning pairs have larger clutch size?), the mean clutch size for all
70 pairs was plotted against spawning periodicity (Figure 3). The results indicated that pairs
with the longest periodicity of 14 days produced average sized clutches, while those with
intermediate periodicity of 5 – 10 days produced the largest average clutches obtained in this
study (about 200 embryos). In addition, this intermediate group had the largest variation in
clutch size. Some of the pairs with short spawning periodicity of 2 – 4 days, produced
clutches of over 100 embryos, while others in this group produced only a few embryos per
clutch (Figure 4). While in constant laboratory conditions, zebrafish are not exposed to
seasonal conditions, wild zebrafish have peak reproduction during the monsoon season in
their native Bangladesh (Spence et al. 2007). The present study was carried out for 5 years
and encompassed all seasons; however, no obvious seasonal differences were noted.
Figure 2. Graph of days since last spawn (ie. Periodicity) versus frequency of the 70 pairs exhibiting a
particular periodicity on average. The most frequent periodicity was every 2 days, but ranged up to
every 14 days for 4 of 70 pairs.
Figure 3. Graph of average clutch size (bin of 10 embryos) versus the frequency exhibited for the 70
pairs in this study. The most frequent clutch size was 30-40 embryos (16 of 70 pairs) while 2 pairs of
the 70 produced on average about 200 embryos per clutch.
No reproductive diapause was observed in the 70 pairs followed in this study (i.e., fish
spawned in all months). Variation in spawning periodicity and number of embryos produced
was correlated with particular pairs. The ovary must produce the bulk mass of the embryos
oviposited, while the male provides the fertilizing sperm which has negligible mass compared
to the egg.
This suggests that the female is the primary source of variation based on sheer gamete
biomass produced by each sex. Environmental and nutritional factors were held constant
throughout the study, suggesting that genetically-controlled factors associated with individual
females including feed conversion, energy efficiency, activity level, hormone production and
liver function (i.e. vitellogenin gene function) may be some of the major variables.
Figure 4. Graph of average number of days since last spawn (i.e. periodicity) versus mean clutch size
for the 70 pairs in the study. The densest clustering appears at about 2.5 days since last spawn; it is
interesting to note the intermediate periodicity of the 2 pairs with the largest average clutch size of
about 200 embryos. The 4 pairs with longest average periodicity of about 14 days since last spawn
produced moderate sized clutches, indicating that maturing oocytes do not seem to accumulate in
longer-periodicity spawning females.
A previous study found spawning periodicity to be related to temperature. At 22.5C no

spawning was observed, while a periodicity of 5 days was seen at 26C and spawning
periodicity decreased to 2 day intervals at 29C (Hisaoka and Firlit 1962). In another early
study, individual mated pairs were held together continuously for 26 days at 25 – 27C and
found to spawn with an average interval of 1.9 days and an average clutch size of 41 embryos
(Eaton and Farley 1974). When these same pairs were allowed to mate 3 months later, the
same pairs increased the spawning interval to 2.7 days, suggesting that age influenced
spawning periodicity. Factors tested that did not seem to play a role in spawning included:
water hardness, light intensity (15 – 170 FC), and presence of more than one male per female
(one versus three males). Separation of mated pairs from 2 – 9 days, followed by reuniting the
pair, resulted in a significant decrease in embryo production with increasing days of forced
separation suggesting that maturing eggs are not stored for subsequent large clutches (Eaton
and Farley 1974).
A number of more recent studies have reported the effects of a variety of factors on
reproduction in zebrafish. A recently published study, involving eight different zebrafish
facilities, used a common zebrafish genetic pool to produce adults that were randomly
assigned to different facilities for spawning (Castranova et al. 2011). The average clutch size,
spawning success or percent viable embryos were not affected by the stocking densities of up
to 12 adults per L, indicating broad tolerance for relatively high population density without
degrading reproductive functions. A related study focused on mating chamber volumes and
its effect on spawning; reproductive output was determined for spawning chamber volumes of
100, 200, 300, 400 and 500 ml housing six adults (two males and four females) (Goolish et al.
1998). The results indicated that chambers containing less than 300 ml reduced spawning, i.e.
as little as 50 ml per fish was required for normal mating.
Chamber shape and water depth was shown to affect spawning output in another study
(Sessa et al. 2008). Spawning boxes that contained tilted inner liners to form shallow areas,
promoted spawning output, and fish tended to oviposit over the shallower regions compared
to mating chambers with equal depth. While changing feeding time had no major effect on
spawning, altering the light cycle produced alteration in spawning behavior (Blanco-Vives
and Sánchez-Vázquez 2009). Applying 1 hr of darkness at the normal spawning time (i.e. 3 hr
after lights on, zeitgeber time 3 or ZT3) caused a delay of spawning to 7 hr after lights on
(ZT7); the normal spawning cycle could be resumed to ZT3 after a 1 hr darkness pulse was
given at ZT7 (Blanco-Vives and Sánchez-Vázquez 2009).
Melatonin was shown to increase fecundity in spawning zebrafish and upregulate genes
such as Cox2A, leptin and ghrelin thought to be important in ovarian regulation (Carnevali et
al. 2010). Another important variable studied in zebrafish reproductive success is diet. A
study comparing four different diets: 1) mixture of Artemia, flake feed and liver paste, 2) live
Artemia, 3) flake feed, and 4) commercial trout feed found differences in embryo output and
embryo viability (Markovich, Rizzuto and Brown 2007).
The number of eggs laid and their diameter varied considerably based on individual
matings irrespective of diet. However, the conclusion of the study suggested the use of dry
flake feed as providing high reproductive success overall. Live Artemia also produced
reproductive success but was more complicated to produce and feed compared to the
convenience of stable flaked feed (Markovich, Rizzuto and Brown 2007).
Another study found that feeding a prepared dry diet only once a day produced growth
and reproductive performance that was no different than more time consuming feeding
schedules (Holland, Lawrence and King 2013). Of particular interest was the finding that
feeding live Artemia alone was actually deleterious to gonosomatic index over a five week
period when compared to other feed regimes including dry flaked food (Gonzales Jr. and Law
2013).
Mate selection appears to be weak in zebrafish and males use active pursuit of females as
a mating strategy (Spence, Jordan and Smith 2006). In a study of female mating preference, it
was reported that male dominance ranking and male size did not significantly affect female
mating success (Spence and Smith 2006).
A second group reported that females tended to mate preferentially with larger males if
given a choice, while female size had no significant effect on male choice (Pyron 2003).
Variations in sperm release were reported in a study describing sperm trails of viscous
material sometimes released prior to female oviposition (Njiwa, Müller and Klein 2004).
The ovary is the likely bottleneck for reproductive output rather than the testes; clearly
the large energy investment and time required to produce the large oocytes (i.e. >0.6 mm)
argues for this point. Reviews of ovarian regulators in zebrafish are available (Clelland, Peng
2009, Ge 2005).
A number of research studies have reported regulatory control molecules for the ovary.
These include nanos 1 (Draper, McCallum and Moens 2007), activin, TGF-, BMP-15 and
gonadotropin (Tan et al. 2009), and GDF-9 (Liu and Ge 2007). Additional factors concerning
ovarian cycling that are less well studied include atresia and apoptosis of ovarian follicles
(Gioacchini et al. 2012).
CONCLUSION
Long-term mated pairs of wild-type zebrafish monitored for daily spawning for up to 4
months had an average spawning periodicity of 2.86 days overall, with the mode and median
both 2.82 days. Fecundity, measured as embryos produced per spawn, was 39.6 on average;
while the mode was 34 and the median was 34.6 for the 70 pairs in this study. The results
presented here agree rather well with previous studies carried out over 40 years ago indicating
a spawning cycle of 2-3 days. However, some pairs showed longer periodicity under identical
environmental conditions suggesting an underlying genetic component to the variation. This
presents the possibility of genetic dissection of the spawning cycle regulators in this
genetically tractable model species.
ACKNOWLEDGMENTS
A portion of this work was supported by a USDA-SRAC grant. Technical support was
provided by Katherine A. Love and Jennifer L. Debeauchamp, in addition, a number of
undergraduates in Biology 4000 research participated in harvesting and quantifying embryos
from spawning pairs. Nikki Ballard provided suggestions for improving the manuscript.
REFERENCES
Blanco-Vives, B. and Sánchez-Vázquez, F. J., 2009, "Synchronisation to light and feeding
time of circadian rhythms of spawning and locomotor activity in zebrafish", Physiology
and Behavior, 98(3), 268-275.
Carnevali, O., Gioacchini, G., Piccinetti, C., Maradonna, F., Lombardo, F., Giorgini, E., and
Tosi, G., 2010, "Melatonin control of oogenesis and metabolic resources in Zebrafish",
Journal of Applied Ichthyology, 26(5), 826-830.
Castranova, D., Lawton, A., Lawrence, C., Baumann, D. P., Best, J., Coscolla, J., Doherty,
A., Ramos, J., Hakkesteeg, J., and Wang, C., 2011, "The effect of stocking densities on
reproductive performance in laboratory zebrafish (Danio rerio)", Zebrafish, 8(3), 141-
146.
Clelland, E. and Peng, C., 2009, "Endocrine/paracrine control of zebrafish ovarian
development", Molecular and Cellular Endocrinology, 312(1-2), 42-52.
Draper, B. W., McCallum, C. M. and Moens, C. B., 2007, "Nanos1 is required to maintain
oocyte production in adult zebrafish", Developmental Biology, 305(2), 589-598.
Eaton, R. C. and Farley, R. D., 1974, "Spawning cycle and egg production of zebrafish,
Brachydanio rerio, in the laboratory", Copeia, 1974, 195-204.
Ge, W., 2005, "Intrafollicular paracrine communication in the zebrafish ovary: the state of the
art of an emerging model for the study of vertebrate folliculogenesis", Molecular and
Cellular Endocrinology, 237(1), 1-10.
Gioacchini, G., Dalla Valle, L., Benato, F., Fimia, G. M., Nardacci, R., Ciccosanti, F.,
Piacentini, M., Borini, A., and Carnevali, O., 2012, "Interplay between autophagy and
apoptosis in the development of Danio rerio follicles and the effects of a probiotic",
Reproduction, Fertility and Development, 25(8), 1115-1125.
Gonzales Jr, J. M. and Law, S. H. W., 2013, "Feed and Feeding Regime Affect Growth Rate
and Gonadosomatic Index of Adult Zebrafish (Danio rerio)", Zebrafish, 10(4), 532-540.
Goolish, E. M., Evans, R., Okutake, K., and Max, R., 1998, "Chamber volume requirements
for reproduction of the zebrafish Danio rerio", The Progressive Fish-Culturist, 60(2),
127-132.
Hisaoka, K. and Firlit, C., 1962, "Ovarian cycle and egg production in the zebrafish,
Brachydanio rerio", Copeia, 1962, 788-792.
Holland, J., Lawrence, C. and King, N., 2013, "Children's hospital Boston makes zebrafish
feeding regime breakthrough", Global Aquaculture Advocate, 2013, 76-78.
Lessman, C. A., Taylor, M. R., Orisme, W., and Carver, E. A., 2010, "Use of Flatbed
Transparency Scanners in Zebrafish Research: Versatile and Economical Adjuncts to
Traditional Imaging Tools for the Danio rerio Laboratory", Methods in Cell Biology,
100, 295-322.
Liu, L. and Ge, W., 2007, "Growth differentiation factor 9 and its spatiotemporal expression
and regulation in the zebrafish ovary", Biology of Reproduction, 76(2), 294-302.
Markovich, M. L., Rizzuto, N. V. and Brown, P. B., 2007, "Diet affects spawning in
zebrafish", Zebrafish, 4(1), 69-74.
Njiwa, J. R. K., Müller, P. and Klein, R., 2004, "Variations of sperm release in three batches
of zebrafish", Journal of Fish Biology, 64(2), 475-482.
Paull, G. C., Van Look, K. J. W., Santos, E. M., Filby, A. L., Gray, D. M., Nash, J. P., and
Tyler, C. R., 2008, "Variability in measures of reproductive success in laboratory-kept
colonies of zebrafish and implications for studies addressing population-level effects of
environmental chemicals", Aquatic Toxicology, 87(2), 115-126.
Pyron, M., 2003, "Female preferences and male-male interactions in zebrafish (Danio rerio)",
Canadian Journal of Zoology, 81(1), 122-125.
Sessa, A. K., White, R., Houvras, Y., Burke, C., Pugach, E., Baker, B., Gilbert, R., Thomas
Look, A., and Zon, L. I., 2008, "The Effect of a Depth Gradient on the Mating Behavior,
Oviposition Site Preference, and Embryo Production in the Zebrafish, Danio rerio",
Zebrafish, 5(4), 335-339.
Spence, R. and Smith, C., 2006, "Mating preference of female zebrafish, Danio rerio, in
relation to male dominance", Behavioral Ecology, 17(5), 779.
Spence, R., Fatema, M., Ellis, S., Ahmed, Z., and Smith, C., 2007, "Diet, growth and
recruitment of wild zebrafish in Bangladesh", Journal of Fish Biology, 71(1), 304-309.
Spence, R., Jordan, W. C. and Smith, C. 2006, "Genetic analysis of male reproductive success
in relation to density in the zebrafish, Danio rerio", BMC Frontiers in Zoology, 3(5),
doi:10.1186/1742-9994-3-5.
Tan, Q., Zagrodny, A., Bernaudo, S., and Peng, C., 2009, "Regulation of membrane progestin
receptors in the zebrafish ovary by gonadotropin, activin, TGF-β and BMP-15",
Molecular and Cellular Endocrinology, 312(1-2), 72-79.
PART 2: DEVELOPMENT
Chapter 7
LOCALIZATION OF THE SODIUM-POTASSIUM-

CHLORIDE COTRANSPORTER
(SLC12A2) DURING ZEBRAFISH
EMBRYOGENESIS AND MYOGENESIS
AND A SCREEN FOR ADDITIONAL ANTIBODIES
TO STUDY ZEBRAFISH MYOGENESIS
Ian Dew1, Linda M. Sircy1, Lauren Milleville1,

Michael R. Taylor2, Charles A. Lessman3 and Ethan A. Carver *1
1
Department of Biological and Environmental Sciences,
University of Tennessee at Chattanooga, Chattanooga, TN, US
2
Department of Chemical Biology and Therapeutics,
St. Jude Children‘s Research Hospital, Memphis, TN, US
3
Department of Biological Sciences, The University of Memphis, Memphis, TN, US
ABSTRACT
The objective of the current study was to screen a series of commercially avaliable
antibodies in order to determine if they would bind specifically to target proteins in
zebrafish musculature for use in fluorscence confocal microscopy. Many of these
antibodies were not developed specifically for use in zebrafish; but because of the near
universality of many basic muscle proteins among species these antibodies could
potentially bind to homologus proteins in zebrafish. Of these, T4, for the protein Slc12a,
has not been well described. We reviewed antibody expression in the muscle and
evaluated the protein localization of Slc12a in zebrafish development. T4 was visualized
within the skeletal muscle, where it may play an important role in ion regulation during
muscle activity. Overall, the use of these antibodies will allow researchers access to tools
*
Corresponding Author: Ethan A. Carver Ph.D. Department of Biological and Environmental Sciences, The
University of Tennessee at Chattanooga, 615 McCallie Avenue, 215 Holt Hall, Chattanooga, TN 37363, US,
Phone: (423) 425-4315, Email:ethan-carver@utc.edu
136 Ian Dew, Linda M. Sircy, Lauren Milleville et al.
known to work within the zebrafish and enable more studies using this organism as a
model system for muscle development.
Keywords: Zebrafish, antibodies, sarcomere, muscle development
INTRODUCTION
Zebrafish as a Model Organism
The zebrafish (Danio rerio) has established itself as a major vertebrate organism for the
study of developmental processes. Danio rerio Zebrafish are a tropical freshwater fish
belonging to the minnow family (Cyprinidae) and is native to India. There are many
characteristics of D. reriozebrafish that contribute to its use as a model organism. D. rerio
Zebrafish exhibit optical transparency during development, rapid temporal development, the
existence of mutant strains, and an ease and low cost associated with colony management. In
addition, zebrafish also exhibit external fertilization, which can be artificially induced by the
experimenter to produce a large number of progeny for laboratory use (Nüsslein-Volhard &
Dahm, 2002). Because this species is capable of breeding year round in controlled conditions,
continuous studies utilizing this organism can occur (Gilbert, 2006). The use of zebrafish
provides the researcher a model organism with the observational and manipulative ease
associated with invertebrate models as well as all of the developmental features common to
vertebrates (Liesche & Currie, 2007). These advantages allow the zebrafish to be utilized as a
model for a number of different areas. This chapter will focus on the use of Danio rerio
zebrafish as a model to study striated muscle formation.
Early Development and Structure of Musculature in Zebrafish
The skeletal musculature of zebrafish is a derivative of the mesoderm, which arises from
the somites during the segmentation stage of development. Muscle tissue functions to
coordinate movement, and can support and surround the skeleton and organ systems. In
zebrafish, the majority of skeletal muscle forms from the somites and is involved in
movement of the trunk and fins as well as the pharyngeal muscles used in respiration and
feeding. As the somite forms and differentiates, it will contain three distinct regions known as
the dermatome, the myotome and the sclerotome. In general, the sclerotome will form skeletal
structures such as the vertebrae. The dermatome and the myotome are originally found
together in a dorsal structure known as the dermamyotome, however this structure soon
separates and the dermatome helps form the dermis and the myotome contributes to a large
amount of the trunk skeletal muscle (Macintosh, 2006).
As an organ, muscle contains bundles of muscle cells, also known as fascicles, as well as
connective tissue, blood vessels, and nerves. Within each muscle fascicle, there reside many
muscle cells, also known as muscle fibers. Skeletal muscle fibers are elongated cells that run
the length of the muscle and contain multiple peripheral nuclei that lie immediately below the
sarcolemma, or plasma membrane. The muscle fiber‘s semi fluid cytoplasm, sarcoplasm, is
filled with mitochondria and hundreds of myofibrils. Myofibrils are banded, rod-like elements
Localization of the Sodium-Potassium-Chloride Cotransporter … 137
that contain the fiber‘s contractile machinery. Each myofibril is essentially a repetitive series
of sarcomeres. Sarcomeres are comprised of overlapping thick and thin filaments made of
myosin and actin proteins respectively that are visualized as muscle striations (Figure 1;
Stanfield, 2007). Actin is a muscle protein that forms filaments with a double-helical
structure. Associated with actin filaments are the proteins tropomyosin and troponin in
addition to nebulin, which aids in strengthening muscle structure (Macintosh, 2006). Myosin
is made of two globular heads and two -helix tails wrapped around one another. Hundreds
of individual myosin proteins link together in order to form one myosin filament (Macintosh,
2006).
Figure 1. Model of a sarcomere. This model names and places the major proteins within the contractile
element. The sarcomere is a repeated structure along a myofibril.
Together the thin actin filaments and the thick myosin filaments form the alternating dark
and light bands associated with muscle tissue and visualized as muscle striations. The myosin
filaments form the dark, anisotropic A-bands, and the actin filaments form the light, isotropic
I-bands. The actin and myosin filament partially overlap one another in resting muscle, but
there is a region, the H-zone, in which the two do not overlap. Within this region there is a
dark line that runs perpendicular to the actin and myosin filaments. This dark region is known
as the M-line and contains filaments of myomesin, which run parallel to the myosin filaments
and create a space between the myosin thick filaments (Macintosh, 2006). Titin filaments also
make up part of the muscle structure. These are bound to -actinin in the Z-disks and
myomesin in the M-line and act as stabilizers for the myosin thick filaments (Macintosh,
2006). Collectively, these make up a number of the proteins and structures within a sarcomere
(Figure 1). These form the repetitive units that make up a bulk of the myofiber, and then
collect together as part of the muscle fasicle.
A sac-like membranous network called the sarcoplasmic reticulum surrounds each of the
individual myofibrils. The sarcoplasmic reticulum and associated transverse (t) tubules help
transmit signals from the sarcolemma to the myofibrils, allowing the muscle cell to uniformly
respond to a neural input (Stanfield, 2007). Initial signals for muscle contraction begin with
the nerve cell as an action potential; subsequent myofibril contraction is then initiated as a
result of the release of Ca2+ ions from the sarcoplasmic reticulum. This sudden release of
Ca2+ ions changes the cell‘s membrane potential. Other ion gradients across the
plasmalemma become activated during muscle activity based on the release and reuptake of
Ca2+ ions with the fiber. These other ions, such as Na+, K+ and Cl-, maintain normal
transmembrane gradients and counteracts changes in ion gradients due to muscle activity.
Collectively, these proteins make up the contractile elements of skeletal muscle and are
present in vertebrate musculature. We use the zebrafish as a model to better understand the
interrelationships between these proteins and how they interact during development and
myogenesis to create the functional elements of the muscle.
In this chapter, we describe the identification of antibodies that cross-react with various
proteins within the muscle and sarcomere of zebrafish. Some of these antibodies have been
previously published (Brand et al. 1996; Barresi et al. 2001; Bessarab et al. 2008; Câmara-
Pereira et al. 2009; Codina et al. 2010; Hinitis et al. 2009 Hinits et al. 2012; Grosskurth et al.
2008;
Knight et al. 2008; Ochi & Westerfield, 2009; Piotrowski & Nüsslein-Volhard, C. 2000;
Tallafuss & Eisen, 2008; Tee et al. 2009; Walters et al. 2009).
Here, we use these antibodies to focus on muscle structure and development and illustrate
their localization within muscle fibers. We also include a more comprehensive study of the
zebrafish Slc12a2 antibody (i.e., T4) during embryogenesis and muscle development. This
provides beneficial information on muscle development and begins to study the role that
Slc12a2 has in ion transport within this tissue.
METHODS
Zebrafish Husbandry and Egg Collection
The approved IACUC protocols to be used in this study include; protocols #0306EAC-
01, #0806EAC-02, #0306EAC-03, and are based upon and modified from prior zebrafish
work (Westerfield, 1994; Brand et al. 2002; Nüsslein-Volhard & Dahm, 2002). In this
experiment, wild-type zebrafish were raised in 10-gallon tanks. These tanks were maintained
at 28C and the water was filtered to remove fish waste and debris and to slow algal growth.
In each tank, between 10 to 20 male and female zebrafish were housed. The water supply is
slightly acidic, so in order to maintain the proper pH of 7 to 7.5, sodium bicarbonate was
added to the tank water.
To collect embryos, a plastic container with a layer of glass marbles was placed atop an
inverted glass bowl within each tank. During mating, the fertilized eggs would fall to safety
within the marbles.
Tanks were checked daily to ensure cleanliness, and proper temperature and pH were
maintained. If the tanks had experienced significant algal growth, the fish were carefully
removed and placed temporarily in holding tanks so that the mating tanks could be properly
cleaned. If needed, the tanks were topped-off with fresh tank water.
The mating tanks were checked daily for embryos. If embryos were present, they were
carefully removed using a plastic pipette and placed in a small container with special egg
water and a drop of anti-fungal methylene blue solution (Westerfield, 1994). The embryos
were either raised to maturity or incubated until the desired developmental stage was reached.
The water used for storing eggs is a diluted salt water solution of 1.5 milliliters of stock
solution (140 g Instant Ocean Sea Salts [Aquarium Systems, Inc.] in one liter of distilled
water) in one liter of reverse osmosis water.
Adult fish were fed dry flake food (Tetramin) daily. Newly hatched fry were fed
paramecium once or twice a day. If not used for this experiment, the young zebrafish were
moved into nursery tanks after twenty-one days, and were fed brine shrimp, paramecium and
flake food before being moved to adult maintanence tanks.
Histological Fixation of Embryos
When embryos reached the desired developmental stage (Kimmel, 1995), histological
fixation was used to preserve the embryos for future use.
Euthanized embryos of the desired developmental stage were placed into 1.5 mL
Eppendorf tubes and 1 mL of 4% Paraformaldehyde (PFA) was added to the tube. After
incubation at room temperature for 15 minutes, the PFA was removed and the samples were
then washed with 1 mL of Phosphate Buffered Saline (PBS) to dilute any residual PFA
remaining in the tube with the embryos. After dilution with the PBS, this solution, too, was
removed and 1 mL of 100% methanol was added to the tube, and the embryos were storred at
-20 until the embryos were needed.
Whole-Mount Antibody Staining

The immunohistochemistry protocol used in this study was a modified version of the
protocol described in Nüsslein-Volhard (2002).
Day 1
Three to six embryos of the desired developmental time point were removed from their
respective Eppendorf tube and placed into a viewing dish along with a few milliliters of 100%
methanol. If the chorion was still intact it was carefully removed by viewing the embryo
under a dissecting microscope and using a set of tweezers to slowly peel away the chorion.
Once the embryos were properly prepared, they were placed back into an Eppendorf tube
and taken through a methanol-PBS gradient of descending concentrations of methanol. Each
wash was of a 5 minute duration and consisted of a 100% methanol wash, 75% methanol to
25% PBS, 50% methanol to 50% PBS, and 25% methanol to 75% PBS. The embryos were
then washed twice for ten minutes each wash in 1 mL 1X PBS solution. After the two 10
minute washes the embryos were washed four times in 1 mL PBS 1% Triton (PBST) solution
for 10 minutes each wash. The embryos were then immersed in 0.5 mL of primary antibody
solution and incubated overnight in 4C refrigeration.
Day 2
After incubation with the primary antibody, the embryos were removed from
refrigeration and the Eppendorf tube was incubated 15 minutes at room temperature. The
primary antibody was removed and placed back into its original tube for reuse. The embryos
were then washed four times with 1 mL of 1X PBS for 30 minutes each. This series of washes
dilutes any residual primary antibody. After the series of washes was completed the embryos
were incubated over night in AlexaFluor 488 secondary antibody at 4C.
Day 3
The Eppendorf tube was removed from incubation and the secondary antibody was
removed and placed back into the original container for reuse. The embryos were then
washed four times using 1 mL PBS for 30 minutes each wash. After the final wash the
embryos were mounted onto slides and counter-stained using Anti-Fade Dapi-Fluoromount-G
(Southern Biotech).
Antibodies Used in Screening
The following antibodies were used to probe various muscle proteins within the skeletal
musculature of zebra fish embryos:
A4.1025
The A4.1025 antibody, developed by Helen M. Blau at Stanford University, was obtained
from the Developmental Studies Hybridoma Bank developed under the auspices of the
NICHD and maintained by The University of Iowa, Department of Biology, Iowa City, IA
52242 (Webster et al. 1998).
CT3
The CT3 antibody, developed by J. Lin, was obtained from the Developmental Studies
Hybridoma Bank developed under the auspices of the NICHD and maintained by The
University of Iowa, Department of Biology, Iowa City, IA 52242.
EB165
The EB165 antibody, developed by Everett Bandman at University of California at Davis,
was obtained from the Developmental Studies Hybridoma Bank developed under the auspices
of the NICHD and maintained by The University of Iowa, Department of Biology, Iowa City,
IA 52242 (Cerny & Bandman, E. 1986). EB165 binds to fast myosin heavy chain isoforms,
and was used at a 1:200 dilution and has been successful in zebrafish (Ochi & Westerfield,
2009; Tee et al. 2009; Walters et al. 2009).
F59
The F59 antibody, developed by Stockdale, was obtained from the Developmental
Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The
University of Iowa, Department of Biology, Iowa City, IA 52242 (Miller & Stockdale, 1986).
F59 binds to myosin heavy chain isoforms, and was used at a 1:200 dilution during
experiments.
MF20
The MF20 antibody, developed by Donald Fischman at Cornell, was obtained from the
Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and
maintained by The University of Iowa, Department of Biology, Iowa City, IA 52242. MF20
should bind to all sarcomere myosin and light meromyosin of skeletal muscle (Bader, Masak
& Fischman, 1982).
T11
The T11 monoclonal antibody was purchased from Sigma (T9030) (Wang, 1985).
T11 is a primary antibody that binds to titin filaments, which are present in sarcomeres of
striated muscles. This antibody was used successfully at a concentration of 1:1000.
T4
T4 is a polyclonal mouse anti-human NKCC1 antibody (1:2000; gift from Dr. Donald
Thomason) and was developed by Christian Lytle at University of California Riverside. It
was also obtained from the Developmental Studies Hybridoma Bank developed under the
auspices of the NICHD and maintained by The University of Iowa, Department of Biology,
Iowa City, IA 52242 (Lytle et al. 1995).
4D9
The 4D9 antibody, developed by Corey Goodman at the University of Californa at
Berkeley, was obtained from the Developmental Studies Hybridoma Bank developed under
the auspices of the NICHD and maintained by The University of Iowa, Department of
Biology, Iowa City, IA 52242 (Patel et al. 1989).
Secondary antibody: Alexa Fluor-488 conjugated Goat anti-mouse IgG (1:100;
Molecular Probes). The secondary antibody alone did not specifically bind to the embryo
proper in any measurable amount, however, some nonspecific binding did occur within the
yolk compartment. (data not shown).
Confocal Microscopy
The immunohistochemically stained zebrafish embryos were mounted and oriented on

slides for proper visualization of skeletal muscle using an Olympus FluoView FV1000
microscope. Embryos were studied under epi-fluorescent and confocal microscopy. The epi-
fluorescent setting was used to properly view whole embryos before using switching to the
laser confocal settings of the microscope. Confocal microscopy allowed for viewing the
skeletal musculature of the embryos at the cellular level, and analysis of binding of the
different antibodies to their respective muscle proteins. Images were captured and analyzed
using Fluoview software (Olympus America, Inc.) and saved in jpeg format. Then, images
were compiled using Photoshop CC5 (Adobe) and are shown with anterior to the right
throughout.
RESULTS
Most of the embryos tested in these experiments were between 24 and 48 hours post
fertilization (hpf). During this period of development the somites are rapidly specializing into
skeletal musculature of the trunk and tail of the young zebrafish. Nearly all of the features of
adult musculature are present by the 48-hpf stage of development. The muscle fibers consist
of myofibrils composed of a repetitive series of sarcomeres that contain the fiber‘s contractile
elements. The sarcomeres are primarily composed of myosin, actin, and titin proteins as well
as a number of other associated proteins involved in muscle contraction (Figure 1; Stanfield
& Germann, 2007).
Antibodies Showing Specificity for Muscle
T4
Figure 2. T4 localization within the early developing zebrafish. NKCC1 localization along during early
development is visualized. Small bars denote 20 um lengths. A) T4 localization at 1.5 hours post
fertilization with an objective magnification of 20X, with a brightfield background to visualize the cells
and yolk components. B) T4 localization at 1.5 hours post fertilization with an objective magnification
of 20X. This is the same field capture as seen in Figure 2A without brightfield. C) T4 localization at 3
hours post fertilization with a total magnification of 10X. The entire blastula is visible with localization
seen within blastomeres and as illustrated with yellow arrow, discrete regions of the chorion. D) T4
localization at 3 hours post fertilization with a total magnification of 10X. The entire blastula is visible
with a brightfield background to visualize the cells and yolk components. E) T4 localization at 3 hours
post fertilization with a total magnification of 10X. Fluorescence capture only without brightfield, as
seen in Figure 2D. F) T4 localization at 3 hours post fertilization with a total magnification of 40X. The
fluorescent localization is seen within blastomeres.
T4 is a polyclonal mouse anti-human Na+-K+-2Cl- co-transporter type 1 (NKCC1)

antibody, also known as Sodium-potassium-chloride cotransporter (Slc12a2). Overall, the T4
antibody has not been well documented in studies. With this in mind, we used whole-mount
immunohistochemistry utilizing the T4 antibody at various time points in zebrafish
development (Figures 2-6). During development, the T4 antibody stained for zebrafish
Slc12a2 at very early stages. Slc12a2 localization was confined to the blastomeres and not
present with the yolk (Figure 2A and B). This localization continues within the blastomeres,
during the blastula period, again within cells and not the yolk (Figure 2C-F). Slc12a2 protein
expression is also seen within the chorion as a punctate series of localizations. (Figure 2C-
yellow arrows). The blastomeres retain similar patterns of localization throughout
development (Figure 2B and F). By 16 hpf, Slc12a2 still localized within all cells of the
embryo proper; however, some fluorescence is seen within the yolk ( Figure 3). This
nonspecific binding in the yolk is seen with the secondary antibody alone (data not shown).
Figure 3. T4 localization along the entire tailbud region at 16 hours post fertilization is visualized.
Small bars denote 20 um lengths.
As muscle begins to form, we found localization of Slc12a2 within muscle myofibrils

(Figure 4). Slc12a2 has been associated with muscle tissue in rats (Won et al. 1999;
Kristensen, Hansen, & Juel, 2006), however, it has not been well visualized in zebrafish.
The T4 antibody bound within the skeletal myotubes in a very repetitive pattern (Figure
4). Under both low (Figure 4A) and high power magnification (Figure 4B), the Slc12a2
protein is visualized along the length of the myofibrils. This expression pattern was seen
within skeletal muscles during the course of development and does not vary (Figure 4 C and
D, and data not shown). T-tubules are narrow channels that encircle the myofibrils at regular
intervals and lie perpendicular to the long axis of the muscle fiber. These tubules run through
muscle fiber plasma membranes and act as part of excitation-contraction coupling
(MacIntosh, 2006). They function to conduct impulses from the surface to the interior of the
muscle fiber, initiating the release of Ca2+ from the lateral sacs of the SR (MacIntosh, 2006).
The repetitive patterns seen by these localizations lend to postulating that the T4 antibody
associates with the T-tubules themselves, or are in close association with them on the
sarcolemmal membrane.
Figure 4. T4 localization within zebrafish sarcomere. Small bars denote 20 um lengths. A) T4

localization at 1 day post fertilization with an objective magnification of 40X. B) T4 localization at 1
day post fertilization with a total magnification of 300X. C) T4 localization at 2 day post fertilization
with an objective magnification of 40X. D) T4 localization at 2 day post fertilization with an objective
magnification of 40X.
Slc12a2 has been shown to mediate electroneutral transport of Na+ and K+ associated
with 2Cl–ions across membranes in a number of organs (Payne et al. 1995; Xu et al. 1994;
Abbas & Whitfield, 2009). At different time points in zebrafish development, we looked at
localization of Slc12a2 through T4 antibody staining outside of truck musculature.
Localization of Slc12a2 was observed in the developing lens at different stages of
development (Figure 5A and B). Also, different regions of skeletal muscle illustrate the
presence of Slc12a2, as seen in cranial skeletal muscle (Figure 5C and D). Otic expression in
zebrafish was seen as well (data not shown), and mice homozygous for a knockout of the
NKCC1 gene are profoundly deaf and have other growth and neurological defects (Delpire et
al. 1999; Flagella et al. 1999). Slc12a2 localization is seen in the cardiac muscle as well
(Figure 6). Overall, the T4 antibody has been shown to work well with zebrafish and provide
a resource for experimentation to better understand the role of Slc12a2 in development and
functionality within different organ systems.
Figure 5. T4 localization within different zebrafish organs. Small bars denote 20 um lengths. A) T4
localization in the lens at 1 day post fertilization with an objective magnification of 40X. B) T4
localization in the lens at 3 day post fertilization with a total magnification of 60X. T4 localization is
more intense at this stage and better defined within the lens and not the surrounding cells. C) T4
localization in cranial musculature at 5 day post fertilization with an objective magnification of 4X. The
yellow box encompasses the region that is shown in Figure 5D. D) T4 localization at 2 day post
fertilization with a total magnification of 140X.
Figure 6. T4 localization within the zebrafish heart. Small bars denote 20 um lengths. A) T4 localization
in the heart at day 2 post fertilization with an objective magnification of 40X. The heart is seen with
both a brightfield background and fluorescence to visualize the heart, surrounding cells and yolk
components (upper region of the figure). B) T4 localization in the ear at day 2 post fertilization with a
total magnification of 40X. This is the same image as Figure 6A without brightfield illumination. T4
localization within the sarcomere structures (white arrows) are seen within the cardiac muscle tissue.
A4.1025
The A4 monoclonal antibody has been tested at concentrations of 1:200 and bound
specifically to its target proteins. This antibody is specific for the myosin heavy chain protein;
this antibody has been successfully used in previous experiments on zebrafish (Bessarab et al.
2008; Hinitis et al. 2009). These proteins are both the fast and slow twitch striated muscle
myosin heavy chain isoforms (Blagden et al, 1997, Scnapp et al. 2009). Specimens stained
with A4 at this concentration had clearly visible fluorescence within the sarcomeres due to the
antibody binding to the myosin bands (Figure 7). Myosin represents the dark banding of the
striations seen under a regular light microscope within skeletal and heart muscle. The bands
of fluorescence are very broad, with small intervening spaces in between, and have similar
fluorescing regions for both 1 and 2 days post fertilization (Figure 7). This localization
pattern is indicative of the width of the myosin protein within each individual sarcomere
(Figure 1).
MF20
MF20 is an anti-myosin antibody. MF20 has been used successfully in prior experiments
on zebrafish (Barresi et al. 2001). In experiments where MF20 was diluted to concentrations
of 1:20, the specimens that had been stained with the antibody displayed a general wash of
fluorescence, which inhibited the proper visualization of the skeletal muscle structure.
However, when the antibody is diluted to concentrations of 1:40 repetitive myosin
localization within the sarcomeres were clearly visible from the antibody binding properly
(Figure 8A and B). This expression pattern is seen as early as 1 day post fertilization (dpf)
and throughout development (data not shown). One thing to note with this antibody as
compared to the A4.1025 anti-myosin antibody or the F59 anti-myosin antibody, it is that the
MF20 localization domain is less broad. (Figures 7 and 8). This may be due to the specificity
and actual target region differences between the two antibodies.
Figure 7. A4.1025 localization to myofibrils within the zebrafish. Myosin localization along the length
of the myofibril in broad domains are seen. Small bars denote 20 um lengths. A) A4.1025 localization at
1 day post fertilization with an objective magnification of 40X. B) A4.1025 localization at 2 day post
fertilization with an objective magnification of 60X.
F59
F59 is another anti-myosin heavy chain antibody. F59 has been used successfully in prior
experiments on zebrafish (Codina et al. 2010, Tallafuss & Eisen, 2008, Hinits et al. 2012). In
experiments where MF20 was diluted to concentrations of 1:200, myosin localization was
repeated as a broad domain within the sarcomeres (Figure 8C and D). This localization
pattern closely mimics the broad pattern seen using the A4.1025 antibody (Figure 7 and
Figure 8C and D).
T11
T11 is an anti-titin antibody that binds to titin filaments present in sarcomeres of striated
muscles. The T11 antibody was used successfully at a concentration of 1:1,000. It has also
been used in zebrafish (Câmara-Pereira et al. 2009). Bands of titin protein were clearly visible
at 2 dpf. (Figure 9A). When we increased the magnification to 180X, we noticed a finer
sublocalization of Titin within the sarcomere. The antibody staining revealed a repeating
doublet of expression within the sarcomere (Figure 9B, arrows). Contrary to myosin patterns,
titin proteins are located on either side of a myosin protein, and are present twice within a
sarcomere (Figure 1). As shown in Figure 9B, the arrowheads point to the doublet expression.
The white arrowheads bracket one domain, sarcomere, of titin localization, and then the
yellow arrowheads denote the next sarcomere. The larger space between the domains is where
myosin proteins reside (Figure 7 and 8 C and D). Experiments using antibodies to T11 in
conjunction with A4.1025 or F59, will resolve this structure. This finer resolution localization
at a higher magnification and may allow for a better understanding of sarcomere assembly.
Figure 8. MF20 and F59 localization to myofibrils within the zebrafish. Myosin localization along the
length of the myofibrils are seen. Notice MF20 has a relatively small region of fluorescence, while F59
has a much broader region of expression similar to A4.1025. Small bars denote 20 um lengths. A)
MF20 localization at day 2 post fertilization with an objective magnification of 40X. B) MF20
localization at 2 day post fertilization with an objective magnification of 60X. C) F59 localization at
day 2 post fertilization with an objective magnification of 40X. D) F59 localization at 2 day post
fertilization with an objective magnification of 60X.
Figure 9. T11 localization to myofibrils within the zebrafish. Titin localization along the length of the
myofibril is seen. Small bars denote 20 um lengths. A) T11 localization at 1 day post fertilization with
an objective magnification of 40X. B) T11 localization at 2 day post fertilization with a total
magnification of 180X. Yellow and white arrowheads denote 1 sarcomere unit with T11 localization on
either end of the sarcomere.
Antibodies That Showed No Specific Localization to Sarcomere Components
4D9
The 4D9 primary antibody was tested at a dilution of 1:300 and failed to bind specifically
to its protein. When viewed under confocal microscopy the stained embryos presented a
general wash of fluorescence that did not yield any focused localization within the zebrafish
either within muscle or within other regions of the zebrafish (Figure 10A). The engrailed gene
products are present within zebrafish and have been visualized within the head regions of
zebrafish (Brand et al. 1996; Knight et al. 2008; Piotrowski & Nüsslein-Volhard, C. 2000).
Currently, we are testing different dilutions of the 4D9 antibody to improve results.
CT3
CT3 was diluted to a concentration of 1:100 but failed to bind specifically to a protein.
Once again embryos stained with such an antibody failed to provide specimens that could be
viewed properly with the confocal microscope (Figure 10B). It has been visualized in
zebrafish heart (Grosskurth et al. 2008). However, we have not seen this localization with our
dilutions. We are currently testing other dilutions of this antibody.
EB165
The EB165 antibody failed to bind specifically within the embryo at a 1:100 or 1:200
dilution (Figure 10C). It has been reported to bind to fast myosin heavy chain isoforms
successful in zebrafish (Ochi & Westerfield, 2009; Walters et al. 2009; Tee et al. 2009).
Further experiments with other dilutions are underway.
Figure 10. Illustration of antibody localization to skeletal muscle. These proteins have given a general,
nonspecific binding to all cells within the developing zebrafish. Small bars denote 20 um lengths. A)
CT3 pattern of localization at day 2 post fertilization with an objective magnification of 40X. B) 4D9
pattern of localization at day 2 post fertilization with an objective magnification of 40X. C) EB165
pattern of localization at day 2 post fertilization with an objective magnification of 40X.
DISCUSSION
The objective of this project was to gain a more definitive view of zebrafish musculature
through the use of monoclonal antibodies that might bind to specific target proteins within the
zebrafish musculature. Examining these antibodies collectively and examining their activity is
useful for building a better picture of zebrafish muscle development.
Out of the antibodies that were tested, three were nonspecific and the others produced
specific staining patterns that could be visualized using confocal microscope. The nonspecific
antibodies produced a general background wash of fluorescence, which inhibited the proper
visualization of muscle structure at the cellular level. The MF20 monoclonal antibody binds
to sarcomere myosin in striated muscle and was tested successfully at concentrations of 1:40.
The use of the MF20 antibody on zebrafish specimens allowed for clear visualization of the
sarcomeres of the skeletal musculature. The A4 monoclonal antibody binds to both fast and
slow twitch striated muscle myosin heavy chain isoforms (Blagden et al, 1997, Scnapp et al.
2009). When zebrafish samples were visualized with this antibody, the sarcomeres were
visible from the A4 antibody binding to myosin bands. The T11 antibody binds to titin
filaments within the sarcomeres of striated muscle, and titin bands were easily visualized in
zebrafish samples that were stained with this antibody.
From this study it is clear that zebrafish musculature can be characterized by the use of
various monoclonal antibodies, which bind to specific proteins in the muscle tissue. The
successful antibodies work well, produce low amounts of background fluorescence, and the
results obtained from whole-mount antibody staining are highly reproducible. These
antibodies can be used in future studies examining the development of zebrafish musculature.
For example, the effects of certain mutations affecting muscle proteins can be compared to
wild-type musculature through a comparative staining. The expression at certain
developmental time periods of specific muscle proteins can also be examined using these
antibodies. Many issues involving the development of zebrafish skeletal muscle can be
addressed using the antibodies screened in this study.
CONCLUSION
Overall, we screened a series of commercially avaliable antibodies that localized to
zebrafish musculature using in fluorscence confocal microscopy. Many of these antibodies
have been published (Brand et al. 1996; Barresi et al. 2001; Bessarab et al. 2008; Câmara-
Pereira et al. 2009; Codina et al. 2010; Hinitis et al. 2009 Hinits et al. 2012; Grosskurth et al.
2008; Knight et al. 2008; Ochi & Westerfield, 2009; Piotrowski & Nüsslein-Volhard, C.
2000; Tallafuss & Eisen, 2008; Tee et al. 2009; Walters et al. 2009), but we verified and
expanded their localization within skeletal muscle. We illustrated differences in the
localization domains between different anti-myosin antibodies, and illustrated a fine detail
localization of the T11, anti-titin antibody. We focused on the protein localization of Slc12a
using the T4 antibody in early zebrafish development and later during muscle formation,
where it may play an important role in ion regulation during muscle activity. Overall, the use
of these antibodies will allow researcher access to tools known to work within the zebrafish
and enable more studies using this organism as a model system for muscle development.
ACKNOWLEDGEMENTS
This research material is based upon workwas supported by National Science Foundation
under grant Grant No. (DBI-0922941)., Research reported in this publication was supported
by the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National
Institutes of Health under Award Number 1R15AR055798-01A1. The content is solely the
responsibility of the authors and does not necessarily represent the official views of the
National Institutes of Health. National Institutes of Health Grant #1R15AR055798-01A1
Other funding includes, UTC startup funds and UC Foundation Faculty Research Grant
#R04-1011-088 to EAC. A UTC provost award funds part of the research to LM. Portions of
this chapter are part of research conducted in partial fulfillment of Undergraduate
Departmental Honors projects (LS and LM). Open access publication costs of this chapter
were defrayed though the generosity of Dr. Jeff Elwell, Dean of the College of Arts and
Sciences at the University of Tennessee at Chattanooga.
REFERENCES
Abbas, L., & Whitfield, T.T. 2009, ―Nkcc1 (Slc12a2) is required for the regulation of
endolymph volume in the otic vesicle and swim bladder volume in the zebrafish larva",
Development 136(16), 2837–2848.
Bader, D., Masaki T., & Fischman D.A. 1982, "Immunochemical analysis of myosin heavy
chain during avian myogenesis in vivo and in vitro", The Journal of Cell Biology,
95(3),763-70.
Barresi, M.J.F., D'Angelo, J.A., Hernández, L.P., & Devoto, S.H. 2001, "Distinct mechanisms
regulate slow-muscle development", Current Biology, 11(18), 1432-8.
Bentzinger, C.F., Wang, Y.X., & Rudnicki, M.A. 2012, "Building muscle: molecular
regulation of myogenesis", Cold Spring Harb Perspect Biology, 4(2), a008342.
Bessarab, D.A., Chong, S.W., Srinivas, B.P., & Korzh, V. 2008, "Six1a is required for the
onset of fast muscle differentiation in zebrafish", Dev. BiolDevelopmental Biology,.
323(2), 216-228.
Blagden, C.S., Currie, P.D., Ingham, P.W., & Hughes, S.M. 1997, "Notochord induction of
zebrafish slow muscle mediated by Sonic hedgehog", Genes and Dev. elopment, 11(17),
2163–2175.
Brand, M., Heisenberg, C.P., Jiang, Y.J., Beuchle, D., Lun, K., Furutani-Seiki, M., Granato,
M., Haffter, P., Hammerschmidt, M., Kane, D.A., Kelsh, R.N., Mullins, M.C., Odenthal,
J., van Eeden, F.J., & Nüsslein-Volhard, C. 1996, "Mutations in zebrafish genes affecting
the formation of the boundary between midbrain and hindbrain", Development, 123, 179-
190.
Brand, M., Granato, M., & Nusslein-Volhard, C. 2002, Keeping and raising zebrafish. In:
Nusslein-Volhard C, Dahm R, editors. Zebrafish: a practical approach. 2002. Oxford,
UK: Oxford University Press. p 7-37.
Câmara-Pereira, E.S., Campos, L.M., Vannier-Santos, M.A., Mermelstein, C.S., and Costa,
M.L., 2009, ―Distribution of cytoskeletal and adhesion proteins in adult zebrafish skeletal
muscle‖, Histological Histopathology, 24(2), 187-196.
Cerny, L. C. & Bandman, E. 1986, "Contractile activity is required for the expression of
neonatal myosin heavy chain in embryonic chick pectoral muscle cultures", The Journal
of. Cell Biology,. 103, 2153 -2161.
Codina, M., Li, J., Gutiérrez, J., Kao, J.P., & Du, S.J., 2010, ―Loss of Smyhc1 or
Hsp90alpha1 function results in different effects on myofibril organization in skeletal
muscles of zebrafish embryos”, PLoS One, 5(1), e8416.
Delpire E., Lu, J., England, R., Dull, C., & Thorne, T., 1999, ―Deafness and imbalance
associated with inactivation of the secretory Na-K-2Cl co-transporter.‖ Nature Genetics,
22(2),192-5.
Flagella, M., Clarke, L.L., Miller, M.L., Erway, L.C., Giannella, R.A., Andringa, A.,
Gawenis, L.R., Kramer, J., Duffy, J.J., Doetschman, T., Lorenz, J.N., Yamoah, E.N.,
Cardell, E.L., Shull, G.E., 1999, ―Mice lacking the basolateral Na-K-2Cl cotransporter
have impaired epithelial chloride secretion and are profoundly deaf‖, Journal of
Biological Chemistry, 274(38), 26946-55.
Flucher, B.E., Andrews, S.B., & Daniels, M.P. 1994, "Molecular organization of transverse
tubule/sarcoplasmic reticulum junctions during development of excitation-contraction
coupling in skeletal muscle", Molecular Biology of the Cell, 5(10), 1105–1118.
Gilbert, Scott F. (2006). Developmental Biology. (8th ed.). Sunderland, MA: Sinauer
Associates, Inc.
Gunning, P., O‘Neill. G, & Hardeman, E. 2008, "Tropomyosin-based regulation of the actin
cytoskeleton in time and space", Physiological Rev. iews, 88(1):1-35.
Grosskurth, S.E., Bhattacharya, D., Wang, Q., & Lin, J.J. 2008, "Emergence of Xin
demarcates a key innovation in heart evolution", PLoS One, 3(8), e2857.
Hinits, Y., Osborn, D.P., & Hughes, S.M. 2009, "Differential requirements for myogenic
regulatory factors distinguish medial and lateral somitic, cranial and fin muscle fibre
populations", Development, 136(3), 403-414.
Hinits, Y., Pan, L., Walker, C., Dowd, J., Moens, C.B., & Hughes, S.M., 2012 ―Zebrafish
Mef2ca and Mef2cb are essential for both first and second heart field cardiomyocyte
differentiation‖, Developmental Biology, Dev. Biol. 369(2), 199-210.
Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., & Schilling, T.F., 1995, ―Stages
of embryonic development of the zebrafish‖, Developmental Dynamics, 203(3), 253-310.
Knight, R.D., Mebus, K., &Roehl, H.H. 2008, "Mandibular arch muscle identity is regulated
by a conserved molecular process during vertebrate development", Journal of
Experimental Zoology Part B: Molecular and Developmental Evolution, J. Exp. Zoolog.
B Mol. Dev. Evol. 310(4), 355-369.
Lieschke GJ, & Currie PD. 2007, "Animal models of human disease: zebrafish swim into
view", Nature Reviews Genetics, 8(5), 353-367.
Lytle, C., Xu, J-.C., Biemesderfer, D., & Forbush III, B. 1995, "Distribution and diversity of
Na-K-C1 cotransport proteins: a study with monoclonal antibodies", Am. erican Journal
of. Physiol. ogy, 269, C1496-C1505.
MacIntosh, B.R., Gardiner, P.F., & McComas, A.J. 2006, Skeletal muscle: form and function,
2nd ed. Human Kinetics, Champaign (IL).
Miller, J.B. & Stockdale, F.E. 1986, ―Developmental origins of skeletal muscle fibers: clonal
analysis of myogenic cell lineages based on expression of fast and slow myosin heavy
chains.‖ Proc Natl Acad Sci U S A. 83(11), 3860–3864.
Nüsslein-Volhard C, & Dahm R. 2002, Zebrafish: a practical approach. NY: Oxford
University Press.
Ochi, H. & Westerfield, M. 2009, "Lbx2 regulates formation of myofibrils", BMC
Developmental. Biol. ogy, 9: 13.
Patel, N.H., Martin-Blanco, E., Coleman, K,.G., Poole, S.J., Ellis, M.C., Kornberg, T.B., &
Goodman, C.S. 1989, "Expression of engrailed proteins in arthropods, annelids, and
chordates", Cell, 58(5), 955-68.
Payne, J. A. & Forbush, B., 3rd. (1995). "Molecular characterization of the epithelial Na-K-Cl
cotransporter isoforms", Curr. Opin. Cell Biol. Current Opinion in Cell Biology, 7, 493-
503.
Piotrowski, T. & Nüsslein-Volhard, C. 2000, "The endoderm plays an important role in
patterning the segmented pharyngeal region in zebrafish (Danio rerio) ", Developmental
Biology, Dev. Biol. 225(2), 339-356.
Stanfield, C. L., & Germann, W.J. (2007). Principles of Human Physiology. (3rd ed.). New
York: Pearson/Benjamin Cummings.
Schnapp, E., Pistocchi, A.S., Karampetsou, E., Foglia, E., Lamia, C.L., Cotelli, F., & Cossu.
G., 2009, "Induced early expression of mrf4 but not myog rescues myogenesis in the
myod/myf5 double-morphant zebrafish embryo", Journal of Cell Science, 122(4),481-8.
Tallafuss, A., & Eisen, J.S., 2008, ―The Met receptor tyrosine kinase prevents zebrafish
primary motoneurons from expressing an incorrect neurotransmitter‖ Neural
Development, 3:18.
Tee, J.M., van Rooijen, C., Boonen, R., & Zivkovic, D. 2009, "Regulation of slow and fast
muscle myofibrillogenesis by Wnt/beta-catenin and myostatin signaling", PLoS One,
4(6), e5880.
Walters, K.B., Dodd, M.E., Mathias, J.R., Gallagher, A.J., Bennin, D.A., Rhodes, J., Kanki,
J.P., Look, A.T., Grinblat, Y., & Huttenlocher, A. 2009, "Muscle degeneration and
leukocyte infiltration caused by mutation of zebrafish fad24" Developmental Dynamics,
Dev. Dyn. 238(1), 86-99.
Wang D-Z., Reiter, R.S., Lin, J.L-C., Wang, Q., Williams, H.S., Krob, S.L., Schultheiss,
T.M., Evans, S., & Lin J.J. 1999, "Requirement of a novel gene, Xin, in cardiac
morphogenesis" Development, 126: 1281–1294.
Wang, K. 1985, "Sarcomere-associated cytoskeletal lattices in striated muscle. Review and
hypothesis" Cell Muscle Motility, 6:315-69.
Webster, C., Silberstein, L., Hays, A.P., Blau, H.M. 1988, "Fast muscle fibers are
preferentially affected in Duchenne muscular dystrophy." Cell, 52(4): 503-513.
Westerfield, M. 2004, The zebrafish book. A guide for the laboratory use of zebrafish (Danio
rerio), 4th ed, Univ. of Oregon Press, Eugene.
Wong, J.A., Fu, L., Schneider, E.G., Thomason, D.B. 1999, ―Molecular and functional
evidence for Na+-K+-2Cl− cotransporter expression in rat skeletal muscle‖, America
Journal of Physiology, 277, R154-61.
Xu, J. C., Lytle, C., Zhu, T. T., Payne, J. A., Benz, E., Jr, & Forbush, B., 3rd. 1994,
"Molecular cloning and functional expression of the bumetanide-sensitive Na-K-Cl
cotransporter", Proc. Natl. Acad. Sci. USA, 91, 2201-2205.
Chapter 8
THE ZEBRAFISH DEAD ELVIS (DEL)

MUTANT ENCODES TITINA
Ethan A. Carver1*, Lauren Milleville1, Nominanda I. Barbosa1,

Michael R. Taylor2 and Charles A. Lessman3
1
Department of Biological and Environmental Sciences,
University of Tennessee at Chattanooga, Chattanooga, TN, US
2
Department of Chemical Biology and Therapeutics, St. Jude Children‘s Research
Hospital, Memphis, TN, US
3
Department of Biology, The University of Memphis, Memphis, TN, US
ABSTRACT
This study is focused on a zebrafish mutant, dead elvis (del), discovered using an N-
ethyl N-nitrosourea (ENU)-based screen in association with computer screening
methodology developed in Dr. Lessman‘s laboratory at the University of Memphis. The
del mutation manifests as a non-motile phenotype starting around 20 hours post
fertilization (hpf) and is lethal by five days post fertilization (dpf). Microscopic analysis
of the dead elvis mutant revealed obvious myotome defects, non-motility, cardiac
myopathy and edema, and growth delay. A positional cloning strategy was used to isolate
the del mutation to a small critical interval containing the titina and titinb genes located
on zebrafish chromosome nine. Complementation anaylsis of del with an existing titina
mutant, pikuw2, confirmed that the dead elvis mutant is a new allele of titina. Titin is a
protein involved in sarcomerogenesis, affecting striated muscle structure and proper
muscular function. Immunohistochemistry and confocal microscopy techniques were
used to observe muscle formation and sarcomeric assemblages. A mutation in titina
correlates well with immunohistochemical findings illustrating a lack of sarcomeric
organization. In addition, microarray analysis of the del transcriptome revealed changes
in the expression of transcripts, including titina, involved in sarcomere formation. This
study supports the role of titina in myogenesis and proper muscle formation, and
*
Corresponding Author: Ethan A. Carver Ph.D. Department of Biological and Environmental Sciences, The
University of Tennessee at Chattanooga, 615 McCallie Avenue, 215 Holt Hall, Chattanooga, TN 37363, USA.
Phone: (423) 425-4315. Email:ethan-carver@utc.edu.
156 Ethan A. Carver, Lauren Milleville, Nominanda I. Barbosa et al.
identifies a new titina mutant that exhibits a phenotype that varies from other known
titina alleles.
Keywords: Zebrafish, sarcomere development, Titin, striated muscle, genetic mapping,

immunohistochemistry
INTRODUCTION
The zebrafish (Danio rerio) is a valuable model for research in vertebrate muscle
development. Embryonic development of the musculature involves the differentiation and
interactions of varing components including muscle cells, the nervous system, and the
components that the muscle are bound to, including skeletal elements, cartilage, and other
tissues. For most organisms, the formation and innervation of musculature is a key
developmental event. The ability to initate and complete movement; be it heart contraction,
movement of food through a digestive tract, gross body movements for propulsion, or
movements for a miriade of other functions, is necessary for survival. Improper development
of any of these tissues can result in disorders such as muscular dystrophy, various
myopathies, paralysis or other phenotypes deleterious to the organism. (Amack &
Mahadevan, 2004; Mankodi et al., 2002). Zebrafish homologs of human genes associated
with muscle architecture have been discovered (Basset & Currie, 2003; Costa et al., 2002).
Many of these human genes, if altered, give rise to musculoskeletal diseases (reviewed by
Rahimov & Kunkel, 2013). One advantage to using zebrafish as a model organism is the
ability to generate novel mutations using a variety of techniques (Jao, et al., 2008; Moore et
al., 2012; Sivasubbu et al., 2007). Numerous large-scale ENU screens have been carried out in
the zebrafish (Amsterdam et al., 1999; Muto et al., 2005; Driever et al., 1996; Haffter et al.,
1996). Zebrafish mutants that closely model human diseases such as Duchenne or Becker
muscular dystrophies have been discovered using genetic screens (Bassett et al., 2003; Berger
& Curie, 2012; Granato et al., 2006; Steffen, et al., 2007a). Some of these zebrafish mutants
have been characterized, and affect different aspects of muscle development (Dodd et al.,
2004; Guyon et al., 2003; Guyon et al., 2005, Steffen et al., 2007b).
In this chapter, we describe the characterization of the zebrafish motility mutant, dead
elvis (del). These mutant embryos have a non-motile phenotype throughout development and
die by five days post fertilization. Gross analysis via light microscopy, genetic mapping, and
complementation analysis of del mutants have been completed, and indicate that del is a new
allele of the titina gene. Immunofluorescence microscopy using antibodies that target various
muscle proteins was performed and show fine scale alterations in the architecture of the
sarcomere consistent with the loss-of-function of the Titina protein.
Titin, also known as connectin, is one of several proteins (including actin and myosin)
that make up the filament system associated with the sarcomere. Titin is the largest known
protein (~3.8 MDa), and has a correspondingly large gene structure (~360 exons). In
zebrafish, there are two titin genes, titina and titinb. Titin gives rise to a number of splice
variants whose isoforms range in size (Steffen et al., 2007b). The cardiac isoforms differ from
skeletal muscle titin by the inclusion of the N2B exon, a cardiac-specific exon, and mutations
within this N2B exon give rise to a cardiac specific titinopathy in zebrafish. (Xu et al., 2002).
In zebrafish, the two titin loci are located adjacent to one another and the runzel (ruz) mutant
The Zebrafish Dead elvis (del) Mutant Encodes Titina 157
is associated with mutations in the TTN1 gene (Steffen et al., 2007b). In contrast to the runzel
(ruz) mutant, loss of function of titin associated with the del mutation leads to an earlier onset,
and more severe myopathy.
Further investigation of this mutation may provide insights concerning the role of various
titin mutations in myotome development within striated muscle and could lead to a better
understanding of human neuromuscular disease conditions.

Fish Embryos
The del mutation was isolated using an ENU mutagenesis screen in an AB-like short tail
strain complemented by novel computer-aided motility screens (CAS and CALMS)
(Lessman, 2002; 2004; Lessman et al. 2010). To generate embryos exhibiting the del
phenotype, del heterozygous animals were mated and offspring were were incubated at
28.5°C in E3 embryo medium (Brand et al., 2002; Westerfield, 1994). Embryos were
screened based on motility (CALMS screening) and visual cues (edema, and abnormal size).
These embryos were time-staged, euthanized, and stored depending on their use. To generate
multiple families for linkage analysis, del heterozygotes were outcrossed with wildtype TL
fish. Heterozygotes were identified from the resulting offspring and underwent pairwise
mating to generate homozygous F2 mutant hybrid embryos. All animal work was performed
with approval from the Animal Care and Use Committee (Protocol #0306EAC-01,
#0806EAC-02, #0306EAC-03, to EAC and #0677 to CAL).
Motility Screening and Temporal Stacking
del mutants were assayed over time using a transparency scanner, computer, and
associated software (Lessman, 2002; 2004). Embryos were transferred into multiwell plates,
placed on a flatbed scanner, and repeated images were taken over a time couse. Using ImageJ
software (NIH), the series of images were stacked together; and by animating the stack, del
mutants were readily distinguished by their reduced movement over time (Lessman, 2002;
2004). These images were also layered upon each other to make a composite image that
allows for easy verification of absent or reduced motility.
Genetic Mapping
Mapping crosses were generated by outcrossing del heterzygotes to the TL strain. The
resulting F1 hybrids were incrossed and the F2 del mutants and wild-type siblings were
collected. DNA was isolated and pooled from 30 mutants and wild-type siblings. Genetic
mapping was performed using microsatellite-based linkage mapping methods by bulked
segregant analysis with 192 polymorphic primer pairs evenly distributed across the zebrafish
genome (Muto et al., 2005). Tightly linked polymorphic markers were identified and used to
identify recombinants by PCR and agarose gel electrophoresis. Bulk segregant analysis
revealed linkage to LG9. Using LG9 specific markers, recombination analysis was performed
using DNA isolated from individual F2 embryos.
Complementation Analysis
A complementation analysis can be used to test whether two different mutant lines that
present similar phenotypes are alleles of the same gene. If the mutations are recessively lethal,
heterozygous carriers from each mutant are mated together. If the genes are allelic, a
proportion of the offspring will recapitulate the phenotype. del heterozygote carriers and
pikuw2 heterozygote carriers (gift from Mary C. Halloran) were mated to generate F1 progeny
and screened for allelism.
Antibodies
A series of antibodies were obtained and diluted for use in this study. Primary antibodies
included: anti-actin (Sigma A1978) used at a dilution of 1:200. This monoclonal antibody
targets the thin actin filament of the sarcomere. The anti-desmin antibody ( AC-15; Sigma
5441) was diluted 1:1000 for use. The AC15 monoclonal antibody recognizes the
intermediate filament protein, desmin. F59 antibody (Developmental Studies Hybridoma
Bank) was diluted from a supernate to 1:100. F59 recongnizes adaxil muscle cells in
zebrafish. The T11 antibody (Sigma T9030) from ascites fluid, recognizes Titin, which
extends along the thin filament from the M line to each Z line and anchors the thick myosin
filaments to their proper positions relative to the thin filaments (Wang, 1985). Anti-
tropomyosin, CH1 (Sigma T9283) and used at a 1:100 dilution, is a monoclonal antibody in
ascities fluid which targets the tropomyosin protein in striated muscle that extends over actin
filaments. T4 antibody (initially a gift from Dr. Donald Thomason) was diluted 1:100 for
immunohistochemistry and is a polyclonal mouse anti-human NKCC1 antibody. Additional
amounts of T4 were obtained from the Developmental Studies Hybridoma Bank developed
under the auspices of the NICHD and maintained by The University of Iowa, Department of
Biology, Iowa City, IA 52242 (Lytle et al., 1995). The Zm3 monoclonal antibody recognizes
the branchial and enteric musculature and was obtained from the Zebrafish International
Resource Center at the University of Oregon. This antibody was used at a 1:20 dilution. The
Znp1 monoclonal antibody recognizes motoneuronal axons at a 1:2000 dilution. It was
obtained from the Zebrafish International Resource Center at the University of Oregon.
The secondary antibody used was the Alexa Fluor® 488 Goat Anti-Mouse IgG diluted
1:100 (Molecular Probes). Embryos were counterstained with DAPI using Anti-Fade Dapi-
Fluoromount-G (Southern Biotech).
Whole-mount Immunohistochemistry
Embryos were fixed in 4% paraformaldhyde/PBS (phosphate buffered saline) fixative for

20 minutes at RT, then washed in PBST (1X PBS containing 1% Triton X-100). Embryos
were then dehydrated in methanol and stored at -20° C. Embryos were rehydrated through a
methanol series then a series of PBST washes at RT. Samples were blocked in PBS
containing 10% bovine serum for 1 hour at RT, prior to overnight incubation with a primary
antibody. The primary antibody was removed after incubation, and embryos were
subsequently washed in a series of PBST prior to another overnight incubation with the
Alexaflour 488 secondary antibody. Secondary antibody was removed, and embryos were
washed in PBST then slide mounted in a anti-fade/counter-stain for fluorescence microscopy.
Microscopy and Imaging
Images were captured using an FV1000 confocal microscope (Olympus). Images were
analyzed using Fluoview software (Olympus America, Inc.) and saved in jpeg format. Images
were then compiled using Photoshop CC (Adobe) and are shown with anterior to the left
throughout.
Microarray Analysis
Microarray analysis was completed using 5 dpf del mutants and wild-type siblings.
STAT-60 method: 100 embryos were homogenized in 1 ml of STAT-60 reagent using a
glass-Teflon homogenizer. The sample volume did not exceed 10 % of the volume of STAT-
60 reagent used for homogenization. The homogenate was stored at RT for 5-10 min and then
mixed with 200 μl of chloroform. The sample tube was capped tightly, shaken vigorously for
15 seconds and stored at room temperature for 5 min. The mixture was centrifuged at 12,000g
for 45 min at 4 °C. The colorless upper aqueous phase was transferred to a fresh tube and
mixed with isopropanol (500 μl isopropanol per 1 ml STAT-60 used in the original
homogenization). The sample was stored at room temperature for 30 min and centrifuged at
12,000g for 45 min at 4 °C. The supernatant was carefully removed and the white RNA pellet
was washed once with 80 % ethanol (1 ml ethanol per 1 ml STAT-60 used in the original
homogenization). The washed RNA pellet was collected by centrifugation at 7,500g for 10
min at 4 °C. After the ethanol was discarded, the RNA pellet was air dried, dissolved in
RNase-free water, and stored at -20 °C for future analysis.
Prior to running the microarrays, RNA integrity was determined using Bioanalyzer 2100
analysis. cDNA was synthesized from total RNA (8 g) using the Superscript Double-
Stranded cDNA synthesis kit (Invitrogen Corp, Carlsbad, CA) and poly T-nucleotide primers
that contain a sequence recognized by T7 RNA polymerase. The newly synthesized cDNA
was used as a template to generate biotin-labeled in vitro transcribed (IVT) cRNA using the
Bio-Array High Yield RNA transcript labeling kit (Enzo Diagnostics, Inc, Farmingdale, NY).
The cRNA (20 g) was fragmented to strands of 35 to 200 bases in length and hybridized to
an Affymetrix GeneChip Zebrafish Genome Array at 450C with rotation for 16 h (Affymetrix
GeneChip Hybridization Oven 320). The GeneChip arrays were washed and stained
(streptavidin phycoerythrin) on an Affymetrix Fluidics Station 400, followed by scanning.
Figure 1. Time-lapse imaging of wild-type and del mutant embryos using CALMS. A montage of
images in series are presented at left. These images were stacked one on top of each other and then
collapsed into a composite images at right. The movements of the wild-type embryo are clearly seen,
while the lack of movement in the del embryo is striking.

Phenotypic Characterization of the del Mutant
N-ethyl-N-nitrosourea (ENU) is a powerful mutagen in animals resulting in single, base

pair (point) mutations (Russell et al., 1979, Solnica-Krezel et al., 1994). Small-scale ENU
screens as well as large-scale screens have been carried out in the zebrafish (Amsterdam et al.,
1999; Baraban et al., 2007; Driever et al., 1996; Haffter et al., 1996; Kishi et al., 2008;
Lessman, 2004; and others). In a small pilot study, ENU mutagenesis, combined with
Computer-aided screening (CAS) and Computer-aided larval motility screening (CALMS),
was used to isolate the motility mutant del (Lessman 2002; 2004). CAS and CALMS are tools
to help detect motility mutants by assaying the animals over time using a transparency
scanner, computers, and associated software. This method isolates embryos or larvae on a
scanner and collects sequential images of them over time. By stacking the images for each
animal together and animating the stack, a researcher can readily distinguish those that are
mobile compared to embryos or larvae that have reduced movement over time. These images
can also be collapsed into one composite image that can be informative as well. del is a
recessive mutation that first manifests a discernable non-motile phenotype starting around 20
hours post fertilization (hpf). del mutants can easily be screened for by their lack of motility
(Figure 1 and supplement Figures 1 and 2). Morphological development is grossly normal
until about 36 hpf. However, del mutants do exhibit obvious cardiac edema, shortening of the
gut tube, abnormal body curvature, some misalignment of myosepta, and myotome defects
seen throughout the length of the embryo (Figure 2, solid arrows). The cardiac muscle in del
homozygotes contract and pump blood, albeit poorly. del mutants display cardiac edema and
blood can be seen pooling in the trunk region of the mutant embryos (Figure 2, dashed arrow
and supplement Figure 3). Because of the myotome disorganization, we visualized
birefringence using polarizing microscopy. Birefringence is an optical method used to follow
myofilament (actin) organization of skeletal muscle during development. Birefringence of del
mutants was significantly reduced compared to wild-type controls at the same stages of
development indicating a derangement of the filament arrays responsible for birefringence in
del mutants (Figure 3).
Wild type
del Mutant
Figure 2. Comparison of the wild-type and the del phenotypes. Panel on top is a wild-type 4 dpf
embryo. The del embryo bottom panel is seen with its chorion manually removed. Notice the
pericardial edema, swollen yolk sac, and myotome defects (arrows). In addition, there is a smaller swim
bladder, and shorter overall embryo length in the del mutants.
Normal optics
del Mutant
Wild type
Polarized optics
del Mutant
Wild type
Figure 3. Comparison of wild-type and del birefringence. Top panel illustrates wild-type and del
embryos under standard light. The bottom panel is the same embryos illuminated to show birefringence.
The wild-type has greater birefringence as seen by the brighter refraction of polarized light.
Figure 4. Bulk segregant analysis of del mutation using markers for Linkage Groups 1-8.
Each marker was used to amplify a specific region on wild-type (left lane) verses del mutant pooled
DNA (right lane) run on an agarose gel. No linkage was observed for del in this panel.
Figure 5. Bulk segregant analysis of del mutation using markers for Linkage Groups 9-16. Each marker
was used to amplify a specific region on wild-type (left lane) verses del mutant pooled DNA (right
lane) run on an agarose gel. Markers that show differences are located in the panel for linkage group 9
(white box).
Figure 6. Bulk segregant analysis of del mutation using markers for Linkage Groups 1-25. Each marker
was used to amplify a specific region on wild-type (left lane) verses del mutant pooled DNA (right
lane) run on an agarose gel. Markers that show differences are located in the panel for linkage group 9
(white box).
Figure 7. Markers #1-6 are specific for Linkage Group 9 (LG9). Wild-type pooled DNA (A) and mutant
pooled DNA (B) were amplified using these linkage group specific markers. Lanes 1 and 2 show no
linkage, lane 3 failed, lane 6 shows no polymorphism between wild-type and mutants. Lanes 4 and 5
illustrate polymorphism and linkage to markers on LG 9.
Genetic Mapping of the del Mutant
To localize the del mutation within the zebrafish genome, microsatellite-based linkage
mapping was used. Heterozygous carriers of the del mutation (in a wild-type background)
were crossed with the TL strain to generate an F1 generation. F1 heterozygous pairs were
identified and mated repeatedly to generate an F2 mapping panel. F2 clutches were sorted for
del mutants and non-mutant siblings. Bulk-segregant analysis using pooled DNA from
siblings and mutants was completed using a set of 192 polymorphic simple-sequence repeat
markers (Muto et al., 2005) (Figures 4-6). This panel of markers provided a full genome scan
and revealed polymorphic markers within LG 9 that co-segregated with the del mutant DNA
pool (Figure 5, boxed in white). Linkage to these markers was confirmed by analysis of
individual fish DNA (Figure 7, boxed in white). Fine mapping to LG 9 was completed using
additional markers (Figures 8 and 9). From these markers, we constructed a linkage map of
the del mutation and found that it contained two titin genes, titina and titinb (Steffen et al.,
2007b; Figure 10).
Figure 8. Recombination analysis using markers z7120 and z20031. Map position was further verified
by demonstration of linkage to markers located in the chromosome 9 region. Multiple individual wild-
type DNA and del mutant DNA were amplified using these linkage-group specific markers, and were
used to build a linkage map of the region.
Figure 9. Recombination analysis using markers z10166 and z17365. Map position continued to be
refined by inclusion of linkage to these markers. Multiple individual wild-type DNA and del mutant
DNA were amplified using these linkage-group specific markers, and were used to build a linkage map
of the region. This region of zebrafish chromosome 9 shows synteny with human chromosome 2, but
there are regional genome rearrangements.
Figure 10. Genetic map of the del mutation. Top: The recombination distances, represented in cM, for
each marker localizes del to a region between z20031 and z10166, with del being closer to marker
z20031. Bottom: Based on known marker maps within Ensembl, a more detail regional map with the
inclusion of the titina and titinb genes are shown in relation to the region were the del mutation exists.
Complementation Analysis of del and pikuw2 Mutants
Zebrafish titin mutant lines have been previously identified and exhibit defects in striated
muscle formation similar to del (Sheely et al., 2007; Paulus et al., 2009; Xu et al., 2002).
Paulus et al. recently published research associated with the pikuw2 mutant that shows defects
in heart and skeletal muscle and edema associated with a mutation in the titina gene.
Complementation crosses were made using del and pikuw2 heterozygotes in both Dr.
Lessman‘s and Dr. Carver‘s laboratories. Approximately 25% of the offspring displayed
edema, non-motility and muscular defects common to both mutants (Figure 11) and
supplement Figure 4, indicating that del fails to complement pikuw2. Based upon these results,
we concluded that del is a new allele of titina.
Figure 11
wt
del-pik
del-pik wt
del-pik wild-type
wt wt
Figure 11. Complementation analysis of del. Left panel is the del mutation exhibiting obvious defects in
body curvature, yolk sac, and cardiac edema. Right panel gives examples of the pikuw2 mutation
illustrating similar defects.
Lower panel shows the affected offspring of the del and pikuw2 heterozygotes with defects that are
similar to del or pikuw2 homozygous embryos.
Sarcomeric Protein Localization Patterns within Skeletal Muscle
The obvious striated muscle defects presented in the del mutant, including the basic lack
of muscle striation and reduced birefringence, suggested functional variations within the
proteins associated with sarcomere formation. We examined a series of antibodies against
sarcomeric proteins in del skeletal muscle using immunofluorescence microscopy.
Collectively, the differences seen between wild-type and del mutants confirm disruption of
the basic contractile apparatus in del mutants.
Actin proteins make up the thin actin filaments of the muscle fiber (Du et al., 2007;
Figure 20). Within the sarcomere, we expect localization of actin at the I bands, resulting in a
striated appearance. Whole-mount immunohistochemistry using the anti-actin antibody to 3
dpf wild-type and del mutant embryos illustrate the presence of the actin protein (Figure 12).
However, only the wild-type embryos display proper localization of the actin protein as a
repeated series along the length of the myotubes (Figure 12). In the del mutant, the actin
proteins are present but lack any focal localization within the sarcomere (Figure 12).
Actin
Wild type del Mutant
Figure 12. Whole-mount immunohistochemistry using the anti-actin antibody

Left panel: Confocal image of wild-type embryo using the anti-actin antibody, located within the
sarcomere at 60x.
Right panel: Confocal image of del mutant embryo using the anti-actin antibody at 60x. Actin is present
in del, but there is no structured localization.
Desmin, another sarcomeric protein, was also visualized. Desmin is an intermediate

filament protein that binds the myofibrils (i.e., thin and thick filaments) together at the z-discs
(Costa, 2008), and is one of the first proteins expressed in muscle differentiation (Furst et al.,
1989). Since desmin bind myofibrils at the z-discs, we expected to see antibody staining
primarily along the z-discs of the sarcomere. Immunohistochemistry using 3 dpf wild-type
and del mutant embryos illustrated presence of desmin within the myofibril (Figure 13).
Within the wild-type embryos, there were regions within the myofibril where desmin
localizes to a greater extent, creating a striated pattern within the myocytes (Figure 13).
However, in the del mutant embryo, we found the presence of the desmin protein but no sub-
localization of the protein to the z-discs of the sarcomeres (Figure 13).
The F59 antibody labels myosin with adaxial cell slow-twitch muscle cells (Zeller, 2002).
Myosin is located within the sarcomere at the A-bands, the dark striation as visualized using
light microscopy (Figure 20). Images of immunohistochemistry of wild-type and del mutant
embryos both displayed the presence of myosin with the lateral adaxial slow-twitch muscle
cells. The localization of myosin within the sarcomere of wild-type embryo appears normal
(Figure 14). However, while Myosin was present in del mutants; myosin filaments were not
localized with a sarcomere, as evident by the lack of myofibril formation and non-striated
appearance (Figure 14).
Desmin
Figure 13. Whole-mount immunohistochemistry using the anti-desmin antibody.

Left panel: Confocal image of wild-type embryo stained with anti-desmin antibody at 60x, with
sarcomere and cytoskeletal localization.
Right panel: Confocal image of del mutant embryo stained with anti-desmin antibody at 60x illustrating
the presence of the Desmin in the myocytes, but no structured localization along a sarcomere.
f59
Figure 14. Whole-mount immunohistochemistry using the F59 antibody.

Left panel: Confocal image of wild-type embryo stained with F59 antibody at 60x with striated
localization within the skeletal muscle.
Right panel: Confocal image of del mutant embryo stained with F59 antibody at 60x with localization
within skeletal muscle cells, but without any repeated localization along the sarcomere.
Tropomyosin
Wild Type del Mutant
Figure 15. Whole-mount immunohistochemistry using the anti-tropomyosin antibody.

Left panel: Confocal image of wild-type embryo stained with anti-tropomyosin antibody at 60x
localizing along the sarcomere.
Right panel: Confocal image of del mutant embryo stained with anti-tropomyosin antibody at 60x
without sarcomeric localization.
T4
Figure 16. Whole-mount immunohistochemistry using the T4 (Slc12a2) antibody.

Left panel: Discrete localization of the Slc12a2 antibody along the length of the myocytes as illustrated
with a confocal image of wild-type embryo at 60x.
Right panel: A confocal 60x image of del mutant embryo with general, nonspecific localization of
Slc12a2.
Zm3
Figure 17. Whole-mount immunohistochemistry using the zm3 antibody.

Left panel: A confocal image of wild-type embryo stained with zm3 antibody at 60x depicting
myocytes with clearly defined sarcomeres.
Right panel: Image of a del mutant embryo with deranged localization of the zm3 antibody within
muscle cells at 60x.
Tropomyosin consists of a double helix structure that associates with actin filaments.
Because of this direct association, the expected localization pattern of Tropomyosin should be
similar to Actin at the I-bands of the sarcomere. We found that Tropomyosin was present in
both wild-type and del embryos, however, only the wild-type embryos illustrated proper
localization within the myofibril (Figure 15). In the del mutant, some localization was seen,
but tropomyosin was not localized in any discernible pattern indicative of sarcomere
formation (Figure 15).
The T4 antibody labels Slc12a2. Dew et al., (2014, this volume) found that the T4
antibody localizes near the t-tubules (transverse tubules) within the zebrafish musculature.
Because t-tubules are located regularly along consecutive sarcomeres, we expected Slc12a2 to
show a striated pattern in the wild-type zebrafish. We found that Slc12a2 was present in both
the wild-type and del mutant embryos at 3 dpf (Figure 16). However, only the wild-type
embryo showed a repeating pattern of localization along the length of the myocytes (Figure
16). These results indicate that secondary structures associated within the myocytes are being
affected as well. If the sarcomeres are unable to form, the secondary structures that rely on the
sarcomeres to establish basic uniform architecture, such as the t-tubules, are perturbed as well
(Figure 16).
The zm3 antibody localizes to brachial and enteric muscle cells (zfin.org); zm3 staining
was seen in both wild-type and del mutant embryos (Figure 17). Wild-type embryos exhibited
a striated appearance; indicative of a protein involved in sarcomere structure (Figure 17).
However, this striated localization did not occur within del mutant embryos (Figure 17).
Wild Type Znp1 del Mutant
Figure 18. Whole-mount immunohistochemistry using the znp1 antibody.

Left panel: Confocal image of wild-type embryo with znp1 antibody along motoneuronal axons at 60x.
Right panel: Confocal image of del mutant embryo localizing the znp1 antibody along motorneuronal
axons at 60x with a similar pattern to wild-type embryos.
Titin
Figure 19. Whole-mount immunohistochemistry using the anti-titin antibody.

Left panel: Titin localizes along the sarcomere of wild-type embryos as illustrated using this confocal
image at 60x.
Right panel: A del mutant embryo illustrating deranged localization of Titin along the myocytes at 60x.
The znp1 antibody recognizes motoneuronal axons, including their main trunks within
the spinal nerve through to the myotomes (Fashena, 1999). Branches of the motoneuronal
axons appear regularly along the myosepta. Both wild-type and del mutant embryos exhibited
proper localization of the znp1 antibody to the motoneuronal axons in musculature at 3 dpf
(Figure 18), indicating that innervation occurs normally in del mutant embryos. Thus, we
conclude that the non-motile phenotype of the del mutant is not due to improper
motoneuronal axon outgrowth targeting the musculature.
Titin filaments connect the thick myosin filaments to the z-discs and help stabilize the
myosin filaments in the longitudinal axis (Figure 20). The Titin antibody, T11, targets
epitopes that are near the z-disc. The Titin protein localizes within the myofibrils in an
ordered pattern in association with myosin and the z-discs. As seen using
immunohistochemistry, the wild-type embryos displayed proper localization of Titin within
the sarcomere (Figure 19). In the del mutant, Titin localization occurred within the myofibril,
indicating that the protein was present but lacked organized patterning (Figure 19).
Overall, these substructure protein localization experiments indicate a defect in
sarcomere formation and suggest a central role for Titin in sarcomere development.
I-band (Light striation) Sarcomere structure I-band (Light striation)
A-band (Dark striation) Z-disc

Z-disc M-line
Thick filament Titin filament Thin filament

Actin and tropomyosin filaments
Figure 20. Basic sarcomere structure illustrating some of major proteins found within the contractile
element.
Microarray Analysis
Gene expression profiling using microarrays is a technique to measure the expression

level of many genes simultaneously and to analyze embryos in a large systematic manner.
When you use microarray analysis to compare two systems, such as a wild type versus
mutant, you generate two datasets and compare them to find differences in gene expression
patterns. These differences may either be directly caused by the mutation, or may be a
secondary characteristic. These data sets have the potential to be very informative. For this
study, we completed a microarray for the del mutant. This array compared wild-type to del
mutant embryos at the same developmental stage. We uncovered marked expression

differences between the del mutant and wild-type embryos. Sarcomere specific genes actin,
myosin, tropomosin, desmin, nebulin, and titin were differentially expressed in del mutants
compared to wild-type siblings (Figure 21). These genes were expressed transcripts in the del
mutant, confirming our whole-mount immunohistochemical analysis. Data also indicate
misexpression of heat shock and metalloproteinase proteins as well (data not shown). These
data are similar, as a trend, to microarray data on the ruz mutant (Steffen et al., 2007).
Affymetrix zebrafish array: Feinstone Center for Functional Genomics
del wt gene name abbrev ratio

gb:NM_131591.1 /Danio rerio actin, alpha 1, skeletal muscle
175407 147943 (acta1), mRNA actin, alpha 1 acta1 0.84
gb:NM_131591.1 /Danio rerio actin, alpha 1, skeletal muscle
163303 141297 (acta1), mRNA actin, alpha 1 acta1 0.87
gb:AL717344 / weak similarity to protein MLE1_HUMAN Myosin myosin light zgc:77

50833 46103 light chain 1 chain 231 0.91
gb:AW777826 /moderate similarity to protein myosin light chain myosin light
34518 34693 2 (Homo sapiens) chain --- 1.01
gb:AF434191.1 /Danio rerio atrial myosin light chain mRNA, myosin light zgc:66
25782 32250 complete cds. chain 286 1.25
alpha-
36128 30053 gb:NM_131105.1 / Danio rerio alpha-tropomyosin (tpma), mRNA tropomyosin tpma 0.83
gb:AL723338 / strong similarity to protein tropomyosin NM, zgc:77
7722 9322 skeletal muscle - human tropomyosin 592 1.21
7885 3188 gb:NM_130963.1 /Danio rerio desmin (desm), mRNA desmin desm 0.40
gb:AW116068 / weak similarity to protein Sh3 Domain From

793 1797 Human Nebulin nebulin --- 2.26
431 989 gb:AY081167.1 /titin /DEF=Danio rerio titin mRNA, partial cds. titin ttn 2.29
563 1016 gb:BI878949 /Danio rerio transcribed sequences titin ttn 1.81
gb:AI601291 /weak similarity to protein S63665 titin protein -
3159 4188 human (fragment) titin ttn 1.33
Figure 21. Microarray analysis. del transcriptome alterations listing the major sarcomere loci.
CONCLUSION
This chapter discusses the characterization of the dead elvis (del) mutant in zebrafish. del
mutant embryos exhibit a phenotype that consists of a failure to move during a motility
screen, cardiac myopathy and edema, shortened gut tube, abnormal curvature, and obvious
defects of the myotome (Figures 1-3). Genetic mapping revealed localization of del to linkage
group 9. Fine mapping of the del mutation revealed it to map near the titina and titinb genes
(Figures 4-10). Complementation analysis was completed using del mutants to cross with the
pikuw2 mutant, a known titina mutant (Steffen 2007b). The results indicated that del and pikuw2
mutant are allelic and the del mutation is a new allele of titina (Figure 11).
Whole-mount immunohistochemical techniques and confocal microscopy revealed the

sarcomere structure defects associated with the del mutant. Sarcomeric proteins Actin,
Myosin, Tropomyosin, zm3, and Titin were present in the del mutant, but failed to
sublocalize, suggesting that the sarcomere architecture was abnormal (Figures 12, 14, 15, 17,
and 19).
Desmin and Slc12a2 both localized to structures that are associated with proteins in the
sarcomere (Figures 13 and 16). Desmin was present in both wild-type and del embryos, but
del embryos did not exhibit any secondary structures as seen in the wild-type embryos (Figure
13). Similarly, Slc12a2 was present in both wild-type and del mutant embryos, with no
uniform localization patterns seen in the del embryos.
The Znp1 protein, present in the motoneuronal axons, localized properly in both the wild-
type and the del mutant embryos (Figure 18). From this, it seems that innervation is grossly
normal within the del mutant and the non-motile phenotype is not due to a lack of
motoneuronal axon outgrowth in the musculature.
As a new allele of titina, the immunohistochemistry experiments on the del mutant
embryos support the role of Titin as a major ―scaffolding protein‖ that connects and interacts
with multiple proteins within the sarcomere (MacIntosh, 2006; Figure 20). Titin binds to
Actin and Ayosin, connects to α-Actinin at the Z-disk and Myomesin in the M-region to help
establish the basic structure of the sarcomere (reviewed in Tskhovrebova and Trinick, 2010;
Ehler and Gautel, 2008). Therefore, if the Titin protein, or one of its isoforms, were absent or
non-functional; the development of the sarcomere would not be normal. A mutation in the
cardiac isoform of titin, pikm171, has been associated with the N2B region of the gene, and has
heart defects that are more severe than del (Xu et al., 2002). Another mutation, ruz, has not
been sequenced, but through mapping and complementation analysis also localizes to the
titina gene. (Steffen et al., 2007b). The ruz mutant exhibits a less severe phenotype and later
onset than seen in del. Together, these mutant animals begin to define a range of phenotypes
associated with abnormal functionality of Titin in zebrafish. A series of more specific Titin
antibodies with cardiac or skeletal muscle specificity and that target specific domains of Titin,
could help clarify region-specific functions of the protein. Also, even with the complex nature
of this large gene notwithstanding, sequencing the del mutation would provide definitive
proof of its association with titina and provide new ideas of how alterations within the gene
affects protein function. Future work with these mutants may lead to a better understanding of
Titin‘s role in striated muscle formation, contractility, and association with muscular disease.
ACKNOWLEDGEMENTS
We thank Dianna Liu of the Lessman lab for help maintaining zebrafish stocks, and
isolating embryos. This material is based upon work supported by National Science
Foundation under Grant No. (DBI-0922941). Research reported in this publication was
supported by the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the
National Institutes of Health under Award Number 1R15AR055798-01A1. The content is
solely the responsibility of the authors and does not necessarily represent the official views of
the National Institutes of Health. Other funding includes UTC startup funds and UC
Foundation Faculty Research Grant #R04-1011-088 to EAC.. A UTC provost award funds
part of the research to LM. Portions of this chapter are part of research conducted in partial
fulfillment of Undergraduate Departmental Honors project (LM). Open access publication
costs of this chapter were defrayed though the generosity of Dr. Jeff Elwell, Dean of the
College of Arts and Sciences at the University of Tennessee at Chattanooga. A University of
Memphis Faculty Research Grant to CAL supported a portion of this work.
REFERENCES
Abbas, L., and Whitfield, T.T., 2009, ―Nkcc1 (Slc12a2) is required for the regulation of
endolymph volume in the otic vesicle and swim bladder volume in the zebrafish larva‖
Development. 136(16), 2837–2848.
Amack, J.D., & Mahadevan, M.S., 2004. ―Myogenic defects in myotonic dystrophy‖,
Developmental Biololgy, 265(2),294-301.
Amsterdam, A., Burgess, S., Golling, G., Chen, W., Sun, Z., Townsend, K., Farrington, S.,
Haldi, M., & Hopkins, N., 1999, ―A large-scale insertional mutagenesis screen in
zebrafish‖, Genes and Development, 13, 2713-24.
Baraban, S.C., Dinday, M.T., Castro, P.A., Chege, S., Guyenet, S., & Taylor, M.R., 2007, ―A
Large-scale Mutagenesis Screen to Identify Seizure-resistant Zebrafish‖ Epilepsia, 2007
48(6), 1151–1157.
Bassett, D.I., Bryson-Richardson, R.J., Daggett, D.F., Gautier, P., Keenan, D.G., & Currie,
P.D., 2003, "Dystrophin is required for the formation of stable muscle attachments in the
zebrafish embryo", Development. 130, 5851-5860.
Berger, J., and Currie, P.D., 2012, ―Zebrafish models flex their muscles to shed light on
muscular dystrophies‖, Disease Models & Mechanisms, 5(6), 726–732.
Brand M, Granato M, and Nusslein-Volhard C. (2002). "Keeping and raising zebrafish"
In:Nusslein-Volhard C, Dahm R, editors. Zebrafish: a practical approach. Oxford, UK:
Oxford University Press. p 7-37.
Costa, M.L., Escaleira, R.C., Rodrigues, V.B., Manasfi, M., & Mermelstein, C.S., 2002,
"Some distinctive features of zebrafish myogenesis based on unexpected distributions of
the muscle cytoskeletal proteins actin, myosin, desmin, alpha-actinin, troponin and titin",
Mechanisms of Development, 116, 95–104.
Costa, M.L., Escaleira, R.C., Jazenko, F., & Mermelstein, C.S., 2008, ―Cell Adhesion in
Zebrafish Myogenesis: Distribution of Intermediate Filaments, Microfilaments,
Intracellular Adhesion Structures and Extracellular Matrix‖, Cell Motility and the
Cytoskeleton, 65:801-815.
Dew, I., Sircy, L., Milleville, L., Taylor, M.R., Lessman, C.A., & Carver, E. A., 2014,
―Localization of the Sodium-potassium-chloride cotransporter (Slc12a2) during zebrafish
embryogenesis and myogenesis and a screen for additional antibodies to study zebrafish
myogenesis‖, submitted.
Dodd, A., Chambers, S.P., Nielsen, P.E., & Love, D.R., 2004, ―Modeling human disease by
gene targeting‖, Methods in Cell Biology, 76, 593-612.
Driever, W., Solnica-Krezel, L., Schier, A.F., Neuhauss, S.C., Malicki, J., Stemple, D.L.,
Stainier, D.Y., Zwartkruis, F., Abdelilah, S., Rangini, Z., Belak J., & Boggs, C., 1996, ―A
genetic screen for mutations affecting embryogenesis in zebrafish‖, Development 123,

37-46.
Du, S.J., Li, H., Bian, Y., & Zhong, Y., 2008, ―Heat-shock protein 90a1 is required for
organized myofibril assembly in skeletal muscles of zebrafish embryos‖, PNAS, 104(2),
554-9.
Ehler, E., & Gautel, M. 2008, ―The sarcomere and sarcomerogenesis‖, Advances in
Experimental Medicine and Biology, 642, 1–14.
Guyon, J.R., Mosley, A.N., Zhou, Y., O'Brien, K.F., Sheng, X., Chiang, K., Davidson, A.J.,
Volinski, J.M., Zon, L.I., & Kunkel, L.M., 2003, ―The dystrophin associated protein
complex in zebrafish‖, Human Molecular Genetics, 12(6), 601-15.
Guyon, J.R., Mosley, A.N., Jun, S.J., Montanaro, F., Steffen, L.S., Zhou, Y., Nigro, V., Zon,
L.I., & Kunkel, L.M., 2005, ―Delta-sarcoglycan is required for early zebrafish muscle
organization‖, Experimental Cell Research, 304(1), 105-15.
Haffter, P., Granato, M., Brand, M., Mullins, M.C., Hammerschmidt, M., Kane, D.A.,
Odenthal, J., van Eeden, F.J., Jiang, Y.J., Heisenberg, C.P., Kelsh, R.N., Furutani-Seiki,
M., Vogelsang, E., Beuchle, D., Schach, U., Fabian, C., & Nüsslein-Volhard C., 1996,
―The identification of genes with unique and essential functions in the development of
the zebrafish, Danio rerio‖, Development 123, 1-36.
Jao, L-E., Maddison, L., Chen, W., & Burgess, S.M., 2008, ―Using retroviruses as a
mutagenesis tool to explore the zebrafish genome‖, Briefings in Functional Genomics
Proteomic, 7(6), 427–443.
Kishi, S., Bayliss, P.E., Uchiyama, J., Koshimizu, E., Qi, J., 2008, ―The Identification of
Zebrafish Mutants Showing Alterations in Senescence-Associated Biomarkers‖, PLoS
Genetics, 4(8), e1000152.
Lessman, C.A., 2002, ―Use of computer-aided screening (CAS) for detection of motility
mutants in zebrafish embryos‖, Real-Time Imaging. 8, 189-201.
Lessman, C.A., 2004, ―Computer-Aided Screening (CAS) for zebrafish embryonic motility
mutants‖, Methods in Cell Biology. 76, 285-313.
Lessman, C.A., Taylor, M.R., Orisme, W. & Carver, E.A. 2010, ―Use of flatbed transparency
scanners in zebrafish research: Versatile and economical adjuncts to traditional imaging
tools for the Danio rerio laboratory‖, Methods in Cell Biology, 100, 295-322.
Mankodi, A., & Thornton, C.A., 2002, ―Myotonic syndromes.‖ Current Opinion in
Neurology, 15, 545-52.
Moore, F.E., Reyon, D., Sander, J.D., Martinez, S.A., Blackburn, J.S., Khayter, C., Ramirez,
C.L., Joung, J.K., & Langenau, DM, 2012, ―Improved Somatic Mutagenesis in Zebrafish
Using Transcription Activator-Like Effector Nucleases (TALENs)‖, PLoS ONE 7(5),
e37877.
Muto, A., Orger, M.B., Wehman, A.M., Smear, M.C., Kay, J.N., Page-McCaw, P.S., Gahtan,
E., Xiao, T., Nevin, L.M., Gosse, N.J., Staub, W., Finger-Baier, K., & Baier, H. 2005,
―Forward genetic analysis of visual behavior in zebrafish‖, PLoS Genetics,1(5), e66.
Paulus, J.D., Willer, G.B., Willer, J.R., Gregg, R.G., & Halloran, M.C., 2009, ―Muscle
contractions guide Rohon-Beard peripheral sensory axons‖, Journal of Neuroscience,
29(42), 13190–13201.
Payne, J. A. and Forbush, B., 3rd., 1995, ―Molecular characterization of the epithelial Na-K-
Cl cotransporter isoforms”, Current Opinion in Cell Biology, 7, 493-503.
Rahimov, F., and. KunkelL.M., 2012, ―Cellular and molecular mechanisms underlying
muscular dystrophy‖, J. Cell Biol. 201(4), 499–510.
Russell, W.L., Kelly, E.M., Hunsicker, P.R., Bangham, J.W., Maddux, S.C., & Phipps, E.L.,
1979, ―Specific locus test shows ethylnitrosourea to be the most potent mutagen in the
mouse‖, PNAS USA, 76, 5818-5819.
Seeley, M., Huang, W., Chen, Z., Wolff, W.O., Lin, X., & Xu, X., 2007, ―Depletion of
Zebrafish Titin Reduces Cardiac Contractility by Disrupting the Assembly of Z-Discs
and A-Bands‖, Circulation Research,100(2), 238-245.
Solnica-Krezel L., Schier AF, & Driever W., 1994, ―Efficient recovery of ENU induced
mutations from the zebrafish germline‖, Genetics, 36(4), 1401-20.
Stanfield, C. L., and Germann, W.J., 2007, Principles of Human Physiology. (3rd ed.). New
York: Pearson/Benjamin Cummings.
Steffen, L.S., Guyon, J.R., Vogel, E.D., Beltre, R., Pusack, T.J., Zhou, Y., Zon, L.I., &
Kunkel, L.M.,2007a, ―Zebrafish orthologs of human muscular dystrophy genes‖, BMC
Genomics, 8(1), 79.
Steffen, L.S., Guyon, J.R., Vogel, E.D., Howell, M.H., Zhou, Y., Weber, G.J., Zon, L.I., &
Kunkel, L.M., 2007b, ―The zebrafish runzel muscular dystrophy is linked to the titin
gene‖, Developmental Biology, 309(2), 180-192.
Tskhovrebova, L., & Trinick, J., 2010, ―Roles of Titin in the Structure and Elasticity of the
Sarcomere‖, Journal of Biomedicine and Biotechnology, 2010, 612482.
Westerfield, M. 2004, The zebrafish book. A guide for the laboratory use of zebrafish (Danio
rerio), 4th ed, Univ. of Oregon Press, Eugene.
Xu, J. C., Lytle, C., Zhu, T. T., Payne, J. A., Benz, E., Jr, & Forbush, B., 3rd., 1994,
―Molecular cloning and functional expression of the bumetanide-sensitive Na-K-Cl
cotransporter‖, PNAS, USA 91, 2201-2205.
Xu, X., Meiler, S.E., Zhong, T.P., Mohideen, M., Crossley, D.A., Burggren, W.W., &
Fishman, M.C., 2002, ―Cardiomyopathy in zebrafish due to mutation in an alternatively
spliced exon of titin‖, Nature Genetics, 30(2), 205-209.
Zeller, J., Schneider, V., Malayaman, S., Higashijima, S., Okamoto, H., Gui, J., Lin, S.,
Granato, M., 2002, ―Migration of Zebrafish Spinal Motor Nerves into the Periphery
Requires Multiple Myotome-Derived Cues‖, Developmental Biology, 252, 241-256.
Chapter 9
RENAL SYSTEM DEVELOPMENT IN THE ZEBRAFISH:

A BASIC NEPHROGENESIS MODEL
Christina N. Cheng and Rebecca A. Wingert

Department of Biological Sciences, University of Notre Dame, Notre Dame, IN, US
ABSTRACT
The zebrafish has proven to be an important model organism for investigating
numerous developmental topics, especially organogenesis. To date, the zebrafish has
played an expanding role in aiding our understanding of the genetic intricacies that
underlie renal development, a process that has been poorly understood in the past. The
kidney is a vital organ that is responsible for maintaining fluid homeostasis and removing
waste metabolites from the body. Current research has established that the segmentation
patterning of the nephrons, which are the basic functional units of the kidney, is
conserved between this teleost species and higher vertebrates, including mammals. This
concept of conservation within the kidney was further exemplified by the identification of
orthologous genes that are expressed during the dynamic cellular and morphological
processes that occur throughout nephrogenesis. Continuing advances in molecular
techniques, from morpholinos to TALENs and now CRISPRs, have fueled the increasing
appeal of employing zebrafish in research. The future application of these technologies
offers a valuable venue to study kidney development and holds promise to elucidate
clinical interventions for a variety of renal diseases.
Keywords: Zebrafish, nephrogenesis, retinoic acid, cdx genes, HNF1β, irx3b, morpholino,
TALENs, CRISPR-Cas
ABBREVIATIONS
5‘ UTR 5‘ untranslated region
A-P axis anterior-posterior axis
*
Corresponding Author: rwingert@nd.edu
180 Christina N. Cheng and Rebecca A. Wingert
AKI acute kidney injury

AS antisense
CAKUT congenital abnormalities of the kidney and urinary tract
CAR coxsackie and adenovirus receptor
CaSR calcium-sensing receptor
CD collecting duct
cdx caudal
CKD chronic kidney disease
CNF congenital nephrotic syndrome of the Finnish type
CRISPRs clustered regularly interspaced short palindromic repeats
crRNA CRISPR RNA
CS Corpuscle of Stannius
DCT distal convoluted tubule
DE distal early
DEAB 4-diethylaminobenzaldehyde
DL distal late
dpi days post injection
DSB double-stranded break
ESRD end-stage renal disease
HDR homology directed repair
hpf hours post fertilization
IM intermediate mesoderm
indels insertion or deletion mutations
irx Iroquois
MCC multiciliated cell
MD macula densa
MET mesenchymal-to-epithelial transition
MKS Meckel syndrome
NHEJ non-homologous end joining
PAM protospacer adjacent motif
PCT proximal convoluted tubule
PD pronephric duct
PKD polycystic kidney disease
PST proximal straight tubule
RA retinoic acid
RALDH retinaldehyde dehydrogenases
RAR retinoic-acid receptor
RAREs retinoic-acid response elements
RVDs repeat-variable di-residues
RXR retinoid X receptor
S sense
SCC single ciliated cell
sgRNA single guide RNA
ssDNA single-stranded DNA
ssODNs single-stranded oligodeoxynucleotides
TAL thick ascending limb
Renal System Development in the Zebrafish: A Basic Nephrogenesis Model 181
TALE transcription activator-like effector

TALENs transcription activator-like effector nucleases
tracrRNA trans-activating crRNA
WISH whole mount in situ hybridization
WT wild-type
INTRODUCTION
Danio rerio, more commonly known as the zebrafish, is a freshwater fish native to the
shallows of the Indian floodplains in the tropics. Once domestic aquarium strains were
procured for laboratory settings, research involving the zebrafish initially focused on
toxicology and environmental studies (Spence et al., 2008; Laale, 1977). However, work by
Streisinger and colleagues (1981) pertaining to the application of molecular genetics within
the zebrafish to investigate embryology revealed the potential of zebrafish for vertebrate
developmental biology research (Spence et al., 2008; Streisinger et al., 1981; Kimmel, 1993).
This concept was further established by studies that examined the patterning and
differentiation of the vertebrate brain using the zebrafish (Kimmel, 1989; 1993). These
studies, in addition to the discovery of genetic conservation between the zebrafish and other
vertebrates, ultimately founded the importance of the zebrafish in cellular and molecular
biology. To date, numerous findings regarding various developmental phenomena including
neurogenesis, hematopoiesis, and organogenesis have been made by employing the zebrafish
model (Kimmel, 1993; Barrallo-Gimeno et al., 2003; Galloway et al., 2005; Wingert &
Davidson, 2011).
Overall, the zebrafish is an excellent organism for developmental studies. Not only does
the zebrafish show significant genetic and anatomical conservation with that of higher
vertebrates (Gerlach & Wingert, 2013; Lieschke & Currie, 2007; Goldsmith & Jobin, 2012;
Howe et al., 2013), it is also very amenable to experimental analyses due to the attribute of
optical clarity during its embryonic stages (Kimmel, 1993). Adult zebrafish undergo
broadcast spawning with each adult capable of producing hundreds of embryos each week.
This fecundity of zebrafish heightens their appeal for use in high-throughput experiments.
Moreover, the external development of the zebrafish embryo offers researchers the ability to
study the developmental processes that occur from the onset of fertilization (Driever et al.,
1996; Haffter & Nusslein-Volhard, 1996; Drummond et al., 1998; Amsterdam et al., 1999;
Westerfield, 2000; Swanhart et al., 2011). Advances made in molecular techniques
(Nasevicius & Ekker, 2000; Gaj et al., 2013) suitable for use with the zebrafish have further
stimulated the popularity of this particular organism to study development and model a
plethora of diseases as well. Consequently, the zebrafish has both transformed the scientific
community and enabled the advancement of biomedical knowledge in recent years (Spence et
al., 2008; Santoriello & Zon, 2012; Seth et al., 2013). In terms of organogenesis, the zebrafish
has begun to enhance our understanding of kidney development, which will be the focus of
this chapter.
Among vertebrates, the kidney is a vital organ since it primarily functions to filter the
blood and remove waste metabolites from the body. Thus, organismal homeostasis is
maintained through the kidney‘s stringent regulation of fluids, pH, and blood pressure.
Furthermore, the ability of the kidney to control these important processes resides in the
integral performance of its functional units known as nephrons. These nephrons are highly
specialized epithelial tubules that are divided into proximal and distal regions based on their
respective activities of solute reabsorption and urinary salt regulation (Reilly et al., 2007;
Gerlach & Wingert, 2013) Until recently, the mechanisms responsible for vertebrate
nephrogenesis remained largely unknown. However, the prospect for new insights into this
complex process emerged once it was discovered that the patterning of the nephron segments
was conserved across species including frogs, zebrafish, and mammals (Wingert et al., 2007;
Wingert & Davidson, 2008). As a result, the zebrafish has become a key model organism for
investigating the mechanisms that underlie renal development, regeneration, and disease.
Kidney dysfunction can lead to a variety of diseases in human adults and is typically
categorized as either acute kidney injury (AKI) or chronic kidney disease (CKD)
(McCampbell & Wingert, 2012; CDC, 2010). In addition, prenatal kidney defects, which
comprise congenital abnormalities of the kidney and urinary tract (CAKUT), can also arise
from genetic and/or environmental aberrations (Welham et al., 2005; Song & Yosypiv, 2011;
Renkema et al., 2011; El-Dahr et al., 2000; Schwaderer et al., 2007). Most notably, the
overall incidence of renal anomalies throughout the world is astounding. In the United States
alone, it is estimated that approximately 1 out of 10 people are afflicted with some form of
chronic kidney disease (NIH, 2012). Presently, there are only two viable forms of treatment
for nonfunctioning kidneys: dialysis and transplantation. Dialysis is an inherently grueling
and time-consuming process for the patient since it involves a lifetime of frequent blood
filtrations performed by an external medical device. The prospects for a kidney transplant can
also be quite disheartening since this procedure normally entails long waitlist times of several
years. Furthermore, even after a kidney transplant is obtained, it is still possible that the
patient will suffer from transplant rejection and/or eventual graft failure. Kidney transplant
recipients may experience many side effects that are associated with the administration of
immunosuppressant drugs as well (Poureetezadi & Wingert, 2013; Jacobs, 2009; Song et al.,
2013; CDC, 2010; U.S. HHS, 2013).
Interestingly, in some cases of human AKI, varying degrees of regeneration have been
documented. However, the general capability of the mammalian kidney to repair nephrons is
minimal when compared to the robust rates of regeneration observed within the renal systems
of lower vertebrates including the zebrafish (Humphreys et al., 2008; Hartman et al., 2007;
Diep et al., 2011; Zhou et al., 2010). Currently, it is unknown why there is such disparity
between the regenerative abilities of the kidney between species. Even so, by revealing the
fundamental mechanisms that govern zebrafish kidney regeneration, it is believed that this
knowledge could be extended to treat human renal diseases because of the high degree of
genetic conservation exhibited within the kidney (McCampbell & Wingert, 2012; Li &
Wingert, 2013). Nevertheless, it is essential to first characterize the basic processes that occur
during kidney organogenesis because such pathways may also play significant roles in the
regeneration events that transpire after injury. This chapter will demonstrate how the
zebrafish is being used to elucidate the complex genetic intricacies that underlie the process
of kidney development, thereby providing the basic understanding needed for prospective
translational applications to disease and potential therapeutic treatments. This chapter will
then review the recent advances in molecular techniques that are poised to transform future
research using the zebrafish, not only in the field of nephrology but to further elucidate topics
ranging from development to regeneration.
NEPHRON STRUCTURE AND ORGANIZATIONAL CONSERVATION

AMONG VERTEBRATES
Previously, it was believed that the mammalian nephron was significantly more complex
than that of lower vertebrate species, where the former consisted of highly specialized
epithelial tubules that contained numerous distinct regions responsible for performing certain
tasks related to maintaining homeostasis, nutrient reabsorption, and waste excretion (Figure
1A). Despite this preconceived notion within the field of nephrology, recent studies have
demonstrated that the segmentation patterning exhibited by the mammalian nephron is
actually conserved among other species, specifically Xenopus and the zebrafish (Figure 1B)
(Wingert et al., 2007; Wingert & Davidson, 2008; Dressler, 2006). Orthologs of many key
genes that had been implicated in kidney organogenesis from murine studies are also
similarly expressed in these model organisms, establishing their importance in renal
developmental research (Wingert et al., 2007; Wingert & Davidson, 2008; Drummond, 2005).
For instance, renal progenitor differentiation in vertebrates is facilitated in part by the
transcription factors Pax2 and Wt1 that are also expressed by renal precursors in zebrafish
(Wingert & Davidson, 2008; Dressler, 2006). Therefore, the combination of structural
simplicity and conserved specialization of the zebrafish pronephros offers great advantages
for genetic investigations of nephrogenesis (Gerlach & Wingert, 2013; Drummond, 2003).
During early vertebrate development, a succession of up to three different kidney forms
emerges from the intermediate mesoderm (IM). The pronephros is the first embryonic kidney
and is vestigial in some species. Degeneration of the pronephros is accompanied by the
formation of a second kidney, the mesonephros. The mesonephros functions transiently until
the development of the metanephros, after which it will rapidly degenerate leaving the
metanephros to serve as the adult kidney in higher vertebrates including birds, reptiles, and
mammals. Lower vertebrates like fish never form a metanephros and instead utilize the
mesonephros during adult life. Despite this difference, each kidney form is comprised of
nephrons that exhibit a similar composition (Gerlach & Wingert, 2013; Wingert & Davidson,
2008; Dressler, 2006).
Each nephron consists of a renal corpuscle that connects to an epithelial tubule
(sometimes via a ciliated neck segment) followed by a collecting duct (CD) (Schonheyder &
Maunsbach, 1975; Hallgrimsson et al., 2003; Reilly et al., 2007). Within the renal corpuscle,
the glomerulus, which serves as the blood filter, contains podocytes whose foot processes
interdigitate with those of its neighbors to produce the fenestrated architecture of the slit
diaphragm that is characteristic of this particular structure (Reilly et al., 2007). The adjoining
nephron tubule is responsible for the reabsorption of specific solutes, such as salts and sugar,
as well as the excretion of metabolic waste. In order to achieve these tasks, this specialized
nephron tubule is further subdivided into distinct segments: a series of proximal, intermediate,
and distal segments (Figure 1A) (Reilly et al., 2007). Solute reabsorption primarily occurs in
the proximal regions through the utilization of solute transporters, while the distal segments
are involved in the precise regulation of salt concentrations. Urinary waste will then exit the
nephron at the collecting duct and be channeled into a centralized drainage system
culminating at the bladder for final excretion from the body (Reilly et al., 2007; Hallgrimsson
et al., 2003).
Figure 1. Nephron segmentation is conserved between mammals and zebrafish. (A) A generic
mammalian kidney in sagittal section and its functional unit, the nephron, which has a characteristic
coiled structure. Lower schematic indicates the distinct segments present within a ―stretched out‖
nephron. (B) Top and middle images illustrate the zebrafish pronephric kidney (designated in pink)
from lateral and dorsal views, respectively. Bottom schematic shows the zebrafish pronephros
segmentation pattern viewed dorsally. Embryo anterior is located on the left. Analogous segments
between the mammalian nephron (A) and the zebrafish pronephros (B) are color-coded. Note that there
are variations in nephron structure among mammals, e.g. the presence of a neck segment (see text).
Historically, research about nephron segmentation has been impeded by the architectural
complexity of the metanephros in mammals since this kidney form is composed of thousands
to millions of nephrons (McCampbell & Wingert, 2012; Hallgrimsson et al., 2003). A new
opportunity to study nephrogenesis emerged when scientific evidence was found supporting
the conclusion that the zebrafish nephron also consists of a similarly segmented tubule,
contrary to past belief concerning its lack of specialization (Wingert et al., 2007; Wingert &
Davidson, 2008). Further, the zebrafish pronephros is composed of two nephrons that share a
single glomerulus and collecting duct at either end, which offers a simplified anatomical
kidney model (Figure 1B) (Gerlach & Wingert, 2013; Wingert & Davidson, 2008). By
evaluating gene expression patterns in the zebrafish kidney, Wingert et al. (2007)
demonstrated that the segment composition of the nephron was conserved between mammals
and the zebrafish with the notable exception of the intermediate segment known as the Loop
of Henle (Gerlach & Wingert, 2013; Wingert et al., 2007; Wingert & Davidson, 2008). Since
zebrafish have no need for water conservation as opposed to its mammalian counterpart, this
difference is logically acceptable. Therefore, the mechanisms that govern kidney development
can still be uncovered by investigating such processes within the zebrafish pronephros.
Several lines of evidence have demonstrated the similarity of the renal corpuscle between
zebrafish and mammals (Ruotsalainen et al., 1999; Holthofer et al., 1999; Kramer-Zucker et
al., 2005b; O‘Brien et al., 2011). For example, earlier studies in humans (Ruotsalainen et al.,
1999; Holthofer et al., 1999; Kestila et al., 1998) and murine models (Holzman et al., 1999;
Putaala et al., 2001) showed that the transmembrane protein, nephrin, localized to the slit
diaphragm of the glomerulus. Mutations in the gene encoding nephrin, NPHS1, lead to severe
edema and proteinuria in mice (Putaala et al., 2001) reminiscent of patients suffering from
Finnish type congenital nephrotic syndrome of the Finnish type (CNF) who also exhibit this
genetic defect (Ruotsalainen et al., 1999; Holthofer et al., 1999; Kestila et al., 1998). Based
on these findings, nephrin has been implicated in playing a crucial role in normal glomerular
filtration (Ruotsalainen et al., 1999; Holthofer et al., 1999; Kestila et al., 1998; Holzman et
al., 1999; Putaala et al., 2001). Additionally, Boute et al. (2000) discovered podocin, another
podocyte specific membrane protein that is vital for the functionality of the glomerulus. In
this respect, individuals displaying autosomal recessive steroid-resistant nephrotic syndrome,
which is first characterized by proteinuria followed by end-stage renal disease (ESRD) and
glomerulosclerosis, possess defects in the podocin gene NPHS2 (Boute et al., 2000).
Correspondingly, zebrafish homologs of nephrin and podocin have since been identified,
revealing the conserved function of these genes across species (Kramer-Zucker et al., 2005b)
as well as their ability to signify mature glomeruli in studies evaluating the mechanisms of
podocyte formation (O‘Brien et al., 2011).
Not only does the zebrafish glomerulus exhibit genetic conservation with that of
mammals, but the same situation has been found in terms of the specialized nephron tubule.
Tubule similarities have been documented based on the differential expression of various
solute transporters shared between analogous segments (Wingert et al., 2007; Wingert &
Davidson, 2011). Most notably, nephrons within the zebrafish pronephros are comprised of a
proximal convoluted tubule (PCT), proximal straight tubule (PST), distal early (DE), and
distal late (DL) segment, which show correspondence to the mammalian PCT, PST, thick
ascending limb (TAL), and distal convoluted tubule (DCT), respectively (Figure 1B)
(Wingert, et al., 2007). In the murine nephron, solute carrier family 5 (sodium/glucose
cotransporter) member 2 (slc5a2) (Reggiani et al., 2007) and solute carrier family 20
(phosphate transporter) member 1 (slc20a1) typically demarcate the PCT region of the
nephron (Wingert et al., 2007; Wingert & Davidson, 2008). Likewise, the zebrafish PCT
expresses solute carrier family 20, member 1a (slc20a1a) (Wingert et al., 2007; Gerlach &
Wingert, 2013; Nichane et al., 2006). The PST in the mouse and zebrafish can be delineated
by expression of solute carrier family 13 (sodium-dependent dicarboxylate transporter),

member 3 (slc13a3) (Wingert et al., 2007). Both the mouse and zebrafish DE segments
display solute carrier family 12, member 1 (slc12a1) expression while solute carrier family
12 (sodium/chloride transporters), member 3 (slc12a3) specifically indicates the DL region
(Gerlach & Wingert, 2013; Wingert et al., 2007; Wingert & Davidson 2008). Finally, GATA-
binding protein 3 (gata3) designates either the CD or pronephric duct (PD) of the mouse and
zebrafish, respectively (Gerlach & Wingert, 2012; Wingert et al., 2007; Wingert & Davidson
2008). These observations ultimately led to the appreciation of organizational similarity
between mammalian and zebrafish nephron segmentation, thereby exemplifying the utility of
the zebrafish for the examination of renal development. In addition to the aforementioned
tubule segments, zebrafish nephrons contain a neck segment, marked by the ciliogenesis
regulator, regulatory factor X, 2 (rfx2), which is also found in the nephrons of some mammals
(Wingert et al., 2007; Dubruille et al., 2002; Lipton, 2005; Reilly et al., 2007).
Of interest, certain anatomical differences have been documented between the kidneys of
mammals and zebrafish. Under normal conditions, the mammalian kidney contains primary
cilia while both multiciliated cells (MCCs) and single ciliated cells (SCCs) are present within
the zebrafish kidney (Ma & Jiang, 2007; Liu et al., 2007; Tammachote et al., 2009; Kramer-
Zucker et al., 2005a). Furthermore, in zebrafish, the Jagged2a-Notch signaling pathway
mediates the differentiation of these ciliated cell types, and these cell populations are
responsible for facilitating fluid propulsion throughout the nephron (Ma & Jiang, 2007; Liu et
al., 2007). In particular, rfx2+ MCCs are dispersed throughout the zebrafish PST, DE, and
anterior most region of the DL (Wingert et al., 2007; Ma & Jiang, 2007; Liu et al., 2007;
Kramer-Zucker et al., 2005a). However, unlike the zebrafish kidney, the appearance of MCCs
is typically associated with diseased states within the mammalian kidney. Thus, ciliary
defects commonly result in human pathologies, such as polycystic kidney disease (PKD) and
Meckel syndrome (MKS) (Tammachorte et al., 2009; Deane & Ricardo, 2007; 2012).
Another intriguing distinction is the Corpuscles of Stannius (CS), a teleost-specific endocrine
gland important for the regulation of calcium and phosphate concentrations (Greenwood et
al., 2009; Krishnamurthy, 1976). Though, based on the close proximity of the zebrafish CS to
the distal region of the pronephros resulting from supposed renal-derived progenitors, it has
been hypothesized that the CS may be reminiscent of the mammalian macula densa (MD), a
region of specialized cells found in the distal tubule (Wingert & Davidson, 2008).
Nonetheless, studies have demonstrated the evolutionarily conserved roles of the calcium-
sensing receptor (CaSR), expressed by the mammalian parathyroid glands and zebrafish CS,
in organismal calcium regulation (Greenwood et al., 2009; Loretz, 2008).
While these observed differences are still being actively investigated, overall, the
zebrafish pronephros still offers a simplified model to study how nephrons arise from renal
progenitors during renal ontogeny, a process termed nephrogenesis. Nephrogenesis includes a
constellation of complex events that include pattern formation, differentiation, tubulogenesis,
and lumen formation, just to name a few. Anatomically the zebrafish pronephros provides
several advantages for study because it is only comprised of two nephrons located in a linear
orientation along the trunk (Wingert & Davidson, 2008). The location of nephron segments
can be compared to the position of other anatomical features (Wingert et al., 2007). Namely,
the somites, which are transient blocks of mesoderm that make up the embryonic trunk, can
be used to map the location of renal progenitor subdomains and consequently the nephron
segment boundaries (Figure 2) (Wingert et al., 2007). Corresponding nephrogenesis events in
the mouse embryo happen during stages of development that occur in utero, and kidney organ
culture is severely limited in terms of how long cultures can be maintained. Thus, the
zebrafish pronephros provides a number of unique opportunities to delineate the mechanisms
of nephrogenesis, particularly to discover genes that are essential for the process and may be
relevant in higher vertebrates like humans.
Figure 2. Nephron segmentation formation during zebrafish development. (A) Schematics depicting the
intermediate mesoderm (IM) and paraxial mesoderm (PM) fields within a zebrafish embryo. (B) Renal
progenitors arise from the intermediate mesoderm and can be demarcated by the expression of pax2a
(top panels). At the 2 somite stage (indicated by dlc expression), exclusive rostral and caudal domains
can be visualized by dlc and mecom transcripts, respectively (bottom panels). (C) Schematic of the
segmented pronephros in a zebrafish embryo. (D) WISH of transcripts specific to each tubule segment
is shown in embryos at 24 hpf – PCT (slc20a1a), PST (trpm7), DE (slc12a1), DL (slc12a3). Somites
are marked by smyhc1 expression. Embryo anterior is located on the left. Abbreviations: PM: paraxial
mesoderm; IM: intermediate mesoderm; PCT: proximal convoluted tubule; PM: paraxial mesoderm;
PST: proximal straight tubule; DE: distal early; DL: distal late.
INSIGHTS INTO NEPHROGENESIS USING THE ZEBRAFISH

Several prominent studies have momentously contributed to current knowledge of the
genetic pathways that direct nephron segmentation during zebrafish nephrogenesis and will
be discussed in depth in this chapter (Wingert et al., 2007; Wingert & Davidson 2011; Naylor
et al., 2013). During zebrafish pronephric development, renal progenitors arise from bilateral
stripes of IM located in embryonic trunk adjacent to the paraxial mesoderm (Figure 2A)
(Drummond, 2003). Genes encoding transcription factors implicated in nephron development,
such as paired box genes 2a (pax2a) and 8 (pax8) and LIM homeobox 1a (lhx1a), are
expressed throughout these early stages as well (Wingert & Davidson, 2011; Ma & Jiang,
2007; Dawid et al., 1998; Pfeffer et al., 1998; Toyama et al., 1998). Subdivision of the renal
progenitor field commences during early somitogenesis (Figure 2B), and has been associated
with highly dynamic spatiotemporal changes in the gene expression domains of numerous
transcription factors throughout the remainder of somitogenesis, though the functions of most
still remain unknown (Wingert & Davidson, 2011; Li, et al., 2014). By 24 hours post
fertilization (hpf), nephron segmentation of all proximal and distal domains can be visualized
(Figure 2C, Figure 2D), though dynamic gene expression patterns and morphological changes
within the pronephros will continue to occur during subsequent development (Wingert et al.,
2007; Drummond, 2003). Renal progenitors ultimately progress through a mesenchymal-to-
epithelial transition (MET). The two resulting epithelial tubules will eventually become
connected, as anterior renal progenitors will differentiate into populations of podocytes that
migrate and fuse at the midline into a single glomerulus, and the posterior ends of the
nephrons join at the cloaca where waste will exit (Drummond, 2003). At approximately 48
hpf, signified by the midline fusion of the podocyte progenitors, blood filtration begins, and
the pronephros is then considered to be functional. Furthermore, between 72-144 hpf, a
progressive coiling of the PCT is observed, driven partially by the proliferation and collective
cell migration of the distal segments (Wingert et al., 2007; Vasilyev et al., 2009). While these
morphological events became well documented, the underlying mechanisms behind these
phenomena were still poorly understood until recent studies, which have provided a
framework of many genetic components of nephrogenesis (Figure 3).
The Role of Retinoic Acid in Proximodistal Renal Progenitor Patterning
To shed insight into the mechanisms that mediate segment patterning within the zebrafish
pronephros, the retinoic acid (RA) pathway (Wingert et al., 2007; Wingert & Davidson, 2011)
and caudal (cdx) (Wingert et al., 2007) gene family were first investigated since these factors
are essential in the development of tissues located near or adjacent to the renal precursors.
Among vertebrates, the establishment of the anterior-posterior (A-P) axis in ectoderm,
mesoderm, and endoderm-derived tissues is largely dependent on the signaling of RA, a
vitamin A metabolite, that regulates Hox genes during development. This transpires by the
binding of RA to the retinoic-acid receptor (RAR) and retinoid X receptor (RXR)
heterodimer, enabling subsequent interactions with the retinoic-acid response elements
(RAREs) of the Hox genes. Spatiotemporal bioavailability of RA is influenced through
sources and sinks of RA synthesis and degradation, respectively. RA synthesis relies on
retinol dehydrogenase (RDH) and retinaldehyde dehydrogenase (RALDH) enzymes, and RA

removal is mediated by retinoic acid hydroxylases (Cyp26) that degrade RA (Holland, 2007).
Figure 3. Functional roles of RA, cdx genes, and the HNF1β factors in the segmentation programming
of the zebrafish pronephros. (A) Schematics of the intermediate mesoderm (IM) and paraxial mesoderm
(PM) regions in a zebrafish embryo. The cdx genes regulate cyp26a1 and raldh2 to mediate the
concentration of RA along the anterior-posterior (A-P) axis of the embryo. RA promotes the formation
of the rostral domain while it inhibits the caudal field. (B) Exclusive rostral and caudal domains appear
around the 2 somite stage under the influence of an RA gradient along the A-P axis. HNF1β factors act
downstream of RA to initiate the segmentation patterning among renal progenitors and are also
dependent on pax2a/8, which are early regulators of nephrogenesis. (C) HNF1β factors are essential for
inducing the segmentation programming in the zebrafish pronephros. During early somite stages,
hnf1ba/b is required for the expression of irx3b, which will facilitate the differentiation of the DE
segment and mediate the PCT/PST boundary. At later stages, hnf1ba/a is dependent on irx3b for the
specification and maintenance of the DE. Embryo anterior is located on the left. Abbreviations: A-P:
anterior-posterior; PM: paraxial mesoderm; IM: intermediate mesoderm; RA: retinoic acid; P:
podocytes; PCT: proximal convoluted tubule; PM: paraxial mesoderm; PST: proximal straight tubule;
DE: distal early; DL: distal late.
Previous studies have shown that precisely regulated RA production and degradation are
vital for the dynamic patterning events during somitogenesis and ontogeny of the hindbrain,
pancreas, and even hematopoiesis (Dubrulle & Pourquie, 2004; Stafford et al., 2006; Stafford
& Prince, 2002; Ross et al., 2000; Gavalas & Krumlauf, 2000; Chanda et al., 2013).
The role of RA signaling during zebrafish pronephros development was assessed by
performing morpholino inactivation of retinaldehyde dehydrogenase 2 (raldh2) and by
treating wild-type (WT) embryos with the reversible RALDH inhibitor 4-
diethylaminobenzaldehyde (DEAB). It was observed that the distal regions expanded at the
expense of the proximal segments (Wingert et al., 2007). The same result was obtained when
WT embryos were treated with an antagonist targeting the RAR-α receptor (Wingert &
Davidson, 2011). Conversely, opposite effects were seen when embryos were exposed to
exogenous RA (Wingert et al., 2007) or when RAR-α was administered to WT embryos
(Wingert & Davidson, 2011). These findings indicated that a functional RA pathway (RA and
RAR-α receptors) is essential for normal nephron segmentation to occur by promoting
proximal fates and restricting distal domains (Wingert et al., 2007; Wingert & Davidson,
2011). Furthermore, results obtained from a DEAB timecourse suggested that various
segments had differential RA requirements that were temporally modulated. Interestingly, the
impact of RA on proximo-distal patterning was found to be greatest between gastrulation and
the 5-somite stage. Moreover, during this time period, varying RA levels could influence
renal progenitor gene expressions of dlc, jag2a, and mecom in the IM as well. Thus, RA
signaling is necessary for proper proximodistal nephron patterning during early development
(Wingert et al., 2007; Wingert & Davidson, 2011).
During early embryogenesis, the entire renal progenitor field can be visualized by the
expression of pax2a and pax8 (Wingert & Davidson, 2011). It is now known that by the end
of the 2-somite stage, the renal progenitors can be demarcated into two exclusive domains,
termed rostral and caudal, by the transcripts deltaC (dlc) and MDS1 and EVI1 complex locus
(mecom, formerly known as evi1) respectively (Li, et al., 2014). Previously, other genes such
as jagged 2a (jag2), POU class 3 homeobox 3a (pou3f3a), and empty spiracles homeobox 1
(emx1), were known to show overlapping domains in the renal progenitor field at various
early stages (Wingert & Davidson, 2011). These dynamic gene expression patterns suggested
that the segmentation program might be activated among the renal progenitors prior to
somitogenesis. Therefore, in order to evaluate the effect of RA on nephron segmentation
during early development, the lightbulb (lib) mutant containing a defect in RA production
was utilized. Indeed, while the renal progenitor domains were still visible, there was a
noticeable reduction of the rostal domain and expansion of the distal domain, leading to an
overall shift of these regions towards the anterior based on dlc, jag2, and mecom transcript
localization in lib mutants at the 8-somite stage. Together, these findings suggest that RA
mediates the early rostal and caudal domains (Figure 3B) (Wingert & Davidson, 2011).
Caudal Gene Activity Positions the Renal Progenitor Field by Influencing

the Locale of Retinoic Acid Activity in the Zebrafish Embryo
Like RA, cdx transcription factors can directly regulate Hox genes to influence posterior
fates in an embryo along the A-P axis (Lohnes, 2003). For this reason, the relationship
between the cdx genes and RA were evaluated in the developing zebrafish pronephros
(Wingert et al., 2007). The cdx transcription factors were found to influence the location of
the pronephros along the A-P axis (Wingert et al., 2007). In embryos deficient for either cdx4
or cdx1a/4, Wilms tumor protein 1a (wt1a) expressing podocytes were located more
posteriorly. However, the podocytes of cdx1a/4 doubly-deficient embryos failed to fuse into a
single glomerulus at 48 hpf, resulting in the eventual development of cysts and extreme
pericardial edema unlike WT and cdx4-/- embryos (Wingert et al., 2007). The tubules of both
of these morphant types were also more caudally positioned as indicated by the pan-tubule
and duct marker cadherin 17 (cdh17). Although cdh17 expression was continuous in cdx4
morphants, this was not the case in cdx1a/4 deficient embryos, indicating that the pronephros
was unable to form normally (Wingert et al., 2007). In agreement with this latter observation,
slc20a1a expression in the PCT was intermittent while markers for the other segments were
absent (Wingert et al., 2007). Alternately, all segments (PCT, PST, DE, CS, DL, PD) were
present in cdx4-/- embryos, but the PCT domain increased by approximately two somites
whereas the distal segments became slightly reduced (Wingert et al., 2007).
Intriguingly, data was found in support of the cdx genes regulating the expression of
raldh2 and cyp26, the synthesizing and degrading enzymes of RA respectively, to further
direct nephron segmentation (Figure 3A) (Wingert et al., 2007). The gene expression domains
of both raldh2 in the paraxial mesoderm and cyp26a1 in the upper trunk became more
posteriorly shifted in cdx4-/- and cdx1a/4 deficient embryos, with more dramatic effects
observed in the latter (Wingert et al., 2007). When these embryos were treated with DEAB,
distal fates were rescued (Wingert et al., 2007). Consequently, these analyses suggested that
along the A-P axis, the cdx genes regulate raldh2 and cyp26a1 to specify RA levels enabling
RA to spatially promote proximal fates while limiting distal domains (Wingert et al., 2007).
Of importance, these results also indicated that this proximodistal patterning is largely
enabled by the paraxial mesoderm, which is the predominant source of RA (Figure 3A)
(Wingert et al., 2007; Wingert & Davidson, 2011).
Renal Progenitor Pattern Specification and Differentiation: The Influence

of the Homeobox Transcription Factor Genes hnf1ba/b and irx3b
Additional regulation of nephron segmentation in the zebrafish pronephros is facilitated

by the paralogues, HNF1 homeobox Ba (hnf1ba) and HNF1 homeobox Bb (hnf1bb) (Figure
3C) (Naylor et al., 2013). Typically, HNF1β factors have been associated in the early
development of various organs (Chauveau et al., 2013; Sun & Hopkins, 2001; Ulinski et al.,
2006), especially the differentiation of epithelia (Sun & Hopkins, 2001; Coffinier et al., 1999;
D‘Angelo et al., 2010). With respect to the kidney, genetic defects in HNF1β are commonly
detected among individuals suffering from developmental renal abnormalities that arise
prenatally or in later life (Massa et al., 2013; Decramer et al., 2007; Heidet et al., 2010;
Ulinski et al., 2006). Correspondingly, murine models have recently shown the role of
HNF1β in regulating nephron segmentation with links to the Iroquois (Irx) transcription
factors (Heliot et al., 2013; Massa et al., 2013).
In WT zebrafish embryos, hnf1ba is expressed throughout the entire nephron while
hnf1bb is only found in the proximal and DE segments (Wingert & Davidson, 2011).
Embryos lacking these homeodomain transcription factors exhibited normal cloaca
development but failed to express proximal and distal markers at 24 hpf, which suggested the
absence of segmentation events upon tubule formation (Naylor et al., 2013). Thus, hnf1ba/b
appears to be essential for the activation of the segmentation pathway but not tubule
epithelialization (Naylor et al., 2013). When embryos deficient for hnf1ba/b were treated with
DEAB (Naylor et al., 2013), podocytes were lost and tubules adopted entirely distal fates as
seen in DEAB treated WT embryos (Wingert et al., 2007). This implicated that the HNF1β
factors act downstream of the RA pathway to initiate nephron patterning (Naylor et al., 2013).
In contrast, hnf1ba/b expression was dependent on that of early nephrogenesis regulators,
pax2a and pax8 (Naylor et al., 2013). This was indicated though the observation of similar
phenotypes in hnf1ba/b and pax2a/8 morphants, where the expression of markers for mature
nephron segments was significantly decreased in the latter (Naylor et al., 2013). Moreover,
epistasis experiments demonstrated a temporal feedback loop where hnf1ba/b factors are first
needed for iroquois homeobox protein 3b (irx3b) expression in the DE, but at later stages of
development, irx3b is required for a hnf1ba-expressing DE (Naylor et al., 2013). Based on
these findings, HNF1β factors operate downstream of RA to initiate the segmentation
programming in the nephron while dynamic interactions between irx3b and hnf1ba/b are
needed for the specification and maintenance of the DE (Figure 3C).
In concurrence with this model establishing the relationship between RA, the HNF1β
factors, and irx3b (Naylor et al., 2013), corresponding evidence places irx3b downstream of
RA signaling to induce DE differentiation (Figure 3C) (Wingert & Davidson, 2011). WT
embryos injected with an irx3b morpholino failed to develop a DE segment at 24 hpf leading
to a caudal expansion of the proximal regions (Wingert & Davidson, 2011). In support of this
finding, the domain of hepatocyte nuclear factor 4, alpha (hnf4a), a rostral and PST marker,
elongated and the pou3f3a-expressing region was found to undergo a posterior shift (Wingert
& Davidson, 2011). However, the transcripts of mecom (DL and PD) and gata3 (CS and PD)
retained their WT phenotypic expression in the irx3b morphants (Wingert & Davidson, 2011).
Therefore, it was thought that irx3b imparts late acting functions of inhibiting proximal
boundaries and initiating DE specification (Wingert & Davidson, 2011). In adherence to these
proposed roles of irx3b, lib mutants injected with morpholinos targeting irx3b displayed a
lack of DE with substantially expanded PCT and PST segments (Wingert & Davidson, 2011).
This revealed that irx3b is still able influence nephron segmentation once RA has already
initiated proximal programming in the progenitors of these segments, thereby showcasing the
dynamism of this intricate process (Wingert & Davidson, 2011). Furthermore, in DEAB
treated embryos, irx3b expression was comparable to that of slc12a1 in the DE (Wingert &
Davidson, 2011). In embryos doubly treated with DEAB and the irx3b morpholino, a region
corresponding to the DE as delineated by irx3b was visualized by the DL marker, slc12a3
(Wingert & Davidson, 2011). The authors concluded that irx3b plays a prominent part in the
later stages of DE segment differentiation, such that irx3b activity is required for the
expression of DE-specific solute transporters, but in its absence, DL markers will be
expressed instead (Wingert & Davidson, 2011).
Overall, these studies exemplify the genetic complexities that drive the fundamental
mechanisms of nephron segmentation. The dynamic interplay between RA signaling, HNF1β
factors, and irx3b illustrate the elaborate processes that coordinate the initial boundaries of
proximal and distal segments to the refinement of gene expression patterns for the final
specification of various domains (Wingert et al., 2007; Wingert & Davidson, 2011; Naylor et
al., 2013). While considerable research has already been conducted to elucidate the pathways
that control nephrogenesis, the function of many genes in the kidney are still unknown as
implicated by the recently annotated zebrafish genome. Additional analyses within the
zebrafish model will undoubtedly contribute significantly to the current working model of
renal development.
FURTHER DELINEATION OF RENAL DEVELOPMENTAL

PATHWAYS WITH ESTABLISHED AND EMERGING
MOLECULAR TOOLS IN ZEBRAFISH
Newly developed molecular techniques pertinent to the zebrafish system have further
enhanced its application as a powerful model organism for developmental studies. In
particular, the generation of loss of function (e.g. morpholinos) and genome editing
techniques (e.g. TALENs and CRISPRs) has fueled the advancement of gene function
analyses in the zebrafish (Figure 4) (Nasevicius & Ekker, 2000; Ekker, 2000; Gaj et al.,
2013). Specifically, within the context of this chapter, the current use of morpholinos to
reveal the underlying mechanisms that govern kidney organogenesis (Wang et al., 2012;
Ihalmo et al., 2003; Nishibori et al., 2011; Perner et al., 2007) and the potential of TALENs
and CRISPRs to revolutionize renal research will be discussed in the following sections.
Figure 4. Chart detailing the advantages and disadvantages of current molecular techniques amenable
to the zebrafish model for investigating gene function.
Morpholino Mediated Knockdown of Target Genes to Investigate

Kidney Development
One fundamental method used to study gene function by targeted knockdown in the
zebrafish is the utilization of antisense morpholino oligonucleotides (Nasevicius & Ekker,
2000; Bill et al., 2009). A morpholino is synthesized as an oligomer containing approximately
25 morpholine bases that are ―antisense‖ to the target ―sense‖ RNA (Ekker, 2000; Summerton
& Weller, 1997; Summerton, 1999). The morpholino is then able to bind the RNA strand of
interest through complementary base pairing, thereby functioning to sterically inhibit the
translation of that RNA into a functional protein in vivo (Bill et al., 2009; Summerton &
Weller, 1997). In many cases, morpholinos are generated to bind mRNA at the 5‘
untranslated region (5‘ UTR) near the start site resulting in the complete inhibition of gene
expression by preventing the assembly of the cell‘s translational machinery (Bill et al., 2009;
Summerton 1999). Alternately, morpholinos can be designed to target splice junctions. In this
respect, these splice blocking morpholinos are able to deter proper RNA splicing by
interfering with the binding ability of the spliceosome during pre-mRNA processing
(Summerton & Weller, 1997; Morcos, 2007). Accordingly, both of these morpholino
targeting strategies have been found to be quite effective in the zebrafish (Nasevicius &
Ekker, 2000; Ekker, 2000) and are currently being widely used to evaluate gene function and
confirm morphant phenotypes (Bill et al., 2009; Yuan & Sun, 2009).
In zebrafish, the delivery of a morpholino occurs through microinjection directly into the
1- to 2- cell stage of embryonic development (Yuan & Sun, 2009). Based on previous studies
that employed the use of morpholinos in zebrafish, the effects of morpholinos have been
documented to be fully penetrant during the first 48 hours of development (Nasevicius &
Ekker, 2000) and can even last as long as 5 days post injection (dpi) (Bill et al., 2008; 2009;
Smart et al., 2004; Kimmel et al., 2003). An example of a typical readout of a morpholino
experiment, aside from the observation of morphological morphant phenotypes, is a whole
mount in situ hybridization (WISH) where gene expression is detected by the localization of
mRNA transcripts in the zebrafish embryo. This is achieved by labeled antisense riboprobes
that are complementary to the mRNA of interest (Jacobs et al., 2011). As a result, this
technique enables the visualization of aberrant mRNA expression patterns within the injected
embryo when compared to that of the endogenous mRNA in a WT embryo.
Morpholinos are excellent for the investigation of gene function during development and
are also particularly valuable to scientists because they are affordable, water soluble, and
unaffected by nuclease activity (Summerton & Weller, 1997). Additionally, for the most part,
morpholinos (i) can be designed to target any gene and show sequence specificity, (ii) are
efficient at eliminating proteins of interest by preventing RNA translation, (iii) exhibit
potency in all cells in terms of gene knockdown, and (iv) results obtained by morpholinos are
typically reproducible (Ekker, 2000). However, as with any molecular technique, while
morpholinos provide developmental biologists with a critical means for studying gene
function in the zebrafish, several drawbacks are still associated with this method. For
example, an inherent disadvantage of morpholinos is the inability to evaluate phenotypes (e.g.
metabolic diseases) that manifest during post-embryonic stages since morpholinos tend to
lose potency after the first 48 hours (Seth et al., 2013). Furthermore, in some circumstances,
the injection of a translational blocking morpholino can lead to the ectopic upregulation of the
p53 apoptotic pathway resulting in neuronal cell death as an off-target pheonotype, but this
effect can be alleviated in part by a concomitant p53 morpholino co-injection (Bill et al.,
2009; Bedell et al., 2011; Robu et al., 2007; Ekker & Larson, 2001). Another common issue
with morpholinos is the observation of off-target effects (e.g. creation of ―monster‖ embryos
with truncated tails, grossly dysmorphic bodies, and shrunken heads) (Bill et al., 2009; Bedell
et al., 2011).
Nevertheless, the risk of nonspecific activity can typically be reduced by the
standardization of morpholino doses within an experiment (Bill et al., 2009; Bedell et al.,
2011). Control RNA rescue experiments can also be performed for further validation of
morpholino induced phenotypes by verifying the specificity of the morpholino. In a rescue,
exogenous mRNA coding for the protein of interest is co-injected with the antisense
morpholino (Bill et al., 2009; Eisen & Smith, 2008). Essentially, this injected mRNA contains
the same coding region as the morpholino, but lacks or possesses a different 5‘ UTR (Eisen &
Smith, 2008). If the morpholino is specific for its target locus, the presence of the exogenous
mRNA should be able to offset the effects of the morpholino knockdown, thereby restoring
the WT phenotype and demonstrating morpholino target specificity in the zebrafish. Another
strategy for testing morpholino specificity is the creation of a five base pair mismatch
morpholino. In this case, five nucleotides are changed in the original morpholino, which
should impair its ability to bind to its target mRNA, resulting in a WT phenotype (Eisen &
Smith, 2008). In combination, dosage adjustments and these specificity controls can help
reduce the amount of nonspecific and off-target effects often seen in morpholino experiments
(Bill et al., 2009; Bedell et al., 2011; Eisen & Smith, 2008).
Even so, the most significant disadvantage associated with conventional morpholinos is
the lack of spatial and temporal control during gene knockdown, especially when such loss of
function results in an embryonic lethal phenotype. These limitations have been obviated
through the recent development of photo-morpholinos (Shestopalov et al., 2007; Tallafuss et
al., 2012; Wolf & Ryu, 2013; Schweitzer et al., 2013) where gene expression can be activated
or de-activated in the whole embryo or select groups of cells (Tallafuss et al., 2012; Wolf &
Ryu, 2013; Schweitzer et al., 2013). These photo-morpholinos can be synthesized as either
antisense (AS) or sense (S) oligomers and gene expression will either be inhibited or
activated, respectively. In the AS-photo-morpholino strategy, a photo-cleavable unit is
inserted into the middle of the AS-photo-morpholino. Upon injection into the zebrafish
embryo, gene expression is silenced by the binding of the AS-photo-morpholino to the target
mRNA. Once the embryo is exposed to 365 nm UV light, the photo-cleavable unit is severed
releasing the AS-photo-morpholino from its target and allowing protein expression of the
targeted gene to ensue (Tallafuss et al., 2012).
Alternatively, the S-photo-morpholino is annealed to the conventional AS-morpholino
strand and injected into the embryo. In this scenario, gene expression is still active because
the AS-morpholino is inhibited from blocking translation since it is bound to the S-photo-
morpholino. When exposed to UV light, the S-photo-morpholino will be cleaved enabling the
AS-morpholino to target its complementary endogenous RNA sequence, thus turning gene
expression off (Shestopalov et al., 2007; Tallafuss et al., 2012; Wolf & Ryu, 2013;
Schweitzer et al., 2013). This S-photo-morpholino technique has been successfully utilized in
studies examining the role of various genes, such as no tail (Tallafuss et al., 2012), FEZ
family zinc finger 2 (Wolf & Ryu, 2013), and single-minded homolog 1a (Schweitzer et al.,
2013), in zebrafish neurogenesis. Consequently, temporal control is achieved through the
presence of a photo-sensitive unit in AS- and S-photo-morpholinos (Tallafuss et al., 2012;
Wolf & Ryu, 2013; Schweitzer et al., 2013). Additional studies have shown it is possible to
attain spatial control as well by using a laser to limit UV exposure to a small subset of cells in
the zebrafish embryo (Shestopalov et al., 2007; Tallafuss et al., 2012). These modified
morpholino targeting strategies provide researchers with the flexibility to control gene
expression both spatially and temporally, which permits the evaluation of when and where a
gene‘s activity is essential during development (Tallafuss et al., 2012; Wolf & Ryu, 2013;
Schweitzer et al., 2013). Thus, the use of photo-morpholinos has high potential to provide
insights into the mechanisms of renal progenitor development, for example.
Morpholino knockdown has become a crucial tool for evaluating gene function in
zebrafish (Bedell et al., 2011; Yuan & Sun, 2009; Tallafuss et al., 2012; Draper et al., 2001),
and this method has provided considerable insight into kidney organogenesis as well (Wang
et al., 2012; Mitra et al., 2012; Raschperger et al., 2008; Wang et al., 2013). In particular,
morpholinos have helped elucidate the roles of genes with unknown functions in kidney
development through gene silencing resulting in the abrogation of normal nephron
phenotypes. Current literature contains numerous examples of morpholinos to establish gene
function in the complex processes of glomerulus and nephron formation. For instance,
zebrafish kin of IRRE like 3 like (kirrel3l, previously named neph3), an ortholog of human
neph3, was found to be important in the early developmental stages of the glomerulus, the
blood filter of the renal system, but not for glomerular function after pronephros maturation
(Wang et al., 2012). In WT embryos, neph3 encodes a transmembrane protein that is
expressed in the glomerular podocyte epithelial cells (Ihalmo et al., 2003). Upon neph3
morpholino injection, embryos displayed body curvature and transient pericardial edema
detected at 4 dpi, representative of renal dysfunction. Histological analysis of these neph3
morphant embryos revealed an expanded Bowman‘s space within the glomerulus, but
interestingly, the expression of nephrin and podocin, both of which are glomerular markers of
maturity and differentiation, were not perturbed. These findings suggest that neph3 may
regulate early glomerular formation rather than its structural integrity and function following
maturation (Wang et al., 2012). Alternately, another morpholino study showed that
glucocorticoid-induced transcript 1 (glcci1) was imperative for podocyte formation and
structural maintenance, as the knockdown of this gene caused extensive effacement of
podocyte foot processes and collapse of glomeruli (Nishibori et al., 2011). Strikingly, the
inactivation of wt1a by morpholinos in zebrafish embryos lead to the complete loss of
podocytes and glomerular differentiation indicated by the lack of nephrin and podocin
expression (Perner et al., 2007).
In the tubules of the zebrafish pronephros, the apical surfaces of the epithelial cells
express uroplakin 3l (upk3l) (Mitra et al., 2012). When upk3l function is obliterated by
morpholinos, drastic functional and morphological events occur in the pronephros. upk3l
morpholino dose dependent phenotypes were observed with regards to pericardial edema
beginning at 3 dpi and axial curvature where severity correlated with increased dosage. While
upk3l morpholino inactivation did not alter the development or organization of the
pronephros, epithelial cell polarization was significantly disrupted, as was the presence of
their brush borders. Not surprisingly, upk3l morphants exhibited lower rates of renal
clearance based on dextran injections, indicative of faulty kidney function (Mitra et al., 2012).
Similarly, knockdown of the coxsackie and adenovirus receptor (CAR), which is expressed at
the tight junctions of epithelial cells, resulted in the loss of close cell-to-cell contacts
throughout the tubule and severely reduced or abrogated apical brush borders. The latter
finding indicates the potential role of CAR in microvilli organization within the proximal
regions of the nephron (Raschperger et al., 2008). Additionally, in another study relating to
proximal tubule characterization, microRNA 34b (mir24b) was determined to be important for
multiciliogenesis and the convolution of this segment (Wang et al., 2013). Taken together,
these examples demonstrate how morpholinos have enabled the characterization of many
genes during nephrogenesis and will undoubtedly continue to do so in the future.
Genomic Engineering: Implications of TALENs in Nephrology
The recent development of transcription activator-like effector nucleases (TALENs) for

genome editing is now beginning to emerge within the zebrafish community (Moore et al.,
2012; Bedell et al., 2012b; Sander et al., 2011; Huang et al., 2011; Dahlem et al., 2012; Joung
& Sander, 2013). In general, TALENs consist of a FokI nuclease domain fused to
transcription activator-like effector (TALE) proteins, which are naturally present in
Xanthomonas, a genus of phytopathogenic bacteria (Moore et al., 2012; Gaj et al., 2013; Boch
& Bonas, 2010). The DNA binding ability of TALENs occurs through the TALE repeat
domains which contain DNA-binding domains comprised of a series of 33-35 conserved
amino acid repeat domains. Within each TALE DNA-binding domain, two hypervariable
positions, termed repeat-variable di-residues (RVDs), are able to recognize a single DNA
nucleotide, conferring TALEN sequence specificity (Mak et al., 2012; Deng et al., 2012;
Boch & Bonas, 2010).
Upon TALEN dimerization on the DNA, the FokI nuclease domains are able to induce
double-stranded breaks (DSBs), causing the cell to undergo non-homologous end joining
(NHEJ) as a repair response (Moore et al., 2012; Bedell et al., 2012b). Since NHEJ is a highly
error-prone pathway, the resulting creation of insertion or deletion mutations (indels) at the
site of the DSB can cause shifts in the reading frame often leading to a premature stop during
translation (Cade et al., 2012; Dahlem et al., 2012). Notably, studies examining the
mechanism of modified TALENs in editing endogenous genes discovered that homology
directed repair (HDR) (Gaj et al., 2013) can occur after a TALEN induced DSB in the
presence of a donor DNA fragment (Miller et al., 2011) and be inherited by the offspring
(Moore et al., 2012). This finding unlocks the possibility of inserting a sequence of interest
into a homologous region near the location of the DSB, which would be used during HDR to
repair the DNA and therefore introduce that sequence into the desired area of the genome
(Jasin, 1996).
Extensive chromosomal insertions and deletions mediated by pairs of TALENs in
livestock (Carlson et al., 2012), silkworm (Ma et al., 2012), and zebrafish (Xiao et al., 2013)
have been successful as well. In the latter organism, two sites in zebrafish semaphorin 3fb
(sema3fb) were targeted by TALENs, one pair per location (Xiao et al., 2013), resulting in
heritable deletions and inversions of that chromosomal region (Xiao et al., 2013; Ma et al.,
2012). Five other endogenous zebrafish loci were tested in the same manner and showed that
this outcome was effective for segments up to 1Mb (Xiao et al., 2013). Together, these
findings reveal the ability of TALENs to not only disrupt protein-coding regions by the
creation of indels (Moore et al., 2012; Bedell et al., 2012b; Huang et al., 2011), but to also
perturb sequences containing regulatory elements or non-coding genes by sizeable genomic
inversions or deletions (Xiao et al., 2013; Carlson et al., 2012; Ma et al., 2012).
Due to its mechanism of action, TALENs represent a class of molecular techniques that is
particularly appealing in terms of gene function analyses. The construct of TALENs enables
the effective disruption of gene expression in a highly specific and predictable manner
(Huang et al., 2011; Cade et al., 2012), which has been demonstrated in various model
organisms including Drosophila (Katsuyama et al., 2013), Xenopus (Suzuki et al., 2013),
mice (Qiu et al., 2013; Sung et al., 2013; Panda et al., 2013), and zebrafish (Sander et al.,
2011; Huang et al., 2011; Bedell et al., 2012b). TALEN gene inactivation has phenocopied
mutations caused by morpholinos, providing additional confirmation of TALEN specificity
(Moore et al., 2012). In essence, the engineering of different combinations of TALE repeat
domains containing the RVDs can significantly increase the ability of TALENs to recognize
the correct target gene sequence within the genome (Moore et al., 2012; Bedell et al., 2012b;
Dahlem et al., 2012). Since it is possible to design and manipulate the arrangements of RVDs
for personalized applications, this method ultimately provides researchers with the flexibility
to customize TALENs to fundamentally target any number of sequences within the genome
of an organism (Gaj et al., 2013; Joung & Sander, 2013). A major caveat to the targeting
range of TALENs is the requirement of a 5‘ thymine base located at position 0 of the target
site (Mak et al., 2012; Katsuyama et al., 2013; Bochtler, 2012: Boch et al., 2009). Consensus
in the literature indicates that this thymine base is critical for TALEN target recognition
occurring through two degenerate folds at the N-terminus (Mak et al., 2012; Katsuyama et al.,
2013). If this conserved thymine site is altered, TALEN activity at that location will
substantially decrease (Boch et al., 2009; Romer et al., 2010). Regardless, the relative
frequency of thymines in a genome should help alleviate this limitation on TALEN targeting
to some degree.
Subsequent murine (Qiu et al., 2013; Sung et al., 2013) and zebrafish (Huang et al., 2011;
Cade et al., 2012) studies have also shown that mutations induced by TALENs can be
transmitted through the germline with high frequencies of up to 100% (Moore et al., 2012;
Cade et al., 2012; Dahlem et al., 2012) depending on the targeted site to produce mutant
progeny. This high level of germline transmission can typically be achieved with
GoldyTALENs, a modified TALEN construct resulting in greater efficiencies (Moore et al.,
2012). However, the repeated outcrossing of mutant lines is still necessary to remove any
unrelated mutations that might have been inadvertently introduced. Confirming observed
phenotypes from TALEN mutagenesis by at least two independent lines is an added
precaution that is highly recommended for these types of experiments as well (Hwang et al.,
2013a).
While TALENs are a considerably powerful technique for site-specific genome
engineering, and have exciting implications for the advancement of both developmental and
therapeutic studies, TALEN technology has not yet been used to extensively study kidney
development. In fact, the majority of published studies pertaining to the utilization of
TALENs in zebrafish typically addressed the ability of this new technology to recapitulate the
mutagenic efficiencies seen in other model organisms in this teleost species (Huang et al.,
2011; Zu et al., 2013; Huang et al., 2012). The findings of these analyses suggest a favorable
outlook for TALEN based approaches for elucidating the genetic mechanisms that direct
nephrogenesis. Provided that the sequence of interest begins with a thymine (Bochtler, 2012;
Romer et al., 2010), virtually any genetic mutant could be created for kidney studies. As
opposed to the more time-consuming approach of morpholino induced gene knockdown,
which is only effective during early embryonic stages (Smart et al., 2004; Bill et al., 2008),
TALENs would enable targeted gene knockouts with lifelong effects in the zebrafish. Gene
inactivation can be achieved in somatic cells (Bedell et al., 2012b; Sander et al., 2011) and
transmitted to the F1 generation as well (Dahlem et al., 2012; Zu et al., 2013), the latter of
which is unattainable by the transient-lasting morpholinos (Seth et al., 2013). It has also been
reported that approximately two weeks in total are needed from TALEN construct design to
obtaining mutants with germline transmission capabilities (Dahlem et al., 2012). Therefore,
the establishment of mutant lines harboring defective genes that are important for kidney
development would enable quicker analyses of gene function. Moreover, by exploiting HDR
repair, TALEN facilitated insertions (Miller et al., 2011; Jasin, 1996) of essential
nephrogenesis genes, such as pax2a and wt1a/b, could mimic gene duplication events
resulting in either beneficial or deleterious effects on this process.
The use of TALENs to study kidney development has already been demonstrated (Bedell
et al. 2012a; 2012b). Normal glomerulus formation in the zebrafish has been found to be
dependent on ponzr1 based on data obtained from morpholino knockdowns (Bedell et al.,
2012a). As a result, TALENs were designed to target ponzr1 in order to test the efficacies of
pTAL (Cermak et al., 2011), a standard TALEN construct, and GoldyTALENs (Bedell et al.,
2012b). Both types of TALENs produced similar types of indels at the targeted ponzr1 site,
but the efficiencies of both mutagenesis and transmission to the progeny were significantly
higher when GoldyTALENs were used. Successful HDR mediated integrations of an EcoRV
restriction site and mloxP into the ponzr1 locus was achieved when GoldyTALENs targeting
ponzr1 was introduced with single-stranded DNA (ssDNA) containing either sequence, and
these mutations were passed through the germline as well (Bedell et al., 2012b). These studies
ultimately establish the abilities of TALENs to contribute additional temporal control, as seen
by the introduction of an mloxP site, and to make stable kidney mutant lines with relative
ease. In any event, it remains to be seen how TALENs will transform the world of zebrafish
nephrology. However, these initial studies offer promise based on the overall effectiveness of
this technique for site-specific gene targeting.
Prospects for CRISPR-Cas Facilitated Genome Editing in the Analyses

of Nephrogenesis
An alternate, newly emerging technique for genome editing is the CRISPR-Cas system
where a RNA guide strand is used to mediate a double-stranded break in DNA by a Cas9
endonuclease causing repair by the error-prone pathway of NHEJ. This strategy is derived
from an adaptive defense mechanism against foreign nucleic acids that is found in Bacteria
and Archaea species: clustered regularly interspaced short palindromic repeats (CRISPRs)
and Cas proteins that possess nuclease activity (Hwang et al., 2013b; Horvath & Barrangou,
2010). In nature, the CRISPR loci contain several direct repeats that are interspersed with
hypervariable regions known as spacers. These spacers are short segments of exogenous
DNA sequences obtained from previously encountered viruses and plasmids that have
become integrated into the CRISPR loci (Blackburn et al., 2013; Wiedenheft et al., 2012). A
CRISPR RNA (crRNA), containing the target sequence, can then be transcribed and, in a type
II system, will also base pair to a trans-activating crRNA (tracrRNA) and foreign DNA
harboring complementary sequences adjacent to a protospacer adjacent motif (PAM)
(Blackburn et al., 2013; Jao et al., 2013; Widenheft et al., 2012). Of note, the PAM sequence
in the target DNA and a ―seed‖ region in the crRNA are required for Cas9 nuclease activity
and target recognition (Jao et al., 2013; Jinek et al., 2012). Correspondingly, functioning in
combination with the Cas9 endonuclease, this CRISPR-Cas complex is able to cleave
exogenous DNA resulting in DSBs (Blackburn et al., 2013; Wiedenheft et al., 2012).
Following the discovery of this naturally occurring CRISPR-Cas system, efforts have
been made to manipulate this mechanism for site-specific genomic engineering in vitro and in
vivo (Hwang et al., 2013a; 2013b; Jao et al., 2013; Gaj et al., 2013). By fusing the crRNA and
tracrRNA together in vitro to produce a synthetic single guide RNA (sgRNA), successful
cleavage of target sequences by Cas9 can be attained (Hwang et al., 2013b; Jinek et al., 2012;
Cho et al., 2013). This complex is designated as sgRNA:Cas9 and has been found to cause
targeted indels in human cells (Cho et al., 2013; Jinek et al., 2013; Mali et al., 2013) varying
from frequencies of 2-4% for induced pluripotent stem cells (Mali et al., 2013) and up to 33%
in the K562 myelogenous leukemia line (Cho et al., 2013). Promising results from an in vivo
study by Hwang and colleagues (2013b) indicated that the CRISPR-Cas system was able to
produce directed modifications in the zebrafish genome at rates comparable to those caused
by TALEN technology (Hwang et al., 2013b) as well thereby proposing the likely success of
this method in mutagenizing the genome of any organism as long as RNA can be
administered (Hwang et al., 2013b; Jao et al., 2013). Jao et al. (2013) reported efficient and
effective knockdown of multiple genes in one zebrafish embryo further implicating the power
of this method. Transmission of induced CRISPR-Cas mutations through the germline is also
thought to be probable since the frequencies of site-specific alterations are similar between
CRISPRs and TALENs as previously mentioned (Blackburn et al., 2013; Hwang et al.,
2013b).
In general, studies that have employed the CRISPR-Cas technique cited that it was a
fairly fast process and easy to use because only two plasmids are typically needed: one
plasmid encoding the Cas9 sequence and another with the sgRNA containing the sequence of
interest (Blackburn et al., 2013; Jao et al., 2013). This latter component of the CRISPR-Cas
system provides simplified re-targeting strategies since only a single sequence would need to
be replaced (Cho et al., 2013; Mali et al., 2013). Consequently, these attributes are perhaps
the most attractive aspects of the CRISPR-Cas system since other methods, such as TALENs,
require the construction of two nucleases per target site making it a more costly and time-
consuming approach (Cho et al., 2013; Jao et al., 2013; Hwang et al., 2013b). Additionally,
shorter sequences of approximately 100 base pairs are needed to encode an sgRNA (Hwang et
al., 2013b), which is advantageous over the high degree of repeats present in TALEN vectors
(Mak et al., 2012; Deng et al., 2012; Moore et al., 2012), a possible risk factor causing
complications in synthesis, vector delivery, and/or DNA sequencing (Hwang et al., 2013b;
Cho et al., 2013).
Of interest, Hwang et al. (2013b) indicated that the CRISPR-Cas methodology permitted
successful targeting of endogenous genes in the zebrafish that had been unaffected by
TALENs, though the reasons behind this discrepancy have yet to be elucidated. One potential
explanation for this difference could be the location of the gene on the chromosome. For
instance, if a substantial amount of steric hindrance (e.g. epigenetic state, insulators, compact
heterochromatin, etc.) were present near the targeted site, it could be less accessible to the
long TALEN dimers in comparison to the short, sgRNAs of the CRISPR-Cas system. The
lower stringency between the base paring of the sgRNA spacer and target strand (Hwang et
al., 2013a; Jao et al., 2013; Jinek et al., 2012; Cong et al., 2013) could provide more
flexibility in these situations as well. Strikingly, it has also been recognized that some sites in
the zebrafish genome are inaccessible to CRISPR-Cas induced mutagenization (Hwang et al.,
2013b; Jao et al., 2013). In any event, the specific causes of this phenomenon are presently
undetermined at this time and warrants future investigation.
Despite the apparent benefits of the CRISPR-Cas system, some constraints are yet to be
revealed. One proposed limitation of CRISPR-Cas applications is the requirement of the
PAM region for Cas9 function. This stipulation could essentially place restrictions on which
endogenous sequences could be targeted and may play a role in why certain sequences are left
unmodified by the CRISPR-Cas system, though the reasons behind this event are currently
unknown (Hwang et al., 2013b; Gaj et al., 2013). Variable results pertaining to sgRNA
toxicity and off-target effects have been documented, which indicate that further evaluation of
such incidents is necessary (Blackburn et al., 2013; Cho et al., 2013). However, it has been
found that the frequencies of dead or deformed zebrafish embryos were similar between
CRISPR-Cas and TALENs, suggesting equal toxicity associated with both techniques
(Hwang et al., 2011). A possibility for decreased sgRNA specificity could result from the fact
that only 8-14 bases (Jao et al., 2013; Jinek et al., 2012; Cong et al., 2013) of the 20 base pair
spacer near the 5‘ end of PAM is critical for Cas9 directed cleavage, thus increasing the risk
of off-target effects (Jao et al., 2013; Cho et al., 2013; Mali et al., 2013). Therefore, whole-
genome sequencing could be used to identify any off-target mutagenesis caused by CRISPRs
(Cho et al., 2013). Nevertheless, the attributes of the CRISPR-Cas strategy for modifying
genomes in a site-specific manner holds great promise for analyzing gene function and
determining the epistatic relationships that exist during development.
Upon the advent of the CRISPR-Cas system, assessment of whether or not this powerful
technology is amenable for use in the zebrafish has been quite rapid, and as previously
alluded, favorable results have been obtained so far (Xiao et al., 2013; Chang et al., 2013; Jao
et al., 2013). Several endogenous zebrafish genes, including fumarate hydratase (fh),
glycogen synthase kinase 3 beta (gsk3b), and dopamine receptor D3 (drd3), were mutated at
relatively high frequencies comparable to that of TALENs (Hwang et al., 2013b). Not only
were genes successfully targeted by the CRISPR-Cas system (Hwang et al., 2013a; 2013b;
Xiao et al., 2013; Chang et al., 2013), but the transmission of these site-specific mutations
through the germline reached astoundingly high frequencies (Hwang et al., 2013a; Jao et al.,
2013), one of which was 100% (Hwang et al., 2013a). In this case, two zebrafish were
injected with fh sgRNA and Cas9 mRNA, and all of their progeny were mutant for fh,
implicating that they possessed bialleleic gametes (Hwang et al., 2013a). Similarly, mosaic
phenotypes were observed in zebrafish injected with CRISPR-Cas constructs targeting
pigmentation genes, tyrosinase (tyr) and golden (gol). When founders with gol-mutations
were intercrossed, a majority of their progeny exhibited null-like pigmentation, suggestive of
biallelelic alternations in the germline of the founders and confirmed by sequencing of the
progeny. Furthermore, when five sgRNAs targeting different genomic loci were co-injected
with Cas9 mRNA into a zebrafish, site-specific CRISPR-Cas disruptions were found in all
five locations by sequencing, and the mutagenesis efficiencies were similar to those seen in
single-knockdowns for the most part. These findings indicate the use of CRISPR-Cas to
knockout multiple genes in a single organism to produce distinct phenotypes, a promising
finding for applications in epistasis experiments (Jao et al., 2013). In conjunction, these
studies revealed that RNA-directed Cas9 cleavage of specific target loci could be achieved at
effective rates in both somatic and germ cells within the zebrafish (Hwang et al., 2013a;
2013b; Jao et al., 2013; Chang et al., 2013).
Significantly, modifications have already been made to the CRISPR-Cas system within
the zebrafish. Based on prior adjustments made to the TALENs protocol (Bedell et al.,
2012b), co-injections with CRISPR-Cas components and single-stranded oligodeoxy-
nucleotides (ssODNs) lead to precise alterations at the desired genomic loci including single-
nucleotide substitutions, though differing targeting efficiencies imply that locus-dependent
factors may be at play. However, it was noted that a portion of the ssODN sequence could
become integrated at the indel and that the presence of ssODNs could impede the
effectiveness of the sgRNAs based on the observation of lower mutation frequencies (Hwang
et al., 2013a). Therefore, these aspects should be considered during future applications of
ssODNs and the CRISPR-Cas system. Chang et al. (2013) also established that insertions
could be made in the zebrafish genome through the CRISPR-Cas technique. This was
achieved by introducing an ssDNA with an mloxP site in addition to the Cas9 mRNA and
sgRNA. Of importance, both the ssDNA and sgRNA contained sequences targeting the ets
variant gene 2 (etv2, previously named etsrp), but no sequence overlap was permitted
between these two RNA strands thus preventing inadvertent cleavage of the ssDNA. As a
result, after CRISPR-Cas induced cleavage of the etsrp site, the mloxP site was successfully
inserted via HDR. Even so, there are several caveats to this mechanism: after mloxP
integration (i) some embryos exhibited partial mloxP deletions and (ii) additional sequences
appeared next to the inserted mloxP, a possible artifact of other repair processes. Regardless,
the benefits of CRISPR-Cas/HDR mediated insertions cannot be entirely negated since these
downsides can easily be remedied through careful screening (Chang et al., 2013). Moreover,
the combined implications of CRISPR-Cas/HDR and Cre-lox recombination are immense in
terms of targeting specificity and temporal control over gene expression, which are important
factors in developmental studies. Alternately, another study demonstrated that the CRISPR-
Cas system could potentially be extended to create large deletions in the zebrafish genome to
inactivate non-coding genes, gene clusters, and other regulatory sequences. Here, the co-
injection of two sgRNAs and the Cas9 mRNA was sufficient to generate a targeted
chromosomal deletion corresponding to the location of a miRNA gene cluster (Xiao et al.,
2013). While most groups focused on utilizing the CRISPR-Cas system to disrupt protein-
coding genes by generating site-specific indels by NHEJ (Blackburn et al., 2013; Hwang et
al., 2013a; 2013b), this finding is rather exciting since it shows even broader applications for
this revolutionary method in vivo.
Although CRISPR-Cas technology has been evaluated to some degree in the zebrafish
model, additional characterization of this technique is required before its significance in
genetic and developmental studies can be truly appreciated. Nonetheless, preliminary data
suggests that the CRISPR-Cas system may indeed transform genetic engineering in the near
future and advance the field of nephrology. One obvious benefit of CRISPR-Cas technology
is the relative ease of construct design and production of directed gene mutagenesis (Hwang
et al., 2013b; Cho et al., 2013; Mali et al., 2013). In conjunction with the short generation
time of 3-4 months among zebrafish, the creation of numerous genetic kidney mutants would
be fairly rapid and therefore excellent for high-throughput experiments, functional analyses,
and gene characterization. The heritability of CRISPR-Cas induced genomic modifications
(Hwang et al., 2013a; Jao et al., 2013) is certainly appealing for similar reasons by way of
establishing mutant lines displaying specific kidney defects. Multiple, targeted mutations in
the zebrafish by the CRISPR-Cas system (Jao et al., 2013) would also enable further analysis
of the epistatic relationships between different genes and molecular pathways which are
characteristic of the genetically intricate processes of kidney development. More insight into
the roles of genes during nephron patterning could be obtained as well by exploiting the
mechanism of HDR and the directed insertion of Cre-lox components into the zebrafish
genome once DSBs are induced via the CRISPR-Cas complex (Chang et al., 2013) ultimately
providing researchers with an additional means of temporal control. Moreover, under the
assumption that little overlap exists between the sequences that cannot be mutated by either
CRISPRs or TALENs (Hwang et al., 2013b; Jao et al., 2013), virtually all genes important for
kidney development and function should be able to be targeted. In essence, the
implementation of CRISPR-Cas for genetic engineering could potentially offer alternate
avenues for efficiently studying gene function during zebrafish nephrogenesis.
CONCLUSION
The zebrafish model has come to the forefront of medical and developmental research in
recent years (Lieschke & Currie, 2007; Spence et al., 2008). This teleost species is of
particular interest throughout the research community because it exhibits a high degree of
genetic conservation with higher vertebrates, including humans (Lieschke & Currie, 2007;
Howe et al., 2013). Significantly, studies have determined that there are functional zebrafish
homologs for an estimated 70% of all genes associated with human diseases (Langheinrich,
2003). As such, the zebrafish has been used to model a variety of disease pathologies
including hematological disorders, tumorigenesis, and central nervous system abnormalities
(Lieschke & Currie, 2007; Santoriello & Zon, 2012). Numerous developmental processes,
such as organogenesis and neurogenesis, have also been evaluated within the zebrafish
(Wingert et al., 2007; Barrallo-Cimeno et al., 2003). Furthermore, novel biomedical research
using zebrafish is enabled by the relative ease through which tools such as transgenic lines
can be generated, in combination with the ability to perform classical and chemical genetic
screens. The zebrafish is indeed a powerful model organism for a number of reasons and will
continue to fuel the acquisition of exciting, novel discoveries in the near future.
As demonstrated, analogous segmental organization exists between the mammalian and
zebrafish nephrons, which are the basic functional units of the kidney (Wingert et al., 2007).
Research using zebrafish has provided several new insights into the complex pathways that
direct nephron segmentation during renal development. The initial induction of RA permits
the proximodistal regulation of nephron patterning, and this process is further refined along
the A-P axis by the cdx genes (Wingert et al., 2007; Wingert & Davidson, 2011). Dynamic
gene expression among the renal progenitors from early embryogenesis to somitogenesis also
contributes to the formation of distinct segment boundaries as well as the differentiation of
specific cell types within those regions (Wingert & Davidson, 2011). While substantial
advances have been made to elucidate the genetic intricacies that underlie kidney
organogenesis, such as the identification of the essential roles performed by the hnf1ba/b and
irx3b transcription factors, the function of many genes within the kidney remain to be
determined. The development of novel molecular technologies (e.g. TALENs and CRISPRs)
amenable to the zebrafish system can lead to the generation of new nephrology tools, thus
enabling the practicality of future substantive kidney research using zebrafish.
REFERENCES
Amsterdam, A., Burgess, S., Golling, G., Chen, W., Sun, Z., Townsend, K., Farrington, S.,
Haldi, M., Hopkins, N., 1999, ―A large-scale insertional mutagenesis screen in
zebrafish‖, Genes Dev., 13, 2713-2724.
Barrallo-Gimeno, A., Holzschuh, J., Driever, W., Knapik, E.W., 2004, ―Neural crest survival
and differentiation in zebrafish depends on mont blanc/tfap2a gene function‖,
Development, 131, 1463-1477.
Bedell, V.M., Person, A.D., Larson, J.D., McLoon, A., Balciunas, D., Clark, K.J., Neff, K.I.,
Nelson, K.E., Bill, B.R., Schimmenti, L.A., Beiraghi, S., Ekker, S.C., 2012a, ―The
lineage-specific gene ponzr1 is essential for zebrafish pronephric and pharyngeal arch
development‖, Development, 139, 793-804.
Bedell, V.M., Wang, Y., Campbell, J.M., Poshusta, T.L., Starker, C.G., Krug, R.G., Tan, W.,
Penheiter, S.G., Ma, A.C., Leung, A.Y., Fahrenkrug, S.C., Carlson, D.F., Voytas, D.F.,
Clark, K.J., Essner, J.J., Ekker, S.C., 2012b, ―In vivo genome editing using a high-
efficiency TALEN system‖, Nature, 491, 114-118.
Bedell, V.M., Westcot, S.E., Ekker, S.C., 2011, ―Lessons from morpholino-based screening
in zebrafish‖, Brief Funct. Genomics, 10, 181-188.
Bill, B.R., Balciunas, D., McCarra, J.A., Young, E.D., Xiong, T., Spahn, A.M., Garcia-Lecea,
M., Korzh, V., Ekker, S.C., Schimmenti, L.A., 2008, ―Development and Notch signaling
requirements of the zebrafish choroid plexus‖, PLoS One, 3, e3114.
Bill, B.R., Petzold, A.M., Clark, K.J., Schimmenti, L.A., Ekker, S.C., 2009, ―A primer for
morpholino use in zebrafish‖, Zebrafish, 6, 69-77.
Blackburn, P.R., Campbell, J.M., Clark, K.J., Ekker, S.C., 2013, ―The CRISPR system-
keeping zebrafish gene targeting fresh‖, Zebrafish, 10, 116-118.
Boch, J., Bonas, U., 2010, ―Xanthomonas AvrBs3 family-type III effectors: discovery and
function‖, Annu. Rev. Phytopathol., 48, 419-436.
Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt,
A., Bonas, U., 2009, ―Breaking the code of DNA binding specificity of TAL-type III
effectors‖, Science, 326, 1509-1512.
Bochtler, M., 2012, ―Structural basis of the TAL effector-DNA interaction‖, Biol. Chem.,
393, 1055-1066.
Boute, N., Gribouval, O., Roselli, S., Benessy, F., Lee, H., Fuchshuber, A., Dahan, K.,
Gubler, M.C., Niaudet, P., Antignac, C., 2000, ―NPHS2, encoding the glomerular protein
Podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome‖, Nat.
Genet., 24, 349-354.
Cade, L., Reyon, D., Hwang, W.Y., Tsai, S.Q., Patel, S., Khayter, C., Joung, J.K., Sander,
J.D., Peterson, R.T., Yeh, J.R., 2012, ―Highly efficient generation of heritable zebrafish
gene mutations using homo- and heterodimeric TALENs‖, Nucleic Acids Res., 40, 8001-
8010.
Carlson, D.F., Tan, W., Lillico, S.G., Stverakova, D., Proudfoot, C., Christian, M., Voytas,
D.F., Long, C.R., Whitelaw, C.B., Fahrenkrug, S.C., 2012, ―Efficient TALEN-mediated
gene knockout in livestock‖, Proc. Natl. Acad. Sci. USA, 109, 17382-17387.
Centers for Disease Control and Prevention, 2010, ―National chronic kidney disease fact
sheet: general information and national estimates on chronic kidney disease in the United
States‖, http://www.cdc.gov/DIABETES//pubs/factsheets/kidney.htm.
Cermak, T., Doyle, E.L., Christian, M., Wang, L., Zhang, Y., Schmidt, C., Baller, J.A.,
Somia, N.V., Bogdanove, A.J., Voytas, D.F., 2011, ―Efficient design and assembly of
custom TALEN and other TAL effector-based constructs for DNA targeting‖, Nucleic
Acids Res., 39, e82.
Chanda, B., Ditadi, A., Iscove, N.N., Keller, G., 2013, ―Retinoic acid signaling is essential for
embryonic hematopoietic stem cell development‖, Cell, 155, 215-227.
Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W., Xi, J.J., 2013, ―Genome
editing with RNA-guided Cas9 nuclease in zebrafish embryos‖, Cell Res., 23, 465-472.
Chauveau, D., Faguer, S., Bandin, F., Guigonis, V., Chassaing, N., Decramer, S., 2013,
―HNF1β-related disease: Paradigm of a developmental disorder and unexpected
recognition of a new renal disease‖, Nephrol. Ther., doi: 10.1016/j.nephro.2013.05.004.
Cho, S.W., Kim, S., Kim, J.M., Kim, J.S., 2013, ―Targeted genome engineering in human
cells with the Cas9 RNA-guided endonuclease‖, Nat. Biotechnol., 31, 230-232.
Coffinier, C., Thepot, D., Babinet, C., Yaniv, M., Barra, J., 1999, ―Essential role for the
homeoprotein vHNF1/HNF1beta in visceral endoderm differentiation‖, Development,
126, 4785-4794.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W.,
Marraffini, L.A., Zhang, F., 2013, ―Multiplex genome engineering using CRISPR/Cas
systems‖, Science, 339, 819-823.
Dahlem, T.J., Hoshijima, K., Jurynec, M.J., Gunther, D., Starker, C.G., Locke, A.S., Weis,
A.M., Voytas, D.F., Grunwald, D.J., 2012, ―Simple methods for generating and detecting
locus-specific mutations induced with TALENs in the zebrafish genome‖, PLoS Genet.,
8, e1002861.
D'Angelo, A., Bluteau, O., Garcia-Gonzalez, M.A., Gresh, L., Doyen, A., Garbay, S., Robine,
S., Pontoglio, M., 2010, ―Hepatocyte nuclear factor 1alpha and beta control terminal
differentiation and cell fate commitment in the gut epithelium‖, Development, 137, 1573-
1582.
Dawid, I.B., Breen, J.J., Toyama, R., 1998, ―LIM domains: multiple roles as adapters and
functional modifiers in protein interactions‖, Trends Genet., 14, 156-162.
Deane, J.A., Ricardo, S.D., 2012, ―Emerging roles for renal primary cilia in epithelial repair‖,
Int. Rev. Cell Mol. Biol., 293, 169-193.
Deane, J.A., Ricardo, S.D., 2007, ―Polycystic kidney disease and the renal cilium‖,
Nephrology, 12, 559-564.
Decramer, S., Parant, O., Beaufils, S., Clauin, S., Guillou, C., Kessler, S., Aziza, J., Bandin,
F., Schanstra, J.P., Bellanne-Chantelot, C., 2007, ―Anomalies of the TCF2 gene are the
main cause of fetal bilateral hyperechogenic kidneys‖, J. Am. Soc. Nephrol., 18, 923-933.
Deng, D., Yan, C., Pan, X., Mahfouz, M., Wang, J., Zhu, J.K., Shi, Y., Yan, N., 2012,
―Structural basis for sequence-specific recognition of DNA by TAL effectors‖, Science,
335, 720-723.
Diep, C.Q., Ma, D., Deo, R.C., Holm, T.M., Naylor, R.W., Arora, N., Wingert, R.A., Bollig,
F., Djordjevic, G., Lichman, B., Zhu, H., Ikenaga, T., Ono, F., Englert, C., Cowan, C.A.,
Hukriede, N.A., Handin, R.I., Davidson, A.J., 2011, ―Identification of adult nephron
progenitors capable of kidney regeneration in zebrafish‖, Nature, 470, 95-100.
Draper, B.W., Morcos, P.A., Kimmel, C.B., 2001, ―Inhibition of zebrafish fgf8 pre-mRNA
splicing with morpholino oligos: a quantifiable method for gene knockdown‖, Genesis,
30, 154-156.
Dressler, G.R., 2006, ―The cellular basis of kidney development‖, Annu. Rev. Cell Dev. Biol.,
22, 509-529.
Driever, W., Solnica-Krezel, L., Schier, A.F., Neuhauss, S.C., Malicki, J., Stemple, D.L.,
Stainier, D.Y., Zwartkruis, F., Abdelilah, S., Rangini, Z., Belak, J., Boggs, C., 1996, ―A
genetic screen for mutations affecting embryogenesis in zebrafish‖, Development, 123,
37-46.
Drummond, I., 2003, ―Making a zebrafish kidney: a tale of two tubes‖, Trends Cell Biol., 13,
357-365.
Drummond, I.A., 2005, ―Kidney development and disease in the zebrafish‖, J. Am. Soc.
Nephrol., 16, 299-304.
Drummond, I.A., Majumdar, A., Hentschel, H., Elger, M., Solnica-Krezel, L., Schier, A.F.,
Neuhauss, S.C., Stemple, D.L., Zwartkruis, F., Rangini, Z., Driever, W., Fishman, M.C.,
1998, ―Early development of the zebrafish pronephros and analysis of mutations affecting
pronephric function‖, Development, 125, 4655-4667.
Dubruille, R., Laurencon, A., Vandaele, C., Shishido, E., Coulon-Bublex, M., Swoboda, P.,
Couble, P., Kernan, M., Durand, B., 2002, ―Drosophila regulatory factor X is necessary
for ciliated sensory neuron differentiation‖, Development, 129, 5487-5498.
Dubrulle, J., Pourquie, O., 2004, ―Coupling segmentation to axis formation‖, Development,
131, 5783-5793.
Eisen, J.S., Smith, J.C., 2008, ―Controlling morpholino experiments: don't stop making
Antisense‖, Development, 135, 1735-1743.
Ekker, S.C., 2000, ―Morphants: a new systematic vertebrate functional genomics approach‖,
Yeast, 17, 302-306.
Ekker, S.C., Larson, J.D., 2001, ―Morphant technology in model developmental systems‖,
Genesis, 30, 89-93.
El-Dahr, S.S., Harrison-Bernard, L.M., Dipp, S., Yosipiv, I.V., Meleg-Smith, S., 2000,
―Bradykinin B2 null mice are prone to renal dysplasia: gene-environment interactions in
kidney development‖, Physiol. Genomics, 3, 121-131.
Gaj, T., Gersbach, C.A., Barbas, C.F., 2013, ―ZFN, TALEN, and CRISPR/Cas-based
methods for genome engineering‖, Trends Biotechnol., 31, 397-405.
Galloway, J.L., Wingert, R.A., Thisse, C., Thisse, B., Zon, L.I., 2005, ―Loss of gata1 but not
gata2 converts erythropoiesis to myelopoiesis in zebrafish embryos‖, Dev. Cell, 8, 109-
116.
Gavalas, A., Krumlauf, R., 2000, ―Retinoid signaling and hindbrain patterning‖, Curr. Opin.
Genet. Dev., 10, 380-386.
Gerlach, G.F., Wingert, R.A., 2013, ―Kidney organogenesis in the zebrafish: insights into
vertebrate nephrogenesis and regeneration‖, Wiley Interdiscip. Rev. Dev. Biol., 2, 559-
585.
Goldsmith, J.R., Jobin, C., 2012, ―Think small: zebrafish as a model system of human
Pathology‖, J. Biomed. Biotechnol., 2012, 817341.
Greenwood, M.P., Flik, G., Wagner, G.F., Balment, R.J., 2009, ―The corpuscles of Stannius,
calcium-sensing receptor, and stanniocalcin: responses to calcimimetics and
physiological challenges‖, Endocrinology, 150, 3002-3010.
Haffter, P., Nusslein-Volhard, C., 1996, ―Large scale genetics in a small vertebrate, the
zebrafish", Int. J. Dev. Biol., 40, 221-227.
Hallgrimsson, B., Benediktsson, H., Vize, P.D., 2003, ―Anatomy and histology of the human
urinary system‖ in The Kidney, From Normal Development to Congenital Disease: ed.
P.D. Vize, A.S. Woolf, J.B.L. Bard, Academic Press, pp. 149-164.
Hartman, H.A., Lai, H.L., Patterson, L.T., 2007, ―Cessation of renal morphogenesis in mice‖,
Dev. Biol., 310, 379-387.
Heidet, L., Decramer, S., Pawtowski, A., Moriniere, V., Bandin, F., Knebelmann, B., Lebre,
A.S., Faguer, S., Guigonis, V., Antignac, C., Salomon, R., 2010, ―Spectrum of HNF1B
mutations in a large cohort of patients who harbor renal diseases‖, Clin. J. Am. Soc.
Nephrol., 5, 1079-1090.
Heliot, C., Desgrange, A., Buisson, I., Prunskaite-Hyyrylainen, R., Shan, J., Vainio, S.,
Umbhauer, M., Cereghini, S., 2013, ―HNF1B controls proximal-intermediate nephron
segment identity in vertebrates by regulating Notch signalling components and Irx1/2‖,
Holland, L.Z., 2007, ―Developmental biology: a chordate with a difference‖, Nature, 447,
153-155.
Holthofer, H., Ahola, H., Solin, M.L., Wang, S., Palmen, T., Luimula, P., Miettinen, A.,
Kerjaschki, D., 1999, ―Nephrin localizes at the podocyte filtration slit area and is
characteristically spliced in the human kidney‖, Am. J. Pathol., 155, 1681-1687.
Holzman, L.B., St John, P.L., Kovari, I.A., Verma, R., Holthofer, H., Abrahamson, D.R.,
1999, ―Nephrin localizes to the slit pore of the glomerular epithelial cell‖, Kidney Int., 56,
1481-1491.
Horvath, P., Barrangou, R., 2010, ―CRISPR/Cas, the immune system of bacteria and
archaea‖, Science, 327, 167-170.
Howe, K., Clark, M.D., Torroja, C.F., Torrance, J., Berthelot, C., Muffato, M., Collins, J.E.,
Humphray, S., McLaren, K., Matthews, L., McLaren, S., Sealy, I., Caccamo, M.,
Churcher, C., Scott, C., Barrett, J.C., Koch, R., Rauch, G.J., White, S., Chow, W., Kilian,
B., Quintais, L.T., Guerra-Assuncao, J.A., Zhou, Y., Gu, Y., Yen, J., Vogel, J.H., Eyre,
T., Redmond, S., Banerjee, R., Chi, J., Fu, B., Langley, E., Maguire, S.F., Laird, G.K.,
Lloyd, D., Kenyon, E., Donaldson, S., Sehra, H., Almeida-King, J., Loveland, J.,
Trevanion, S., Jones, M., Quail, M., Willey, D., Hunt, A., Burton, J., Sims, S., McLay,
K., Plumb, B., Davis, J., Clee, C., Oliver, K., Clark, R., Riddle, C., Eliott, D.,
Threadgold, G., Harden, G., Ware, D., Mortimer, B., Kerry, G., Heath, P., Phillimore, B.,
Tracey, A., Corby, N., Dunn, M., Johnson, C., Wood, J., Clark, S., Pelan, S., Griffiths,
G., Smith, M., Glithero, R., Howden, P., Barker, N., Stevens, C., Harley, J., Holt, K.,
Panagiotidis, G., Lovell, J., Beasley, H., Henderson, C., Gordon, D., Auger, K., Wright,
D., Collins, J., Raisen, C., Dyer, L., Leung, K., Robertson, L., Ambridge, K.,
Leongamornlert, D., McGuire, S., Gilderthorp, R., Griffiths, C., Manthravadi, D., Nichol,
S., Barker, G., Whitehead, S., Kay, M., Brown, J., Murnane, C., Gray, E., Humphries,
M., Sycamore, N., Barker, D., Saunders, D., Wallis, J., Babbage, A., Hammond, S.,
Mashreghi-Mohammadi, M., Barr, L., Martin, S., Wray, P., Ellington, A., Matthews, N.,
Ellwood, M., Woodmansey, R., Clark, G., Cooper, J., Tromans, A., Grafham, D., Skuce,
C., Pandian, R., Andrews, R., Harrison, E., Kimberley, A., Garnett, J., Fosker, N., Hall,
R., Garner, P., Kelly, D., Bird, C., Palmer, S., Gehring, I., Berger, A., Dooley, C.M.,
Ersan-Urun, Z., Eser, C., Geiger, H., Geisler, M., Karotki, L., Kirn, A., Konantz, J.,
Konantz, M., Oberlander, M., Rudolph-Geiger, S., Teucke, M., Osoegawa, K., Zhu, B.,
Rapp, A., Widaa, S., Langford, C., Yang, F., Carter, N.P., Harrow, J., Ning, Z., Herrero,
J., Searle, S.M., Enright, A., Geisler, R., Plasterk, R.H., Lee, C., Westerfield, M., de
Jong, P.J., Zon, L.I., Postlethwait, J.H., Nusslein-Volhard, C., Hubbard, T.J., Roest
Crollius, H., Rogers, J., Stemple, D.L., 2013, ―The zebrafish reference genome sequence
and its relationship to the human genome‖, Nature, 496, 498-503.
Huang, P., Xiao, A., Zhou, M., Zhu, Z., Lin, S., Zhang, B., 2011, ―Heritable gene targeting in
zebrafish using customized TALENs‖, Nat. Biotechnol., 29, 699-700.
Huang, P., Zhu, Z., Lin, S., Zhang, B., 2012, ―Reverse genetic approaches in zebrafish‖, J.
Genet. Genomics, 39, 421-433.
Humphreys, B.D., Valerius, M.T., Kobayashi, A., Mugford, J.W., Soeung, S., Duffield, J.S.,
McMahon, A.P., Bonventre, J.V., 2008, ―Intrinsic epithelial cells repair the kidney after
injury‖, Cell Stem Cell, 2, 284-291.
Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Kaini, P., Sander, J.D., Joung, J.K.,
Peterson, R.T., Yeh, J.R., 2013a, ―Heritable and precise zebrafish genome editing using a
CRISPR-Cas system‖, PloS One, 8, e68708.
Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T.,
Yeh, J.R., Joung, J.K., 2013b, ―Efficient genome editing in zebrafish using a CRISPR-
Cas system‖, Nat. Biotechnol., 31, 227-229.
Ihalmo, P., Palmen, T., Ahola, H., Valtonen, E., Holthofer, H., 2003, ―Filtrin is a novel
member of nephrin-like proteins‖, Biochem. Biophys. Res. Commun., 300, 364-370.
Jacobs, C., 2009, ―The substitution of renal function by dialysis. A century and a half of
history. Renal replacement therapy by hemodialysis: An overview‖, Néphrologie &
Thérapeutique 5, 306-312.
Jacobs, N.L., Albertson, R.C., Wiles, J.R., 2011, ―Using whole mount in situ hybridization to
link molecular and organismal biology‖, J. Vis. Exp., 49, doi: 10.3791/2533.
Jao, L.E., Wente, S.R., Chen, W., 2013, ―Efficient multiplex biallelic zebrafish genome
editing using a CRISPR nuclease system‖, Proc. Natl. Acad. Sci. USA, 110, 13904-
13909.
Jasin, M., 1996, ―Genetic manipulation of genomes with rare-cutting endonucleases‖, Trends
Genet, 12, 224-228.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., Charpentier, E., 2012, ―A
programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity‖,
Science, 337, 816-821.
Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., Doudna, J., 2013, ―RNA-programmed genome
editing in human cells‖, eLife, 2, e00471.
Joung, J.K., Sander, J.D., 2013, ―TALENs: a widely applicable technology for targeted
genome editing", Nat. Rev. Mol. Cell Bio., 14, 49-55.
Katsuyama, T., Akmammedov, A., Seimiya, M., Hess, S.C., Sievers, C., Paro, R., 2013, ―An
efficient strategy for TALEN-mediated genome engineering in Drosophila‖, Nucleic
Acids Res., 17, e163.
Kestila, M., Lenkkeri, U., Mannikko, M., Lamerdin, J., McCready, P., Putaala, H.,
Ruotsalainen, V., Morita, T., Nissinen, M., Herva, R., Kashtan, C.E., Peltonen, L.,
Holmberg, C., Olsen, A., Tryggvason, K., 1998, ―Positionally cloned gene for a novel
glomerular protein--nephrin--is mutated in congenital nephrotic syndrome‖, Mol. Cell, 1,
575-582.
Kimmel, C.B. 1993, ―Patterning the brain of the zebrafish embryo‖, Annu. Rev. Neurosci., 16,
707-732.
Kimmel, C.B., 1989, ―Genetics and early development of zebrafish‖, Trends Genet., 5, 283-
288.
Kimmel, C.B., Ullmann, B., Walker, M., Miller, C.T., Crump, J.G., 2003, ―Endothelin 1-
mediated regulation of pharyngeal bone development in zebrafish‖, Development, 7,
1339-1351.
Kramer-Zucker, A.G., Olale, F., Haycraft, C. J., Yoder, B.K., Schier, A.F., Drummond, I.A.,
2005a, ―Cilia-driven fluid flow in the zebrafish pronephros, brain and Kupffer‘s vesicle is
required for normal organogenesis‖, Development, 132, 1907-1921.
Kramer-Zucker, A.G., Wiessner, S., Jensen, A.M., Drummond, I.A., 2005b, ―Organization of
the pronephric filtration apparatus in zebrafish requires Nephrin, Podocin and the FERM
domain protein Mosaic eyes‖, Dev. Biol., 285, 316-329.
Krishnamurthy, V.G., 1976, ―Cytophysiology of corpuscles of Stannius‖, Int. Rev. Cytol., 46,
177-249.
Laale, H.W., 1977, ―The biology and use of zebrafish, Brachydanio rerio in fisheries
research. A literature review‖, J. Fish Biol., 10, 121-173.
Langheinrich, U., 2003, ―Zebrafish: a new model on the pharmaceutical catwalk‖, BioEssays,
25, 904-912.
Li, Y., Wingert, R.A., 2013, ―Regenerative medicine for the kidney: prospects and
challenges‖, Clin. Transl. Med., 2, doi:10.1186/2001-1326-2-11.
Li, Y., Cheng, C.N., Verdun, V., Wingert, R.A., 2014, ―Zebrafish nephrogenesis is regulated
by interactions between retinoic acid, mecom, and Notch signaling‖, Dev. Biol., 386,
111-122.
Lieschke, G.J., Currie, P.D., 2007, ―Animal models of human disease: zebrafish swim into
view‖, Nat. Rev. Genet., 8, 353-367.
Lipton, J., 2005, ―Mating worms and the cystic kidney: Caenorhabditis elegans as a model
for renal disease‖, Pediatr. Nephrol., 20, 1531-1536.
Liu, Y., Pathak, N., Kramer-Zucker, A., Drummond, I.A., 2007, ―Notch signaling controls the
differentiation of transporting epithelia and multiciliated cells in the zebrafish
pronephros‖, Development, 134, 1111-1122.
Lohnes, D., 2003, ―The Cdx1 homeodomain protein: an integrator of posterior signaling in
the mouse‖, BioEssays, 25, 971-980.
Loretz, C.A., 2008, ―Extracellular calcium-sensing receptors in fishes‖, Comp. Biochem.
Physiol. A Mol. Integr. Physiol., 149, 225-245.
Ma, M., Jiang, Y.J., 2007, ―Jagged2a-notch signaling mediates cell fate choice in the
zebrafish pronephric duct‖, PLoS Genet, 3, e18.
Ma, S., Zhang, S., Wang, F., Liu, Y., Liu, Y., Xu, H., Liu, C., Lin, Y., Zhao, P., Xia, Q.,
2012, ―Highly efficient and specific genome editing in silkworm using custom
TALENs‖, PloS One, 7, e45035.
Mak, A.N., Bradley, P., Cernadas, R.A., Bogdanove, A.J., Stoddard, B.L., 2012, ―The crystal
structure of TAL effector PthXo1 bound to its DNA target‖, Science, 335, 716-719.
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church,
G.M.,2013, ―RNA-guided human genome engineering via Cas9‖, Science, 339, 823-826.
Massa, F., Garbay, S., Bouvier, R., Sugitani, Y., Noda, T., Gubler, M.C., Heidet, L.,
Pontoglio, M., Fischer, E., 2013, ―Hepatocyte nuclear factor 1β controls nephron tubular
development‖, Development, 140, 886-896.
McCampbell, K.K., Wingert, R.A., 2012, ―Renal stem cells: fact or science fiction?‖
Biochem. J., 444, 153-168.
Miller, J.C., Tan, S., Qiao, G., Barlow, K.A., Wang, J., Xia, D.F., Meng, X., Paschon, D.E.,
Leung, E., Hinkley, S.J., Dulay, G.P., Hua, K.L., Ankoudinova, I., Cost, G.J., Urnov,
F.D., Zhang, H.S., Holmes, M.C., Zhang, L., Gregory, P.D., Rebar, E.J., 2011, ―A TALE
nuclease architecture for efficient genome editing‖, Nat. Biotechnol., 29, 143-148.
Mitra, S., Lukianov, S., Ruiz, W.G., Cianciolo Cosentino, C., Sanker, S., Traub, L.M.,
Hukriede, N.A., Apodaca, G., 2012, ―Requirement for a uroplakin 3a-like protein in the
development of zebrafish pronephric tubule epithelial cell function, morphogenesis, and
polarity‖, PloS One, 7, e41816.
Moore, F.E., Reyon, D., Sander, J.D., Martinez, S.A., Blackburn, J.S., Khayter, C., Ramirez,
C.L., Joung, J.K., Langenau, D.M., 2012, ―Improved somatic mutagenesis in zebrafish
using transcription activator-like effector nucleases (TALENs)‖, PloS One, 7, e37877.
Morcos, P.A., 2007, ―Achieving targeted and quantifiable alteration of mRNA splicing with
morpholino oligos‖, Biochem. Bioph. Res. Co, 358, 521-527.
Nasevicius, A., Ekker, S.C. 2000, ―Effective targeted gene 'knockdown' in zebrafish‖, Nat.
Genet., 26, 216-220.
National Institute of Health, 2012, ―Kidney disease statistics for the United States. National
Kidney and Urologic Diseases Information Clearinghouse‖. NIH Publication No. 12-
3895.
Naylor, R.W., Przepiorski, A., Ren, Q., Yu, J., Davidson, A.J., 2013, ―HNF1β is essential for
nephron segmentation during nephrogenesis‖, J. Am. Soc. Nephrol., 24, 77-87.
Nichane, M., Van Campenhout, C., Pendeville, H., Voz, M.L., Bellefroid, E.J., 2006, ―The
Na+/PO4 cotransporter SLC20A1 gene labels distinct restricted subdomains of the
developing pronephros in Xenopus and zebrafish embryos‖, Gene Expr. Patterns, 6, 667-
672.
Nishibori, Y., Katayama, K., Parikka, M., Oddsson, A., Nukui, M., Hultenby, K., Wernerson,
A., He, B., Ebarasi, L., Raschperger, E., Norlin, J., Uhlen, M., Patrakka, J., Betsholtz, C.,
Tryggvason, K., 2011, ―Glcci1 deficiency leads to proteinuria‖, J. Am. Soc. Nephrol., 22,
2037-2046.
O'Brien, L.L., Grimaldi, M., Kostun, Z., Wingert, R.A., Selleck, R., Davidson, A.J., 2011,
―Wt1a, Foxc1a, and the Notch mediator Rbpj physically interact and regulate the
formation of podocytes in zebrafish‖, Dev. Biol., 358, 318-330.
Panda, S.K., Wefers, B., Ortiz, O., Floss, T., Schmid, B., Haass, C., Wurst, W., Kuhn, R.,
2013, ―Highly Efficient Targeted Mutagenesis in Mice Using TALENs‖, Genetics, 195,
703-713.
Perner, B., Englert, C., Bollig, F., 2007, ―The Wilms tumor genes wt1a and wt1b control
different steps during formation of the zebrafish pronephros‖, Dev. Biol., 309, 87-96.
Pfeffer, P.L., Gerster, T., Lun, K., Brand, M., Busslinger, M., 1998, ―Characterization of three
novel members of the zebrafish Pax2/5/8 family: dependency of Pax5 and Pax8
expression on the Pax2.1 (noi) function‖, Development, 125, 3063-3074.
Poureetezadi, J.S., Wingert, R.A., 2013, ―Congenital and acute kidney disease: translational
research insights from zebrafish chemical genetics‖, General Med., 1:3, 1000112.
Putaala, H., Soininen, R., Kilpelainen, P., Wartiovaara, J., Tryggvason, K., 2001, ―The
murine nephrin gene is specifically expressed in kidney, brain and pancreas: inactivation
of the gene leads to massive proteinuria and neonatal death,‖ Hum. Mol. Genet., 10, 1-8.
Qiu, Z., Liu, M., Chen, Z., Shao, Y., Pan, H., Wei, G., Yu, C., Zhang, L., Li, X., Wang, P.,
Fan, H.Y., Du, B., Liu, B., Liu, M., Li, D., 2013, ―High-efficiency and heritable gene
targeting in mouse by transcription activator-like effector nucleases‖, Nucleic Acids Res.,
41, e120.
Raschperger, E., Neve, E.P., Wernerson, A., Hultenby, K., Pettersson, R.F., Majumdar, A.,
2008, ―The coxsackie and adenovirus receptor (CAR) is required for renal epithelial
differentiation within the zebrafish pronephros‖, Dev. Biol., 313, 455-464.
Reggiani, L., Raciti, D., Airik, R., Kispert, A., Brandli, A.W., 2007, ―The prepattern
transcription factor irx3b directs nephron segment identity‖, Genes Dev., 21, 2358-2370.
Reilly, R.F., Bulger, R.E., Kriz, W., 2007, ―Structural-functional relationships in the kidney‖
in Diseases of the Kidney and Urinary Tract; ed. R.W. Schrier, Lippincott Williams &
Wilkins, pp. 2-53.
Renkema, K.Y., Winyard, P.J., Skovorodkin, I.N., Levtchenko, E., Hindryckx, A., Jeanpierre,
C., Weber, S., Salomon, R., Antignac, C., Vainio, S., Schedl, A., Schaefer, F., Knoers,
N.V., Bongers, E.M., EUCAKUT Consortium. 2011, ―Novel perspectives for
investigating congenital anomalies of the kidney and urinary tract (CAKUT)‖, Nephrol.
Dia. Transplant., 26, 3843-3851.
Robu, M.E., Larson, J.D., Nasevicius, A., Beiraghi, S., Brenner, C., Farber, S.A., Ekker, S.C.,
2007, ―p53 Activation by Knockdown Technologies‖, PLoS Genet., 3, e78.
Romer, P., Recht, S., Strauss, T., Elsaesser, J., Schornack, S., Boch, J., Wang, S., Lahaye, T.,
2010, ―Promoter elements of rice susceptibility genes are bound and activated by specific
TAL effectors from the bacterial blight pathogen, Xanthomonas oryzae pv. Oryzae‖, New
Phytol., 187, 1048-1057.
Ross, S.A., McCaffery, P.J., Drager, U.C., De Luca, L.M., 2000, ―Retinoids in embryonal
development,‖ Physiol. Rev., 80, 1021-1054.
Ruotsalainen, V., Ljungberg, P., Wartiovaara, J., Lenkkeri, U., Kestila, M., Jalanko, H.,
Holmberg, C., Tryggvason, K., 1999, ―Nephrin is specifically located at the slit
diaphragm of glomerular podocytes‖, Proc. Natl. Acad. Sci. USA, 96, 7962-7967.
Sander, J.D., Cade, L., Khayter, C., Reyon, D., Peterson, R.T., Joung, J.K., Yeh, J.R., 2011,
―Targeted gene disruption in somatic zebrafish cells using engineered TALENs‖, Nat.
Biotechnol., 29, 697-698.
Santoriello, C., Zon, L.I., 2012, ―Hooked! Modeling human disease in zebrafish‖, J. Clin.
Invest., 122, 2337-2343.
Schonheyder, H.C., Maunsbach, A.B., 1975, ―Ultrastructure of a specialized neck region in
the rabbit nephron‖ Kidney Int., 7, 145-153.
Schwaderer, A.L., Bates, C.M., McHugh, K.M., McBride, K.L., 2007, ―Renal anomalies in
family members of infants with bilateral renal agenesis/adysplasia‖, Pediatr. Nephrol.,
22, 52-56.
Schweitzer, J., Lohr, H., Bonkowsky, J.L., Hubscher, K., Driever, W., 2013, ―Sim1a and
Arnt2 contribute to hypothalamo-spinal axon guidance by regulating Robo2 activity via a
Robo3-dependent mechanism‖, Development, 140, 93-106.
Seth, A., Stemple, D.L., Barroso, I., 2013, ―The emerging use of zebrafish to model metabolic
Disease‖, Dis. Model Mech., 6, 1080-1088.
Shestopalov, I.A., Sinha, S., Chen, J.K., 2007, ―Light-controlled gene silencing in zebrafish
embryos", Nat. Chem. Biol., 3, 650-651.
Smart, E.J., De Rose, R.A., Farber, S.A., 2004, ―Annexin 2-caveolin 1 complex is a target of
zetimibe and regulates intestinal cholesterol transport‖, Proc. Natl. Acad. Sci. USA, 101,
3450-3455.
Song, J.J., Guyette, J.P., Gilpin, S.E., Gonzalez, G., Vacanti, J.P., Ott, H.C., 2013,
―Regeneration and experimental orthotopic transplantation of a bioengineered kidney‖,
Nat. Med., 19, 646-651.
Song, R., Yosypiv, I.V., 2011, ―Genetics of congenital anomalies of the kidney and urinary
tract‖ Pediatr. Nephrol., 26, 353-364.
Spence, R., Gerlach, G., Lawrence, C., Smith, C., 2008, ―The behaviour and ecology of the
zebrafish, Danio rerio”, Biol. Rev. Camb. Philos., 83, 13-34.
Stafford, D., Prince, V.E., 2002, ―Retinoic acid signaling is required for a critical early step in
zebrafish pancreatic development‖, Curr. Biol., 12, 1215-1220.
Stafford, D., White, R.J., Kinkel, M.D., Linville, A., Schilling, T.F., Prince, V.E., 2006,
―Retinoids signal directly to zebrafish endoderm to specify insulin-expressing beta-cells‖,
Streisinger, G., Walker, C., Dower, N., Knauber, D., Singer, F., 1981, ―Production of clones
of homozygous diploid zebra fish (Brachydanio rerio)”, Nature, 291, 293-296.
Summerton, J., 1999, ―Morpholino antisense oligomers: the case for an RNase H-independent
structural type‖, Biochim. Biophys., 1489, 141-158.
Summerton, J., Weller, D., 1997, ―Morpholino antisense oligomers: design, preparation, and
Properties‖, Antisense Nucleic Acid Drug Dev., 7, 187-195.
Sun, Z., Hopkins, N., 2001, ―vhnf1, the MODY5 and familial GCKD-associated gene,
regulates regional specification of the zebrafish gut, pronephros, and hindbrain‖, Genes
Dev., 15, 3217-3229.
Sung, Y.H., Baek, I.J., Kim, D.H., Jeon, J., Lee, J., Lee, K., Jeong, D., Kim, J.S., Lee, H.W.,
2013, ―Knockout mice created by TALEN-mediated gene targeting‖, Nat. Biotechnol.,
31, 23-24.
Suzuki, K.T., Isoyama, Y., Kashiwagi, K., Sakuma, T., Ochiai, H., Sakamoto, N., Furuno, N.,
Kashiwagi, A., Yamamoto, T., 2013, ―High efficiency TALENs enable F0 functional
analysis by targeted gene disruption in Xenopus laevis embryos‖, Biol. Open., 2, 448-452.
Swanhart, L.M., Cosentino, C.C., Diep, C.Q., Davidson, A.J., de Caestecker, M., Hukriede,
N.A., 2011, ―Zebrafish kidney development: basic science to translational research‖,
Birth Defects Res., 93, 141-156.
Tallafuss, A., Gibson, D., Morcos, P., Li, Y., Seredick, S., Eisen, J., Washbourne, P., 2012,
―Turning gene function ON and OFF using sense and antisense photo-morpholinos in
zebrafish‖, Development, 139, 1691-1699.
Tammachote, R., Hommerding, C.J., Sinders, R.M., Miller, C.A., Czarnecki, P.G., Leightner,
A.C., Salisbury, J.L., Ward, C.J., Torres, V.E. Gattone II, V.H., Harris, P.C., 2009,
―Ciliary and centrosomal defects associated with mutation and depletion of the Meckel
syndrome genes MKS1 and MKS3‖, Hum. Mol. Genet., 18, 3311-3323.
Toyama, R., Kobayashi, M., Tomita, T., Dawid, I.B., 1998, ―Expression of LIM-domain
binding protein (ldb) genes during zebrafish embryogenesis‖, Mech. Dev. 71, 197-200.
Ulinski, T., Lescure, S., Beaufils, S., Guigonis, V., Decramer, S., Morin, D., Clauin, S.,
Deschenes, G., Bouissou, F., Bensman, A., Bellanne-Chantelot, C., 2006, ―Renal
phenotypes related to hepatocyte nuclear factor-1β (TCF2) mutations in a pediatric
cohort‖, J. Am. Soc. Nephrol., 17, 497-503.
US Department of Health and Human Services, 2013, ―National transplantation data report.
OPTN: Data Organ Procurement and Transplantation Network‖, 〈 http://optn.transplant.
hrsa.gov/latestData/step2.asp?.
Vasilyev, A., Liu, Y., Mudumana, S., Mangos, S., Lam, P.Y., Majumdar, A., Zhao, J., Poon,
K.L., Kondrychyn, I., Korzh, V., Drummond, I.A., 2009, ―Collective cell migration
drives morphogenesis of the kidney nephron,‖ PLoS Biol, 7, e9.
Wang, H., Lehtonen, S., Chen, Y.C., Heikkila, E., Panula, P., Holthofer, H., 2012, ―Neph3
associates with regulation of glomerular and neural development in zebrafish‖,
Differentiation 83, 38-46.
Wang, L., Fu, C., Fan, H., Du, T., Dong, M., Chen, Y., Jin, Y., Zhou, Y., Deng, M., Gu, A.,
Jing, Q., Liu, T., Zhou, Y., 2013, ―miR-34b regulates multiciliogenesis during organ
formation in zebrafish‖, Development, 140, 2755-2764.
Welham, S.J., Riley, P.R., Wade, A., Hubank, M., Woolf, A.S., 2005, ―Maternal diet
programs embryonic kidney gene expression‖, Physiol. Genomics, 22, 48-56.
Westerfield, M., 2000, The Zebrafish Book, 3rd ed, University of Oregon Press, Eugene, OR.
Wiedenheft, B., Sternberg, S.H., Doudna, J.A., 2012, ―RNA-guided genetic silencing systems
in bacteria and archaea‖, Nature, 482, 331-338.
Wingert, R.A., Selleck, R., Yu, J., Song, H.D., Chen, Z., Song, A., Zhou, Y., Thisse, B.,
Thisse, C., McMahon, A.P., Davidson, A.J., 2007, ―The cdx genes and retinoic acid
control the positioning and segmentation of the zebrafish pronephros‖, PLoS Genet., 3,
1922-1938.
Wingert, R.A., Davidson, A.J., 2008, ―The zebrafish pronephros: a model to study nephron
Segmentation,‖ Kidney Int., 73, 1120-1127.
Wingert, R.A., Davidson, A.J., 2011, ―Zebrafish nephrogenesis involves dynamic
spatiotemporal expression changes in renal progenitors and essential signals from retinoic
acid and irx3b‖, Dev. Dyn., 240, 2011-2027.
Wolf, A., Ryu, S., 2013, ―Specification of posterior hypothalamic neurons requires
coordinated activities of Fezf2, Otp, Sim1a and Foxb1.2‖, Development, 140, 1762-1773.
Xiao, A., Wang, Z., Hu, Y., Wu, Y., Luo, Z., Yang, Z., Zu, Y., Li, W., Huang, P., Tong, X.,
Zhu, Z., Lin, S., Zhang, B., 2013, ―Chromosomal deletions and inversions mediated by
TALENs and CRISPR/Cas in zebrafish‖, Nucleic Acids Res., 41, e141.
Yuan, S., Sun, Z., 2009, ―Microinjection of mRNA and morpholino antisense
oligonucleotides in zebrafish embryos‖, J. Vis. Exp., 27, doi: 10.3791/1113.
Zhou, W., Boucher, R.C., Bollig, F., Englert, C., Hildebrandt, F., 2010, ―Characterization of
mesonephric development and regeneration using transgenic zebrafish‖, Am. J. Physiol.
Renal. Physiol., 299, F1040-7.
Zu, Y., Tong, X., Wang, Z., Liu, D., Pan, R., Li, Z., Hu, Y., Luo, Z., Huang, P., Wu, Q., Zhu,
Z., Zhang, B., Lin, S., 2013, ―TALEN-mediated precise genome modification by
homologous recombination in zebrafish‖, Nat. Methods, 10, 329-331.
Chapter 10
THE USE OF WHOLE MOUNT IN SITU

HYBRIDIZATION SCREENING TO UNDERSTAND
THE DEVELOPMENTAL TOXICOLOGY
OF ENVIRONMENTAL POLLUTANTS
IN ZEBRAFISH EMBRYOS
William K. F. Tse*
Department of Biology, Hong Kong Baptist University, Kowloon Tong, Hong Kong
ABSTRACT
Zebrafish have been widely used in developmental studies as an excellent in vivo,
high-throughput and scalable system for decades, due to the following advantages. Its
small size (< 5mm at 7 days post-fertilization (dpf)) and large number of rapidly
developing transparent embryos (most organs are developed within 5dpf) enable
researchers to undergo whole mount in situ hybridization studies, real-time fate-mapping
experiments, and visualizing developing organ morphology. Furthermore, the zebrafish
has a well-established genome database that provides information for genomic studies,
ranging from microarrays to more advance deep-sequencing studies. Moreover, its highly
conserved developmental signalling pathways position it as a good model to correlate
with other mammalian studies. In the field of environmental toxicology, zebrafish is used
to understand the common and standard toxicology end point, such as phenotypic
changes and lethal concentrations (LC50). However, these studies do not fully utilize the
features of zebrafish. This chapter aims to provide our experiences and opinion on using
zebrafish to understand early developmental defects caused by toxicant exposures. A
standard whole-mount in situ hybridization screening protocol was used to monitor three
critical early developmental stages (60–75% epiboly, 8–10 somite, and prim-5). The
screening provided first-hand information of whether the toxicant affects the dorsoventral
(DV) patterning, segmentation, and brain development in zebrafish embryos within 24
hours exposure of toxicants. Since tracing the continuous developmental changes at
different stages of mammalian embryos is not easy due to in utero development; the
*
Corresponding author: Department of Biology, Hong Kong Baptist University, Kowloon Tong, HONG KONG,
kftse@hkbu.edu.hk.
216 William K. F. Tse
zebrafish provides an excellent alternative way to understand the developmental

toxicology of different toxicants.
Keyword: Developmental toxicology, environmental pollutants, whole mount in situ

hybridization, zebrafish embryogenesis
ABBREVIATIONS
BPA bisphenol A
dpf days post fertilization
DV dorsoventral
EDCs endocrine disrupting chemicals
hdf hours post fertilization
LC lethal concentration
NGS next generation sequencing
PFA paraformaldehyde
PFOS perfluorooctanesulfonic acid
PTU phenylthiourea
TCS triclosan
WISH whole-mount in situ hybridization
INTRODUCTION
The drastic advancement in industrialization and technology and the growth in human
population in the past century have resulted in unprecedented environmental changes in
human history. Global industrialization improves our living standard but at the same time, it
exposes us to unexpected pollutions. Global warming is one of these issues. The production
of large amounts of synthetic chemicals and pollutants has influenced our ecosystem and
brings potential hazards to humans. Among the pollutants, the endocrine disrupting chemicals
(EDCs) are one of the most concerning pollutants; as they can interfere with the synthesis,
metabolism, and action of endogenous hormones (Phillips & Foster 2008; Phillips et al.
2008). Humans are exposed to EDCs easily through the environment, consumer products, and
foods (Poppenga 2000; Feron et al. 2002; Mantovani et al. 2006; Wigle et al. 2008). There is
an urgent need to access the effect of such chemicals. Manufactured chemicals such as
bisphenol A (BPA) and perfluorooctanesulfonic acid (PFOS) are classified as the endocrine
descriptors that affect the reproductive system. Another example, triclosan (TCS), is added in
many household products and may be harmful as well. Recently, studies have suggested that
TCS can act as an endocrine disruptor, affecting thyroid function and live birth index in rat
(Rodriguez & Sanchez 2010; Fort et al. 2011). In addition, TCS could affect heart tissue in
rats (Cherednichenko et al. 2012). As a common household product ingredient, used products
containing TCS enters the sewer systems and is transported to wastewater sewage treatment
Zebrafish as a Developmental Toxicology Screening Model 217
plants, eventually reaching our rivers and ultimately the sea. If they are not well pre-treated
before releasing, these chemicals will enter the ecosystem and bring potential hazards to
organisms within these environments. In order to assess the risks of EDCs exposure, a
sensitive animal model for in vivo studies is required. The study should not be limited to the
―toxicology dosage‖ studies but also the potential long-term defects after prolong exposure.
Whether the exposure of the pollutants will affect normal embryogenesis is critical. Feeding
pregnant mice with chemicals is widely used to understand the effect of such chemicals in
fetal development. However, traditional experiments using in-utero mouse models limit the
full understanding of the nature of toxicants during development. This model system is also
relatively expensive and slow in comparison to work with zebrafish. The suggested screening
method in zebrafish mentioned below could greatly reduce the screening cost. And most
importantly, utilizing zebrafish as the model could augment our understanding of
developmental toxicology that is difficult to be achieved in mouse model. Zebrafish embryos
are externally fertilized, and transparent during the early development. Visualizing and
tracing the developmental abnormalities caused by the exposure of toxicants are much easier
in the zebrafish model, and could lead to better understanding of how these chemicals affect
development.
This chapter will provide new insight on the environmental toxicity studies. Using
zebrafish as a model has different advantages not limited to its well-known genome and easy
to perform a reasonably high throughput screening (Zon & Peterson 2005). Zebrafish acts as
an excellent model in developmental biology to study embryogenesis for over two decades. A
fundamental advantage of zebrafish is their high similarity to humans, in terms of genetic
similarity and organ systems. As a large-scale screening model, they can produce a large
number of transparent and rapidly developing embryos. Furthermore, most of the organs are
well-developed and functional at around 5-7 dpf in the zebrafish (Seth, Stemple & Barroso
2013). All these advantages shape zebrafish as a good experimental model. Numerous of
reports have used zebrafish for standard toxicology studies (Duan et al. 2008; McCormick et
al. 2010). However, limited groups have fully used the developmental features of zebrafish.
Besides the standard toxicology studies such as measuring the LC50, and dosage effects,
zebrafish can give invaluable information on developmental signaling pathways and
patterning. Since examinations of toxicants‘ effect on early in utero development are difficult
and costly in mammalian models; zebrafish, with the feature of external fertilization, can
serve as an alternative model. Here, we introduce a general idea for toxicant studies that focus
on developmental defects. By recruiting the standard methodologies from developmental
biology into toxicology studies, a new trend of developmental toxicological science has
begun.
The chapter summarized the procedures used in our team for developmental toxicology
screening on pollutants. Based on the standard whole mount in situ hybridization staining
used in developmental biology, we have reported that BPA influences DV patterning, somite
formation, brain development, and causes cell death at early developmental stages in
zebrafish embryos (Tse et al. 2013). Brief methodology will be introduced in both the adult
and the embryos experiments. The suggested study opens a new window for studying
toxicants from a different point of view, gaining an insight of how toxicants could affect the
early developmental mechanisms.
SUGGESTED PROCEDURE FOR TOXICANTS TEST IN ADULT FISH

Typical toxicant tests on zebrafish have been performed for decades. Basically, the adult
fish are bathed into a toxicant solution for a given time period, followed by dissection and
sampling of internal organs. By this typical method, the toxicological dosage can be
determined. Furthermore, if researchers are interested in particular signalling molecules
within specific organs, qRT-PCR of different genes can be performed. In this chapter, we are
not going through the general adult treatment; however, we would like to mention one
additional experiment that can be used in zebrafish to understand the trans-generation
developmental toxicology effect of toxicants. Reports have suggested that some toxicants
may pass the toxicological effects from mother to the subsequent generation (Bernal & Jirtle
2010; Manikkam et al. 2013). Zebrafish can act as a good model to understand if exposed fish
will pass down developmental defects in their offspring in their relative F2 or F3 generations.
The procedures are as follows. All testing subjects will be the female zebrafish at age around
4 months. Before exposure to toxicant, the female zebrafish were crossed with males
continuously for two days to ensure all the stored eggs were spawned. The female will be
transferred to the recovery tank separately for one day. Afterwards, the fish will be transferred
to the toxicant solution tank for desired period at 28 oC. By the end of the experiment, the fish
will be used for crossing with normal male. It should be noted that if treated males were used,
the data will contain two variable factors (Spermatogenesis verses Oogenesis). Thus, we
suggest the test should start with female exposure. Embryos were then collected and raised to
F2 and F3 (depends on the experimental design); and others will be used for the in situ
screening mentioned below.
SUGGESTED PROCEDURE FOR TOXICANTS SCREENINGS

IN ZEBRAFISH EMBRYOS IN 96-WELL PLATE
Different toxicants have their respective working dosage. The screening in 96-well plate
allows researchers to understand both the dosage and its relative developmental toxicology at
one time. Briefly, zebrafish were set for crossing one day before the experiment. Details for
setting up the crossing tanks can be referenced to our previous book chapter (Tse & Jiang
2012). Before the experiment, researchers should prepare different concentrations of toxicants
to be tested. Afterwards, embryos were collected and put into the 96-well plate. Three to six
embryos (depends on the day for sample collection) were placed into each well. The E3
medium was then removed, and refilled with the toxicant solution (200μl) to the well. Place
the plate back to 28oC and incubate until the desired time point for analysis. 0.03%
Phenylthiourea (PTU) can be added to prevent pigmentation after 24 hours post fertilization
(hpf) (Tse & Jiang 2012). Toxicant solution should be changed daily. Taking an example of
our suggested time points, embryos will be collected at three stages within 24 hours to study
different stages of embryogenesis. The whole-mount in situ hybridization (WISH) procedure
we use has been previously described (Tse & Jiang 2012). Briefly, toxicant exposed embryos
were collected at 3 stages 60–75% epiboly, 8–10 somite stage (ss), and prim-5 stage. Chorion
should be removed by adding pronase (2.5mg/ml). Reaction can be stopped once the chorion
is detached. Embryos were then fixed in 4% paraformaldehyde (PFA). The embryos can be
stored at PFA in the 96-well plate until the end of the whole set experiment. Plasmids used to
make antisense mRNA probes for WISH are listed in figure 1. Figure 2 illustrates an example
of an experimental design for a 24hpf developmental toxicology screen in a 96-well plate
format.
Stage (Objective) Probe References

60-75% epiboly Ventral markers: eve1, gata2; Joly et al. 1993; Stachel, Grunward
(DV patterning) dorsal markers: chd, gsc & Myers 1993; Detrich et al. 1995;
Miller-Bertoglio et al. 1997
8-10 somite Somite marker: myoD Weinberg et al. 1996
(segmentation)
Prim-5 Rhombomere 3 and 5: krox20; Strahle et al. 1993; Heisenberg et al.
(Brain structure) mid-hindbrain boundary: eng2b; 1996; Schier et al. 1996
midbrain: otx2
Figure 1. In situ hybridization markers used in a 24 hpf developmental screening.
Figure 2. An example of a 24 hpf developmental toxicology screens in a 96-well plate format. The
example shows a typical embryogenesis screen on zebrafish embryos. Three chemicals, each for four
different dosages (including control) can be tested at one time. Three developmental stages (60-75%
epiboly, 8-10 somite stage, and prim-5 stage) can be collected for eight in situ hybridization molecular
markers. For dorsoventral patterning markers at epiboly stage, eve1, gata2, chd, and gsc will be used;
for segmentation at somite stage, myoD; and brain development at prim-5 stage will be krox20, eng2b,
and otx2.
Figure 3. Figure shows the in situ hybridization results of three brain developmental markers (eng2b,
krox20, otx2) of the control group at prim-5 stage in 96-well plate. Arrows indicated the positive
staining in the embryos.
Studies for Organogenesis at the Later Developmental Stages
Besides the time points that we have mentioned above, if the researcher is interested on
the effect of toxicants on organogenesis (later developmental stages), he/she may consider the
use of different in situ markers that are specific for the organ labelling. For example, at 5dpf,
common markers such as fatty acid binding protein2 (fabp2) labelling the intestine, prospero-
related homebox gene 1a (prox1) labelling liver and pancreas, and trypsin (try) marking the
exocrine cells of the pancreas can be used. One of the advantages of using zebrafish is the
well-organized community database. Researchers could search suitable in situ markers easily
at the zfin website (http:// zfin.org). It should be noted that PTU has to be added to the well to
prevent pigmentation (or bleaching step will be necessary during the in situ hybridization) for
studying older embryos. Furthermore, the reaction time of proteinase K in the in situ
hybridization has to be longer as well. Detailed protocol can be referenced to (Tse & Jiang
2012).
CONCLUSION AND PROSPECTIVE

The use of zebrafish in environmental sciences studies is increasing. Besides the classical
in situ hybridization method that we have mentioned in this chapter, the use of transgenic
zebrafish has become a growing trend within the community. Fluorescence transgenic
zebrafish could help researches to target specific genes and/or organs easily during the whole
experimental period. Different organ-specific reporter fish lines have been generated. For
example, Tg(fabp10:dsRed) labels liver; Tg(ins:mCherry) labels beta pancreatic cells; and
Tg(cmlc2:egfp) labels heart. In addition, double labelling such as Tg(fabp10:
RFP,ela3l:EGFP)gz12 labels liver in red and exocrine cells of the pancreas in green. All
these lines can greatly facilitate the screening process. Researchers can search for available
fish lines for their studies (Kimmel & Meyer 2011; North & Gossling 2011) or they can
generate their own specific transgenic fish using the gateway cloning system (Villefranc.
Amigo & Lawsaon 2007).
Lastly, the successfulness and great cost reduction on next generation sequencing (NGS)
enables researchers to realize a new potential within toxicogenomic studies. Exploration of
altered genes expression levels in toxicant-exposed fish and/or embryos could provide a
whole new understanding of the toxicant effects in the in vivo model. Further bioinformatics
analysis can provide hints on potential regulatory network and signalling pathways. Recently,
a research group in Singapore has started to perform next generation sequencing on toxicant-
exposed zebrafish to monitor/identify altered genes and pathway regulation (Lam et al. 2011).
Although a microarray approach has been used for years, we foresee that the array will be
replaced by the RNA-sequencing protocols that can identify more genes at one time with a
similar cost. Furthermore, the zebrafish genome has been completed [23], which will further
boost the zebrafish as a developmental toxicology model. Over the past decade, many new
zebrafish related technologies have been developed. The high degree of similarities between
zebrafish and human has strengthened the zebrafish as a model to study human diseases
(Burgess 2013; Howe et al. 2013). The use of zebrafish will bring new insight and impact to
the classical toxicology field.
REFERENCES
Bernal, A. J. & Jirtle, R. L. (2010). ‗Epigenomic disruption: the effects of early
developmental exposures‘, Birth Defects Res A Clin Mol Teratol, 88, 938-944.
Burgess, D. J. (2013). ‗Genomics: New zebrafish genome resources‘, Nat Rev Genet, 14,
368-369.
Cherednichenko, G., Zhang, R., Bannister, R. A., Timofeyev, V., Li, N., Fritsch, E. B., et al.
(2012). ‗Triclosan impairs excitation-contraction coupling and Ca2+ dynamics in striated
muscle‘, Proc Natl Acad Sci USA, 109, 14158-14163.
Detrich, H. W., 3rd Kieran, M. W., Chan, F. Y., Barone, L. M., Yee, K., Rundstadler, J. A., et
al. (1995). ‗Intraembryonic hematopoietic cell migration during vertebrate development‘,
Proc Natl Acad Sci USA, 92, 10713-10717.
Duan, Z., Zhu, L., Zhu, L., Kun, Y. & Zhu, X. (2008). ‗Individual and joint toxic effects of
pentachlorophenol and bisphenol A on the development of zebrafish (Danio rerio)
embryo‘, Ecotoxicol Environ Saf, 71, 774-780.
Feron, V. J., Cassee, F. R., Groten, J. P., van Vliet, P. W. & van Zorge, J. A. (2002).
‗International issues on human health effects of exposure to chemical mixtures‘, Environ
Health Perspect, 110, Suppl 6, 893-899.
Fort, D. J., Mathis, M. B., Hanson, W., Fort, C. E., Navarro, L. T., Peter, R., et al. (2011).
‗Triclosan and thyroid-mediated metamorphosis in anurans: differentiating growth effects
from thyroid-driven metamorphosis in Xenopus laevis‘, Toxicol Sci, 121, 292-302.
Heisenberg, C. P., Brand, M., Jiang, Y. J., Warga, R. M., Beuchle, D., van Eeden, F. J. et al.
(1996). ‗Genes involved in forebrain development in the zebrafish, Danio rerio‘,
Howe, K., Clark, M. D., Torroja, C. F., Torrance, J., Berthelot, C., Muffato, M., et al. (2013).
‗The zebrafish reference genome sequence and its relationship to the human genome‘,
Nature, 496, 498-503.
Joly, J. S, Joly, C., Schulte-Merker, S., Boulekbache, H. & Condamine, H. (1993). ‗The
ventral and posterior expression of the zebrafish homeobox gene eve1 is perturbed in
dorsalized and mutant embryos‘, Development, 119, 1261-1275.
Kimmel, R. A. & Meyer, D. (2011). ‗Molecular regulation of pancreas development in
zebrafish‘, Methods Cell Biol, 100, 261-280.
Lam, S. H., Hlaing, M. M., Zhang, X., Yan, C., Duan, Z., Zhu, L., et al. (2011).
‗Toxicogenomic and phenotypic analyses of bisphenol-A early-life exposure toxicity in
zebrafish‘, PLoS One, 6, e28273.
Manikkam, M., Tracey, R., Guerrero-Bosagna, C. & Skinner, M. K. (2013). ‗Plastics derived
endocrine disruptors (BPA, DEHP and DBP) induce epigenetic transgenerational
inheritance of obesity, reproductive disease and sperm epimutations‘, PLoS One, 8,
e55387.
Mantovani, A., Maranghi, F., Purificato, I. & Macri, A. (2006). ‗Assessment of feed additives
and contaminants: an essential component of food safety‘, Ann Ist Super Sanita, 42,
427-432.
McCormick, J. M., Van, Es. T., Cooper, K. R., White, L. A. & Häggblom, M. M. (2010).
‗Microbially mediated O-methylation of bisphenol A results in metabolites with
increased toxicity to the developing zebrafish (Danio rerio) embryo‘, Environ Sci
Technol, 45, 6567-6574.
Miller-Bertoglio, V. E., Fisher, S., Sánchez, A., Mullins, M. C. & Halpern, M. E. (1997).
‗Differential regulation of chordin expression domains in mutant zebrafish‘, Dev Biol,
192, 537-550.
North, T. E. & Goessling, W (2011). ‗Endoderm specification, liver development, and
regeneration‘, Methods Cell Biol, 101, 205-223.
Phillips, K. P. & Foster, W. G. (2008). ‗Key developments in endocrine disrupter research
and human health‘, J Toxicol Environ Health B Crit Rev, 11, 322-344.
Phillips, K. P., Foster, W. G., Leiss, W., Sahni, V., Karyakina, N., Turner, M. C., et al.
(2008), ‗Assessing and managing risks arising from exposure to endocrine-active
chemicals‘. J Toxicol. Environ Health B Crit Rev, 11, 351-372.
Poppenga, R. H. (2000), ‗Current environmental threats to animal health and productivity‘,
Vet Clin NorthAm Food Anim Pract, 16, 545-558.
Rodríguez, P. E. & Sanchez, M. S. (2010). ‗Maternal exposure to triclosan impairs thyroid

homeostasis and female pubertal development in Wistar rat offspring‘, J Toxicol Environ
Health A, 73, 1678-1688.
Schier, A. F., Neuhauss, S. C., Harve, y M., Malicki, J., Solnica-Krezel, L., Stainier, D. Y., et
al. (1996). ‗Mutations affecting the development of the embryonic zebrafish brain‘,
Seth, A., Stemple, D. L. & Barroso, I. (2013). ‗The emerging use of zebrafish to model
metabolic disease‘, Dis Mod Mech, 6, 1080-1088.
Stachel, S. E., Grunwald, D. J. & Myers, P. Z. (1993). ‗Lithium perturbation and goosecoid
expression identify a dorsal specification pathway in the pregastrula zebrafish‘,
Development, 117, 1261-1274.
Strähle, U., Blader, P., Henrique, D. & Ingham, P. W. (1993). ‗Axial, a zebrafish gene
expressed along the developing body axis, shows altered expression in cyclops mutant
embryos‘, Genes Dev, 7, 1436-1446.
Tse, W. K. F. & Jiang, Y. J. (2012). ‗Functional screen of zebrafish deubiquitylating enzymes
by morpholino knockdown and in situ hybridization‘, Methods Mol Biol, 815, 321-331.
Tse, W. K. F., Yeung, B. H., Wan, H. T. & Wong, C. K. (2013). ‗Early embryogenesis in
zebrafish is affected by bisphenol A exposure‘, Biol Open, 2, 466-471.
Villefranc, J. A., Amigo, J. & Lawson, N. D. (2007). ‗Gateway compatible vectors for
analysis of gene function in the zebrafish‘, Dev Dyn, 236, 3077-3087.
Weinberg, E. S., Allende, M. L., Kelly, C. S., Abdelhamid, A., Murakami, T., Andermann, P.,
et al. (1996). ‗Developmental regulation of zebrafish MyoD in wild-type, no tail and
spadetail embryos‘, Development, 122, 271-280.
Wigle, D. T., Arbuckle, T. E., Turner, M. C., Berube, A., Yang, Q., Liu, S. & Krewski, D.
(2008). ‗Epidemiologic evidence of relationships between reproductive and child health
outcomes and environmental chemical contaminants‘, JToxicol Environ Health B Crit
Rev, 11, 373-517.
Zon, L. I. & Peterson, R. T. (2005). ‗In vivo drug discovery in the zebrafish‘, Nat Rev Drug
Discov, 4, 35-44.
Chapter 11
USING ZEBRAFISH TO DEFINE MECHANISMS

OF LEAD (Pb) DEVELOPMENTAL NEUROTOXICITY
Sara E. Wirbisky and Jennifer L. Freeman*

School of Health Sciences, Purdue University, West Lafayette, IN, US
ABSTRACT
Lead (Pb) is a physiologically non-essential toxic heavy metal. The use of Pb in
industrial applications is widespread and has resulted in an increase in human exposure.
Over the previous six decades, active efforts to reduce the use of Pb have caused federal
regulations concerning industrial and environmental Pb levels to become more stringent
leading to a reduction in human exposure. The specific adverse health effects of Pb
exposure are dependent on dose with the central nervous system (CNS) being one of the
most vulnerable targets. Despite the advances in our knowledge of Pb neurotoxicity, the
specific molecular mechanisms have not yet been completely defined. Exposure to Pb
poses a significant risk to human health especially when exposure occurs during
fertilization or early developmental stages. It is because of these risks that an integrated
approach that includes these beginning life stages is needed in order to understand the
working mechanisms of Pb neurotoxicity. The zebrafish presents itself as a
complementary vertebrate model that possesses many strengths and has gained popularity
in developmental biology and environmental toxicology. The strengths of the zebrafish
model in developmental toxicology stem from their rapid ex utero embryonic
development, transparent embryos, and high degree of genetic homology. Their use in the
identification of behavioral, genetic, and morphological alterations that occur during
development and adulthood induced by Pb exposure has provided valuable insight and
identified novel mechanisms of Pb neurotoxicity.
Keywords: Development, lead, metal, neurotoxicity, Pb, zebrafish
*
Corresponding author: Jennifer L. Freeman, Ph.D., School of Health Sciences, Purdue University, 550 Stadium
Mall Dr., HAMP-1263D, West Lafayette, IN 47907 USA, E-mail: jfreema@purdue.edu.
226 Sara E. Wirbisky and Jennifer L. Freeman
INTRODUCTION
Generally confined to ore deposits, the heavy metal Pb does not naturally come into
contact with biological systems. Its existence in nature is almost exclusively anthropogenic,
being the result of human production, with its introduction to biological systems occurring
relatively recent in terms of biological evolution. The story of modern Pb exposure in the
United States can be traced to two developments that occurred in the 1920s, the combined
effects of which drastically increased the levels of human exposure. The first of these events
was the failure of the United States to adopt an international ban on the use of Pb in
household paint and the second was the approval of its use as a gasoline additive. The full
scope of the impacts that these decisions would have on the public was not understood at the
time they were made, even though there was clear evidence that both leaded paint and
gasoline posed significant threats to human health. Even today, Pb is used in the production
of ceramic glazes, batteries, pipes, and ammunition.
Pb is considered to be a multimedia pollutant to humans in that exposures can occur in
the forms of ingestion or inhalation (White et al. 2007). Percutaneous absorption of Pb or
inorganic Pb compounds is far less common with minimal translation into blood lead levels
(BLLs) (Stauber et al. 1994; Sun et al. 2002). Once ingested, Pb is primarily absorbed in the
intestinal tract; mainly in the duodenum. Children can absorb 40-50% of an ingested dose,
while adults only absorb approximately 3-10% (ATSDR 2007). Pb accumulation in the lungs
is also common due to occupational inhalation of Pb or Pb containing compounds. Intestinal
and lung absorption are the primary routes by which Pb enters the bloodstream. Once Pb
enters the bloodstream it is carried by erythrocytes with a half-life (t1/2) of approximately one
month. Once in the bloodstream, the majority of Pb accumulates in bone increasing the t1/2 to
10-30 years (Rabinowitz 1991). This long half-life causes bone to act as a Pb sink allowing
for continual release into the bloodstream after exposure has ceased.
Pb has been known to be toxic to human health for centuries. Although harmful at any
age, Pb exposure during early development and early childhood causes long lasting adverse
health effects. Prenatal Pb exposure is shown to cause a reduction in fetal weight and growth.
Maternal and cord BLLs that are below the current Centers for Disease Control and
Prevention (CDC) reference level of 5 g/dL are associated with a decrease in fetal weight
and growth (Xie et al. 2013). In utero Pb exposure is associated with adverse effects on
cognitive, language, and social development in children 2 years of age. Pb can also cause
adverse brain development including structural, organizational, and functional alterations in
adulthood (Bellinger 2013; Lin et al. 2013). A variety of evidence also suggests that expectant
mothers can release and transmit Pb to their children during pregnancy and lactation
(Silbergeld 1992).
During the 1960‘s the CDC assigned an initial BLL standard of 60 g/dL in children. At
and above this BLL, visible symptoms in children begin to show, including but not limited to
abdominal pain, clumsiness, and headaches. Encephalopathy is the most severe manifestation
that occurs at levels at or above 60 g/dL (Needleman 2004). Throughout the ensuing
decades, the BLL in children began to decrease as emerging evidence deemed that childhood
Pb exposure causes neurodevelopmental alterations below previously assigned values. In
1991, the CDC lowered the BLL standard to 10 g/dL which held fast until the most recent
reduction in January of 2012, in which the CDC reduced the standard to a new reference
Developmental Lead Neurotoxicity in Zebrafish 227
value of 5g/dL in children. Currently, there are approximately 500,000 children one through
five years of age who have a BLL above this reference value in the United States (CDC.gov).
The simple question that remains unanswered is whether 5 g/dL is low enough or can
neurodevelopmental alterations occur at even lower levels.
PB MECHANISMS OF NEUROTOXICTY
Over the past few decades, there has been a vast amount of research on Pb neurotoxicity
utilizing both in vivo and in vitro models as well as epidemiological studies. Numerous
studies have identified some molecular mechanisms of Pb neurotoxicity (e.g., Pb induced
activation of calcium binding sites) and functional mechanisms (e.g., long-term potentiation
[LTP] inhibition), but many of those studies were conducted at relatively high doses (Figure
1). Thus, it is difficult to know which of these molecular mechanisms of toxicity are relevant
to the ―lower-dose‖ environmental exposures of today associated with developmental toxicity
(White et al. 2007). A likely scenario exists, in which due to the general nature of Pb, its
similarity to other biologically available and reactive elements, and its ability to infiltrate and
disrupt multiple neurological processes there does not exist a single molecular mechanism
behind its neurotoxicity. These mechanisms are complicated due to the simple structure of Pb
which results in a non-uniform but widespread distribution.
Research has found that there are select windows of brain development in which
particular neural processes are strongly affected by Pb. The developing CNS is the most
vulnerable to toxic insults due to incomplete blood-brain barrier (BBB) formation, cell-to-cell
interactions, neuronal differentiation and migration, axonal growth and migration, and
synaptogenesis. These processes are highly regulated and interruptions in their normal
function can cause substantial adverse neurodevelopment alterations and deficits in
neurobehavioral function. Pb exerts its toxic effects on the developing CNS directly and
indirectly by a variety of mechanisms which include but are not limited to:
mimicry/substitution of calcium (Ca2+) and/or zinc (Zn), apoptosis, excitotoxicity, second
messenger pathways, mitochondrial dysfunction, accumulation in glial cells, penetration of
the BBB, and disruption of neurotransmission (reviewed in Lidsky & Schneider 2003).
The primary reason Pb causes such widespread destruction within the developing CNS is
in its ability to mimic or substitute for Ca2+ and to a lesser extent, Zn (reviewed in Lidsky &
Schneider 2003). Ca2+ is a vital intracellular signaling molecule that is critical for cell and
neuronal functions and its elimination or accumulation causes widespread damage. Another
proposed mechanism in which Pb causes destruction of the developing CNS is by initiating
the apoptotic cascade. Pb can initiate the apoptosis pathway via mitochondrial dysfunction.
This can occur in two ways: an increase in intracellular Ca2+ or Pb accumulation. Pb
accumulation causes a disruption in Ca2+ homeostasis triggering apoptosis. This proposed
mechanism has been studied in retinal cell culture and in adult rats (Fox et al. 1997; He et al.
2000; reviewed in Lidsky & Schneider 2003).
Pb also has been shown to cause a deficit in cognitive function by acting on second
messenger pathways. Protein kinase C (PKC) is a serine/threonine protein kinase that is
important in the cellular regulation of synaptic transmission. These events include the
synthesis of neurotransmitters, ligand-receptor interactions, and dendritic branching in the
developing CNS. PKC is also necessary for proper signal transduction that is involved in
learning and memory (Cremin & Smith 2002). The hypothesized mechanism of Pb on PKC is
the ability of Pb to mimic Ca2+ which is an activator of multiple isoforms of PKC. Pb
activation of PKC occurs in picomolar concentrations compared to nanomolar concentrations
of Ca2+ that is needed for activation (Markovac & Goldstein 1988). The γ-isoform is a
potential target because it is calcium dependent, neuron specific, and is important for spatial
learning and memory. Multiple studies have been aimed at deciphering the direct mode of
action that Pb has on PKC; however, the findings have varied (Chen et al. 1998; Cremin &
Smith 2002; Markovac & Goldstein 1988).
Glial cells are also highly susceptible to the neurotoxic effects of Pb; most notably the
astrocytes and oligodendrocytes. Studies have provided evidence that astrocytes act as Pb
sinks in the developing and mature brain. The uptake of Pb occurs in non-mitochondrial sites
which are thought to serve as a protective mechanism in order to prevent damage to the cells
respiratory function (reviewed in Lidsky & Schneider 2003). Tiffany-Castiglioni and
colleagues demonstrated in vitro that immature astrocytes accumulate and retain more Pb than
adults (Tiffany-Castiglioni et al. 1989). This accumulation and retention of Pb might allow
for the constant release of Pb into the brain, damaging other neurons (Holtzman et al. 1987).
Oligodendrocytes are also affected by Pb exposure. Adult rats exposed to Pb showed
abnormal oligodendrocytes with characteristics that included different dispersion of
chromatin, irregular structure of the Golgi system, and damaged rough endoplasmic
reticulum. These structural changes in oligodendrocytes are thought to disrupt the proper
production of myelin sheaths causing alterations in their membrane fluidity and destruction of
its ordered layering (Dabrowska-Bouta et al. 1999).
Figure 1. Mechanisms of developmental lead (Pb) neurotoxicity. Pb exerts its toxic effects on the
developing CNS directly and indirectly by a variety of mechanisms which include but are not limited
to: mimicry and substitution of calcium (Ca2+) and/or zinc (Zn), second messenger pathways,
excitotoxicity, apoptosis, long term potentiation, accumulation in glial cells, penetration of the blood-
brain barrier (BBB), and disruption of neurotransmission. (ACh: acetylcholine; BBB: blood brain
barrier; DA: dopamine; GABA: gamma-aminobutyric acid; Glu: glutamate; PKC: protein kinase C).
Pb can also disrupt neurotransmitter function throughout the CNS. Due to the numerous
and complex neurotransmitter systems, Pb can disrupt one or multiple avenues of proper
functioning. These disruptions can range from precursor uptake and synthesis, packaging,
vesicular membrane fusion and release, transporters, and receptors. Pb alters the
neurotransmission of virtually all neurotransmitters, but the most predominant changes occur
in acetylcholine (ACh), dopamine (DA), and the amino acid neurotransmitters glutamate
(Glu) and γ-aminobutyric acid (GABA) (reviewed in Lidsky & Schneider 2003). Low
concentrations of Pb are shown to increase the spontaneous release of these neurotransmitters
while higher concentrations inhibit neurotransmitter release caused by depolarization
(Bressler & Goldstein 1991).
Pb also causes neurotoxicity indirectly by a number of mechanisms. Pb can cause anemia
by inhibiting heme synthesis or reducing iron absorption in the gut. Delta aminolevulinic acid
dehydratase (ALAD) is the second enzyme in heme synthesis and is often used as a
biomarker of Pb toxicity due to its sensitivity. When Pb exposure causes a decrease in ALAD,
erythrocyte synthesis is inhibited leading to anemia and a decrease in hemoglobin levels.
These enzymes can also affect GABA neurotransmission in the CNS. Through the heme
production process, ALAD generates an additional enzyme aminolevulinic acid (ALA)
(Feksa et al. 2012). ALA is a weak agonist of the neurotransmitter GABA and an
accumulation of ALA has the capability to decrease presynaptic release of GABA (Feksa et
al. 2012; Needleman 2004). Another indirect mechanism is based on the fact that during
development, the BBB is still undergoing maturation making it vulnerable to Pb toxicity
through the Ca2+/ATPase pumps. In addition, Pb can also cause a disruption in thyroid
hormone transport to the brain which is essential for normal development. Furthermore, from
a genetic standpoint, Pb can also replace Zn which can alter genetic transcription and Pb
accumulation in the nucleus can lead to adverse effects on gene function (reviewed in Lidsky
& Schneider 2003).
PB NEUORTOXICITY IN RODENT MODELS

The neurotoxicity effects of Pb exposure in rodent models varies greatly due to
differences in dose, time and duration of exposure, and methods of analysis. However, it is
understood that Pb affects multiple aspects of CNS development and proper functioning
during adulthood. Trying to identify the most sensitive periods during development is also a
challenge due to differences in procedures, even though these differences may have
significantly different impacts on functional development (Schneider et al. 2012a). One of the
most highly agreed upon adverse effects of developmental Pb exposure is the impacts on
learning and memory deficits and behavioral alterations. The hippocampus is known to be
sensitive to the effects of Pb and effects on hippocampal physiology have been studied
(Gilbert et al. 1999). Hippocampal transcriptomic analysis of developmental Pb exposure
revealed that effects vary between male and female rats, and whether the dose occurred
during gestation/lactation or during postnatal development. The doses used in this study were
250 and 750 ppm Pb acetate; however, results showed a nonmonotonic dose response with
effects at 250 ppm exceeding or being similar in magnitude to the 750 ppm dose. Genes
significantly changed were associated with neuronal plasticity. Alterations within this
pathway can potentially lead to cognitive, behavioral, and neurological deficits (Schneider et
al. 2012a). Even though Pb exposure during early childhood increases the risk, Pb exposure
occurring during later childhood or early adolescence can also be problematic. Post-weaning
Pb exposure caused significant changes in gene expression that are responsible for structure,
maturation, and function of the hippocampus and frontal cortex (Schneider et al. 2012b).
Differences in sex and rearing conditions are also noted to demonstrate different
performances of learning and memory associated with a developmental Pb exposure
(Anderson et al. 2012). Doses consisting of 0, 250, 750, or 1500 ppm Pb acetate showed that
females in non-enrichment environments with Pb exposure had slower less efficient spatial
learning compared to females raised in the non-enrichment environment without Pb exposure.
Similar to past Pb studies (e.g., Lasley & Gilbert 2002; Schneider et al. 2012a; White et al.
2007) this study also noted a nonmonotonic dose response with effects only at the lowest (250
ppm) and highest doses (1500 ppm). These results suggest that different mechanisms are
affected by different Pb doses. Lower doses may affect physiological processes leading to
functional changes; whereas intermediate doses allow for system compensation and higher
doses overwhelming the system.
It is known that Pb exposure affects multiple neurotransmitter systems in a biphasic
response; increasing spontaneous release at low doses while inhibiting depolarization induced
release at high doses (Leret et al. 2002). The most common neurotransmitter systems to be
effected by Pb exposure are norepinephrine and its metabolite (Bijoor et al. 2012), GABA
(Drew et al. 1990; Leret et al. 2002; Silbergeld et al. 1979, 1980), Glu (Marchetti & Gavazzo
2005), ACh, and DA (Scortegagna & Hanbauer 1997). Even though these studies vary greatly
in terms of dose, time and length of exposure, they all share a commonality in which changes
in neurotransmitter systems have much larger implications on overall CNS function.
PB AND DEVELOPMENTAL ORIGINS OF ADULT DISEASE (DOAD)

Concerns over whether developmental Pb exposure can cause lasting effects that
eventually influence the risk of developing adult diseases have been under investigation. In
1975, a case report documented a patient who suffered from severe Pb induced
encephalopathy as a child who died at the age of 42 with severe brain deterioration,
neurofibrillary tangles, and senile plaques (Niklowitz & Mandybur 1975). The appearance of
these characteristics is predominately found in Alzheimer‘s disease (AD) patients. AD, the
most common form of dementia, is characterized by progressive loss of neurons and
synapses, primarily occurring in the cortex and subcortical regions. Late-onset (sporadic) AD
accounts for almost 90% of AD cases. Environmental and genetic factors and their
interactions affect the development of sporadic AD. Pb has been hypothesized to be a factor
in the pathogenesis of AD due to Pb‘s ability to cause cognitive damage and to interact with
several proteins and genes associated with AD. Specific molecular mechanisms are beginning
to be identified that link Pb exposure to key features of AD pathogenesis. Behl et al. (2009)
demonstrated that Pb treatment caused an accumulation of amyloid beta (ABeta) in brain
tissue. ABeta is a polypeptide which is a primary component of beta-amyloid plaques that are
found in the brain of AD patients. It is these plaques that are thought to contribute to cellular
disruption leading to neuronal death (Koronyo-Hamaoui et al. 2011). Additionally, Pb

exposure caused improper functioning of PKC causing an increase in cytosolic ABeta (Behl
et al. 2010). Transgenic mice that were exposed to Pb demonstrated an increase in ABeta in
the cerebrospinal fluid (CSF) and brain tissues, without an increase in ABeta production by
neurons (Gu et al. 2011). This increase in ABeta could be an indication of improper clearance
or metabolism.
Furthermore, early life exposure to Pb is also reported to cause overexpression of genes
and proteins associated with AD pathology in non-human primates and rodents and an
increase in amyloid plaques in non-human primates (Basha et al. 2005; Wu et al. 2008). In
order to improve our understanding of how a developmental Pb exposure affects AD
pathogenesis, lifespan studies were conducted examining cognitive function and its
association with biochemical and molecular pathways associated with AD (Basha et al. 2005;
Bihaqi et al. 2013). Mice treated with Pb during development had an up regulation of AD
biomarkers including the amyloid beta precursor protein (APP) and its amyloidogenic
product, ABeta; and beta-site APP cleaving enzyme one (BACE1) (Basha et al. 2005; Bihaqi
et al. 2013). The authors suggest that a potential mechanism of this up-regulation could
include long-term epigenetic modification of DNA that regulates the transcription factors of
these genes (Basha et al. 2005; Bihaqi et al. 2011, 2013).
Early Pb exposure is also linked to a decrease in cognitive function and smaller brain
volume, in the frontal and total gray matter zones as well as in the parietal white matter
(Stewart & Schwartz 2007). These data imply that Pb exposure can cause persistent and
permanent brain lesions. Gene-environment interactions are seen between Pb and the specific
apolipoprotein E (APOE) allele known to be associated with increased odds of AD (APOE
e4). Previous Pb exposure in conjunction with at least one e4 allele has a stronger correlation
with decreased performance of neurobehavioral tests than in patients without an e4 allele
(Stewart et al. 2002). Keeping in mind that this study was not developmentally focused, it
does demonstrate gene-environment interactions of Pb and its ability to alter brain
performance during adulthood. Epigenetic markers have also been used to undercover
molecular mechanisms of DOAD. These studies have shown that developmental Pb exposure
pre-determined the expression of AD-related genes during adulthood. The expression of these
genes influenced amyloidogenesis and oxidative damage by processes involving DNA
methylation (Basha et al. 2005; Bihaqi et al. 2011; Wu et al. 2008; Zawia et al. 2009).
Dosunmu et al. (2012) addressed the epigenetic alterations associated with a developmental
Pb exposure on a global scale utilizing microarrays. This study found that the expression of
genes related to aging were down regulated; potentially hindering the brains ability to defend
against neurodegenerative damage and that DNA methylation plays a significant role in this
down regulation.
ZEBRAFISH: A COMPLEMENTARY VERTEBRATE MODEL ORGANISM

While many studies have investigated developmental Pb neurotoxicity, the mechanisms
of toxicity are not yet completely understood. Furthermore, the developmental origin of Pb
induced neurodegenerative disease pathogenesis presents new interesting questions in regards
to Pb neurotoxicity. The zebrafish (Danio rerio) is a popular complementary vertebrate model
system that is being used to assess the developmental and adult impacts of Pb and other
toxicants. The zebrafish model was introduced in the 1930‘s; however, it was not until the
1960‘s that its popularity grew due to the work of Dr. George Streisinger (reviewed in de
Esch et al. 2012; Vernier & Bally-Cuif 2010). Through the 1980‘s development of genetic
techniques such as cloning, mutagenesis, transgenesis, and mapping approaches using the
zebrafish began to be developed (Lieschke & Currie 2007). The use of zebrafish as an in vivo
model in toxicology is growing in many areas that include but are not limited to:
developmental, reproductive, neurological, endocrine, genetic, and neurobehavioral
toxicology (e.g., Chen et al. 2012; Liu et al. 2013; Weber et al. 2013; Yu et al. 2013).
The recent popularity of the zebrafish as a model organism has produced much literature
characterizing developmental processes and genetic function. There are multiple strengths in
using the zebrafish model; first being their size. Zebrafish are small vertebrate animals that
are approximately 1-1.5 inches in length as adults. Their small size allows large numbers to
be housed in small areas which reduces husbandry costs. Zebrafish also have a high fecundity
rate; one female can lay ~100 eggs per mating. Laboratories with multiple breeding groups
can produce a few thousand embryos per breeding and zebrafish can breed approximately
every seven days (Hill et al. 2005). The availability of a large number of embryos is a great
advantage for performing high throughput analysis and for generating a large sample size.
The near transparent chorion is another strength making for easy observation of gross
morphological alterations throughout embryonic development. A shorter time to maturity and
a shorter lifespan are other strong attributes of the zebrafish as a model organism primarily
for full lifespan and multigenerational studies. Important for genetic applications, the
sequencing of the genome has been completed and the high homology (60-80%) to humans
makes translation and extrapolation to humans possible (Barbazuk et al. 2000; reviewed in de
Esch et al. 2012).
The zebrafish genome has 25 chromosome pairs compared to the 23 pairs in humans
(Freeman et al. 2007). In addition, a whole genome duplication event occurred during teleost
evolution; an event which did not occur in mammals. However, only a small percentage of
these duplications still remain today. Some of the duplicated genes may not have the same
function or may not be expressed in the same tissue. This poses an advantage over
mammalian models where an ortholog mutation might cause lethality, but a mutation of the
zebrafish paralog, may show a less severe phenotypic alteration allowing for greater analysis
of gene function (Spitsbergen & Kent 2003). In addition to genetic homology, it is also shown
that the amino acid sequences of functionally relevant protein domains are evolutionarily
conserved.
Multiple genetic tools are established to aid in detection of genetic alterations due to
toxicant exposure (reviewed in de Esch et al. 2012). Transgenic applications have allowed
researchers to generate multiple zebrafish models. These transgenic fish lines are being used
to identify gene alterations due to toxicant exposure as well as gene recovery. Knockdown
technology has also greatly improved over the years with morpholino oliogonucleotides
(MOs) being a valuable technique for the zebrafish. Primary and immortal cell culture lines
are also established from embryonic and adult zebrafish. With the completion of the zebrafish
genome, the use of microarrays and whole genome sequencing is becoming a powerful tool to
assess the global genetic impact of a toxicant (Hill et al. 2005).
Understanding the role of human genes in development of diseases require models which
allow gene function to be easily studied and the zebrafish is recognized as a genetic and
physiological model for vertebrate specific processes (Barbazuk et al. 2000). Large scale
mutagenic screens found multiple zebrafish mutants that resemble various disorders such as
hemophilia, anemia, porphyria, and disorders of the peripheral nervous system (PNS) and
CNS (Dodd et al. 2000). The strengths of the zebrafish as a model organism span across
multiple disciplines bridging the gap between cell culture, rodent models, and human studies.
It is in this ability that their role not only in toxicology but in other areas of science has grown
in strength and popularity. Increasing our knowledge to strengthen the link between zebrafish
and other vertebrate species in terms of genetic and neurological disorders can provide
valuable advancements in prevention and treatments.
Many models exist that are being employed to study neurodegenerative disorders,
including both cell culture and whole organism models, each displaying their individual
strengths and weaknesses. A dichotomy exists among these models with a strong focus placed
on higher phylogenetic animals, mainly due to the strong similarity they display with humans,
both in terms of genetics and brain morphology. The studies that use these models often deal
with brain pathologies and frequently utilize transgenic animals engineered to develop
pathologies similar to the human disease states prematurely or artificially. On the other end of
the spectrum are cell culture and invertebrate models which provide information on specific
mechanisms or gene interactions. These models are generally much easier and provide more
flexibility and precision in terms of exposure conditions and genetic manipulation.
Evidence suggests that zebrafish can be a relevant and useful model for the study of
neurodegenerative disorders (Xia 2010; Yanwei et al. 2011). Many genes involved with
development and which are associated with neurodegeneration have been shown to be
strongly conserved in the zebrafish (Bretaud et al. 2011; Kabashi et al. 2011). Furthermore,
while the brain of the zebrafish differs from humans in terms of some structural features,
many important functional areas for modeling disease states are conserved. An important
region involved in neuronal degeneration is the striatum, particularly in Parkinson‘s disease
and Huntington‘s disease. The zebrafish ventral telencephalon is homologous to this
structure, as evidenced by the GABAergic neurons and dopaminergic nerve terminals arising
from a descending dopaminergic projection (Rink & Wullimann 2002). Additionally, the
ventral telencephalon displays homologous features to the human nucleus basalis of Meynert,
affected both in AD and Parkinson‘s disease. As in humans, this region has a large number of
choline acetyltransferase-expressing neurons (Mueller et al. 2004; Rink & Wullimann 2004).
Molecular markers and behavioral experiments provide additional evidence to support the
lateral dorsal telencephalon being a homologous structure to the hippocampus (Mueller et al.
2011). The similarity of these structures in zebrafish to human counterparts gives the
zebrafish the potential to serve as a relevant model to study diseases that specifically affect
these regions.
Besides the utilization of the zebrafish in modeling neurodegenerative diseases, the
zebrafish brain and CNS provide other areas of homology for assessing neurotoxicity. Other
regions of the brain and CNS that are structurally homologous to humans include; the
hypothalamus, optic tracts, olfactory system, and spinal cord. Regions that resemble basal
ganglia have been identified in the zebrafish forebrain. Additionally, the cerebellum of the
zebrafish is similar to the cerebellar cortex in humans due to the similar cellular layers
(molecular, Purkinje, and granule) and neurons (GABAergic and glutamatergic). From a
toxicological standpoint the development of the BBB is essential for controlling brain
homeostasis. The BBB of the zebrafish has been shown to be similar to higher vertebrates
(reviewed in de Esch et al. 2012). Along with the conserved structures, zebrafish also express
similar neurotransmitters including ACh, DA, GABA, Glu, and serotonin (5-HT) (reviewed
in de Esch et al. 2012). Additional similarities can be seen in cell types, specific markers and
synaptic connections (Bae et al. 2009). Overall, the CNS of the zebrafish has strong structural
and functional homology to humans making it a well suited model for neurotoxicology.
PB NEUROTOXICITY IN ZEBRAFISH
As stated above, developmental and childhood Pb exposure poses a significant health risk
due to the vulnerability of the developing CNS and its abundance of cellular processes.
Zebrafish are starting to be used to uncover the morphological, behavioral, and genetic
alterations that are associated with developmental Pb exposure (Figure 2). A study in which
zebrafish embryos were exposed to an EC50 of 290 ppb Pb was shown to cause visible
malformations at 96 hours post fertilization (hpf) including a bent spine, un-inflated swim
bladder, and edema of the pericardium and yolk sac (Chen et al. 2012). During childhood Pb
exposure, clinical symptoms include behavioral changes and hyperactivity and hyperactivity
has been observed in zebrafish in the form of hyper-swimming at levels as low as 25 ppb
(Chen et al. 2012). High dose Pb exposure of 0.2 mM (41,400 ppb) has been shown to cause
sluggish swimming behavior at 144 hpf. This alteration in swimming behavior was correlated
with significant decreases in neuronal gene expression of huC and gfap which are associated
with neuron and glial cell development (Dou & Zhang 2011). This study aided in the
understanding of how a developmental exposure to a high dose of Pb causes visible gross
malformations while a low dose exposure (25 ppb or 2.5 g/dL) provides support of
behavioral alterations that can occur at levels below the current blood lead reference value of
5 g/dL as set by the CDC. In addition, behavioral changes in response to a tap stimulus was
tested on zebrafish aged 7 days that were exposed to 10 or 30 nM Pb chloride through 24 hpf
(Rice et al. 2011). Larvae treated with 30 nM Pb exhibited significantly altered response to a
second stimulus with a decreased response rate and increased reaction latency (Rice et al.
2011).
The identification of neuronal and genetic alterations due to developmental Pb exposure
has been examined in the zebrafish (Peterson et al. 2011, 2013; Zhang et al. 2011). A study
examined global gene expression alterations in zebrafish after developmental Pb exposure.
Following an acute toxicity test, the highest dose used for global gene analysis was 100 ppb.
This dose was well below a dose that caused overt toxicity and did not cause an increase in
mortality, alterations in hatching rate, an increase in gross malformations, or an increase in
apoptotic cells (Peterson et al. 2011, 2013). In this study 55 genes involved in neurological
development (synaptic transmission, long-term potentiation, guidance of axons, and
branching of neurites) and function were identified to be altered at 72 hpf following the
embryonic 100 ppb Pb exposure (Peterson et al. 2011). Of the genes with altered expression,
a specific focus was given to genes involved in synapse formation and further gene and
protein expression analysis confirmed changes in targets such as metallothionein-2 (MT2),
furry-like homolog (FRYL), and reelin (RELN) (Peterson et al. 2011).
A primary goal of defining genetic alterations caused by toxicant exposure is the ability
to link them to morphological changes. A study determined that developmental Pb exposure
causes a decrease in axonal density at 18, 20, and 24 hpf in the mid and forebrain (Zhang et
al. 2011). Genetic analysis was performed on relevant genes associated with axonogenesis
and corresponding decreases reported in sonic hedgehog a (shha) and ephrin type-A receptor
4b (epha4b) (Zhang et al. 2011). It has also been shown that exposure to 100 ppb Pb caused a
decrease in reln expression at 60 hpf in developing zebrafish (Peterson et al. 2013). Reelin is
responsible for mediating many developmental and functional neural processes such as axon
maturation and synaptogenesis, promotion of dendrite extension, and spine maturation. A
decrease in reln at this developmental window is hypothesized to be associated with the
developmental Pb neurotoxicity mechanisms of alterations in learning and behavior.
The adverse effects of Pb on neurotransmitter systems and implications on the
development of neurogenesis have been demonstrated in the zebrafish. It is well known that
Pb exposure adversely affects various neurotransmitter systems including dopaminergic,
serotonergic, glutamatergic, and cholinergic systems. One neurotransmitter system of
particular significance and interest is the GABAergic system. GABA is the primary inhibitory
neurotransmitter in the adult CNS. However, during early CNS development, GABA
functions as an excitatory neurotrophic factor. This excitatory nature allows GABA to have a
predominate role in cell proliferation, neuronal migration, neurite growth, axonal growth, and
synaptogenesis (Zhang et al. 2010). Multiple studies have focused on identifying the
expression and distribution patterns of GABA and its synthesizers throughout zebrafish
embryogenesis (Delgado & Schmachtenberg 2008; Mueller et al. 2006). Martin et al. (1998)
reported that at 24 hpf zebrafish showed expression of both GAD isozymes in similar regions
of the forebrain, midbrain, hindbrain, and spinal cord. The expression of GAD67 and GABA
were also found to be co-localized in the same regions throughout the telencephalon at 30 hpf.
GABA was also identified in four classes of neurons in the spinal cord: dorsal longitudinal,
commissural secondary ascending, ventral longitudinal, and Kolmer-Agduhr neurons. It was
shown that these GABA producing neurons also produced GAD67 (Martin et al. 1998). The
evidence detailing that both GAD isozymes and GABA are expressed during axonogenesis
and early CNS development is in continual support that GABA is needed as a neurotrophic
factor. In addition, the expression pattern of GABA was also studied at 16, 24, 48, and 72 hpf
(Doldan et al. 1999). These developmental time points are of interest as they coincide with a
high rate of proliferation during primary neurogenesis and strong differentiation during
secondary neurogenesis. In addition, the presence of GABA was identified in the
telencephalon, diencephalon, and mesencephalon beginning at 16 hpf and continued to
increase in expression through 72 hpf. At 24 hpf, axonal projections also show GABA
expression (Doldan et al. 1999; Mueller et al. 2006).
Alterations in gene expression throughout the GABAergic pathway and GABA levels
following developmental Pb exposure were recently examined in the zebrafish (Wirbisky et
al., in review). This study examined the alterations of mRNA of seven genes throughout the
GABAergic pathway (gad2, gad1b, gabra1, gabbr1a, gat-1, gat-3, and vgat) at different
developmental time points (24, 36, 48, 60, and 72 hpf) and concentrations (10, 50, 100 ppb
Pb). The overall findings from the gene expression data were that Pb does not appear to affect
the GABAergic pathway in a dose dependent manner; effects that are seen at lower doses are
not expressed at higher doses and vice versa (Wirbisky et al. in review). Throughout the
development of the GABAergic system, Pb appears to elicit its effects in a cyclical pattern
allowing for the system to react and attempt a return to a state of homeostasis. Although these
changes in mRNA expression vary by dose and time, the GABA synthesizing genes (gad2
and gad1b) and receptor genes (gabra1 and gabbr1a) appear to be the most sensitive targets
of Pb exposure during the excitatory role of GABA; potentially serving as large regulators of
the effects of Pb on GABA levels. The most sensitive developmental time point in gene
expression alterations was 48 hpf. During this time in CNS development, there is rapid axonal
growth, migration, and cellular proliferation and these are key functional targets of Pb
neurotoxicity.
Figure 2. Summary of lead (Pb) neurotoxicity studies with zebrafish. A number of studies are
completed that applied the use of the zebrafish model system to define Pb neurotoxicity. These studies
evaluated a wide-range of doses, life stages, and endpoints and are summarized in this figure. (hpf a:
hours post fertilization).
To begin to link the gene expression alterations to changes in GABA, analysis of GABA
levels was performed at 48 and 72 hpf following the same Pb treatment as used for the gene
expression analysis. Overall these results showed that alterations in GABA levels were dose
and time point dependent. In addition, links to gene expression alterations were observed
prior to corresponding changes in GABA levels at treatments of 50 and 100 ppb Pb (i.e., gene
expression changes observed at a specific developmental time point appeared to correspond to
altered GABA levels at a later developmental stage). The outcome of this study also shows
that at the lowest dose of 10 ppb Pb, Pb may be acting as a direct toxicant to GABAergic
neurotransmission and that mRNA expression changes may not underlie alterations in GABA
levels (Wirbisky et al. in review).
These new data provide evidence that low dose Pb exposure affects the developing CNS
with a specific focus on the GABAergic system. The excitatory functions of this system are
highly regulated during development and its proper functioning is important in maintaining
neuronal function. Currently, the literature examining the effects of Pb on the GABAergic
system focuses on effects later in development or in adulthood when GABA is inhibitory,
with no attention on how negative alterations during the excitatory phase translates to
functional changes in adulthood. Due to GABAs role in multiple adult illnesses,
understanding how Pb alters the molecular pathways during development could help uncover
potential developmental origins of Pb induced neurodegenerative disease.
Alterations in the cholinergic system from exposure to Pb are also being investigated.
ACh as a neurotransmitter is involved in cognitive processes with AChE being responsible in
the zebrafish for the degradation of ACh. AChE is a biomarker of many environmental
contaminants and is known for playing a role in neurodegenerative diseases such as AD. The
association between heavy metals and neurodegenerative diseases stems from heavy metals
being able to cross the BBB and accumulate in the brain causing oxidative stress and
alterations in the metabolism of some proteins that are linked to neurodegenerative diseases
including AD, Parkinson‘s disease, and amyotrophic lateral sclerosis. It has been shown that
adult zebrafish exposed to 20 ppb Pb for 24 hours had a decrease in AChE without changes in
mRNA transcript levels (Richetti et al. 2011). This decrease in AChE was restored by 96
hours after exposure indicating a possible compensatory response.
Adenosine triphosphate (ATP) is also indicated as a target of Pb neurotoxicity. ATP is a
primitive signaling molecule that has been retained as a co-transmitter in every nerve type
within the CNS and PNS. ATP is released into the synaptic cleft where it has the capability to
act as a neurotransmitter itself or as a modulator of other neurotransmitter activity. Once
released, ATP is metabolized by ecto-nucleotidases which belong to the NTPDase family. A
study performed by Senger et al. (2006) used in vitro and in vivo zebrafish models to assess
the effects of Pb on NTPDase and ecto-5‘-nucleotidase activity and expression in the CNS. In
vitro studies using zebrafish brain membranes found that exposure to 0.25-1 mM Pb acetate
inhibited ATP hydrolysis but caused no significant change in the hydrolysis of adenosine
diphosphate (ADP) or adenosine monophosphate (AMP). In vivo studies using adult zebrafish
exposed to 20 ppb Pb acetate found that exposure after 96 hours caused a decrease in ATP
hydrolysis, but no change in ADP or AMP. However, exposure for 30 days did cause
significant reductions in ATP, ADP, and AMP hydrolysis. ATP can be co-liberated with other
neurotransmitter systems with adenosine exhibiting a strong neuroprotective effect; however,
high concentrations of purines can also be cytotoxic to the CNS. It is the ecto-nucleotidases
which can regulate its concentration (Senger et al. 2006). Therefore, utilizing both in vitro
and in vivo zebrafish models a potential indirect mechanism in which Pb can exert
neurotoxicity through multiple neurotransmitter systems was demonstrated.
CONCLUSION
In conclusion, there has been much advancement in our understanding of the different
molecular mechanisms in which Pb exerts its neurotoxic effects utilizing in vitro and in vivo
models. However, due to the complex and non-uniform effects of Pb exposure, a large gap
still exists in our understanding of the molecular pathways of toxicity. The zebrafish has been
implemented as a complementary vertebrate model with many strengths as a powerful tool to
assess developmental Pb neurotoxicity. These studies with the zebrafish are providing
significant insight into the morphological, behavioral, and genetic alterations caused by Pb
exposure during development and adulthood. These and future studies will aid in furthering
our understanding of Pb neurotoxicity and provide a valuable link between other vertebrate
models and humans.
REFERENCES
Agency for Toxic Substances and Disease Registry (ATSDR). (2007). ―Toxicological profile
for Lead‖, U.S. Department of Health and Human Services, 1-582.
Anderson, D. W., Pothakos, K. & Schneider, J. S. (2012). ―Sex and rearing condition modify
the effects of perinatal lead exposure on learning and memory,‖ Neurotoxicology, 33(5),
985-995.
Bae, Y. K., Kani, S., Shimizu, T., Tanabe, K., Nojima, H., Kimura, Y., Higashijima, S. &
Hibi, M. (2009). ―Anatomy of zebrafish cerebellum and screen for mutations affecting its
development,‖ Dev Biol, 330(2), 406-426.
Barbazuk, W. B., Korf, I., Kadavi, C., Heyen, J., Tate, S., Wun, E., Bedell, J. A., McPherson,
J. D. & Johnson, S. L. (2000). ―The syntenic relationship of the zebrafish and human
genomes‖', Genome Res, 10(9), 1351-1358.
Basha, M. R., Wei, W., Bakheet, S. A., Benitez, N., Siddiqi, H. K., Ge, Y. W., Lahiri, D. K.
& Zawia, N. H. (2005). ―The fetal basis of amyloidogenesis: exposure to lead and latent
overexpression of amyloid precursor protein and beta-amyloid in the aging brain‖', J
Neurosci, 25(4), 823–829.
Behl, M., Zhang, Y. & Zheng, W. (2009). ―Involvement of insulin-degrading enzyme in the
clearance of beta-amyloid at the blood-CSF barrier: Consequences of lead exposure‖,
Cerebrospinal Fluid Res, 6, 11.
Behl, M., Zhang, Y., Shi, Y., Cheng, J., Du, Y. & Zheng, W. (2010, ‖Lead-induced
accumulation of beta-amyloid in the choroid plexus: role of low density lipoprotein
receptor protein-1 and protein kinase C‖, Neurotoxicology, 31(5), 524-532.
Bellinger, D. C. (2013). ―Prenatal exposures to environmental chemicals and children's
neurodevelopment: An update‖, Saf Health Work, 4(1), 1-11.
Bihaqi, S. W., Huang, H., Wu, J. & Zawia, N. H. (2011). ―Infant exposure to lead (Pb) and
epigenetic modifications in the aging primate brain: Implications for Alzheimer‘s
Disease‖, J' Alzheimer’s Dis, 819-833.
Bihaqi, S. W., Bahmani, A., Subaiea, G. M. & Zawia, N. H. (2013, Infantile exposure to lead
and late-age cognitive decline: Relevance to AD‖, Alzheimers Dem, 1-9.
Bijoor, A. R., Sudha, S. & Venkatesh, T. (2012). ―Neurochemical and neurobehavioral effects
of low lead exposure on the developing brain‖, Indian J Clin Biochem, 27(2), 147-151.
Bressler, J. P. & Goldstein, G. W. (1991). ―Mechanisms of lead neurotoxicity‖,
Biochempharmacol, 41(4), 479-484.
Bretaud, S., MacRaild, S., Ingham, P. & Bandmann, O. (2011). ―The influence of the
zebrafish genetic background on Parkinson‘s Disease-related aspects‖, Zebrafish, 8(3),
103-108.
Centers for Disease Control and Prevention. Lead Home Page. Atlanta: CDC.gov.
Chen, H. H., Ma, T. A. N. G. E. N. G., Hume, A. S. & Ho, I. K. (1998). ―Developmental lead
exposure alters the distribution of protein kinase C activity in the rat hippocampus‖,
Biomed Environ Sci, 11(1), 61-9.
Chen, J., Chen, Y., Liu, W., Bai, C., Liu, X., Liu, K., Li, R., Zhu, J. H. & Huang, C. (2012).
―Developmental lead acetate exposure induces embryonic toxicity and memory deficit in
adult zebrafish‖, Neurotoxicol Teratol, 34(6), 581-586.
Cremin, Jr. J. D. & Smith, D. R. (2002). ―In vitro vs in vivo Pb effects on brain protein kinase
C activity‖, Environ Res, 90(3), 191-199.
Dabrowska-Bouta, B., Sulkowski, G., Bartosz, G., Walski, M. & Rafalowska, U. (1999).
―Chronic lead intoxication affects the myelin membrane status in the central nervous
system of adult rats‖, J Mol Neurosci, 13(1-2), 127-139.
Delgado, L. & Schmachtenberg, O. (2008). ―Immunohistochemical localization of GABA,
GAD65, and the receptor subunits GABAA1 and GABAB1 in the zebrafish cerebellum‖,
Cerebellum, 7(3), 444-450.
Dodd, A., Curtis, P. M., Williams, L. C. & Love, D. R. (2000). ‖Zebrafish: bridging the gap
between development and disease‖, Hum Mol Genet, 9(16), 2443-2449.
Doldan, M. J., Prego, B., Holmqvist, B. I. & De Miguel, E. (1999). ―Distribution of GABA-
immunolabeling in the early zebrafish (Danio rerio) brain‖, Eur J Morphol, 37(2-3),
126-129.
Dosunmu, R., Alashwal, H. & Zawia, N. H. (2012). ‖Genome-wide expression and
methylation profiling in the aged rodent brain due to early-life Pb exposure and its
relevance to aging‖, Mechan Ageing Dev, 133(6), 435-443.
Dou, C. & Zhang, J. (2011). ―Effects of lead on neurogenesis during zebrafish embryonic
brain development‖, J Hazard Mater, 194, 277-282.
Drew, C. A., Spence, I. & Johnston, G. A. (1990). ―Effect of chronic exposure to lead on
GABA binding in developing rat brain‖, Neurochem Int, 17(1), 43-51.
de Esch, C., Slieker, R., Wolterbeek, A., Woutersen, R. & De Groot, D. (2012). ―Zebrafish as
potential model for developmental neurotoxicity testing: A mini review‖, Neurotoxicol
Teratol, 34(6), 545-553.
Feksa, L. R., Oliveira, E., Trombini, T., Luchese, M., Bisi, S., Linden, R., Berlese, B.D,
Rojas, D. B, Andrade, R. B., Schuck, P. F., Lacerda, L. M., Wajner, M., Wannmacher, C.
M. & Emanuelli, T. (2012). ―Pyruvate kinase activity and δ-aminolevulinic acid

dehydratase activity as biomarkers of toxicity in workers exposed to lead‖, Arch Environ
Contam Toxicol, 63(3), 453-460.
Freeman, J. L., Adeniyi, A., Banerjee, R., Dallaire, S., Maguire, S. F., Chi, J., Ng, B. L.,
Zepeda, C., Scott, C. E., Humphray, S., Rogers, J., Zhou, Y., Zon, L. I., Carter, N. P.,
Yang, F. & Lee, C. (2007). ‖Definition of the zebrafish genome using flow cytometry
and cytogenetic mapping‖, BMC Genomics, 8, 195.
Fox, D. A., Campbell, M. L. & Blocker, Y. S. (1997). ―Functional alterations and apoptotic
cell death in the retina following developmental or adult lead exposure‖,
Neurotoxicology, 18(3), 645-664.
Gilbert, M. E., Mack, C. M. & Lasley, S. M. (1999). ―Chronic developmental lead exposure
and hippocampal long-term potentiation: Biphasic dose-response relationship‖,
Neurotoxicol, 20(1), 71–82.
Gu, H., Wei, X., Monnot, A. D., Fontanilla, C. V., Behl, M., Farlow, M. R., Zheng, W. & Du,
Y. (2011). ―Lead exposure increases levels of β-amyloid in the brain and CSF and
inhibits LRP1 expression in APP transgenic mice‖, Neurosci Lett, 490(1), 16-20.
He, L., Poblenz, A. T., Medrano, C. J. & Fox, D. A. (2000). ―Lead and calcium produce rod
photoreceptor cell apoptosis by opening the mitochondrial permeability transition pore‖,
J Biol Chem, 275(16), 12175-12184.
Hill, A. J., Teraoka, H., Heideman, W. & Peterson, R. E. (2005). ―Zebrafish as a model
vertebrate for investigating chemical toxicity‖, Tox Sci, 86, 6-19.
Holtzman D., Olson J. E., DeVries C. & Bensch K. (1987). ―Lead toxicity in primary cultured
cerebral astrocytes and cerebellar granular neurons‖, Toxicol App Pharm, 89(2), 211-225.
Kabashi, E., Brustein, E., Champagne, N. & Drapeau, P. (2011). ―Zebrafish models for the
functional genomics of neurogenetic disorders‖, Biochim Biophys Acta, 1812(3),
335-345.
Koronyo-Hamaoui, M., Koronyo, Y., Ljubimov, A. V., Miller, C. A., Ko, M. K., Black, K. L.
& Farkas, D. L. (2011). ―Identification of amyloid plaques in retinas from Alzheimer's
patients and noninvasive in vivo optical imaging of retinal plaques in a mouse model‖,
Neuro Image, 54, S204-S217.
Lasley, S. M. & Gilbert, M. E. (2002). ―Rat hippocampal glutamate and GABA release
exhibit biphasic effects as a function of chronic lead exposure level‖, Tox Sci, 66(1),
139–47.
Leret, M. L., Garcia-Uceda, F. & Antonio, M. T. (2002). ―Effects of maternal lead
administration on monoaminergic, GABAergic and glutamatergic systems‖, Brain Res
Bull, 58(5), 469-473.
Lidsky, T. I. & Schneider J. S. (2003). ―Lead neurotoxicity in children: basic mechanisms and
clinical correlates‖, Brain, 126(1), 5-19.
Lieschke, G. J. & Currie, P. D. (2007). ―Animal models of human disease: zebrafish swim
into view‖, Nat Rev Gen, 8(5), 353-367.
Lin, C., Chen, Y. & Su, F. (2013). ―In utero exposure to environmental lead and manganese
neurodevelopment at 2 years of age‖, Environ Res, 123, 52-57.
Liu, X., Ji, K., Moon, H. B. & Choi, K. (2013). ―Effects of TDCPP or TPP on gene
transcriptions and hormones of HPG axis, and their consequences on reproduction in
adult zebrafish (Danio rerio)‖, Aquat Toxicol, 134-135, 104-111.
Marchetti, C. & Gavazzo, P. (2005). ―NMDA receptors as targets of heavy metal interaction
and toxicity‖, Neurotox Res, 8(3-4), 245-258.
Markovac, J. & Goldstein, G. W., 1988). ―Picomolar concentrations of lead stimulate brain
protein kinase C‖, Nature, 334(6177), 71-73.
Martin, S. C., Heinrich, G. & Sandell, J. H. (1998). ―Sequence and expression of glutamic
acid decarboxylase isoforms in the developing zebrafish‖, J Comp Neurol, 396(2),
253-266.
Mueller, T., Dong, Z., Berberoglu, M.A. & Guo, S. (2011). ―The dorsal pallium in zebrafish,
Danio rerio (Cyprinidae, Teleostei)‖, Brain Res, 1381, 95-105.
Mueller, T., Vernier, P. & Wullimann, M. F. (2004). ―The adult central nervous cholinergic
system of a neurogenetic model animal, the zebrafish Danio rerio‖, Brain Res, 1011(2),
156-69.
Mueller, T., Vernier, P. & Wullimann, M. F. (2006). ―A phylotypic stage in vertebrate brain
development: GABA cell patterns in zebrafish compared with mouse‖, J Comp Neurol,
494(4), 620-634.
Needleman, H. (2004). ―Lead poisoning‖, Annu Rev Med, 55, 209-222.
Niklowitz, W. J. & Mandybur, T. I. (1975). ―Neurofibrillary changes following childhood
lead encephalopathy‖, J Neuropathol Exp Neurol, 34 (5), 445-455.
Peterson, S. M., Zhang, J., Weber, G. & Freeman, J. L. (2011). ―Global Gene Expression
Analysis Reveals Dynamic and Developmental Stage–Dependent Enrichment of Lead-
Induced Neurological Gene Alterations‖, Environ Health Perspect, 119(5), 615-621.
Peterson, S. M., Zhang, J. & Freeman, J. L. (2013). ―Developmental reelin expression and
time point-specific alterations from lead exposure in zebrafish‖, Neurotoxicol Teratol, 38,
53-60.
Rabinowitz, M. B. (1991). ―Toxicokinetics of bone lead‖, Environ Health Perspect, 91,
33-37.
Rice, C., Ghorai, J. K., Zalewski, K. & Weber, D. N. (2011). ‖Developmental lead exposure
causes startle response deficits in zebrafish‖, Aquat Toxicol, 105(3-4), 600-608.
Richetti, S. K., Rosemberg, D. B., Ventura-Lima, J., Monserrat, J. M., Bogo, M. R. & Bonan,
C. D. (2011). ―Acetylcholinesterase activity and antioxidant capacity of zebrafish brain is
altered by heavy metal exposure‖, Neurotoxicology, 32(1), 116-122.
Rink, E. & Wullimann, M. F. (2002). ―Connections of the ventral telencephalon and tyrosine
hydroxylase distribution in the zebrafish brain (Danio rerio) lead to identification of an
ascending dopaminergic system in a teleost‖, Brain Res Bull, 57(3-4), 385-387.
Rink, E. & Wullimann, M. F. (2004). ―Connections of the ventral telencephalon (subpallium)
in the zebrafish (Danio rerio)‖, Brain Res, 1011(2), 206-20.
Schneider, J. S., Anderson, D. W., Talsania, K., Mettil, W. & Vadigepalli, R. (2012a).
―Effects of developmental lead exposure on the hippocampal transcriptome: influences of
sex, developmental period, and lead exposure level‖, Tox Sci, 129(1), 108-125.
Schneider, J. S., Mettil, W. & Anderson, D. W. (2012b). ―Differential effect of postnatal lead
exposure on gene expression in the hippocampus and frontal cortex‖, J Mol Neurosci,
47(1), 76-88.
Scortegagna, M. & Hanbauer, I. (1997). ―The effect of lead exposure and serum deprivation
on mesencephalic primary cultures‖, Neurotoxicology, 18(2), 331-340.
Senger, M. R., Rico, E. P., de Bem Arizi, M., Frazzon, A. P. G., Dias, R. D., Bogo, M. R. &
Bonan, C. D. (2006). ―Exposure to Hg2+ and Pb2+ changes NTPDase and ecto-5′-
nucleotidase activities in central nervous system of zebrafish (Danio rerio)‖, Toxicology,
226, 229-237.
Silbergeld, E. K. (1992). ―Mechanisms of lead neurotoxicity, or looking beyond the
lamppost‖, FASEB J, 6(13), 3201-3206.
Silbergeld, E. K., Hruska, R. E., Miller, L. P., Eng, N. (1980). ―Effects of lead in vivo and in
vitro on GABAergic neurochemistry‖, J Neurochem, 34(6), 1712-1718.
Silbergeld, E. K., Miller, L. P., Kennedy, S. & Eng, N. (1979) ―Lead, GABA, and seizures:
effects of subencephalopathic lead exposure on seizure sensitivity and GABAergic
function‖, Environ Res, 19(2), 371-382.
Spitsbergen, J. M. & Kent, M. L. (2003). ―The state of the art of the zebrafish model for
toxicology and toxicologic pathology research—advantages and current limitations‖,
Toxicol Pathol, 31(1 suppl), 62-87.
Stauber, J. L., Florence, T. M., Gulson, B. L. & Dale, L. S. (1994). ―Percutaneous absorption
of inorganic lead compounds‖, Sci Total Environ, 145(1-2), 55-70.
Stewart, W.F., Schwartz, B.S., Simon, D., Kelsey, K. & Todd, A.C. (2002). ―ApoE genotype,
past adult lead exposure, and neurobehavioral function‖, Environ Health Perspect,
110(5), 501-505.
Stewart, W. S. & Schwartz, B. S. (2007). ―Effects of lead on the adult brain: a 15-year
exploration‖, Am J Ind Med, 50(10), 729-739.
Sun, C. C., Wong, T. T., Hwang, Y. H., Chao, K. Y., Jee, S. H. & Wang, J. D. (2002).
―Percutaneous absorption of inorganic lead compounds‖, AIHA J, 63(5), 641-646.
Tiffany-Castiglioni, E., Sierra, E. M., Wu, J. N. & Rowles, T. K. (1989). ―Lead toxicity in
neuroglia‖, Neurotoxicology, 10(3), 417-443.
Vernier, P. & Bally-Cuif, L. (2010). ―Organization and physiology of the zebrafish nervous
system: fish physiology‖, Zebrafish, 28-80.
Weber, G. J., Sepúlveda, M. S., Peterson, S. M., Lewis, S. S. & Freeman, J. L. (2013).
―Transcriptome alterations following developmental atrazine exposure in zebrafish are
associated with disruption of neuroendocrine and reproductive system function, cell
cycle, and carcinogenesis‖, Tox Sci, 132(2), 458-466.
White, L. D., Cory-Slechta, D. A., Gilbert, M. E., Tiffany-Castiglioni, E., Zawia, N. H.,
Virgolini, M, Rossi-George, A., Lasley, S. M., Qian, Y. C. & Basha, M. R. (2007). ―New
and evolving concepts in the neurotoxicology of lead‖, Toxicol Appl Pharmacol, 225(1),
1–27.
Wirbisky, S. E., Weber, G. J., Lee, J., Cannon, J. R. & Freeman, J. L. ‖Novel dose-dependent
alterations in excitatory GABA during embryonic development associated with lead (Pb)
neurotoxicity‖, (in review).
Wu, J., Basha, M. R., Brock, B., Cox, D. P., Cardozo-Pelaez, F., McPherson, C. A., Harry, J.,
Rice, D. C., Maloney, B., Chen, D., Lahiri, D. K. & Zawia, N. H. (2008). ―Alzheimer‘s
disease (AD)-like pathology in aged monkeys after infantile exposure to environmental
metal lead (Pb): evidence for a developmental origin and environmental link for AD‖, J
Neurosci, 28(1), 3–9.
Xia, W. (2011) ―Exploring Alzheimer‘s Disease in Zebrafish‖, J' Alzheimers Dis, 20(4)
981-990.
Xie, X., Ding, G., Cui, C., Chen, L., Gao, Y., Zhou, Y., Shi, R. & Tian, Y. (2013). ―The
effects of low-level prenatal lead exposure on birth outcomes‖, Environ Pollut, 175,
30-34.
Yanwei, X., Noble, S. & Ekker, M. (2011). ―Modeling neurodegeneration in zebrafish‖, Curr
Neurol Neurosci Rep, 11(3), 274-282.
Yu, L., Chen, M., Liu, Y., Gui, W. & Zhu, G. (2013). ―Thyroid endocrine disruption in
zebrafish larvae following exposure to hexaconazole and tebuconazole‖, Aquat Toxicol,
138-139, 35-42.
Zhang, J., Peterson, S. M., Weber, G. J., Zhu, X., Zheng, W. & Freeman, J. L. (2011).
―Decreased axonal density and altered expression profiles of axonal guidance genes
underlying lead (Pb) neurodevelopmental toxicity at early embryonic stages in the
zebrafish‖, Neurotoxicol Teratol, 33(6), 715-720.
Zhang, R. W., Wei, H. P., Xia, Y. M., Du, J. L. (2010). ―Development of light response and
GABAergic excitation‐to‐inhibition switch in zebrafish retinal ganglion cells‖, J Phys,
15(588), 2557-2569.
Zawia, N. H., Lahiri, D. K. & Cardozo-Pelaez, F. (2009). ―Epigenetics, oxidative stress, and
Alzheimer‘s disease‖, Free Radic Biol Med, 46(9), 1241–1249.
Chapter 12
THE EMBRYONIC ZEBRAFISH AS A MODEL

SYSTEM TO STUDY THE EFFECTS
OF ENVIRONMENTAL TOXICANTS ON BEHAVIOR
Holly Richendrfer1, Robbert Creton1 and Ruth M. Colwill2*

1
Department of Molecular Biology, Cell Biology and Biochemistry,
Brown University, Providence, Rhode Island, US
2
Cognitive, Linguistic, and Psychological Sciences,
Brown University, Providence, Rhode Island, US
ABSTRACT
This chapter highlights current research using the embryonic zebrafish as a model
system to study the effects of environmental toxicants on behavior. Zebrafish are ideally
suited for high-throughput analyses of behavior. Hundreds of fertilized eggs can be
collected daily from a single tank and the synchronously developing embryos can be
exposed to environmental toxicants in a culture dish or multiwell plate. The developing
motor network of the zebrafish embryo has been impressively characterized at multiple
levels, from behavior to circuitry to genes, thus establishing a solid foundation for
investigating mechanisms of neurobehavioral toxicity. Three assays are reviewed and
their usage to screen for toxicant-induced behavioral defects in embryonic zebrafish is
critically evaluated. The mechanisms of neurodevelopment are well conserved in
vertebrate species in that similar genes, neurotransmitters, and hormones control early
brain development and behavior in fish, mice, and humans. Consequently, behavioral
assays in embryonic zebrafish may be used to screen for environmental toxicants that
influence human brain development and behavior. Several recommendations are made to
strengthen current approaches to accomplishing this important goal.
Keywords: Behavior assays, embryonic, stimulus-induced swimming, tail coiling, toxicant

exposure
*
Corresponding author: Ruth M. Colwill, Department of Cognitive, Linguistic & Psychological Sciences, Brown
University, Box 1821, Providence, RI 02912, Email: ruth_colwill@brown.edu, Tel: 401-863-2547, Fax: 401-
863-1300.
246 Holly Richendrfer, Robbert Creton and Ruth M. Colwill
INTRODUCTION
Anthropogenic pollution poses a clear and present danger to the healthy development of
both human and nonhuman animals. Industrial and household waste products, pesticides, and
other chemical pollutants have found their way, historically, accidentally, and illegally, into
the earth‘s atmosphere, soil, and ground and surface waters including oceans at an alarming
rate since the Industrial Revolution in the 1900s. Many of these contaminants enter the food
chain and some bioaccumulate resulting in novel mixtures and concentrations higher than
those found naturally in the environment.
Developing organisms comprise one of the groups most vulnerable to the potentially
hazardous consequences of toxicant exposure (Rodier 1994). Their greater risk has been
attributed to a combination of behavioral, morphological, physiological and biochemical
factors that can lead to increased exposure or uptake of toxicants from the environment,
greater susceptibility for organ and system damage by the toxicant, and reduced capacity for
detoxification and toxicant excretion. The neurobehavioral defects induced by toxicant
exposure have been attributed in large part to altered neuronal connectivity in the developing
brain. Given that the mechanisms of neurodevelopment are well conserved in vertebrate
species (Tropepe & Sive 2003), zebrafish behavioral screens for toxicant-induced defects are
likely to reveal environmental contaminants and mixtures that would influence human brain
development and behavior.
The focus of this chapter is on current usage of embryonic zebrafish behavioral assays to
screen for toxicant exposure effects. The chapter begins with an overview of the merits of the
developing zebrafish as a model system for environmental toxicology and brief descriptions
of the main toxicants that have been used to induce behavioral defects in the zebrafish
embryo. The behavioral milestones that characterize normal early embryonic development
and the assays that incorporate these behaviors are summarized. The use of these behavioral
assays to screen the effects of toxicant exposure on development is critically evaluated. This
review is organized around three categories; spontaneous behavior assays, stimulus-elicited
behavior assays, and experience-based behavior assays. Recommendations are made to
strengthen future assessments of toxicant exposure effects on embryonic behavior using these
assays.
THE DEVELOPING ZEBRAFISH AS A MODEL SYSTEM FOR

ENVIRONMENTAL TOXICOLOGY
The zebrafish (Danio rerio) is emerging as a model system in the field of environmental
toxicology for many of the same reasons it has gained traction as a model system in genetic
and pharmacological research (Barros et al. 2008; Gerlai et al. 2000; Langheinrich 2003;
Lieschke & Currie 2007; Norton & Bally-Cuif 2010). The embryos develop externally,
making them easily accessible to genetic, chemical, and experimental manipulations. They
can be collected in large numbers on a daily basis from even a modest colony and
immediately treated with toxicants in a culture dish or multi-well plate from the one cell stage
of development without affecting the parental generations. Development is extremely rapid;
Embryonic Behaviors and Toxicant Exposure 247
within 24 hours, a fertilized egg has developed into a larva with eyes, a beating heart, and tail
movements (Kimmel et al. 1995; Westerfield 2007). Figure 1 shows three different views of a
zebrafish embryo in its chorion at 24 hours post-fertlization (hpf). In contrast, a day old
human embryo has only just entered the two-cell stage. Zebrafish embryos are also
transparent, making them easy to observe and image for morphological deformities during
toxicant exposure (Beis & Stainier 2006; Fetcho & Liu 1998). In addition to these practical
considerations, behavioral assays have been developed to assess sensory, motor, cognitive,
and social development in the first week following fertilization.
Zebrafish embryos and larvae are small. Even at 7 days post-fertilization (dpf), the larvae
are still only a few millimeters long and can be monitored in multiwell plates using automated
imaging systems, which allows for systematic high throughput screening of the genes,
pharmaceuticals, and environmental toxicants that influence behavior. Genes important for
zebrafish brain development have been identified in large scale mutagenesis screens (Driever
et al. 1996; Granato et al. 1996; Haffter & Nusslein-Volhard 1996; Schier et al. 1996) and can
be knocked down by injecting antisense morpholinos into the developing embryo (Heasman
2002). Optogenetic systems can be used to visualize not only anatomy but also neuronal
activity during development and behavior in transgenic zebrafish that have been designed to
express a genetically encoded calcium sensor in their cells that fluoresces whenever the cells
become active (Arrenberg, Del Bene & Baier 2009; Del Bene & Wyart 2012; Higashijima et
al. 2003). Finally, any delayed deleterious effects of early life stage toxicant exposure on
reproduction, sexual and social behavior, motivation, and cognition can be examined in the
adult zebrafish 3-4 months post-fertilization.
In recent years, there has been considerable progress in the development and
sophistication of behavioral assays for zebrafish larvae and adults (reviewed in Colwill &
Creton 2011; Fero, Yokogawa & Burgess 2011; Gerlai 2011; Stewart & Kalueff 2012;
Wolman & Granato 2012). In contrast, behavioral assays for zebrafish embryos have received
comparatively less attention (Ahmad et al. 2012). However, the motor network of the
developing zebrafish has been impressively characterized at multiple levels from behavior to
circuitry to genes (Brustein et al. 2003; Drapeau et al. 2002; Granato et al. 1996; Grillner
2003; Kullander 2005; Saint-Amant & Drapeau, 1998), thus providing a solid foundation for
understanding mechanisms of neurobehavioral toxicity. The goal of this chapter is to
highlight the perhaps unappreciated potential of the developing zebrafish embryo for
revealing neurobehavioral effects of toxicant exposure.
Figure 1. Tail coiling in a 24 hour-old zebrafish embryo. Images were collected on a Zeiss Axiovert
200M microscope with a 5x objective approximately 1 minute apart to show different orientations of
the embryo during tail coiling. Scale bar = 500 um.
Table 1. Selected effects of toxicants on the frequency and duration of zebrafish

embryo behaviors
Lowest Behavior
Exp Test
Toxicant ED as described in Effect Source
(hpf) (hpf)
(mg/L) study
Spontaneous behavior assay
Bifenthrin 0.05 3 24 Tail movement ↑ Jin et al. (2009)
1R-enantiomer 0.1 3 18-25 Tail movement ↑a Jin et al. (2010)
1S-enantiomer 0.1 3 18, Tail movement ↓a Jin et al. (2010)
20-24
Chlorpyrifos 0.625 2 24-26 Tail coiling ↑ Selderslaghs et
Tail coiling (dur) ↑ al. (2010)
Difenoconazole 1.5 1 24 Tail lashing ↑ Mu et al. (2013)
2.5 1 24 Tail lashing ↓
Malathion 2 1-2 24 Tail lashing ↑ Fraysse et al.
(2006)
Acrylamide 250 2 24-26 Tail coiling ↑ Selderslaghs et
500 2 24-26 Tail coiling (dur) ↑ al. (2013)
Bisphenol A 2 24-26 Tail coiling ― Selderslaghs et
al. (2013)
IDPN 2500 2 24-26 Tail coiling ↑ Selderslaghs et
Tail coiling (dur) ↑ al. (2013)
PFOS 4 6 25 Tail bend ↑ Huang et al.
4 6 19 Tail bend (peak)b ↓ (2010)
PBDEs Usenko et al.
BDE 28 2.5c 6 24 Body flexes ↑ (2011)
BDE 47 4c 6 24 Body flexes ↑
BDE 99 13 6 24 Body flexes ↑
BDE 100 16.8 6 24 Body flexes ↑
BDE 153 11.7 6 24 Body flexes ↑
BDE 183 6 24 Body flexes ―
TMT 0.4 8 19 Tail bend (peak)d ↑ Chen et al. (2011)
2 8 20 Tail bend ↓
1 8 25 ↓
1 8 27
Cadmium 1-2 24 Tail lashing ― Fraysse et al.
(2006)
Methylmercury 0.028 2 24-26 Tail coiling ↓ Selderslaghs et
al. (2013)
Touch-induced motor response assay
Fipronil 0.333 1-2 30 Swimming ↓e Stehr et al. (2006)
TMT 1 8 27 Touch response ↓f Chen et al. (2011)
1 8 36 Touch response ↓f
Key to abbreviations: ED = Effective dose; Exp = age exposure began; Test = age behavior assessed;
Arrows indicate direction of change (increase or decrease) in frequency or duration (dur) of
behavior and – indicates no effect at any of the exposure concentrations used in the study. IDPN =
Iminodipropionitrile; PFOS = Perfluorooctanesulphonicacid; PBDEs = Polybrominated diphenyl
ethers; TNT = Trimethyltin chloride; aNo statistics were reported for these differences; bPeak
frequency was lower and delayed relative to control; cValues estimated from graph; dPeak
frequency advanced by one hour relative to controls; eData not shown for 30 hpf; fPercent of
embryos showing touch response.
Anthropogenic Environmental Toxicants
Anthropogenic environmental toxicants include pesticides, industrial chemicals, and

metals. Their presence in the environment is a direct result of human activity and their
individual harmful effects on human and animal health in large quantities are well
established. However, relatively less is known about their potency for disrupting normal
development in low concentrations and in commonly occurring mixtures. Automated high
throughput screening in animal models is an essential tool for identifying the potential risks
for human development of acute and chronic exposures to these chemical cocktails. Because
the zebrafish is only recently becoming more widely used as a model in behavioral studies
with environmental toxicants, the paucity of studies using multiple chemicals in compounds
to determine potential synergistic or additive effects remains a notable void in the literature.
In this section, we briefly review the toxicants listed in Table 1 that have been the focus of
recent embryonic zebrafish exposure studies. All of these studies examined the sub-chronic
effects of individual toxicants, mainly pesticides and industrial chemicals, on morphological
and behavioral development and all but one tested a range of concentrations.
1. Pesticides
Chlorpyrifos and malathion are organophosphate pesticides (OPs) that are widely used in
agriculture in the United States and internationally. Over 60 million pounds of OPs are
sprayed on crop land in the United States every year (EPA 2011) and they have been detected
in air, dust, and a large portion of the foods eaten on a daily basis (Morgan et al. 2004).
TheOPs adverse effects of OPs have been attributed to actions at several target sites including
their inhibitory action on a key enzyme, acetylcholinesterase (AChE), which degrades the
neurotransmitter acetylcholine (ACh) into choline and acetic acid. OPs inactivate AChE by
phosphorylating the serine hydroxyl group located at the active site of AChE. Inactivation of
AChE results in the accumulation of ACh throughout the nervous system, leading to
overstimulation of muscarinic and nicotinic receptors with clinical effects. Bifenthrin is a
synthetic pyrethroid (SP) used in agriculture and for indoor pest control. SPs are replacing
OPs due to their low avian and mammalian toxicity but they are highly toxic to most fish. SPs
neurotoxic effects have been attributed to their interaction with voltage-sensitive sodium
channels (Jin et al. 2009). Fipronil is a phenylpyrazole insecticide specifically engineered to
control pests by inhibiting insect gamma-aminobutyric acid (GABA) receptors. Although its
affinity for mammalian GABA receptors is relatively low, evidence suggests that it is
neurotoxic to developing fish, a problem given its contamination of aquatic ecosystems where
fish spawn. Evidence suggests that the adverse effects of fipronil result from its action as a
glycine receptor (GlyR) antagonist (Stehr et al. 2006). Difenoconazole, a broad spectrum
triazole fungicide used extensively to protect rice and fruit crops, is also considered toxic to
aquatic organisms (Hinfray, Porcher & Brion 2006). However, adequate data are unavailable
to determine its potential for developmental neurotoxicity (FAO/WHO 2007).
2. Industrial Chemicals
Neural development and function can be affected by a wide variety of industrial

chemicals such as acrylamide, bisphenol A (BPA), iminodipropionitrile (IDPN),
perfluorooctanesulphonicacid (PFOS), polybrominated diphenyl ethers (PBDEs), and
trimethyltin chloride (TMT) that are ubiquitous in consumer products. Acrylamide is a
chemical used in wastewater treatment plants and in the production of dyes, paper, pesticides,
and plastics. Common routes of exposure include inhalation of cigarette smoke and
consumption of cooked starch-rich foods such as toast, cereal, and dried fruits. Neurotoxic
effects have been observed in humans through occupational exposure and nerve terminals
have been identified as a primary site of acrylamide action (Kütting et al. 2009). BPA is
widely used in plastic food and beverage containers, dental sealants, cash register receipts,
and polyvinyl chloride (PVC) (Biedermann, Tschudin & Grob 2010; Kang, Kondo &
Katayama 2006; Welshons, Nagel & vom Saal 2006). Very low levels are consistently
detected in the human population (Geens, Neels & Covaci 2012). While it can be rapidly
metabolized in adults, exposures of infants and young children to BPA may pose a significant
risk for developmental disorders (Groff 2010). The common mode of action of BPA is
through its ability to mimic the effects of estrogen (EPA 2012a; Masuo & Ishido 2011).
Nitriles, such as IDPN, are used in the synthesis of plastics, resins and synthetic fibers.
Exposure to IDPN can cause neurological symptoms similar to those seen in the
neuromuscular degenerative disease, amyotrophic lateral sclerosis (ALS) (Al-Deeb et al.
1994). Perfluorooctanesulfonic acid (PFOS) is a breakdown product of perfluorocarbons
(PFCs) used extensively in stain repellent products, surfactants, and lubricants (Lindstrom,
Strynar & Libelo 2011). PFOS has been detected in human bodily fluids and tissues including
serum from blood bank donations (D'Hollander et al. 2010; Wilhelm et al. 2009) and in
wildlife (Giesy & Kannan 2001). Its neurotoxicity to humans and animals is well established
and PFOS contamination is of global concern (Huang et al. 2010). PBDEs are typically used
in flame retardants commonly found in consumer products for the home. PBDEs persist in the
environment and bioaccumulate in humans and animals (Mai et al. 2005, EPA 2012b). They
are considered neurodevelopmental toxicants, targeting muscarinic cholinergic receptors in
the hippocampus and disrupting thyroid hormone homeostasis (Usenko et al. 2011).
Trimethyltin chloride (TMT) is used primarily in the production of PVC for consumer plastic
products (Sadiki et al. 1996) and in fungicides. It has been detected in both domestic and
aquatic water supplies (Borghi & Porte, 2002; Shawky & Emons 1998). TMT has been linked
to neurological toxicity and profound cognitive impairments in humans and animals (Ishida et
al. 1997; Nishimura et al. 2001; Stanton & Jensen 1991). Its effects typically involve damage
to hippocampal pyramidal cells (Trabucco et al. 2009), deficits in the serotonergic and
GABA-ergic systems, and a decrease in M1 and M2 binding sites in the hippocampus
(Earley, Burke & Leonard 1992).
3. Metals
Cadmium exists naturally in the earth‘s crust but its occurrence as a byproduct of zinc
production and its widespread use in consumer products such as batteries, solar panels,
electroplating, plastic stabilizers, and pigments are what contribute to its role as an
environmental toxicant. Cadmium has been detected in air, dust, soil, food and water.
Neurotoxicity studies suggest that cadmium may alter the release of different
neurotransmitters, thus disrupting the balance of excitation-inhibition in synaptic transmission
(Minami et al. 2001). Cadmium exposure is associated with olfactory dysfunction in humans
and other animals (Blechinger et al. 2007) and with neurobehavioral deficits in rodents
exposed via gestation and lactation (Ali, Murphy & Chandra 1986; Desi et al. 1998).
Methylmercury, once a byproduct of several industrial manufacturing processes, is now
produced largely through the burning of fossil fuels and waste containing mercury and
through the methylation of mercury released into the environment (ATSDR 2012).
Methylmercury bioaccumulates in aquatic food chains and poses serious health risks to
aquatic wildlife in polluted ecosystems and to the developing fetus exposed through maternal
consumption of contaminated fish. Methylmercury has multiple effects in the brain including
disruption of muscarinic cholinergic systems, inactivation of sodium-potassium adenosine
triphosphatase, and the sequestration of selenium essential to cellular and biochemical
functions. Methylmercury consumption is associated with serious cognitive impairments that
are especially pronounced in developing organisms.
EMBRYONIC BEHAVIOR ASSESSMENTS

Normal development of the zebrafish embryo is relatively rapid with hatching occurring
between 48 and 60 hours post-fertilization in embryos incubated at 28.5ºC (Kimmel et al.
1995). Embryonic assays have incorporated two behaviors, tail coiling and swimming, to
investigate the neurotoxic effects of early exposure to various common environmental
contaminants (see Table 1). Embryos are typically bath exposed to the toxicants in small
groups in multiwell plates and behavioral assessments are usually conducted in the exposure
medium. Generally, a range of toxicant concentrations is examined and, as shown in Table 1,
exposure may begin as early as 1 hpf. Some studies reported excluding embryos with visible
morphological malformations from behavioral assessments.
Tail coiling occurs spontaneously in embryos growing in their chorions and in
dechorionated embryos. It is also well established that tail coiling can be induced by external
stimulation. For example, in a dechorionated embryo, vigorous tail coiling can be triggered by
gently touching the head or tail with a fine probe. As the embryo matures, mechanical
stimulation of the head continues to elicit full tail coils and sometimes swimming whereas tail
stimulation elicits partial tail coiling and a swim forward response (Saint-Amant & Drapeau
1998). In mature, dark-adapted embryos, exposure to an intense white light stimulus triggers
whole body contractions (shaking) comprised of both tail coiling and swimming movements
(Kokel & Peterson 2011; Kokel et al. 2010, 2013). These embryonic assays are useful for
distinguishing toxicant-induced changes in the timing of motor and sensory neuron

development and revealing the extent of neurotoxicity. Furthermore, automated analyses of
digital images make it possible to quantify these embryonic behaviors with a high level of
precision, consistency and speed, factors that can enhance the suitability of these assays for
high throughput screening.
In this section, three embryonic behavioral assays are described, two of which have been
used to examine the effects of environmental toxicant exposure. We provide a brief overview
of their usage, consider their suitability for high throughput screening, and make
recommendations for their development including suggestions for standardizing behavior-
related aspects of methodology and reporting procedures to facilitate replication and
comparison across studies.
1. Spontaneous Behavior
a. Tail coiling
Spontaneous tail coiling in normal embryos incubated at 28.5ºC on a 14:10 light:dark
cycle has been well documented at multiple levels with evidence suggesting it is mediated by
a simple spinal network (Drapeau et al. 2002; Granato et al.1996; Kimmel et al. 1995; Saint-
Amant & Drapeau 1998). It is the first motor behavior to develop, appearing at 17 hpf and
coinciding with the innervation of muscle by primary motoneurons. It consists initially of
continuous side-to-side flexes of the tail accompanied by slow coils of the tip of the tail
towards the head. Contractions usually peak at around 19 hpf and then progressively decline
over the next 6-7 hours. After 24 hpf, tail contractions occur in bouts of 2 to 3 coils with up to
20 sec of inactivity between bouts (Saint-Amant & Drapeau 1998). There is negligible further
change in the rate of spontaneous contractions after 26 hpf which persist through hatching
(Saint-Amant & Drapeau 1998). The frequency of spontaneous tail coiling is positively
correlated with the number of depolarizations in the motoneurons and the behavior is
considered functionally integral to the hatching process by enabling the embryo to escape
from its chorion (Kimmel, Patterson & Kimmel 1974; Saint-Amant 2006).
Spontaneous tail coiling has been used to assess the behavioral effects of embryonic
exposure to acrylamide (Selderslaghs et al. 2013), bifenthrin (Jin et al. 2009, 2010), BPA
(Selderslaghs et al. 2013), cadmium (Fraysse, Mons & Garric 2006), chlorpyrifos
(Selderslaghs et al. 2010), difenoconazole (Mu et al. 2013), IDPN (Selderslaghs et al. 2013),
malathion (Fraysse et al. 2006), methylmercury (Selderslaghs et al. 2013), PFOS (Huang et
al. 2010), PBDEs (Usenko et al. 2011), and TMT (Chen et al. 2011). Most of these studies
reported that embryos were incubated within the range 28±1ºC on a 14:10 light:dark cycle but
some reported using a cooler temperature, longer light period or did not specify. Behavioral
assessment was always conducted in the exposure medium with all studies testing at around
24 hpf. Three studies, however, tested at additional time points: Huang et al. (2010) and Jin et
al. (2010) tested at hourly intervals from 17 hpf to 25 hpf, and Chen et al. (2011) tested at
hourly intervals from 19 hpf to 27 hpf. Toxicant effects were routinely measured by
examining changes in the frequency of responding during one or more brief observational
periods generally lasting no longer than 5 min. Details of toxicant exposures and their
behavioral effects are summarized for these studies in Table 1.
Three features make this assay suitable for high throughput screening of environmental
toxicants. First, there is little variability in the development of spontaneous tail coiling across
untreated embryos incubated at 28.5ºC. Second, the behavior can be observed in embryos in
their chorions. Third, commercial and open-access software are available to automate the
measurement of multiple aspects of the tail coil response including its duration and frequency.
Selderslaghs et al. (2010) used automated image analysis software (EthoVision, Noldus) to
derive measures of response frequency and duration from changes in the status of individual
pixels between successive frames sampled at five frames per sec. They were able to set a
threshold level (strong mobility) that corresponded accurately and reliably to the occurrence
of a tail coil response in 24-26 hpf embryos.
Future studies of toxicant exposure effects should consider taking advantage of the
detailed behavioral profile of spontaneous tail coiling developed by Saint-Amant, Drapeau
and colleagues. First, standard rearing conditions should be used to optimize comparison with
that profile; thus, exposed embryos should be incubated at 28.5ºC on a 14:10 light:dark cycle.
Cooler temperatures are known to slow embryonic development and affect behavior (Kimmel
et al. 1974; Laale, 1977; Roy et al. 1999; Scheil & Kohler 2009). Even during behavior
assessment, it is important to avoid cooler temperatures as the frequency of spontaneous tail
coiling decreases considerably (Saint-Amant & Drapeau 1998). Second, behavior should be
routinely measured at multiple time points. Hourly observations from 16 dpf through 27 dpf
would be of tremendous value in determining if toxicant exposure accelerated, delayed or
distorted development of spontaneous tail coiling. For example, Chen et al. (2011) found that
exposure to TMT produced higher initial rates of tail bending, advanced the timing of the
peak rate by 1 hour, and led to lower post-peak rates relative to controls. While this pattern
suggests that TMT accelerates the development of spontaneous tail coiling, the untreated
control embryos did not peak until 22 hpf, 3 hours after the peak time reported by Saint-
Amant & Drapeau (1998) but matching the peak time reported by Kimmel et al. (1974) in
embryos reared at 25ºC. Demonstrating that TMT affects the timing of development when
embryos are incubated under standard conditions is important for establishing the generality
of this effect. Third, while response frequency is informative, other details such as response
amplitude and duration, bout lengths, and intervals between bouts may be useful in profiling
subtle toxicant effects. Image analysis software should be used to automate extraction of these
components to minimize bias, inconsistency, and inefficiency associated with manual coding
of behavior. Finally, because a toxicant could affect spontaneous tail coiling by acute
irritation of the skin or eyes or through an acute action on the brain or nervous system, testing
in the absence of the toxicant would strengthen claims that any significant difference in
behavior between treated and control embryos was a direct consequence of altered
neurobehavioral development.
2. Stimulus-Induced Behavior
a. Touch-induced motor responses

The emergence and progression of touch-induced motor activity have been well
characterized at the levels of spinal cord circuitry and behavior (Saint-Amant & Drapeau
1998; Pietri et al. 2009). Sensitivity to tail touch is mediated between 24 and 60 hpf by the
primary mechanosensory Rohon-Beard cells (RBs), the only sensory neurons in the tail
(Kuwada, Bernhardt & Nguyen 1990; Metcalfe et al. 1990). These RBs have been shown to
develop novel connections involving glutamatergic transmission to drive motoneuron
activation through a rostral loop in the spinal cord (Pietri et al. 2009). For the behavior
studies, Saint-Amant and Drapeau (1998) applied a flamed microelectrode deflected by a 1-
ms square voltage pulse to the head (nose) or tail (tip) of dechorionated embryos incubated at
28.5ºC on a 14:10 light:dark cycle. They found that two behaviors, tail coiling and swimming,
can be elicited by touch depending on the age of the embryo. The key findings for each
behavior are briefly summarized.
i. Tail coiling
Starting at 21 hpf, mechanical stimulation of either the head or the tail elicited rapid tail
coils, contralateral to the stimulus, that served to reorient the larvae away from the stimulus.
By 24 hpf, the speed of touch-induced tail coils was determined to be approximately double
that of spontaneous tail coiling. The similarity in tail coil responses evoked by head and tail
stimulation was observed up to 26 hpf.
ii. Swimming
Starting at 27 hpf, differences were seen in the response to tail and head stimulation. Tail
touch elicited bends or partial coils of the tail which served initially to propel the
dechorionated larvae forward a distance of one body length. Over the next few hours, the
swim response became stronger. By 36 hpf, almost all dechorionated larvae swam away from
the stimulus when touched on the tail. In contrast, head touch continued to elicit tail coiling
but swimming was observed in only about half of the larvae at 36 hpf.
Touch-induced motor response assays have been used to assess the effects of embryonic
exposure to fipronil (Stehr et al., 2006) and TMT (Chen et al. 2011). Details are summarized
in Table 1. The methodologies used in these two studies varied from that used by Saint-
Amant and Drapeau (1998). Stehr et al. (2006) used dark-reared embryos although they were
incubated at 28.5ºC. At 30 hpf, dechorionated embryos were gently touched on the head with
a nylon monofilament up to three times. Larvae were counted as responders if they swam
away from the stimulus on its first, second or third presentation but these data are not shown.
Chen et al. (2011) manually dechorionated embryos at 24 hpf and then recorded touch
responses to manual stimulation of the tail by a rounded probe repeated three times first at 27
hpf and then at 36 hpf. However, the conditions for incubation and the response criteria were
not reported.
Clearly, the potential of touch-induced motor assays for revealing toxicant exposure
effects has yet to be realized. Two issues that might have discouraged its use and limited its
suitability for high throughput screening studies have recently been addressed with some
success. Mandrell et al. (2012) have developed an automated platform for dechorionating
embryos in pronase at 4 hpf and a robotic system for sorting and placing them in 96-well
plates at 6 hpf. At 120 hpf, the low rate (<5%) of morphological abnormalities of these larvae
was comparable to that of controls which were manually dechorionated and placed in 96-well
plates. A third issue, not yet resolved, concerns the manual application of touch stimulation.
This is a labor intensive, repetitive procedure and not without bias and inconsistency in
stimulus delivery. Although Saint-Amant and Drapeau (1998) devised a system that partially
addressed the consistency issue, it was still labor intensive. Building a robotic tool to
automate application of the touch stimulus is a crucial next step not only for high throughput
studies but for eliminating stimulus variability and bias in studies of toxicant exposure
effects.
Future studies of toxicant exposure effects should exploit the time-dependent changes in
the pattern of responding to head and tail stimulation to profile more subtle influences on
behavior. Inclusion of untreated control embryos along with solvent controls and the use of
standard incubation conditions are essential for optimal comparisons with the corpus of
existing information about normal embryonic development.
b. The photomotor response (PMR)

From 30 to 42 hpf, normally developing embryos incubated at 28.5ºC exhibit only a low
level of spontaneous motor activity (Saint-Amant & Drapeau, 1998). During this period,
Kokel, Peterson and their colleagues discovered that dark-raised or dark-adapted embryos
display a robust motor response (shaking) following a 1-sec pulse of intense white light
(Kokel & Peterson, 2011; Kokel et al. 2010, 2013). This photomotor response (PMR) occurs
with a latency of 1-2 sec and involves high-frequency body flexions and tail oscillations for
5-7 sec followed by a refractory period during which spontaneous activity is suppressed and a
second light pulse is ineffective in eliciting motor activity. Only after ten minutes of dark re-
adaptation between photic stimulation will animals respond to a repeated light pulse. Through
a series of elegant experiments, Kokel et al. (2013) determined that the neural circuitry of the
PMR involves nonvisual neurons in the hindbrain that are sensitive to light between 480nm
(blue) and 560nm (green) but not to shorter or longer wavelengths.
Kokel et al. (2010) developed a quantitative method to represent motor activity
throughout the different phases of the PMR in the form of a behavioral barcode. Using this
method, they examined the PMR phenotypes for a large number of pharmaceutical
compounds which they then sorted into clusters based on common behavioral profiles.
Interestingly, phenoclusters emerged with shared pharmacological targets such as dopamine
or beta-adrenergic receptor agonists. This approach may prove immensely useful for
characterizing the putative cellular targets of toxicants and novel chemical compounds based
on their shared similarity to these established PMR phenotype clusters, just as comparison of
toxicant-induced phenotypes to genetic mutants has helped reveal potential cellular targets
(Stehr et al. 2006).
The PMR assay was specifically developed for rapid screening of neuroactive small
molecules and has several desirable qualities for high throughput analyses. Embryos can be
tested in their chorions and both stimulus delivery and response measurement are fully
automated. However, precise topographical information about the motor responses is not
captured by the automated methods used to calculate motor activity from changes in average
pixel intensity between consecutive digital images. To date, we have been unable to locate
any studies using the PMR assay to assess the effects of toxicant exposure on
neurodevelopment in zebrafish embryos. Going forward, combining this assay with the
spontaneous and touch-induced motor activity assays may prove to be a fruitful strategy for
disentangling the effects of toxicant exposure on the rate of development from disturbances in
development.
3. Experience-Based Behavior
There should be little reason to doubt that the behavior of adult zebrafish can be modified
by past experience. Studies have shown that what adult zebrafish do or where they go can be
influenced by food or other rewards or by avoidance of aversive outcomes such as shock
(Colwill et al. 2005; Echevarria et al. 2008; Levin & Cerutti 2009; Sison & Gerlai 2010).
There is also good evidence that the behavior of zebrafish larvae can be influenced by past
experience (O‘Neale et al. 2013; Roberts et al. 2011; Valente et al. 2012; Wolman et al.
2012). Recently, we showed that larvae as young as 5, 6, and 7 dpf will behave differently in
the presence of a moving visual stimulus depending on their recent prior experience with that
stimulus (O‘Neale et al. 2013).
Collectively, the experiences used in these examples to change behavior are typically
thought to recruit the operation of one or more elementary learning processes (habituation,
Pavlovian conditioning and instrumental learning). To the best of our knowledge, comparable
studies to determine if the behavior of embryonic zebrafish can be modified by such
experiences have yet to be done. However, an interesting observation reported in passing by
Saint-Amant and Drapeau (1998) suggests that it might, in fact, be possible to demonstrate an
experience-based alteration in stimulus-induced motor behavior in zebrafish embryos as
young as 21 hpf. Elaborating on this finding, we outline a strategy for an experience-based
behavior assay that could be used to reveal potential effects of toxicant exposure on
embryonic learning.
Saint-Amant and Drapeau (1998) devised a 5-min protocol in which mechanical
stimulation was applied to the heads or tails of different agarose-restrained dechorionated
embryos first at 1 Hz and then at 2 Hz for 1 min periods, each preceded and followed by 1
min periods with no touch stimulation. Measured at hourly intervals from 21 hpf to 24 hpf,
the frequency of tail contractions was found to increase with age during the stimulation
periods but to decline with age during the no stimulation periods. Relevant here was an
incidental and somewhat cryptic remark that accompanied the presentation of these results
indicating that there ‗was a decline in the responses to higher-frequency stimulation,
suggesting habituation‘ (Saint-Amant & Drapeau 1998:626).
We have previously commented, as have others, on the not insignificant problems
associated with interpreting a decline in a response to a repeatedly presented stimulus as
evidence of learning, specifically habituation (Davis 1970; Davis & Wagner 1968, 1969;
O‘Neale et al. 2013; Rescorla 1988; Rescorla & Holland 1976). In our demonstration of
stimulus learning in larval zebrafish, we used the t1-t2 framework proposed by Rescorla and
Holland (1976) to avoid the problem of confounding the opportunity for learning (t1) with the
assessment of that learning (t2). In one experiment, we measured the responses of two groups
of larvae to a moving visual stimulus. One of the groups had been familiarized with this
stimulus but the other had not. The familiar group displayed significantly less freezing in the
presence of the moving visual stimulus than did the unfamiliar group. This difference in
behavior of the two groups to an identical target could only be attributed to the effect of their
prior differential experience with that target.
Building on Saint-Amant and Drapeau‘s (1998) observation, it is a fairly straightforward
matter to apply the t1-t2 logic to the development and implementation of an assay for
demonstrating habituation in the zebrafish embryo. Essentially, two groups of dechorionated
embryos would be tested with mechanical stimulation of the tail for a one minute period. One
group would have received prior presentations of this touch stimulus whereas the other group
would have been spared those presentations. A difference in behavior between the two groups
during identical testing would confirm an effect of their differential prior experience, a result
suggestive of simple learning.
It is important to acknowledge that prior experience may alter behavior for reasons other
than learning. For example, repeated exposure to a stimulus may induce sensory adaptation,
motor fatigue, or even sensitization, and recent experience with a brief stimulus event may
produce pre-pulse inhibition (Burgess & Granato 2007). Methods have been devised to help
distinguish among these possibilities. For instance, in the preceding example, motor fatigue
may be just as reasonable an explanation for the difference between the two groups as
learning. Examining spontaneous rates of contraction and the effectiveness of head
stimulation in eliciting a contraction, exposing the control group at t1 to a different stimulus
that elicits the same response, or using a dishabituation procedure are some of the strategies
that can be deployed to distinguish between motor fatigue and habituation.
Saint-Amant and Drapeau (1998) laid the groundwork for developing a very powerful
approach for studying learning in embryos. Finding a way to fully automate delivery of an
effective touch stimulus or its equivalent is essential for making progress in this area and is
certain to yield appreciable payoff in the long-term. Low level exposure to toxicants during
development may exert subtle effects on behavior due to disruption of neuronal connectivity
that may go undetected through inspection of external morphological development and gross
anatomy. An embryonic assay for reliably demonstrating an effect of prior experience may
serve as a valuable tool to screen for subtle neurobehavioral effects of toxicant exposure at
environmentally relevant concentrations and mixtures.
CONCLUSION
Behavioral assessments of toxicant exposure have been carried out at the embryonic stage
although there are currently limitations. Tail coiling is already a promising candidate behavior
for high throughput analyses for several reasons. It is the first behavior to appear after
fertilization, its measurement can be automated, and its occurrence can be either spontaneous
or elicited by external stimulation. All of the studies reviewed here conducted assessments in
the presence of the exposure medium making it difficult to determine if the observed
behavioral perturbations were due to alterations that had already occurred in the developing
nervous system or to a direct effect of the toxicant on behavior at the time of assessment.
Stehr et al. (2006) did include a condition in which fipronil treated and solvent control
embryos were tested in system water. In contrast to the deficit observed in touch-induced
swimming at 30 hpf following chronic exposure, they found no effect of an 8-hr exposure
pulse (.5 mg/L) prior to 24 hpf on touch-induced swimming assessed at 48 hpf. This result is
interesting because it suggests that over time a developing nervous system may actually
recover from some toxicant exposure effects.
Future studies of toxicant effects on development should focus on automating procedures
for response measurement and stimulus delivery, conducting assessments in the absence of
the toxicant at multiple time points, and perhaps expanding assessments to other behaviors
that emerge later during embryonic development such as the rhythmic movement of the
pectoral fins and abrupt, periodic changes in the position of the embryo, two or three times a
minute (Wielhouwer et al. 2011). Additionally, the practice of rearing and testing embryos
individually should be adopted. Not only are the effects of the presence of a dying embryo
eliminated but one can track the behavior of individuals over time and compare performance
on a variety of assays. There may also be merit to standardizing methodology which varied
widely across the studies reviewed here. At the very least, it is important to include untreated
controls alongside solvent controls particularly in studies using embryos collected from fish
obtained from commercial suppliers and pet stores and where there are significant deviations
from the recommended conditions for embryo incubation. That said, using different strains
and cooler temperatures to slow embryonic development may serendipitously reveal toxicant
effects on brain and behavior that might not otherwise be detected. Such findings could have
translational significance for understanding why typical risk factors such as maternal poor
diet, poverty, or stress may heighten the vulnerability of a developing human fetus to the
adverse effects of toxicant exposure.
Finally, we cannot overstate the importance of developing behavioral assays for assessing
the effects of experience in the embryonic zebrafish. The combination of sophisticated
behavioral tools, powerful optogenetic techniques, and the growing library of transgenic
zebrafish lines offers a formidable arsenal for using the embryonic zebrafish to unlock the
mysteries of both normal and perturbed neurobehavioral development.
ACKNOWLEDGMENTS
This work was supported by the National Institute of Environmental Health Sciences
(NIEHS, R03ES017755 and F32ES021342) and the Eunice Kennedy Shriver National
Institute of Child Health and Human Development (NICHD, R01HD060647).
REFERENCES
Ahmad, F., Noldus, L. P. J. J., Tegelenbosch, R. A. J. & Richardson, M. K. (2012).
―Zebrafish embryos and larvae in behavioural assays‖, Behaviour, 149, 1241-1281.
Al-Deeb, S., Al-Moutaery, K., Bruyn, G. W. & Tariq, M. (1994). ―Neuroprotective effect of
selenium on iminodipropionitrile-induced toxicity‖, Journal of Psychiatry and
Neuroscience, 20(3), 189-192.
Ali, M. M., Murthy, R. C. & Chandra, S. V. (1986). ―Developmental and long term
neurobehavioral toxicity of low level, in utero, cadmium exposure in rats‖,
Neurobehavioral toxicology and teratology, 8, 463-468.
Arrenberg, A. B., Del Bene, F. & Baier H. (2009). ―Optical control of zebrafish behavior with
halorhodopsin‖, Proceedings of the National Academy of Sciences USA, 106(42), 17968–
17973.
ATSDR. (2012). Mercury from http://www.atsdr.cdc.gov/ToxProfiles/tp.asp?id=115&tid=24.
Barros, T. P., Alderton, W. K., Reynolds, H. M., Roach, A. G. & Berghmans, S. (2008).
―Zebrafish: an emerging technology for in vivo pharmacological assessment to identify
potential safety liabilities in early drug discovery‖, British Journal of Pharmacology,

154, 1400-1413.
Beis, D. & Stainier, D. Y. (2006). ―In vivo cell biology: following the zebrafish trend‖,
Trends in Cell Biology, 16, 105-112.
Biedermann, S., Tschudin, P. & Grob, K. (2010). ―Transfer of bisphenol A from thermal
printer paper to the skin‖, Analytical and Bioanalytical Chemistry, 398, 571-576.
Blechinger, S., Kusch, R., Haugo, K., Matz, C., Chivers, D. & Krone, P. (2007). ―Brief
embryonic cadmium exposure induces a stress response and cell death in the developing
olfactory system followed by long-term olfactory deficits in juvenile zebrafish‖,
Toxicology and Applied Pharmacology, 224, 72-80.
Borghi, V. & Porte, C. (2002). ―Organotin pollution in deep-sea fish from the northwestern
Mediterranean‖, Environmental Science & Technology, 36, 4224-4228.
Brustein, E., Saint-Amant, L., Buss, R. R., Chong, M., McDearmid, J. R. & Drapeau, P.
(2003). ―Steps during the development of the zebrafish locomotor network‖, Journal of
Physiology (Paris), 97, 77-86.
Burgess, H. A. & Granato, M. (2007). ―Sensorimotor gating in larval zebrafish‖, The Journal
of Neuroscience, 27(18), 4984-4994.
Chen, J., Huang, C., Zheng, L., Simonich, M., Bai, C., Tanguay, R. & Dong, Q. (2011).
―Trimethyltin chloride (TMT) neurobehavioral toxicity in embryonic zebrafish‖,
Neurotoxicology and Teratology, 33, 721-726.
Colwill, R. M. & Creton, R. (2011). ―Imaging escape and avoidance behavior in zebrafish
larvae‖, Reviews in the Neurosciences, 22, 63-73.
Colwill, R. M., Raymond, M. P., Ferreira, L. & Escudero, H. (2005). ―Visual discrimination
learning in zebrafish (Danio rerio)‖, Behavioural Processes, 70(1), 19–31.
Davis, M. (1970). ―Effects of interstimulus interval length and variability on startle-response
habituation in the rat‖, Journal of Comparative and Physiological Psychology, 72(2),
177-192.
Davis, M. & Wagner, A. R. (1968). ―Startle responsiveness after habituation to different
intensities of tone‖, Psychonomic Science, 12(7), 337-338.
Davis, M. & Wagner, A. R. (1969). ―Habituation of startle response under incremental
sequence of stimulus intensities‖, Journal of Comparative and Physiological
Psychology, 67(4), 486-492.
Del Bene, F. & Wyart, C. (2012 ―Optogenetics: a new enlightenment age for zebrafish
neurobiology‖, Developmental Neurobiology, 72(3), 404-14.
Desi, I., Nagymajtenyi, L. & Schulz, H. (1998). ―Behavioural and neurotoxicological changes
caused by cadmium treatment of rats during development‖, Journal of Applied
Toxicology, 18(1), 63–70.
D'Hollander, W., de Voogt, P., De Coen, W. & Bervoets, L. (2010). ―Perfluorinated
substances in human food and other sources of human exposure‖, Reviews of
Environmental Contamination and Toxicology, 208, 179-215.
Drapeau, P., Saint-Amant, L., Buss, R. R., Chong, M., McDearmid, J. R. & Brustein, E.
(2002). ―Development of the locomotor network in zebrafish‖, Progress in Neurobiology,
68, 85-111.
Driever, W., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C., Malicki, J., Stemple, D. L.,
Stainier, D. Y., Zwartkruis, F., Abdelilah, S., Rangini, Z., et al. (1996). ―A genetic screen
for mutations affecting embryogenesis in zebrafish‖, Development, 123, 37-46.
Earley B., Burke M. & Leonard B. E. (1992). ―Behavioural, biochemical and histological
effects of trimethyltin (TMT) induced brain damage in the rat‖, Neurochemistry
International, 21(3), 351-366.
Echevarria, D. J., Hammack, C. M., Pratt, D. W. & Hosemann, J. D. (2008). ―A novel test
battery to assess global drug effects using the zebrafish‖, International Journal of
Comparative Psychology, 21, 19-34.
EPA. (2011). Organophosphate Pesticides in Food: A Primer on Reassessment of Residue
Limits, from http://www.epa.gov/pesticides/.
EPA. (2012a). Bisphenol A (BPA) action plan summary, from http://www.epa.gov/oppt/
existingchemicals/pubs/actionplans/bpa.html.
EPA. (2012b). PBDE, from http://www.epa.gov/oppt/pbde/.
FAO/WHO. (2007). Pesticide residues in food 2007, from http://www.fao.org/docrep/010/
a1556e/a1556e00.HTM.
Fero, K., Yokogawa, T. & Burgess, H.A. (2011). ―The behavioral repertoire of larval
zebrafish‖, in A.V. Kalueff & J.M. Cachat (eds.), Zebrafish Models in Neurobehavioral
Research, 249–291, Springer, New York.
Fetcho, J.R. & Liu, K.S. (1998). ―Zebrafish as a model system for studying neuronal circuits
and behavior‖, Annals of the New York Academy of Sciences, 860, 333-345.
Fraysse, B., Mons, R. & Garric, J. (2006). ―Development of a zebrafish 4-day embryo-larval
bioassay to assess toxicity of chemicals‖, Ecotoxicology and Environmental Safety,
63(2), 253-67.
Geens, T., Neels, H. & Covaci, A. (2012). ―Distribution of bisphenol-A, triclosan and n-
nonylphenol in human adipose tissue, liver, and brain‖, Chemosphere, 87, 796-802.
Gerlai, R. (2011). ―Associative learning in zebrafish (Danio rerio)‖, Methods in Cell Biology,
101, 249-270.
Gerlai, R., Lahav, M., Guo, S. & Rosenthal, A. (2000). ―Drinks like a fish: zebra fish (Danio
rerio) as a behavior genetic model to study alcohol effects‖, Pharmacology Biochemistry
& Behavior, 67, 773-782.
Giesy, J. P. & Kannan, K. (2001). ―Distribution of perfluorooctane sulfonate in wildlife‖,
Environmental Science & Technology, 35, 1339-1342.
Granato, M., van Eeden, F. J., Schach, U., Trowe, T., Brand, M., Furutani-Seiki, M., Haffter,
P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J. et al. (1996). ―Genes controlling
and mediating locomotion behavior of the zebrafish embryo and larva‖, Development,
123, 399-413.
Hinfray, N., Porcher, J.-M. & Brion, F. (2006). ―Inhibition of rainbow trout (Oncorhynchus
mykiss) P450 aromatase activities in brain and ovarian microsomes by various
environmental substances‖, Comparative Biochemistry and Physiology Part C:
Toxicology & Pharmacology, 144(3), 252–262.
Grillner, S. (2003). ―The motor infrastructure: From ion channels to neuronal networks‖,
Nature Reviews Neuroscience, 4, 573–586.
Groff, T. (2010). ―Bisphenol A: invisible pollution‖, Current Opinion Pediatrics, 22, 524-
529.
Haffter, P. & Nusslein-Volhard, C. (1996). ―Large scale genetics in a small vertebrate, the
zebrafish‖, International Journal of Developmental Biology, 40, 221-227.
Heasman, J. (2002). ―Morpholino oligos: making sense of antisense?‖, Developmental
Biology, 243, 209-214.
Higashijima, S., Masino, M. A., Mandel, G. & Fetcho, J. R. (2003). ―Imaging neuronal
activity during zebrafish behavior with a genetically encoded calcium indicator‖, Journal
of Neurophysiology, 90(6), 3986-3997.
Huang, H., Huang, C., Wang, L., Ye, X., Bai, C., Simonich, M. T., Tanguay, R.L. & Dong,
Q. (2010). ―Toxicity, uptake kinetics and behavior assessment in zebrafish embryos
following exposure to perfluorooctanesulphonicacid (PFOS)‖, Aquatic Toxicology, 98(2),
139-47.
Ishida, N., Akaike, M., Tsutsumi, S., Kanai, H., Masui, A., Sadamatsu, M., Kuroda, Y.,
Watanabe, Y., McEwen, B. S. & Kato, N. (1997). ―Trimethyltin syndrome as a
hippocampal degeneration model: temporal changes and neurochemical features of
seizure susceptibility and learning impairment‖, Neuroscience, 81, 1183-1191.
Jin, M., Zhang, X., Wang, L., Huang, C., Zhang, Y. & Zhao, M. (2009). ―Developmental
toxicity of bifenthrin in embryo-larval stages of zebrafish‖, Aquatic Toxicology, 95,
347-354.
Jin, M., Zhang, Y., Ye, J., Huang, C., Zhao, M. & Liu, W. (2010). ―Dual enantioselective
effect of the insecticide bifenthrin on locomotor behavior and development in embryonic-
larval zebrafish‖, Environmental Toxicology and Chemistry, 29, 1561-1567.
Kang, J.-H., Kondo, F. & Katayama, Y. (2006). ―Human exposure to bisphenol A‖,
Toxicology, 226, 79-89.
Kimmel, C., Ballard, W., Kimmel, S., Ullmann, B. & Schilling, T. (1995). ―Stages of
embryonic development of the zebrafish‖, Developmental Dynamics, 203, 253-310.
Kimmel, C. B., Patterson, J. & Kimmel, R. O. (1974). ―The developmental behavioral
characteristics of the startle response in the zebra fish‖, Developmental Psychobiology, 7,
47-60.
Kokel, D. & Peterson, R. T. (2011). ―Using the zebrafish photomotor response for
psychotropic drug screening‖, Methods in Cell Biology, 105, 517-524.
Kokel, D., Bryan, J., Laggner, C., White, R., Cheung, C. Y. J., Mateus, R., Healey, D., Kim,
S., Werdich, A. A., Haggarty, S. J., MacRae, C. A., Shoichet, B. & Peterson, R. T.
(2010). ―Rapid behavior-based identification of neuroactive small molecules in the
zebrafish‖, Nature Chemical Biology, 6, 231-237.
Kokel, D., Dunn, T. W., Ahrens, M. B., Alshut, R., Cheung, C. Y., Saint-Amant, L., Bruni,
G., Mateus, R., van Ham, T. J., Shiraki, T., Fukada, Y., Kojima, D., Yeh, J. R., Mikut, R.,
von Lintig, J., Engert, F. & Peterson, R. T. (2013). ―Identification of Nonvisual
Photomotor Response Cells in the Vertebrate Hindbrain‖, The Journal of Neuroscience,
33(9), 3834-3843.
Kullander, K. (2005). ―Genetics moving to neuronal networks‖, Trends in Neurosciences, 28,
239–247.
Kütting, B., Schettgen, T., Schwegler, U., Fromme, H., Uter, W., Angerer, J. & Drexler, H.
(2009). ―Acrylamide as environmental noxious agent: A health risk assessment for the
general population based on the internal acrylamide burden‖, International Journal of
Hygiene and Environmental Health, 212, 470–480.
Kuwada, J. Y., Bernhardt, R. R. & Nguyen, N. (1990). ―Development of spinal neurons and
tracts in the zebrafish embryo‖, The Journal of Comparative Neurology, 302, 617–628.
Laale, H. W. (1977). ―The biology and use of zebrafish, Brachydanio rerio, in fisheries
research. A literature review‖, Journal of Fish Biology, 10, 121–173.
Langheinrich, U. (2003). ―Zebrafish: A new model on the pharmaceutical catwalk‖,

Bioessays, 25, 904-912.
Levin, E. D. & Cerutti, D. T. (2009). ―Behavioral neuroscience of zebrafish‖, in J.J.
Buccafusco (ed.), Methods of Behavior Analysis in Neuroscience. 2nd edition, CRC
Press, Boca Raton, FL.
Lieschke, G. J. & Currie, P. D. (2007). ―Animal models of human disease: zebrafish swim
into view‖, Nature Reviews Genetics, 8(5), 353-367.
Lindstrom, A. B., Strynar, M. J. & Libelo, E. L. (2011). ―Polyfluorinated compounds: past,
present, and future‖, Environmental Science & Technology, 45, 7954-7961.
Mai, B., Chen, S., Luo, X., Chen, L., Yang, Q., Sheng, G., Peng, P., Fu, J. & Zeng, E. Y.
(2005). ―Distribution of polybrominated diphenyl ethers in sediments of the Pear River
Delta and adjacent South China Sea‖, Environmental Science & Technology, 39,
3521-3527.
Mandrell, D., Truong, L., Jephson, C., Sarker, M. R., Moore, A., Lang, C., Simonich, M. T.
& Tanguay, R. L. (2012). ―Automated zebrafish chorion removal and single embryo
placement: optimizing throughput of zebrafish developmental toxicity screens‖, Journal
of Laboratory Automation, 17(1), 66-74.
Masuo, Y. & Ishido, M. (2011). ―Neurotoxicity of endocrine disruptors: possible involvement
in brain development and neurodegeneration‖ Journal of toxicology and environmental
health. Part B, Critical reviews, 14, 346-369.
Metcalfe, W. K., Myers, P. Z., Trevarrow, B., Bass, M. B. & Kimmel, C. B. (1990). ―Primary
neurons that express the L2/HNK-1 carbohydrate during early development in the
zebrafish‖, Development, 110, 491–504.
Minami, A., Takeda, A., Nishibaba, D., Takefuta, S. & Oku, N. (2001). ―Cadmium toxicity in
synaptic neurotransmission in the brain‖, Brain Research, 894(2), 336–339.
Morgan, M. K., Sheldon, L. S., Croghan, C. W., Jones, P. A., Robertson, G. L., Chuang, J. C.,
Wilson, N. K. & Lyu, C. W. (2004). ―Exposures of preschool children to chlorpyrifos and
its degradation product 3,5,6-trichloro-2-pyridinol in their everyday environments‖,
Journal of Exposure Analysis and Environmental Epidemiology, 15, 297-309.
Mu, X., Pang, S., Sun, X., Gao, J., Chen, J., Chen, X., Li, X. & Wang, C. (2013). ―Evaluation
of acute and developmental effects of difenoconazole via multiple stage zebrafish
assays‖, Environmental Pollution, 175, 147-57.
Nishimura, T., Schwarzer, C., Furtinger, S., Imai, H., Kato, N. & Sperk, G. (2001). ―Changes
in the GABA-ergic system induced by trimethyltin application in the rat‖, Molecular
Brain Research, 91, 1-6.
Norton, W. & Bally-Cuif, L. (2010). ―Adult zebrafish as a model organism for behavioural
genetics‖, BMC Neuroscience, 11, 90.
O‘Neale, A., Ellis, J., Creton, R. & Colwill, R.M. (2013). ―Single stimulus learning in
zebrafish larvae‖, Neurobiology of Learning and Memory, S1074-7427(13), 175 (Epub
ahead of print).
Pietri, T., Manalo, E., Ryan, J., Saint-Amant, L. & Washbourne, P. (2009). ―Glutamate drives
the touch response through a rostral loop in the spinal cord of zebrafish embryos‖,
Developmental Neurobiology, 69, 780–795.
Rescorla, R. A., 1988). ―Behavioral studies of Pavlovian conditioning‖, Annual Review of
Neuroscience, 11(1), 329-352.
Rescorla, R. A. & Holland, P. C. (1976). ―Some behavioral approaches to the study of

learning‖, in E. Bennett & M.R. Rosenzweig (eds.), Neural mechanisms of learning and
memory, 165-192, MIT Press, Cambridge, MA.
Roberts, A. C., Reichl, J., Song, M. Y., Dearinger, A. D., Moridzadeh, N., Lu, E. D., et al.
(2011). ―Habituation of the C-start response in larval zebrafish exhibits several distinct
phases and sensitivity to NMDA receptor blockade‖, PloS One, 6(12), e29132.
Rodier, P. M. (1994). ―Vulnerable periods and processes during central nervous system
development‖, Environmental Health Perspectives, 102(2), 121–124.
Roy, M. N., Prince, V. E. & Ho, R. K. (1999). ―Heat shock produces periodic somitic
disturbances in the zebrafish embryo‖, Mechanisms of Development, 85, 27-34.
Sadiki, A., Williams, D., Carrier, R. & Thomas, B. (1996). ―Pilot study of the contamination
of drinking water by organotin compounds from PVC materials‖, Chemosphere, 32,
2389-2398.
Saint-Amant, L. (2006). ―Development of motor networks in zebrafish embryos‖, Zebrafish,
3, 173-190.
Saint-Amant, L. & Drapeau, P. (1998). ―Time course of the development of motor behaviors
in the zebrafish embryo‖, Journal of Neurobiology, 37, 622-632.
Scheil, V. & Kohler, H. R. (2009). ―Influence of nickel chloride, chlorpyrifos, and
imidacloprid in combination with different temperatures on the embryogenesis of the
zebrafish Danio rerio‖, Archives of Environmental Contamination and Toxicology, 56,
238-243.
Schier, A. F., Neuhauss, S. C., Harvey, M., Malicki, J., Solnica-Krezel, L., Stainier, D. Y.,
Zwartkruis, F., Abdelilah, S., Stemple, D. L., Rangini, Z., et al. (1996). ―Mutations
affecting the development of the embryonic zebrafish brain‖, Development, 123,
165-178.
Selderslaghs, I. W. T., Hooyberghs, J., De Coen, W. & Witters, H. E. (2010). ―Locomotor
activity in zebrafish embryos: A new method to assess developmental neurotoxicity‖,
Neurotoxicology and Teratology, 32, 460-471.
Selderslaghs, I. W., Hooyberghs, J., Blust, R. & Witters, H. E. (2013). ―Assessment of the
developmental neurotoxicity of compounds by measuring locomotor activity in zebrafish
embryos and larvae‖, Neurotoxicology and Teratology, 37, 44-56.
Shawky, S. & Emons, H. (1998). ―Distribution pattern of organotin compounds at different
trophic levels of aquatic ecosystems‖, Chemosphere, 36, 523-535.
Sison, M. & Gerlai, R. (2010). ―Associative learning in zebrafish (Danio rerio) in the plus
maze‖, Behavioural Brain Research, 207(1), 99-104.
Stanton, M. E. & Jensen, K. F. (1991). ―Neonatal exposure to trimethyltin disrupts spatial
delayed alternation learning in preweanling rats‖, Neurotoxicology and Teratology, 13,
525-530.
Stehr, C. M., Lindo, T. L., Incardona, J. P. & Scholz, N. L. (2006). ―The developmental
neurotoxicity of fipronil: notochord degeneration and locomotor defects in zebrafish
embryos and larvae‖, Toxicological Sciences, 92, 270-278.
Stewart, A. M. & Kalueff, A. V. (2012). ―The developing utility of zebrafish models for
cognitive enhancers research‖, Current Neuropharmacology, 10, 263-271.
Trabucco, A., Di Pietro, P., Nori, S. L., Fulceri, F., Fumagalli, L., Paparelli, A. & Fornai, F.
(2009). ―Methylated tin toxicity a reappraisal using rodent models‖, Archives italiennes
de biologie, 147, 141-153.
Tropepe, V. & Sive, H. L. (2003). ―Can zebrafish be used as a model to study the
neurodevelopmental causes of autism?‖, Genes, Brain and Behavior, 2, 268–281.
Usenko, C. Y., Robinson, E. M., Usenko, S., Brooks, B.W. & Bruce, E.D. (2011). ―PBDE
developmental effects on embryonic zebrafish‖, Environmental Toxicology & Chemistry,
30, 1865-1872.
Valente, A., Huang, K. H., Portugues, R. & Engert, F. (2012). ―Ontogeny of classical and
operant learning behaviors in zebrafish‖, Learning & Memory, 19(4), 170-177.
Welshons, W. V., Nagel, S. C. & vom Saal, F. S. (2006). ―Large effects from small
exposures. III. Endocrine mechanisms mediating effects of Bisphenol A at levels of
human exposure‖, Endocrinology, 147, S56-69.
Westerfield, M. (2007). The Zebrafish Book 5th Edition; A guide for the laboratory use of
zebrafish (Danio rerio), University of Oregon Press, Eugene.
Wielhouwer, E. M., Ali, S., Al-Afandi, A., Blom, M. T., Riekerink, M. B. O., Poelma, C.,
Westerweel, J., Oonk, J., Vrouwe, E. X., Buesink,W., van Mil, H. G. J., Chicken, J., van‘t
Oever, R. & Richardson, M. K. (2011). ―Zebrafish embryo development in a microfluidic
flow-through system‖, Lab on a Chip, 11, 1815-1824.
Wilhelm, M., Holzer, J., Dobler, L., Rachfuss, K., Midasch, O., Kraft, M., Angerer, J. &
Wiesmuller, G. (2009). ―Preliminary observations on perfluorinated compounds in
plasma samples (1977-2004) of young German adults from an area with
perfluorooctanoate-contaminated drinking water‖, International Journal of Hygiene and
Environmental Health, 212, 142-145.
Wolman, M. A., Jain, R. A., Liss, L. & Granato, M. (2011). ―Chemical modulation of
memory formation in larval zebrafish‖, Proceedings of the National Academy of
Sciences, 108(37), 15468-15473.
Wolman, M. & Granato, M. (2012). ―Behavioral genetics in larval zebrafish: Learning from
the young‖, Developmental Neurobiology, 72(3), 366-372.
Chapter 13
ACUTE TOXICITY AND STUDY OF “BIOMARKER

OF EFFECTS” IN ZEBRAFISH EMBRYOS AND LARVAE
EXPOSED TO SELECTED PESTICIDES:
A STEP TOWARDS REFINED RISK ASSESSMENT
OF CHEMICAL AGENTS
Wing Shan Chow and King Ming Chan*

Environmental Science Program, School of Life Sciences, Faculty of Science,
Chinese University, Sha Tin, N.T., Hong Kong
ABSTRACT
We have developed a standard test procedure using zebrafish embryos and larvae to
elucidate the water quality guidelines of pesticides in the tropical region. Zebrafish
embryos and larvae were tested for specific gene expression in response to different
pesticides: heptachlor, methoxychlor, endosulfan, chlorpyrifos, aldicarb, and
cypermethrin. The 96 hour(h) median Effective Concentration (EC50) (hatching rate) and
96 h median Lethal Concentration (LC50) values of different pesticides for zebrafish
embryos and larvae were first determined. Quantitative Polymerase Chain Reaction
(qPCR) was then used to study the gene expression levels of enzyme biomarkers in
zebrafish embryos and larvae after 96 h exposure to different pesticides. The biomarker
enzymes included cytochrome P450 (CYP) enzymes, CYP1A, and 3A65, glutathione S-
transferase (gst), catalase (cat), and resistance gene (mdr1) were studied as responses to
chemical exposures. Inhibition of acetylcholinesterase (AChE) activity was also used as a
biomarker of toxic effects from organophosphate (chlorpyrifos) and carbamate (aldicarb)
pesticides. Inductions of cat and gst mRNA levels demonstrated oxidative-stress-
inducing potential of chlorpyrifos and cypermethrin. Exposures to chlorpyrifos and to
aldicarb significantly inhibited AChE activity in both embryos and larvae, indicating their
neurotoxic effects on zebrafish embryo and larvae. The pesticides tested did not affect the
mRNA levels of cyp1A, but of cyp3A65 and mdr1 levels in zebrafish embryos and
*
Corresponding author: Room 184, Science Centre South Block, The Chinese University of Hong Kong Sha Tin,
N.T., Hong Kong SAR, Tel: 852-3943-4420; Fax: 852-2603-72465123 Email: kingchan@cuhk.edu.hk.
266 Wing Shan Chow and King Ming Chan
larvae, which were altered by heptachlor, methoxychlor and endosulfan. The use of
toxicity tests and a specific gene expression in response to toxic pesticides would help
aquatic scientists in determining the permissible concentrations of pesticides in waters.
Keywords: Pesticides; quantitative PCR; water quality guidelines
INTRODUCTION
Organochlorine (OC) pesticides are major environmental pollutant as they are persistent
and were found to cause feminization of wildlife animals (Colborn 1995, Sheahan et al. 2002,
Yu 2008). After banning dichlorodiphenyltrichloroethane (DDT) in 1972 in the United States
and regulation in many countries, the use of other OC pesticides, e.g. methoxychlor, increased
because of their shorter half-life (120 days) than DDT (Augustijn-Beackers et al. 1994).
Endosulfan and heptachlor are cyclodiene OC insecticides, and fishes are highly sensitive to
very low concentrations of endosulfan with LC50 values reported in parts per billion (Jonsson
& Toledo 1993). Heptachlor is moderately toxic, but highly persistent. For example,
heptachlor and heptachlor epoxide accumulated in Nile perch collected from Uganda (Ogwok
et al. 2009), and pike from Norway (Sharma et al. 2009). Exposure of heptachlor to zebrafish
juveniles caused mortality and proliferation of gill filaments at a low concentration of 0.01
ug/L (ppb) (Campagna et al. 2007). We have also recently reported the use of vitellogenin
(vtg1) gene expression as biomarker of estrogenic effects, and studied the acute toxicities of
endosulfan, heptachlor and methoxychlor on zebrafish embryos and larvae (Chow et al.
2012), however the effects of these OC pesticides on the expression of genes in other
pathways in response to pesticides have not been examined.
Organophosphates (OPs) are a class of insecticides in use since the mid 1940s (Costa
2006). They irreversibly inactivate acetylcholinesterase (AChE), they are relatively non-
persistent, and are highly effective to kill insects. However, OPs also cause significant
adverse effects in non-target species, including mammals, birds, and many aquatic organisms
when flushed in water (Yu 2008). Chlorpyrifos is one of the most heavily used OPs (Barron
& Woodburn 1995), with approximately 45 hundred tonnes of chlorpyrifos applied annually
in agricultural settings (USEPA 2002). Chlorpyrifos is highly toxic to freshwater fish, aquatic
invertebrates, estuarine, and marine organisms, and causes developmental neurotoxicity in
animal models (Levin et al. 2004). Inhibition of acetylcholinesterase was observed in acute
toxicity tests of fish exposed to very low concentrations (12- 316 μg/L) of chlorpyrifos at
different life stages of walleye, Stizostedion vitreum (Phillips et al. 2002). Juvenile walleye
were also killed by the OPs, when AChE activity was inhibited by more than 70% (Phillips et
al. 2002).
The use of OC and OP pesticides are associated with many ecological hazards. Therefore,
carbamate and pyrethroid insecticides, which possess a lower toxicity and persistence,
emerged as substitutes thereof. One of the widely used carbamates is aldicarb, which is water-
soluble and is a systemic insecticide used against aphids, mites, and wireworms in different
crops from cotton to citrus (Moore et al. 2009 2010). A few studies have been carried out to
examine the metabolism and effects of aldicarb in fish (Kuster & Altenburger 2007; Perkins
et al. 1999; Perkins & Schlenk 2000). Its oral LD50 in rats is 1 mg /kg (Yu 2008) and risks to
Acute Toxicity and Study of ―Biomarker of Effects‖ in Zebrafish Embryos … 267
freshwater fish and aquatic biota are considered as minor or negligible (Moore et al. 2009,
2010).
For the synthetic pyrethroids, they are less persistent, but are toxic to fish, birds, and
mammals. Unlike most animals, fish are reported to be deficient in enzymes that hydrolyze
pyrethroids (Haya 1989). Pyrethroid insecticides show their toxic effects by inhibiting
impulse transmission (Casida et al. 1983). Cypermethrin is one of the most toxic pyrethroid
insecticides that is widely used to protect cotton fields against harmful pest species (Croft
1990). Many studies associated cypermethrin with its acute toxicity rather than its sub-lethal
effects (Reddy & Yellamma 1991). Thus it is necessary to study its sub-lethal effects like
oxidative stress in addition to its acute toxicity.
Many xenobiotics, including pesticides, cause oxidative stress leading to the generation
of reactive oxygen species (ROS) or depletion of antioxidants or free oxygen radicals
scavenging enzyme systems in aquatic organisms (Livingstone 2001; Livingstone et al.
1993). It has been reported that OPs may induce oxidative stress (Hai et al. 1997; Yarsan et
al. 1999). Fish combat elevated levels of ROS with protective ROS-scavenging enzymes,
such as superoxide dismutase (SOD), catalase (CAT) and glutathione S-transferase (GST).
CAT is important in catalyzing the reduction of hydrogen peroxide to molecular oxygen and
water, has been well studied in fish (Winston & Di 1991). GST is a multi-gene family of
detoxification enzymes that catalyze the conjugation of GSH with different endogenous and
exogenous electrophilic compounds (Hayes & Pulford 1995). GST or the expression of its
gene gst can be used as a biomarker for assessing the environmental impact of organic
xenobiotics, which can cause oxidative stress (Livingstone 1998).
Zebrafish offers various experimental advantages, including convenient drug delivery,
ease of obtaining eggs and larvae, low cost and miniature in scale (Hallare et al. 2005; Hill et
al. 2005; McGrath & Li 2008; Westerfield 2007). We have previously demonstrated the use
of zebrafish embryos and larvae with the expression of vtg1 mRNA levels as biomarker of
exposures and effects of environmental estrogens including bisphenol A and OC pesticides
(Chow et al. 2012). In the study of the effects of brominated compounds (BDE-47 and
tetrabromobisphenol A) with zebrafish embryos and larvae, thyroid stimulating hormone gene
expression was found to be a sensitive biomarker of exposures and effects (Chan & Chan
2012). In this study, the gene expressions of different enzymes serving as ―biomarker of
effects‖ were chosen to study. These genes included the biotransformation phase I
cytochrome P450 (CYP) enzymes, CYP1A1 and 3A65; enzymes for the antioxidant defense
system glutathione S-transferase (GST), catalase (CAT) and the P-glycoproteins (p-gps),
which are membrane-spanning proteins from the ATP-binding cassette (ABC) family. The
changes of gene expression levels of these genes could be useful ―biomarker of effects‖
showing potential biochemical effects in zebrafish embryo-larvae systems.
Extensive studies related to the effects of pesticides on biomarkers have been reported for
fish (Barber et al. 2007; Blum et al. 2008; Davis et al. 2009). CYP1A is a member of CYP1
family and is important in the metabolism of environmental xenobiotics like polycyclic
aromatic hydrocarbons (PAHs). CYP enzymes oxidize, hydrolyze or reduce compounds by
adding an atom of atmospheric oxygen to the substrate during the reaction cycle (Nelson et al.
1996). Also, members of the CYP2 and CYP3A families play a major role in the metabolism
of xenobiotics and endogenous compounds in fish (Thibaut et al. 2002). In zebrafish, the
CYP3A isoform was known to be CYP3A65 (Tseng et al. 2005). The Multiple drug
resistance gene (mdr1) is the gene which encodes P-glycoproteins (Synold et al., 2001). P-
glycoproteins can pump molecules out of cells by an ATP-dependent removal mechanism
(Germann & Chambers 1998).
The aim of this study is to establish a standard and quick toxicity assay system to
determine the acute toxicities of pesticides using the zebrafish embryos and larvae. The
neurotoxicity of chlorpyrifos and aldicarb was studied by measuring the AChE activity. We
also measured cyp1A, cyp3A65, and mdr1 mRNA levels as biomarkers of exposure to study
the effects of OC pesticides in zebrafish embryos and larvae. We would like to use the levels
of these enzymes and genes to serve as ―biomarkers of effects‖ to determine the
concentrations of pesticides required to cause biological effects in water. Such concentrations
obtained will be helpful to scientists to advice the permissible levels of pesticides in tropical
waters.

Chemicals Tested
Aldicarb (CAS no. 116-06-3), chlorpyrifos (CAS no. 2921-88-2), endosulfan (CAS no.
115-29-7) and cypermethrin (CAS no. 52315-07-8) from Sigma-Aldrich were used.
Heptachlor (CAS no. 76-44-8) and methoxychlor (CAS no. 72-43-5) were purchased from
ChemService. They were all analytical grade with the highest purity available. Stock
solutions were made by dissolving each chemical in dimethyl sulfoxide (DMSO), and the
DMSO concentrations were maintained to less than 0.2% in all exposures tested using
embryo medium made with deionized water prepared from reverse osmosis.
Zebrafish Cultivation and Egg Production
A breeding stock of non-treated, mature zebrafish obtained from local pet shop is used
for egg production. The details of keeping the fish and collecting embryos were the same as
described before (Li et al. 2004; Westerfield 2007; Chan & Chan 2012; Chow et al. 2012).
The embryos were observed under a dissecting microscope to select the fertilized eggs, rinsed
with filtered water several times, and were used for the exposures by adding different
concentrations of chemical agents.
Determination of 96 H-EC50, Hatching of Zebrafish Embryos,

and 96 H-LC50 of Zebrafish Larvae
Toxicity data have been reported previously for endosulfan, heptachlor, and
methoxychlor (Chow et al. 2012). The 96 h median Effective Concentration EC50 (hatching)
and 96 h median Lethal Concentration LC50 values of chlopyrifos, aldicarb and cypermethrin
were determined according to the methods as described previously (OECD 1998; Li et al.
2004; Chan & Chan 2012; Chow et al. 2012). In brief, fertilized embryos (~2 h post-
fertilization) were exposed to the control as well as different concentrations of the test
solution with small polyethylene vials under static exposures. The hatching success was
recorded after 96 h exposure, with the 96 h median effective concentration (EC50; hatching)
values determined by the USEPA Probit Analysis Program (version 1.5), using SPSS for
Windows 17.0 (SPSS Inc., Chicago, IL, USA). Each exposure group used 20 individuals in
20 mL solution using a 50 mL container, triplicated, and was drawn from the same batch of
fertilized eggs.
Pesticide Exposure and Total RNA Preparation for Determination

of mRNA Levels of Biomarkers
Freshly fertilized embryos and 96 h post-fertilization larvae were exposed to 10%, 25%,
50% and 75% of EC50 and LC50 values respectively. A solvent control using DMSO, which
contained the corresponding solvent and filtered water was used for each exposure
experiment. All exposures were performed in a temperature-controlled room with light–dark
cycle controlled as previously described for rearing of adults (26 C with a light–dark period
of 14:10 h). Each exposure group used 10 fish in 10 mL medium, performed in triplicate,
drawn from the same batch of fertilized eggs. After exposure, every solvent control and
exposure concentration groups were separately pooled and homogenized with 1 ml of Tri-
Pure Isolation Reagent (Roche, Indianapolis, IN, USA) on ice. Total RNAs were extracted
according to the manufacturer‘s instructions and subsequently stored at -80 C.
Design of Oligonucleotide Primers for Quantitative(Q) PCR
Gene specific primers for β-actin (act), cytochrome P450 (cyp) enzymes cyp1A and
cyp3A65, multiple drug resistance 1 (mdr1), pi-class glutathione S-transferase (gst) and
catalase (cat) genes of zebrafish were designed based on the sequences published in
GeneBank (β-actin, GeneBank accession number: AF_057040; cat, GeneBank accession
number: AF_170069; cyp1A, GeneBank accession number: NM_131879; cyp3A65,
GeneBank accession number: AY_452279; mdr1, GeneBank accession number:
BQ_2845931; pi-class gst, GeneBank accession number: AB_194127)(Table 1). Using the
online tool, Real-time Primer Design Program provided by Genscript Corporation
(https://www.genscript.com/ssl-bin/app/primer), specific primers were designed to have
spanned over two exons at the intro-exon junction sites to avoid the primers binding onto the
genomic DNA sequences and amplifying contaminated DNA in the samples. The program
also checked for avoidance of hairpin formation and primer-dimer formation. The melting
temperature (Tm) of the primers ranged from 58 to 60 C and was amplified for amplicon
size ranged from 50 to 150 bp. For melting curve analysis, each sample showed a peak at its
specific dissociation temperature (data not shown). No template control (NTC) did not show
sharp peak between 50 and 90 °C, indicating no primer-dimerization or contamination.
Validation of qPCR Conditions
qPCR was carried out with Brilliant® SYBR® Green qPCR Master Mix (Applied
Biosystem) in 25 μL of reaction mixtures in the real-time machine, Chromo 4 ™ Four-Colour
Real Time System (MJ Research®). The PCR program consisted of 1 cycle of initial
denaturation at 95°C for 10 min, 40 cycles of denaturation at 95°C for 30 s, annealing at 56°C
or 58°C for 30 seconds and extension at 70°C for 30 seconds. The fluorescence was read after
the extension in each cycle. Finally, a temperature of 50-90°C with a 0.5°C increment and 1
second for each temperature was used to obtain the melting curve.
Table 1. Nucleotide sequences of zebrafish biomarker gene primers

used for qPCR in this study
Amplicon
Gene (abbreviation) Primer Nucleotide sequence (5’ to 3’)
Size
β-actin (act) Forward CGAGCAGGAGATGGGAACC 102 bp
Reverse CAACGGAAACGCTCATTGC
Catalase (cat) Forward TGAGGCTGGGTCATCAGATA 138 bp
Reverse AAAGACGGAAACAGAAGCGT
Cytochrome P450 1A (cyp1A) Forward CAACCACTGCGAAGACCG 137 bp
Reverse AGACAACCGCCCAGGACA
Cytochrome P450 3A65 Forward TCACATTCTGGTTGACAGCA 88 bp
(cyp3A65) Reverse ATCCATACTGTACGCACCGA
pi-class Glutathione S- Forward CTGAGACATCTGGGTCGAAA 92 bp
transferase (gst) Reverse AGATCTTCAACTCCGTCGTTC
Multiple Drug Resistance 1 Forward GAAAGACGGACCACCTGAA 103 bp
(mdr1) Reverse AGGTTTCTCATCTTGGCTGTAA
(a)
(b)
(c)
(d)
Figure 1. (Continued)
(e)
(f)
Figure 1. Standard curves (Panel A) and the efficiency plots of cat mRNA (B), cyp1A (C), cyp3A65
(D), gst mRNA (E) and mdr1 mRNA (F) against act mRNA. The absolute values of the slopes of the
efficiency plots for all transcripts were smaller than 0.1, which demonstrated that the efficiencies of
target and reference amplifications were approximately equal.
Efficiency plots of delta Ct (Ct) against log dilution factor were drawn. The threshold
cycle (Ct) is defined as the cycle number at which the level of fluorescence exceeded the
fixed threshold. Standard curves of Ct against log dilution factor were obtained for the
housekeeping gene actin and the target gene. The efficiency of the PCR amplification
protocol or gene-specific primers was analyzed by one cDNA sample with five serial
dilutions. All standard curves showed good linear relationships with r2 ranged from 0.95 to
0.99 (Figure1A). A correlation coefficient of greater than 0.95 indicates good primer
efficiency and shows a successful qPCR profile. The efficiencies of PCR amplification for the
target and housekeeping genes were tested and efficiency plots were obtained. The regression
slopes of the efficiency plots for CAT and GST were -0.02 and -0.03 respectively (Figure 1B-
F). The absolute values of the slopes for all were smaller than 0.1, which demonstrated that
efficiencies of target and reference amplifications were approximately equal.
Quantification of Gene Expression Levels
First-strand complementary DNA (cDNA) was synthesized from 1 μg total RNA by

reverse transcription according to the Promega standard reverse transcription protocol in 20
uL reactions. The reactions were stored at -38 C until analysis. The integrity of the first-
strand cDNA was confirmed by polymerase chain reaction (PCR) amplification of the act
gene as previously described (Chow et al. 2012). The fold induction of biomarker gene
expression in each sample was calculated by a comparative Ct threshold method (Giulietti et
al., 2001) using the following equation:
Relative fold induction of target gene mRNA = 2 (ΔCt of control - ΔCt of treated)
where ΔCt = Ct (target gene) – Ct (house-keeping gene).
The Ct of the target gene in the samples was normalized with the Ct of the housekeeping
gene by subtracting the Ct of target gene from Ct of β-actin. The relative fold induction of the
target genes in each sample was determined. Each treatment group was compared with the
control group for each biomarker gene.
Determination of Acetylcholinesterase (AChE) Activities
In addition to gene expression determination, AChE activities in the sample were also
determined. After 96 h exposure, the surviving larvae were rinsed thoroughly in filtered water
to prevent the pesticide remaining in the larvae from affecting the AChE activity. Then, they
were introduced into 2 mL microcentrifuge tubes, snapped frozen in liquid nitrogen, and
stored at – 80 °C until analysis.
Frozen samples were homogenized on ice in 0.5 ml ice-cold 0.1 M sodium phosphate
buffer containing 0.1% (v/v) Triton X-100 (pH 7.5). The homogenates were then centrifuged
at 4 °C for 15 mins at 10,000x g. The supernatants were transferred to 1.5 ml tubes and used
directly for enzyme analysis. AChE activities in the homogenates were measured using a
previously described method (Ellman et al. 1961). In this method, acetylcholine iodide was
used as the substrate, and a mixture containing DTNB and substrate was prepared by mixing
30 mL of 0.1 M phosphate buffer, 0.4 mL 0.075 M acetylcholine and 1 mL 0.01 M DTNB.
Then 50 uL of sample homogenate was mixed with 250 uL of the mixture prepared and
change of optical density with time was recorded. As a result, TNB production was recorded
at 412 nm every 30 seconds for 3 mins at room temperature with a microplate reader to
estimate substrate hydrolysis. This enzyme analysis was carried out in duplicate per sample.
To determine specific AChE activities of the zebrafish embryo-larvae, protein contents of the
enzyme extracts were measured by using the method of Bradford (1967) adapted to
microplates using bovine serum albumin (BSA) as standard. The protein content was
measured at 595 nm with the microplate reader. The protein determination was carried out in
duplicate per sample. The specific enzyme activity was expressed as μmole hydrolyzed
substrate/min/mg protein.
Data Analysis
The effects of pesticides on the mRNA levels and enzyme activities were tested with one-
way ANOVA. Tukey multiple comparison test was applied when one-way ANOVA indicated
that the effect was significant. For the graphs showing the relative mRNA levels of different
biomarkers, bar with the asterisk indicates significant difference from the control (P < 0.05)
and bars with different letters are significantly different from each other (P < 0.05). All
figures and statistical analyses were handled by using the GraphPad program PRISM 4.
RESULTS
Acute Toxicities of Chlorpyrifos, Aldicarb, and Cypermethrin
The hatching rate of zebrafish embryos decreased with increasing concentrations after 96
h exposure to chlorpyrifos, aldicarb and cypermethrin (Figure 2). Mortality of larvae
increased with increasing concentration after 96 h exposure to chlorpyrifos, aldicarb and
cypermethrin (Figure 2). The 96 h- EC50 values of chlorpyrifos, aldicarb and cypermethrin
for zebrafish embryos were 9.62 mg/L, 7.66 mg/L and 0.66 mg/L respectively and 96 h-
LC50 values of chlorpyrifos, aldicarb and cypermethrin for zebrafish larvae were 3.05 mg/L,
2.33 mg/L and 0.15 mg/L respectively (Table 2). 96 h- EC50 value of cypermethrin was
much smaller than that of aldicarb and thus cypermethrin was more toxic than aldicarb for
embryos. Similarly, 96 h- LC50 values of cypermethrin were smaller than that of aldicarb,
meaning that cypermethrin was more toxic to larvae than aldicarb.
Effects of Chlorpyrifos, Aldicarb and Cypermethrin on cat and gst Gene

Expression
Effects of OP pesticide chlorpyrifos on cat and gst mRNA levels in zebrafish embryos
and larvae are shown in Figure 3A. Exposures to chlorpyrifos increased cat mRNA in both
embryos and larvae with a significant 3.6-fold increase in larvae at 2.29 mg/L. A 6.6-fold
increase in gst mRNA was observed at 7.22 mg/L in embryos, but the induction was not
significantly different from the control. In larvae, there was a progressive increase in gst
mRNA, with a 2.3-fold increase at the highest concentration.
(a-i)
(a-ii)
(b-i)
(b-ii)
(c-i)
(c-ii)
Figure 2. Hatching rate (%) of zebrafish embryos and mortality rate (%) of larvae after 96 h exposure at
different concentrations of chlorpyrifos (A), aldicarb (B), and cypermethrin (C) with the fitted
sigmoidal dose response curve. Data are shown as means with standard deviation (±SD). (N = 3).
Table 2. The 96 h-EC50 (hatching) values determined for zebrafish embryos exposed
to chlorpyrifos, aldicarb and cypermethrin in this study
95% Confidence Limit 95% Confidence Limit

EC50 (mg/L) EC50 (uM)
Name
(mg/L) (uM)
Lower Upper Lower Upper
Chlorpyrifos 9.623 7.373 10.625 27.448 21.030 30.306
Aldicarb 7.663 7.373 10.625 40.274 38.750 55.842
Cypermethrin 0.664 0.448 0.797 1.595 1.076 1.914
Table 3. The 96 h- LC50 values determined for zebrafish larvae exposed to chlorpyrifos,
aldicarb and cypermethrin in this study
95% Confidence 95% Confidence

LC50 Limit (mg/L) LC50 Limit (uM)
Name
(mg/L) (uM)
Lower Upper Lower Upper
Chlorpyrifos 3.054 2.307 3.75 8.711 6.580 10.696
Aldicarb 2.332 1.782 2.906 12.256 9.366 15.273
Cypermethrin 0.151 0.127 0.176 0.363 0.305 0.423
The effects of aldicarb and cypermethrin on cat and gst mRNA of zebrafish embryos and
larvae are shown in Figure 3B. Exposure to aldicarb did not affect the cat and gst mRNA in
embryos, but caused a significant suppression of cat and gst transcripts in larvae (Figure 3B).
Exposure to aldicarb significantly reduced cat mRNA levels at, 0.58 mg/L, 1.17 mg/L and
1.75 mg/L was 0.46-fold, 0.32-fold and 0.49-fold, respectively in larvae. Similarly, in larvae,
gst mRNA significantly decreased 0.38-fold at 0.23 mg/L, 0.39-fold at 0.58 mg/L, 0.27-fold
at 1.17 mg/L and 0.34-fold at 1.75 mg/L, respectively.
Figure 3C shows the effects of the pyrethroid pesticide cypermethrin on cat and gst
mRNA levels. Cypermethrin progressively increased cat mRNA and 2.4-fold for embryos
and 6.1-fold for larvae at 0.50 mg/L and 0.11 mg/L respectively. As a result, no changes in
gst mRNA in larvae were detected, whereas there were 2.5-fold to 2.8-fold increases in the
gst mRNA in embryos. The NOEC values of cypermethrin for cat induction in embryos and
larvae were 0.33 mg/L and 0.08 mg/L, respectively; the corresponding LOEC values were
0.50 mg/L and 0.11 mg/L., respectively.
Effects of Chlorpyrifos and Aldicarb on AChE Activity
The specific AChE activity in zebafish embryo or larvae exposed to different

concentrations of chlorpyrifos, and aldicarb, after 96h exposure were determined. The effects
of chlorpyrifos on percentage of AChE inhibition are shown in Figure 4A. The activities were
inhibited significantly in a dose-dependent manner in both embryos and larvae. AChE activity
was significantly reduced at 4.81 mg/L in embryos and significant inhibitions occurred at all
chlorpyrifos concentrations in larvae. The maximum percentage of AChE inhibition for
embryos and larvae were 43% and 70% of the control respectively. The 96 h- IC50 value of
chlorpyrifos for larvae was 0.62 mg/L while that for embryos could not be determined.
(a-i)
(a-ii)
(b-i)
(b-ii)
(c-i)
(c-ii)
Figure 3. Relative fold induction of CAT and GST mRNA levels in zebafish embryos and larvae at
different concentrations of chlorpyrifos (A), aldicarb (B), and cypermethrin (C) after a 4-day exposure.
Data are shown as means with standard deviation (±SD). Bar with the asterisk indicates significant
difference from the control (One-way ANOVA, P < 0.05) (N = 5).
(a-i)
(a-ii)
(b-i)
(b-ii)
Figure 4. Percentage of inhibition of acetylcholinesterase (AChE) activity in zebafish embryos and

larvae exposed after 96 h to different concentrations of chlorpyrifos (A) and aldicarb (B). Data are
shown as means with standard deviation (±SD) (N = 5).
The effects of aldicarb on the percentage inhibition of AChE inhibition are shown in
Figure 4B. The AChE activities were significantly inhibited at all aldicarb concentrations
used in the experiments with embryos even at the lowest dose used. The activities also
decreased in a dose-dependent manner in larvae. The maximum percentage of AChE
inhibitions for embryos and larvae were 90% and 85% of the control, respectively. The 96 h-
IC50 value for embryos was 0.42 mg/L and that for the larvae was 0.38 mg/L.
Effects of Heptachlor, Endosulfan, and Methoxychlor on cyp1a, cyp3a

and mdr1 Gene Expression
The effects of heptachlor, endosulfan, and methoxychlor on cyp1A, cyp3A, and mdr1
gene expression of zebrafish embryos and larvae are shown in Figure 5 and 6 respectively.
Exposure to heptachlor, endosulfan, and methoxychlor did not affect the cyp1A expressions
in either embryos or larvae, and significant changes in cyp3A65 expression were not observed
in embryos exposed to heptachlor. However, 0.4-fold suppression was observed the
concentration of 1.30 mg/L in larvae. The mdr1 expression in embryos was not significantly
altered at any of the heptachlor concentrations whereas the mdr1 expression increased 2.9-
fold at 0.87 mg/L and 3.0-fold at 1.30 mg/L in larvae.
For cyp3A65, the results obtained for embryos and larvae were totally different. In
embryos, endosulfan significantly increased the expression with 4.2-fold at 3.83 mg/L; in
larvae, endosulfan with a concentration of 0.06 mg/L suppressed cyp3A65 mRNA expression
with significant changes at 0.12 mg/L and 0.18 mg/L. A 6.1-fold increase was observed
following exposure to 1.25 mg/L of methoxychlor in embryos while a 4.8-fold increase was
found at 1.19 mg/L in larvae.
(a)
(b)
(c)
Figure 5. Relative fold induction of cyp1A, cyp3A65, and mdr1 mRNA levels in zebafish embryo
exposed to different concentrations of endosulfan (A), heptachlor (B), and methoxychlor (C) for 96 h.
difference from the control. Bars with a different letter are significantly different from each other (One-
way ANOVA, P < 0.05) (N = 5).
(a)
(b)
(c)
Figure 6. Relative fold induction of cyp1A, cyp3A65 and mdr1 mRNA levels in zebrafish larvae
exposed to different concentrations of endosulfan (A), heptachlor (B), and methoxychlor (C) for 96 h.
difference from the control. Bars with a different letter are significantly different from each other (One-
way ANOVA, P < 0.05) (N = 5).
Endosulfan also reduced mdr1 mRNA expression in both embryos and larvae. The mdr1
mRNA expression decreased 0.6-fold at 0.02 mg/L, 0.5-fold at 0.06 mg/L, 0.2-fold at 0.12
mg/L, and 0.2-fold at 0.18 mg/L in larvae. In the same regard, the mRNA expression was
suppressed by 0.3-fold at both 0.79 mg/L and 1.19 mg/L in larvae exposed to methoxychlor.
DISCUSSION
One of the objectives of acute toxicity tests is to quantitatively identify acute adverse
effects, using mortality or hatching rate. For fish, hazard assessments of chemicals use
international standards (ISO) and guidelines (OECD) based on global toxicity endpoints.
OECD guidelines are based on the study of developmental life stages, such as embryo and
pro-larvae. The toxic effects of chemicals can be assessed through the analysis of various
lethal and sub-lethal endpoints, including mortality, hatching (rate and time) and pro-larval
morphology (length, weight and abnormality) (OECD 1998). In the present study, we selected
mortality and hatching rate as the toxicological endpoints to study the effects of different
pesticides on zebrafish embryos and larvae respectively.
The zebrafish larvae are more sensitive than embryos following the exposures to
pesticides (Table 2 and 3). In our previous study of OC pesticides, the 96 h EC50 values of
endosulfan, heptachlor, and methoxychlor for zebrafish embryos to hatch were determined as
5.11, 5.90, and 1.66 mg/L respectively (Chow et al. 2012). For the 96 h LC50 values of
endosulfan, heptachlor, and methoxychlor for zebrafish larvae were determined as 0.24, 1.74,
1.59 mg/L respectively (Chow et al. 2012). The slightly lower sensitivity of embryos to
pesticides might be due to the protection of egg chorion and different metabolic rates in the
developmental stages.
Cypermethrin is the most toxic pesticide as compared with the EC50 values for embryos
to hatch (0.66 mg/L) and LC50 values for larvae (0.15 mg/L) as determined for zebrafish
among the 6 pesticides tested. Previous studies also showed that cypermethrin was toxic to
aquatic invertebrates with LC50s in the range of 0.01–5 µg/L and fish with 96 h- LC50s
generally within the range of 0.4 – 2.8 μg/l (Sarkar et al. 2005, Sthephanson 1982).
Aldicarb is moderately toxic to fish. 96 h- LC50 of aldicarb in rainbow trout is 8.8 mg/L
and that in bluegill sunfish is 1.5 mg/L (Kidd & James 1991). In this study, 96 h- EC50
values of aldicarb and cypermethrin for zebrafish embryos were 7.66 mg/L and 0.66 mg/L,
respectively. The corresponding 96 h- LC50 values for zebrafish larvae were 2.33 mg/L and
0.15 mg/L, respectively.
Survival of zebrafish was significantly reduced by the high dose of chlorpyrifos (100
μg/L) during the study from 20-38 weeks of age (Levin et al. 2003). In this study, the 96 h-
EC50 values of chlorpyrifos for zebrafish embryos were 9.62 mg/L and its 96 h- LC50 value
for zebrafish larvae was 3.05 mg/L.
OP caused inhibitory effects on AChE and induced oxidative stress (Hai et al. 1997;
Yarsan et al. 1999). A 6.6-fold increase in gst mRNA was observed at 7.22 mg/L in embryos.
Increased pi-class gst mRNA in embryos may indicate the development of a defensive
mechanism to counteract the effects of chlorpyrifos and may reflect the possibility of a more
efficient protection against pesticide toxicity. GSTs also protect tissue from oxidative stress
(Fournier et al. 1992). It is known that GST works together with GPx to prevent lipid
peroxidation in fish (Steadman et al. 1991). In addition, GSTs are involved in xenobiotic
detoxification and excretion of xenobiotics and their metabolites (Jokanovic 2001). In this
study, there are 2.5-fold to 2.8-fold increase in gst mRNA in embryos after exposure to
cypermethrin. Previous studies demonstrated a significant increase (p < 0.01) in the activities
of GST in liver and kidney of adult Channa punctatus treated with another pyrethroid
pesticide, deltamethrin (Sayeed et al. 2003). Thus, the increased GST activity in zebrafish
embryos may be a defensive mechanism to counteract the oxidative effects of cypermethrin.
The present study also demonstrated oxidative stress from chlorpyrifos in zebrafish.
Chlorpyrifos increased cat mRNA in both embryos and larvae with a significant 3.6-fold
increase in larvae at 2.29 mg/L. A similar significant increase in the CAT activity in the tissue
of adult catfish was reported upon treatment with the OP pesticide, Dichlorvos (Hai et al.
1997). Increased CAT activities can be a response towards ROS generation by the pesticide
(John et al. 2001). Thus, the increased cat mRNA levels induced by chlorpyrifos in zebrafish
may indicate an elevated antioxidant status attempting to neutralize the effects of the ROS.
The No Observable Effect Concentration (NOEC) of chlorpyrifos for cat induction in larvae
was determined as 1.53 mg/L while its Lowest Observable Effect Concentration (LOEC) was
2.29 mg/L.
Our data showed that exposure to aldicarb significantly suppressed the cat mRNA in
zebrafish larvae. No information related to the effects of aldicarb on cat mRNA is available
for fish. The reduction of the cat mRNA was likely due to general toxicity caused by aldicarb.
In mice treated with aldicarb, the CAT activities were reduced after the administration of
aldicarb (Yarsan et al. 1999).
Cypermethrin caused a significant 2.4-fold and 6.1-fold increase in cat expression for
embryos and larvae, respectively. Similarly, CAT activities in the liver of tilapia and common
carp exposed to cypermethrin were increased significantly (Uner et al. 2001), but a similar
study using catfsh liver showed the decrease of CAT after exposure to alphamethrin (Tripathi
& Bandooni 2011). Therefore, the increase in cat mRNA in this study indicates that
cypermethrin may induce oxidative stress to the zebrafish embryos and larvae. The NOEC
values of aldicarb and cypermethrin for induction of cat mRNA in larvae was determined as
0.23 mg/L and 0.08 mg/L while the LOEC values were 0.58 mg/L and 0.11 mg/L,
respectively. Cypermethrin had higher potential to cause oxidative stress to larvae than other
tested pesticides.
AChE inhibition has been widely regarded as a specific biomarker of exposure to both
organophosphate (OPs) and carbamate insecticides over decades (Fulton & Key 2001; Walker
2001). Chlorpyrifos is a potent AChE inhibitor which causes developmental neurotoxicity in
zebrafish (Levin et al. 2004). Previous assays in mosquitofish muscle reported that
chlorpyrifos caused a significant inhibition of brain AChE activity after 96h exposure to
concentrations equal or higher than 6 μg/L and 50 μg/L (Rendon-von Osten et al. 2005).
AChE activity in brain and muscle of juvenile chinook salmon was significantly reduced to
15% and 8% of control, respectively after exposure to 7.3 μg/L chlorpyrifos (Eder et al.
2004).
In the present study, the AChE activities were inhibited significantly in both embryos and
larvae after chlorpyrifos exposure. Inhibition caused by chlorpyrifos involves CYP-mediated
OP metabolism in which the chlorpyrifos is converted by CYP to the active oxon form, which
inhibits esterase (Wheelock et al. 2005). Our results indicated significant AChE inhibitions in
both embryos and larvae. Young stages of fish may possess lower level of enzymes like
carboxylesterases for detoxification of anti-cholinesterase compounds, such as OP pesticides.

Low levels of carboxylesterases could potentially enhance the in vivo AChE inhibition by OP
pesticides (Li & Fan 1997).
Synonymous to OP pesticide chlorpyrifos, aldicarb also affects acetylcholinesterase
activity. AChE activities were significantly inhibited at all of aldicarb concentrations in both
embryos and larvae. The maximum percentage of AChE inhibitions for embryos and larvae
were 90% and 85% of the control respectively. 96 h-IC50 for embryos was 0.42 mg/L and
that for the larvae was 0.38 mg/L. Our results were consistent with the inhibition (a maximum
of 90% inhibition at a concentration of 9 µM) of cholinesterase by aldicarb in zebrafish
embryos after 48 h exposure (Kuster 2007).
The enzyme activity and mRNA expression of cyp1A have been used to detect exposure
to organic pollutants in fish (Andersson et al. 2007; Webster et al. 2007). In this study, the
tested OC pesticides, heptachlor, methoxychlor and endosulfan, could not induce cyp1A
mRNA expression at any of the pesticide concentrations. One of the possible explanations is
that these OC pesticides do not have structural configurations required for AhR ligands.
Similar results were obtained in other organisms, like mammals. It was reported that
methoxychlor induced CYP2B, 2C, 2E and 3A enzyme activities but not cyp1A mRNA in
rats (Li & Kupfer 1998; Oropeza-Hernandez et al. 2003).
In fish, members of the cyp2 and cyp3A families play a major role in the metabolism of
xenobiotics and endogenous compounds, including steroids (Thibaut et al. 2002). Although
some cyp3A genes have been identified in fish by cDNA cloning and immunological
techniques, little is known about their function, distribution and inducibility. For example,
exposure to p,p‘-DDE and dieldrin which are organochlorine pesticides increased the
expression of hepatic cyp3A68 in largemouth bass (Barber et al. 2007).
Methoxychlor showed PXR agonist activity in vitro and induced cyp2C11, cyp2B1 and
cyp3A1 in male rat liver (Mikamo et al. 2003). Methoxychlor has been classified as pro-
estrogen and demethylation of the methoxy groups and is required for its activation. The
demethylation of methoxychlor was catalyzed by cyp1 and cyp3A enzymes in channel catfish
(Stuchal et al. 2006). In the present study, cyp3A65 expressions were significantly increased
in both embryos and larvae after 96h exposure to methoxychlor. A significant 6.1-fold
increase at 1.25 mg/L in embryos and a significant 4.8-fold increase at 1.19 mg/L in larvae
were observed. This is in agreement with the previous study in which the mRNA expression
of cyp3A68 was increased by all methoxychlor treatments in the liver of largemouth bass
after 24h exposure (Blum et al. 2008).
Endosulfan was shown to be metabolized to a single metabolite, endosulfan sulfate, in
human liver microsomes, and its metabolism is primarily mediated by cyp2B6 and cyp3A4
(Casabar et al. 2006). In the present study, endosulfan significantly increased cyp3A65
mRNA levels by 4.2-fold in embryos. However, endosulfan and heptachlor significantly
reduced cyp3A mRNA levels in larvae. Since the mechanism of induction of cyp3A in fish by
xenobiotics like OC pesticides is still not clear, further research is needed to elucidate the
underlying mechanism responsible for these effects on cyp3A expression. Our results suggest
that cyp3A65 mRNA levels may be a useful biomarker and suggested that CYP3A might
involve in the biotransformation of methoxychlor to its more estrogenic metabolites in
zebrafish.
The multiple drug resistance gene (mdr1) is the gene which encodes P-glycoprotein
(Synold et al. 2001). An in vivo study indicated that knockout mice lacking mdr1a gene were
sensitized to the neurotoxic pesticide ivermectin (Schinkel et al. 1994). DDT and p, p‘-DDE
induced mdr1 in HepG2 cells (Shabbir et al. 2005), but another in vitro study showed that
endosulfan had high inhibitory potential towards P-glycoprotein activity (Bain & LeBlanc
1996). Our data showed that endosulfan and methoxychlor significantly suppressed mdr1
mRNA in zebrafish larvae. However, heptachlor significantly induced mdr1 mRNA
expression by 3-fold in larvae. Perhaps heptachlor and the other two OC pesticides may
function via different mechanisms on mdr1 gene expression. Further studies will be needed to
identify the regulation of mdr1 expression by different OC pesticides.
In summary, this report shows the usefullness of various biomarkers-of-effect genes, in
elucidating the sub-level toxic effects of pesticides, in addition to the hatching rate of fish
embryos and lethality of fish larvae. The inductions of mRNA levels of antioxidant enzymes
demonstrated that chlorpyrifos might have oxidative-stress-inducting potential in zebrafish.
Chlorpyrifos also inhibited AChE activities significantly in embryos and larvae after
chlorpyrifos exposure. Cypermethrin is highly toxic to zebrafish embryos and larvae, thus its
potential hazard on aquatic ecosystems should not be overlooked. Increase in mRNA of cat
and gst indicated that zebrafish embryos and larvae may have experienced oxidative stress
after cypermethrin exposure. In addition, the significant AChE inhibition by aldicarb in both
embryos and larvae demonstrates its neurotoxicity to zebrafish embryo-larvae. Study of
pesticide-induced oxidative stress as represented by the gst and cat mRNA induction and their
neurotoxic effects on fish as shown by the AChE inhibition would provide useful information
on ecotoxicological consequences of pesticides use.
As a step towards a refinement of risk assessment, we have used zebrafish embryos and
larvae for toxicity assays of pesticides by determining the hatching rate of embryos and
lethality of larvae. Several pathway specific biomarkers were utilized and indicated no
observable changes based on the concentrations of pesticides tested. The information obtained
and standard assays developed would be useful to scientists in considering the permissible
levels of pesticides in waters. Similar study could also be applied to the testing of other
chemical agents.
ACKNOWLEDGMENTS
We thank the Graduate Division of Environmental Science for the provision of a post-
graduate studentship to Wing Shan Chow and the Department of Biochemistry for its support
of this research to King Ming Chan with a high degree of academic freedom.
REFERENCES
Andersson, C., Katsiadaki, I., Lundstedt-Enkel, K. & Orberg. J. (2007). ―Effects of 17alpha-
ethynylestradiol on EROD activity, spiggin and vitellogenin in three-spined stickleback
(Gasterosteus aculeatus)‖, Aquatic Toxicology, 83, 33-42.
Atamanalp, M., Keles, M. S., Haliloglu, H. I. & Aras, M. S. (2002). ―The effects of
cypermethrin (a synthetic pyrethroid) on some biochemical parameters (Ca, P, Na and
TP) of rainbow trout (Oncorhynchus mykiss)‖, Turkish J Vet Animal Science, 26,
1157–1160.
Augustijn-Beackers, P. W. M., Hornsby, A. G. & Wauchope, R. D. (1994). ―SCS/ARS/CES
pesticide properties database for environmental decision-making II. additional
properties‖, Archives Environmental Contamination Toxicology, 137, 1-82.
Bagchi, D., Bagchi, M., Hassoun, E. A. & Stohs, S. J. (1995). ―In vitro and in vivo generation
of reactive oxygen species, DNA damages and lactate dehydrogenase leakage by selected
pesticides‖, Toxicology, 104, 129-140.
Bain, L. J. & LeBlanc, G. A. (1996). ―Interaction of structurally diverse pesticides with the
human MDR1 gene product P-glycoprotein", Toxicology Applied Pharmacology, 141,
288-298.
Barber, D. S., McNally, A. J., Garcia-Reyero, N. & Denslow, N. D. (2007). ―Exposure to
p,p'-DDE or dieldrin during the reproductive season alters hepatic CYP expression in
largemouth bass (Micropterus salmoides)", Aquatic Toxicology, 81, 27-35.
Barron, M. G. & Woodburn, K. B. (1995). ―Ecotoxicology of chlorpyrifos", Review
Environmental Contamination Toxicology, 144, 1-93.
Bradford, M. M. (1976). ―A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding", Analytical
Biochemistry, 72, 248-254.
Casabar, R. C., Wallace, A. D., Hodgson, E. & Rose, R. L. (2006). ―Metabolism of
endosulfan-alpha by human liver microsomes and its utility as a simultaneous in vitro
probe for CYP2B6 and CYP3A4", Drug Metabolism Disposition, 34, 1779-1785.
Campagna, A. F., Eler, M. N., Fracacio, R., Rodrigues, B. K. & Verani, N. F. (2007). ―The
toxic potential of aldrin and heptachlor on Danio rerio juveniles (Cypriniformes,
Cyprinidae)", Ecotoxicology, 16, 289-298.
Chan, W. K. & Chan, K. M. (2012). ―Effects of BDE-47, TBBPA and BPA on the
hypothalamic-pituitary-thyroid axis in zebrafish embryo-larvae", Aquatic Toxicology,
108, 106-111.
Chow, W. S., Chan W. K. & Chan K. M. (2012). ―Toxicities and vitellogenin gene expression
in zebrafish embryo-larvae exposed to organochlorine pesticides, tetrabrominated
bisphenol A, and bisphenol A", Journal of Applied Toxicology, 33, 670-678.
Colborn, T. (1995). ―Environmental estrogens: health implications for humans and wildlife",
Environmental Health Perspectives, 103 Suppl 7, 135-136.
Costa, L. G. (2006). ―Current issues in organophosphate toxicology", Clin Chim Acta, 366,
1-13.
Croft, B. A. (1990, Arthropod biological control agents and pesticide, Wiley, New York,
723p.
Davis, L. K., Visitacion, N., Riley, L. G., Hiramatsu, N., Sullivan, C. V., Hirano, T. & Grau,
E. G. (2009). ―Effects of o,p'-DDE, heptachlor, and 17beta-estradiol on vitellogenin gene
expression and the growth hormone/insulin-like growth factor-I axis in the tilapia,
Oreochromis mossambicus", Comparative Biochemistry & Physiology, C: Toxicology,
Pharmacology & Endocrinology, 149, 507-514.
Eder, K. J., Leutenegger, C. M., Wilson, B. W. & Werner, I. (2004). ―Molecular and cellular
biomarker responses to pesticide exposure in juvenile chinook salmon (Oncorhynchus
tshawytscha)", Marine Environmental Research, 58, 809-813.
Ellman, G. L., Courtney, K. D., Andres, V., Jr. & Feather-Stone, R. M. (1961). ―A new and
rapid colorimetric determination of acetylcholinesterase activity", Biochemical
Pharmacology, 7, 88-95.
Fournier, D., Bride, J. M., Poirie, M., Berge, J. B. & Plapp, F. W. Jr. (1992). ―Insect
glutathione S-transferases. Biochemical characteristics of the major forms from
houseflies susceptible and resistant to insecticides", Journal of Biological Chemistry,
267, 1840-1845.
Fulton, M. H. & Key, P. B. (2001). ―Acetylcholinesterase inhibition in estuarine fish and
invertebrates as an indicator of organophosphorus insecticide exposure and effects",
Environmental Toxicology & Chemistry, 20, 37-45.
Germann, U. A. & Chambers, T. C. (1998). ―Molecular analysis of the multidrug transporter,
P-glycoprotein", Cytotechnology, 27, 31-60.
Giulietti, A., Overbergh, L., Valckx, D., Decallonne, B., Bouillon, R. & Mathieu, C. (2001).
―An overview of real-time quantitative PCR: applications to quantify cytokine gene
expression", Methods, 25, 386-401.
Hai, D. Q., Varga, S. I. & Matkovics, B. (1997). ―Organophosphate effects on antioxidant
system of carp (Cyprinus carpio) and catfish (Ictalurus nebulosus)", Comparative
Biochemistry & Physiology, C: Pharmacology Toxicology & Endocrinology, 117, 83-88.
Hallare, A. V., Pagulayan, R., Lacdan, N., Kohler, H. R. & Triebskorn, R. (2005). ―Assessing
water quality in a tropical lake using biomarkers in zebrafish embryos: developmental
toxicity and stress protein responses", Environmental Monitoring & Assess, 104,
171-187.
Haya, K. (1989). ―Toxicity of pyrethroid insecticide to fish", Environmental Toxicology &
Chemistry, 8, 381-391.
Hayes, J. D. & Pulford, D. J. (1995). ―The glutathione S-transferase supergene family:
regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and
drug resistance", Critical Review Biochemistry & Molecular Biology, 30, 445-600.
Hill, A. J., Teraoka, H. & Heideman, W. (2005). ―Zebrafish as a model vertebrate for
investigating chemical toxicity", Toxicological Sciences, 86, 6-19.
John, S., Kale, M., Rathore, N. & Bhatnagar, D. (2001). ―Protective effect of vitamin E in
dimethoate and malathion induced oxidative stress in rat erythrocytes", Journal of
Nutritional Biochemistry, 12, 500-504.
Johnson, W. W. & Finley, M. T. (1980, Handbook of Acute Toxicity of Chemicals to Fish and
Aquatic Invertebrates, Resource Publication 137, U.S. Department of Interior, Fish and
Wildlife Service, Washington, DC, 6-56.
Jonsson, C. M. & Toledo, M. C. F. (1993). ―Bioaccumulation and elimination of endosulfan
in the fish yellow tetra (Hyphessobrycon bifasciatus)", Bulletin Environmental
Contamination & Toxicology, 50, 572–577.
Jokanovic, M. (2001). ―Biotransformation of organophosphorus compounds", Toxicology,
166, 139-160.
Kidd, H. & James, D. R. (1991. The Agrichemicals Handbook, Third Edition. Royal Society
of Chemistry Information Services, Cambridge, UK, 3-11.
Kuster, E. & Altenburger, R. (2007). ―Sub-organismic and organismic effects of aldicarb and
its metabolite aldicarb-sulfoxide to the zebrafish embryo (Danio rerio)", Chemosphere,
68, 751-760.
Levin, E. D., Chrysanthis, E., Yacisin, K. & Linney, E. (2003). ―Chlorpyrifos exposure of
developing zebrafish: effects on survival and long-term effects on response latency and
spatial discrimination", Neurotoxicology & Teratology, 25, 51-57.
Levin, E. D., Swain, H.A., Donerly, S. & Linney, E. (2004). ―Developmental chlorpyrifos
effects on hatchling zebrafish swimming behavior", Neurotoxicology & Teratology, 26,
719-723.
Li, H. C. & Kupfer, D. (1998). ―Mechanism of induction of rat hepatic CYP2B and 3A by the
pesticide methoxychlor", Journal of Biochemical & Molecular Toxicology, 12, 315-323.
Li, S. N. & Fan, D. F. (1997). ―Activity of esterases from different tissues of freshwater fish
and responses of their isoenzymes to inhibitors", Journal of Toxicology & Environmental
Health, 51, 149-157.
Li, W. H., Chan, P. C. & Chan, K. M. (2004). ―Metal uptake in zebrafish embryos exposed to
metal contaminated sediments", Marine Environmental Research, 58, 829–832.
Livingstone, D. R. (1998). ―The fate of organic xenobiotics in aquatic ecosystems:
quantitative and qualitative differences in biotransformation by invertebrates and fish",
Comparative Biochemistry & Physiology, A: Molecular & Integrative Physiology, 120,
43-49.
Livingstone, D. R. (2001). ―Contaminant-stimulated reactive oxygen species production and
oxidative damage in aquatic organisms", Marine Pollution Bulletin, 42, 656-666.
Livingstone, D. R., Lemaire, P., Matthews, A., Peters, L., Bucke, D. & Law, R. J. (1993).
―Pro-oxidant, antioxidant and 7-ethoxyresorufin O-deethylase (EROD) activity responses
in liver of dab (Limanda limanda) exposed to sediment contaminated with hydrocarbons
and other chemicals", Marine Pollution Bulletin, 26, 602-606.
McGrath, P. & Li, C.-Q. (2008). ―Zebrafish: a predictive model for assessing drug-induced
toxicity", Drug Discovery Today, 13, 9-10.
Mikamo, E., Harada, S., Nishikawa, J. & Nishihara, T. (2003). ―Endocrine disruptors induce
cytochrome P450 by affecting transcriptional regulation via pregnane X receptor",
Toxicology & Applied Pharmacology, 193, 66-72.
Moore, D. R., Thompson, R. P., Rodney, S., Fisher, D., Ramanarayanan, T. & Hall, T.
(2009). ―Refined aquatic risk assessment for aldicarb in the United States", Integrative
Environmental Assessment & Management, 4, 56-64.
Moore, D. R., Thompson, R. P., Rodney, S. I., Fisher, D., Ramanarayanan, T. & Hall, T.
(2010). ―Refined aquatic risk assessment for aldicarb in the United States", Integrative
Environmental Assessment & Management, 6, 102-118.
Nelson, D. R., Koymans, L., Kamataki, T., Stegeman, J. J., Feyereisen, R., Waxman, D. J.,
Waterman, M. R., Gotoh, O., Coon, M. J., Estabrook, R. W., Gunsalus, I. C. & Nebert, D.
W. (1996). ―P450 superfamily: update on new sequences, gene mapping, accession
numbers and nomenclature", Pharmacogenetics, 6, 1-42.
OECD. (1998). Fish, Short-term Toxicity test on Embryo and Sac-fry Stages (Guideline 212).
p. 9.
Ogwok, P., Muyonga, J. H. & Sserunjogi, M. L. (2009). ―Pesticide residues and heavy metals
in Lake Victoria Nile perch, Lates niloticus", belly flap oil, Bulletin Environmental
Contamination & Toxicology, 82, 529-533.
Oropeza-Hernandez, L. F., Lopez-Romero, R. & Albores, A. (2003). ―Hepatic CYP1A, 2B,

2C, 2E and 3A regulation by methoxychlor in male and female rats", Toxicological
Letter, 144, 93-103.
Pavlov, D. D., Chuiko, G. M., Gerassimov, Y. V. & Tonkopiy, V. D. (1992). ―Feeding
behavior and brain acetylcholinesterase activity in bream (Abramis brama L.) as affected
by DDVP, an organophosphorus insecticide", Comparative Biochemistry & Physiology,
C: Toxicology, Pharmacology & Endocrinology, 103, 563-568.
Perkins, E. J., El-Alfy A. & Schlenk, D. (1999). ―In vitro sulfoxidation of aldicarb by hepatic
microsomes of channel catfish, Ictalurus punctatus", Toxicological Science, 48, 67-73.
Perkins, E. J. & Schlenk, D. (2000). ―In vivo acetylcholinesterase inhibition, metabolism, and
toxicokinetics of aldicarb in channel catfish: role of biotransformation in acute toxicity",
Toxicological Science, 53, 308-315.
Phillips, T. A., Wu, J., Summerfelt, R. C. & Atchison, G. J. (2002). ―Acute toxicity and
cholinesterase inhibition in larval and early juvenile walleye exposed to chlorpyrifos",
Reddy, A. T. & Yellamma, K. (1991). ―Perturbations in carbohydrate metabolism during
cypermethrin toxicity in fish, Tilapia mossambica", Biochemical International, 23,
633-638.
Rendon-von Osten, J., Ortiz-Arana, A., Guilhermino, L. & Soares, A. M. (2005). ―In vivo
evaluation of three biomarkers in the mosquitofish (Gambusia yucatana) exposed to
pesticides", Chemosphere, 58, 627-636.
Sarkar, B., Chatterjee, A., Adhikari, S. & Ayyappan, S. (2005). ―Carbofuran- and
cypermethrin-induced histopathological alterations in the liver of Labeo rohita
(Hamilton) and its recovery", Journal of Applied Ichthyology, 21, 131-135.
Sayeed, I., Parvez, S., Pandey, S., Bin-Hafeez, B., Haque, R., Raisuddin, S. (2003).
―Oxidative stress biomarkers of exposure to deltamethrin in freshwater fish", Channa
punctatus Bloch, Ecotoxicology & Environmental Safety, 56, 295-301.
Schinkel, A. H., Smit, J. J. M., van Tellingen, O., Beijnen, J. H., Wagenaar, E., van Deemter,
L., Mol, C. A. A. M., van der Valk, M. A., Robanus-Maandag, E. C., te Riele, H. P. J.,
Berns, A. J. M. & Borst, P. (1994). ―Disruption of the mouse mdr1a P-glycoprotein gene
leads to a deficiency in the blood-brain barrier and to increased sensitivity to drugs", Cell,
77, 491-502.
Scholz, S., Fischer, S., Gundel, U., Kuster, E., Luckenbach, T. & Voelker, D. (2008). ―The
zebrafish embryo model in environmental risk assessment--applications beyond acute
toxicity testing", Environmental Science & Pollution Research International, 15,
394-404.
Shabbir, A., DiStasio, S., Zhao, J., Cardozo, C. P., Wolff, M. S. & Caplan, A. J. (2005).
―Differential effects of the organochlorine pesticide DDT and its metabolite p,p'-DDE on
p-glycoprotein activity and expression", Toxicology & Applied Pharmacology, 203,
91-98.
Sharma, C. M., Rosseland, B. O., Almvik, M. & Eklo, O. M. (2009). ―Bioaccumulation of
organochlorine in the fish community in Lake Arungen, Norway", Environmental
Pollution, 157, 2452-2458.
Sheahan, D. A., Brighty, G. C., Daniel, M., Jobling, S., Harries, J. E., Hurst, M. R., Kennedy,
J., Kirby, S.J., Morris, S., Routledge, E. J., Sumpter, J. P. & Waldock, M. J. (2002).
―Reduction in the estrogenic activity of a treated sewage effluent discharge to an English
river as a result of a decrease in the concentration of industrially derived surfactants",

Steadman, B. L., Stubblefield, W. A., Lapoint, T. W. & Bergman, H. L. (1991). ―Decreased
survival of rainbow trout exposed to no. 2 fuel oil caused by sublethal pre-exposure",
Sthephanson, R. R. (1982). ―Aquatic toxicology of cypermethrin (I): acute toxicity to some
freshwater fish and invertebrates in laboratory tests", Aquatic Toxicology, 2, 175-185.
Stuchal, L. D., Kleinow, K. M., Stegeman, J. & James, M. O. (2006). ―Demethylation of the
pesticide methoxychlor in liver and intestine from untreated, methoxychlor-treated, and
3-methylcholanthrene-reated channel catfish (Ictalurus punctatus): evidence for roles of
cyp1 and cyp3A family isozymes", Drug Metabolism & Disposition, 34, 932-938.
Suzuki, T., Takagi, Y., Osanai, H., Li, L., Takeuchi, M., Katoh, Y., Kobayashi, M. &
Yamamoto, M. (2005). ―Pi class glutathione S-transferase genes are regulated by Nrf 2
through an evolutionarily conserved regulatory element in zebrafish", Biochemical
Journal, 388, 65-73.
Synold, T. W., Dussault, I. & Forman, B. M. (2001). ―The orphan nuclear receptor SXR
coordinately regulates drug metabolism and efflux", Nature Medicine, 7, 584–590.
Tripathi, G. & Bandooni, N. (2011). ―Impact of alphamethrin on antioxidant defense
(catalase) and protein profile of a catfish", Environmentalist, 31, 54-58.
Thibaut, R., Debrauwer, L., Perdu, E., Goksoyr, A., Cravedi, J. P. & Arukwe, A. (2002).
―Regio-specific hydroxylation of nonylphenol and the involvement of CYP2K- and
CYP2M-like iso-enzymes in Atlantic salmon (Salmo salar)", Aquatic Toxicology, 56,
177-190.
Tseng, H. P., Hseu, T. H., Buhler, D. R., Wang, W. D. & Hu, C. H. (2005). ―Constitutive and
xenobiotics-induced expression of a novel CYP3A gene from zebrafish larva",
Toxicology & Applied Pharmacology, 205, 247-258.
Uner, N., Oruc, E. O., Canli, M. & Sevgiler, Y. (2001). ―Effects of cypermethrin on
antioxidant enzyme activities and lipid peroxidation in liver and kidney of the freshwater
fish, Oreochromis niloticus and Cyprinus carpio (L.)", Bulletin Environmental
Contamination & Toxicology, 67, 657-664.
USEPA. (2002). Chlopyrifos Facts, EPA 738-F-01-006.
Versonnen, B. J., Roose, P., Monteyne, E. M. & Janssen, C.R. (2004). ―Estrogenic and toxic
effects of methoxychlor on zebrafish (Danio rerio)", Environmental Toxicology &
Chemistry, 23, 2194-2201.
Walker, C. H., Hopkin, S. P., Sibly, R. M. & Peakall, D. B. (2001). Principles of
Ecotoxicology, 2nd edition. Taylor and Francis, London.
Webster, L., Russell, M., Phillips, L., McIntosh, A., Walsham, P., Packer, G., Dalgarno, E.,
McKenzie, M. & Moffat, C. (2007). ―Measurement of organic contaminants and
biological effects in Scottish waters between 1999 and 2005", Journal of Environmental
Monitoring, 9, 616-629.
Westerfield, M. (2007). The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish
(Danio rerio). University of Oregon Press, Eugene, OR, USA.
Wheelock, C. E., Eder, K. J., Werner, I., Huang, H., Jones, P. D., Brammell, B. F., Elskus, A.
A. & Hammock, B. D. (2005). ―Individual variability in esterase activity and CYP1A
levels in Chinook salmon (Oncorhynchus tshawytscha) exposed to esfenvalerate and
chlorpyrifos", Aquatic Toxicology, 74, 172-192.
Winston, G. W. & Di, G. R. T. (1991). ―Pro-oxidant and antioxidant mechanisms in aquatic

organisms", Aquatic Toxicology, 19, 137-161.
Yarsan, E., Tanyuksel, M., Celik, S. & Aydin, A. (1999). ―Effects of aldicarb and malathion
on lipid peroxidation", Bulletin Environmental Contamination & Toxicology, 63,
575-581.
Yu, S. J. (2008). The Toxicology and Biochemistry of Insecticides. CRC Press Taylor &
Francis Group, 276p.
Zhang, Z., Hong, H., Wang, X., Lin, J., Chen, W. & Xu, L. (2002). ―Determination and load
of organophosphorus and organochlorine pesticides at water from Jiulong River Estuary,
China", Marine Pollution Bulletin, 45, 397-402.
INDEX
antisense oligonucleotide (morpholino), 40, 68, 85,

# 88, 213
antisense oligonucleotides, 40, 85, 88, 213
17α, 20β-dihydroxy-4-pregnen-3-one (17,20β-DHP),
A-P axis, 179, 189, 190, 191, 203
111
apoferritin, 44
17-, 20- dihydroxyprogesterone (DHP), 39, 40 apoptosis, 4, 13, 41, 73, 78, 89, 104, 122, 129, 131,
20β-hydroxysteroid dehydrogenase, 111 227, 228, 240
β-actin (act), 108, 109, 110, 111, 269, 270, 273 argonaute protein, 8
4D9 antibody, 141, 149 Argonaute protein, 76, 79
6-dimethylaminopurine, 42, 60 aromatase inhibitor AI (fadrozole), 118
8-bit grayscale, 43, 46, 47 Artemia, 17, 129
8-bit image, 20 aster microtubules, 67
96 h median Lethal Concentration (LC50), 265, 268 asynchronous ovulators, 17
96 hour(h) median Effective Concentration (EC50), ATP-binding cassette (ABC), 267
265 atretic follicles, 22, 23
axonal growth, 227, 235, 236
A
B
A4.1025 antibody, 140, 147
AC15 monoclonal antibody, 158
Balbiani body, vii, 65, 68, 69, 70, 71, 72, 73, 74, 77,
acetylcholine (ACh), 228, 229, 249, 273
82, 84, 88, 92, 96, 98, 100
acetylcholinesterase (AChE), 249, 265, 266, 281, BDE-47, 267, 288
286, 289, 291 bioinformatics analysis, 221
actin, 57, 58, 59, 60, 61, 70, 96, 110, 137, 142, 153, biomarker of effects, 267
156, 158, 161, 166, 167, 170, 173, 175, 269, 272 Biomarkers, 176, 269
activin, 129, 131 biotransformation, 113, 267, 286, 290, 291
Adipocytes, 5 Birefringence, 161
Affymetrix zebrafish genome arrays, 44 bisphenol A, 216, 222, 223, 250, 259, 261, 267, 288
albumin, 15, 29 blastodisc, 39, 40, 48, 49, 56, 58, 59, 60, 71
aldicarb, viii, 265, 266, 268, 274, 276, 277, 279, 281, blastodisc formation, 39, 40, 49, 56, 58, 59, 60
284, 285, 286, 287, 290, 291, 293 blastomeres, 66, 67, 97, 142, 143
Alexa Fluor-488, 141 blood-brain barrier, 227, 228, 291
amplicon, 269 blue dextran, 44
Amquel, 125 BMP-15, 129, 131
anterior-posterior axis, 5, 179 bovine serum albumin, 19, 28, 29, 44, 274
antibodies, vii, viii, 52, 55, 82, 135, 136, 138, 140, bovine serum albumin (BSA), 19, 28, 29, 44, 274
141, 147, 148, 150, 151, 153, 156, 158, 166, 174, brain development, viii, 215, 217, 219, 220, 226,
175 227, 239, 241, 245, 246, 247, 262
296 Index
Bucky ball, 65, 69, 70, 92, 94, 96, 100 cytochrome P450 aromatase (P450arom), 111, 118
cytoskeleton, 56, 58, 59, 61, 63, 153
C
D
calyculin, 39, 40, 43, 51, 60, 62, 63
cantharidin, 39, 40, 43 Danio rerio, v, 13, 15, 16, 17, 36, 37, 39, 40, 42, 60,
carboxylesterases, 286 61, 103, 120, 123, 124, 130, 131, 136, 153, 154,
cardiac myopathy, 155, 173 156, 176, 177, 181, 212, 222, 231, 239, 240, 241,
catalase (cat), 265, 267, 269, 292 242, 246, 259, 260, 263, 264, 288, 290, 292
catalase (CAT), 265, 267, 269, 292 DAPI, 158
cathepsins, 57, 59 days post fertilization (dpf), 5, 7, 8, 9, 10, 11, 85,
Cdc2 kinase, 41, 58 146, 155, 156, 216
Centers for Disease Control and Prevention, 205, Dazl, 65, 75, 77, 78, 79, 81, 87, 88, 91, 92, 100
226, 239 dead elvis, vii, 155, 156, 173
central nervous system (CNS), 96, 203, 225, 239, Dead End, 65, 75, 77, 78, 79, 81, 89, 90, 91, 93
242, 263 Dead End ATPase, 91
centrosome, 67 DEAD-box motif, 80
channel catfish, 286, 291, 292 Deleted in AZoospermia, 87
chinook salmon, 285, 289 deltamethrin, 285, 291
chlorpyrifos, viii, 252, 262, 263, 265, 266, 268, 274, dermatome, 136
276, 277, 279, 281, 284, 285, 286, 287, 288, 290, desmin, 158, 167, 168, 173, 175
291, 292 development, vii, viii, 3, 4, 6, 8, 12, 15, 16, 17, 32,
chorion, 139, 142, 143, 161, 219, 232, 247, 252, 262 33, 34, 35, 36, 40, 42, 59, 61, 62, 65, 66, 68, 69,
chromatin, 62, 75, 94, 228 71, 72, 73, 74, 76, 78, 81, 82, 83, 85, 88, 89, 91,
chromatin condensation, 75 93, 94, 95, 96, 97, 98, 99, 101, 102, 103, 104,
chronic kidney disease, 180, 182, 205 105, 107, 108, 109, 113, 116, 117, 118, 120, 130,
cleavage furrows, 66, 67, 70, 71, 72, 82, 84, 88, 89 131, 135,136, 138, 142, 143, 144, 147, 151, 153,
clutch size, 123, 126, 127, 128 156, 157, 160, 174, 176, 179, 181, 182, 183, 185,
cognitive function, 227, 231 186, 187, 188, 190, 191, 193, 194, 195, 196, 197,
Complementation anaylsis, 155 198, 199, 201, 203, 204, 205, 206, 209, 210, 211,
Computer Aided Screening (CAS), 42 212, 213, 215, 217, 221, 222, 223, 225, 226, 229,
Computer assisted meiotic maturation assay 230, 231, 232, 233, 234, 235, 236, 237, 238, 239,
(CAMMA), 40 242, 245, 246, 247, 249, 250, 251, 252, 253, 255,
Computer-aided larval motility screening (CALMS), 256, 257, 258, 259, 261, 262, 263, 264, 284
160 Developmental Studies Hybridoma Bank, 140, 141,
computer-aided motility screens, 157 158
Computer-aided screening (CAS), 160 Developmental toxicology, 216
Confocal microscopy, 141 diarrhetic seafood poisoning, 41
congenital nephrotic syndrome, 180, 185, 209 Dicer, 76
Coomassie blue, 45, 50, 57 dichlorodiphenyltrichloroethane (DDT), 266
cortical granules, 69, 74 Dichlorvos, 285
Cox2A, 129 dieldrin, 286, 288
CRISPR-Cas, viii, 179, 199, 200, 201, 202, 208 diethylstilbestrol (DES), 113
CT3 antibody, 140 dimethyl sulfoxide (DMSO), 268
cyclic AMP, 40 dinoflagellates, 41
cyclin B, 40, 57, 60, 61, 111 distal convoluted tubule, 180, 185
cyclinB, 86 DNA methylation, 79, 84, 99, 231
cyp19a1a, 8 dopamine, 201, 228, 229, 255
cypermethrin, viii, 265, 267, 268, 274, 276, 277, Drosha, 76
279, 284, 285, 287, 288, 291, 292 Drosophila, 8, 35, 66, 73, 75, 78, 79, 80, 81, 82, 83,
cytochalasin B, 56, 60 84, 86, 87, 88, 89, 91, 93, 94, 95, 96, 97, 98, 99,
cytochrome P450 (CYP), 111, 118, 265, 267, 269, 100, 101, 102, 103, 104, 198, 206, 208
290
Index 297
E G
EB165 antibody, 140, 149 GABAergic, 233, 235, 237, 240, 242, 243
EDCs, vii, 107, 108, 113, 115, 117, 119, 122, 216, gametes, 3, 8, 68, 75, 76, 87, 97, 100, 201
217 gastrulation, 67, 68, 71, 89, 92, 101, 190
edema, 155, 157, 160, 161, 165, 166, 173, 185, 191, GDF-9, 129
196, 234 gene expression, viii, 4, 8, 12, 56, 77, 112, 124, 172,
Efficiency plots of delta Ct (Ct), 272 185, 188, 190, 191, 192, 194, 195, 198, 202, 203,
EGFP, 17, 24, 26, 27, 28, 33, 34, 35, 108, 109, 110, 213, 230, 234, 235, 236, 237, 241, 265, 266, 267,
111, 221 273, 281, 287, 288, 289
egg chorion, 16, 284 GeneBank, 269
embryo counts, 123 genetic mapping, 156
Encephalopathy, 226 Germ granule, 65
endocrine disrupting chemicals, vii, 116, 216 Germ plasm, 65, 72, 95
endocrine-disrupting chemicals, vii, 35, 113, 114, germinal vesicle, 39, 40, 42, 49, 56, 60, 62, 75, 108,
115, 122 111, 112, 113
endogenous hormones, 216 germinal vesicle breakdown, GVBD, 75, 112
endo-lysosome vesicles, 34 germinal vesicle migration (GVM), 39, 49
endosulfan, viii, 265, 266, 268, 281, 282, 283, 284, gill filaments, 266
286, 287, 288, 289 Girth, 5, 6, 10
end-stage renal disease, 180, 185 Glial cells, 228
environmental pollutants, 216 glutathione S-transferase (GST), 265, 267, 269, 289,
environmental toxicity, 217 292
epiboly, 71, 103, 215, 219 Golgi, 228
Epigenetic, 102, 231 gonad anlage, 68, 82, 85
epithelial cells, 16, 17, 34, 196, 208 gonadotropin-releasing hormone, 9
estradiol, 4, 37, 111, 288 gonadotropins, 12, 108
Estradiol, 36 gonads, 3, 4, 73, 81, 86, 91, 118, 120, 122
ethynyl estradiol, 113 gonosomatic index, 129
ex utero, 225 granulito, 72, 82
excitotoxicity, 227, 228 granulosa cells, 111, 122
exocrine cells, 220, 221 GraphPad program PRISM 4, 274
extraembryonic ectoderm, 75 green fluorescent protein, 17
extraembryonic mesoderm, 75, 96 growth hormone, 8, 12, 288
F H
F59 antibody, 140, 158, 167, 168 hairpin formation, 269

fatty acid binding protein2 (fabp2), 220 heptachlor, viii, 265, 266, 268, 281, 282, 283, 284,
fertilization, 3, 6, 16, 56, 60, 61, 62, 65, 66, 69, 75, 286, 287, 288
77, 108, 114, 115, 116, 119, 136, 142, 144, 145, Heterozygotes, 157
146, 147, 148, 149, 150, 181, 215, 217, 225, 247, hippocampus, 229, 230, 233, 239, 241, 250
251, 257, 269 histone H1, 41
FITC filter set, 17 histone modification, 79
FITC-casein, 18, 19, 20, 30, 34 HNF1β, 179, 189, 191, 192, 205, 210
FITC-lectin, 18, 19, 20, 30, 34 homogenate, 43, 45, 159, 274
Fluorescence microscopy, 18 homologs, 75, 78, 80, 84, 86, 87, 156, 185, 203
follicle cells, 16, 73, 111, 114 homology, 83, 87, 89, 90, 180, 197, 225, 232, 233
follicle-stimulating hormone, 8 hours post fertilization (hpf), 82, 85, 142, 143, 155,
functional mechanisms, 227 160, 180, 188, 216, 218, 234, 236
hydrogen peroxide, 267
298 Index
I M
IACUC protocol, 5, 17, 42, 124, 138 macro scheduler program, 42

IACUC protocols, 42, 124, 138 macula densa, 180, 186
ImageJ, 5, 10, 19, 20, 21, 22, 23, 24, 25, 43, 47, 48, Magellan, 70
157 male dominance, 129, 131
imageJ software, 123 Mate selection, 129
Immunofluorescence, 156 maternal-effect, 67, 81, 93, 101, 102
immunohistochemistry, viii, 139, 143, 156, 158, 166, maternal-zygotic transition (MZT), 67, 76, 102
167, 168, 169, 170, 171, 172, 174 maturation-promoting factor (MPF), 60, 63, 111, 122
in vitro, vii, 19, 28, 33, 36, 40, 44, 46, 53, 61, 62, 80, mCherry, 18, 19, 20, 30, 34, 221
86, 108, 112, 113, 115, 116, 119, 120, 121, 152, Meckel syndrome, 180, 186, 213
159, 200, 227, 228, 237, 238, 242, 286, 287, 288 meiosis, 40, 56, 61, 62, 73, 74, 78, 87, 95, 97, 112
in vivo, vii, 3, 4, 5, 13, 16, 31, 83, 107, 108, 110, meiotic maturation, 16, 41, 49, 51, 61, 63, 103, 113,
115, 116, 117, 120, 152, 194, 200, 202, 215, 217, 120, 121, 122
221, 227, 232, 237, 238, 239, 240, 242, 258, 286, meiotic spindle, 40, 57, 95
287, 288 melanophores, 4
in vivo assay, 107, 115 Melatonin, 129, 130
intermediate filament protein, 158, 167 membrane-associated progestin receptor (mPR), 40
intermediate mesoderm, 180, 183, 187, 189 mesenchymal-to-epithelial transition, 180, 188
international standards (ISO), 284 metal, viii, 95, 225, 226, 241, 242, 290
intro-exon junction, 269 metallothionein-2, 234
iridiophores, 4 metaphase/anaphase transition, 40
Iridophores, 109 methanol wash, 139
irx3b, 179, 189, 191, 192, 203, 211, 213 methoxychlor, viii, 113, 121, 265, 266, 268, 281,
282, 283, 284, 286, 287, 290, 291, 292
methylene blue, 18, 139
K METRO for messenger transport organizer, 70
MF20 antibody, 141, 150
Kepon, 113
Microarray, 39, 43, 44, 51, 53, 159, 172, 173
Kisspeptin, 4
Microarray analysis, 44, 159, 173
Knockdown, 68, 194, 211, 232
microarrays, 159, 172, 215, 231, 232
Microphthalmia-Associated Transcription Factor, 4
L micropyle, 40, 57
microRNAs (miRNAs), 76, 96, 97
lamins, 41 microtubule actin crosslinking factor 1 (macf1), 70
largemouth bass, 286, 288 mitochondria, 68, 70, 136
lead, viii, 34, 79, 103, 157, 174, 182, 185, 194, 196, mitogen-activated protein kinase (MAPK), 41, 61,
202, 204, 217, 225, 226, 228, 229, 230, 234, 236, 62
238, 239, 240, 241, 242, 243, 246 M-line, 137
lipovitellin, 16, 33, 34, 40 molecular markers, 9, 219
liver, 4, 16, 36, 127, 129, 220, 221, 222, 260, 285, molecular mechanisms, viii, 40, 107, 108, 177, 225,
286, 288, 290, 291, 292 227, 230, 231, 238
liver microsomes, 286, 288 monsoon season, 126
Lowest Observable Effect Concentration (LOEC), morpholino, 4, 68, 71, 76, 83, 89, 91, 179, 190, 192,
285 194, 195, 196, 198, 199, 204, 206, 210, 213, 223,
luteinizing hormone, 8, 111, 114 232
luteinizing hormone (LH), 8, 111, 114 Morpholino, 194, 196, 212, 260
lysosomes, 16 morphological, 9, 40, 56, 68, 108, 112, 179, 188,
194, 196, 225, 232, 234, 238, 246, 247, 249, 251,
254, 257
motoneuronal axons, 158, 171, 172, 174
Index 299
mouse, 42, 56, 59, 61, 62, 63, 75, 81, 84, 88, 89, 90, okadaic acid, vii, 39, 40, 43, 46, 47, 48, 49, 50, 59,
92, 93, 94, 95, 96, 99, 100, 102, 103, 104, 141, 60, 61, 62, 63
143, 158, 177, 185, 187, 209, 211, 217, 240, 241, Oligodendrocytes, 228
291 Olympus FluoView FV1000 microscope, 141
multiciliated cell, 180, 186, 209 one-way ANOVA, 274
muscle development, 136, 138, 150, 151, 152, 156 Oocyte, v, 12, 13, 36, 39, 46, 48, 50, 51, 52, 57, 62,
muscular dystrophy, 154, 156, 177 63, 65, 71, 96, 102, 104, 107, 108, 111, 114, 115
musculoskeletal diseases, 156 oocyte endocytosis, 15
Mutagenesis, 175, 176, 210 oocyte maturation, vii, 39, 40, 42, 48, 49, 53, 56, 57,
myofibril, 137, 138, 147, 149, 152, 167, 170, 172, 58, 60, 61, 62, 63, 65, 93, 107, 108, 111, 112,
176 113, 114, 115, 116, 117, 119, 120, 121, 122, 124
Myofibrils, 136 oogenesis, 9, 16, 35, 37, 66, 68, 69, 71, 73, 74, 76,
Myogenesis, v, 135, 175 83, 87, 92, 94, 97, 98, 100, 109, 119, 121, 130
myomesin, 137 Oogenesis, 15, 16, 36, 37, 60, 73, 218
myosin, 54, 137, 140, 141, 142, 146, 147, 149, 150, oogonial stem cell, 73, 74, 82, 86
151, 152, 153, 156, 158, 167, 172, 173, 175 ooplasmic clearing, 39
myotome, 136, 155, 157, 161, 173 Organochlorine (OC), 266
myotome defects, 155, 161 Organogenesis, viii, 220
Oskar/TDRD5/TDRD7 Helix Turn Helix, 80, 91
Otic, 145
N Outcrossing, 126
ovarian cycle, 15, 124
Na+-K+-2Cl- co-transporter type 1 (NKCC1), 143
ovarian follicle, vii, 3, 5, 6, 9, 10, 12, 15, 16, 17, 19,
Nacre, 4
21, 22, 23, 24, 25, 26, 27, 28, 30, 31, 33, 34, 35,
nanos, 8, 79, 84, 86, 91, 92, 94, 96, 97, 98, 103, 129
39, 40, 56, 59, 99, 111, 121, 129
nanos 1, 129
ovary, 4, 5, 8, 12, 13, 16, 18, 20, 22, 23, 24, 25, 39,
NANOS2/CCR4-NOT complex, 86
42, 44, 51, 52, 53, 54, 55, 73, 77, 78, 81, 82, 85,
Nanos3, 65, 85, 86, 91, 93
86, 94, 95, 97, 99, 100, 104, 110, 116, 117, 118,
nebel, 67, 101
124, 127, 129, 130, 131
nephrogenesis, 179, 182, 183, 184, 186, 188, 189,
oviposition, 16, 33, 123, 129
192, 197, 198, 203, 206, 209, 210, 213
Oviposition, 131
N-ethyl N-nitrosourea (ENU), 155
ovulation, 16, 75, 107, 108, 109, 111, 114, 115, 116,
neurobehavioral toxicology, 232
117, 119, 120, 121, 122
neuronal differentiation, 227
Ovulation, 114, 115
neurotoxicity, viii, 225, 227, 228, 229, 231, 233,
oxidative stress, 237, 243, 267, 284, 285, 287, 289
235, 236, 237, 238, 239, 240, 242, 250, 252, 263,
266, 268, 285, 287
neurotransmitter, 154, 229, 230, 235, 237, 249 P
neurotrophic, 235
next generation sequencing, 216, 221 P granules, 66, 101, 102
Nile perch, 266, 290 p,p‘-DDE, 286
nitrocellulose, 44, 45, 55 pancreas, 190, 211, 220, 221, 222
NKCC1 antibody, 141, 158 paraformaldehyde, 216, 219
No Observable Effect Concentration (NOEC), 285 Paraformaldehyde, 139
non-motility, 155, 166 Pb, vi, 225, 226, 227, 228, 229, 230, 231, 234, 235,
non-target species, 266 236, 237, 238, 239, 242, 243
nuage, 66, 73, 75, 82, 91, 95, 99 Pb exposure, 225, 226, 228, 229, 230, 231, 234, 235,
nucleoplasmin, 75 236, 237, 238, 239
pentachlorophenol (PCP), 113, 120, 121, 222
Percutaneous, 226, 242
O perfluorooctanesulfonic acid, 216
peripheral nervous system, 233
o,p-DDD, 113
Pesticides, vi, 120, 249, 260, 265, 266
OECD guidelines, 284
P-glycoproteins (p-gps), 267, 268
300 Index
pharyngeal muscles, 136 retinoid X receptor, 180, 188

phenylthiourea, 216 reverse transcription, 273
phoslactomycins, 57, 63 Rhodamine filter set, 17
Phosphate Buffered Saline, 139 ribonucleoprotein (RNP), 65, 89
phospholipoglycoprotein, 16 ribosomal subunit, 83
phosvitin, 16, 33, 34 RNA binding protein, 65, 69, 73, 74, 76, 77, 78, 79,
pikuw2, 155, 158, 165, 166, 173 80, 81, 84, 87, 89, 90, 91, 92, 93
piwi, 8, 95, 98, 99 RNA helicase, 67, 80, 81, 91
Piwi-interacting RNAs (piRNAs), 76, 78 RNA Induced Silencing Complex (RISC), 76
polaydenylation, 82 RNA Recognition Motif (RRM), 79, 80
pollutant, 113, 226, 266 rough endoplasmic reticulum, 228
polycyclic aromatic hydrocarbons (PAHs), 267 roy orbison mutant, 4
polycystic kidney disease, 180, 186 roy-/- mutant, 109
polymorphic markers, 157, 164 runzel (ruz), 156, 177
polytelic, 116
previtellogenesis, 8
primary antibody, 139, 140, 141, 149, 159 S
primer-dimer, 269
sarcomere, viii, 136, 137, 138, 141, 144, 146, 147,
Primers, 269
149, 150, 155, 156, 158, 166, 167, 168, 169, 170,
Primordial Germ Cell, 65
171, 172, 173, 174, 176
Probit analysis, 46
sarcomere development, 156, 172
progestogen, 40, 120
sarcoplasmic reticulum, 137, 153
pronephric duct, 180, 186, 209
sclerotome, 136
prospero-related homebox gene 1a (prox1), 220
SDS-PAGE, 45, 50, 51, 55
protein kinase p34cdc2 (CDK), 40
serine/threonine protein phosphatases (PP), 41
protein phosphatase 1 (PP1), 39, 51, 53, 54, 60, 63
sexual maturity, 3, 85
protein phosphatase 2A (PP2A), 39, 41, 44, 53, 54,
single ciliated cell, 180, 186
60, 61, 62, 63
single-stranded oligodeoxynucleotides, 180
protein phosphatase inhibitor, 53, 54, 59
small interfering endogenous RNAs (endo-siRNAs),
protein phosphorylation, 40, 41, 59, 61
76
proximal convoluted tubule, 180, 185, 187, 189
sodium thiosulfate, 125
pyrethroid insecticides, 266, 267
Sodium-potassium-chloride cotransporter (Slc12a2),
vii, 143, 175
Q somatic tissue, 68, 73
somite formation, 217
quantitative PCR, 266, 289 sonic hedgehog, 235
sonophotocatalysis, 113
spawning chamber volumes, 128
R spawning periodicity, 123, 124, 126, 127, 128, 130
Spermatogenesis, 218
rabbit polyclonal antibody, 44
spermatogonia, 73, 75
rainbow trout, 35, 260, 284, 288, 292
Stage I oocytes, 73
rats, 143, 216, 227, 228, 229, 239, 258, 259, 263,
steroid, 9, 16, 40, 43, 46, 47, 48, 49, 50, 51, 57, 107,
266, 286, 291
108, 112, 114, 115, 117, 120, 121, 185, 204
Real-time Primer Design Program, 269
steroid vehicle, 43, 46, 47, 48, 49, 50, 51, 57
reelin, 234, 241
steroidogenesis, 111
region of interest (ROI), 43
striated muscle, 136, 141, 146, 147, 150, 154, 155,
reproductive cycle, vii, 117, 123
156, 157, 158, 165, 166, 174, 221
reproductive diapause, 127
stromal cell-derived factor 1 (sdf1), 68
resistance gene (mdr1), 265, 268, 287
Superose 6B column, 44, 55
retinaldehyde dehydrogenases, 180
superoxide dismutase (SOD), 267
retinoic acid, 179, 180, 188, 189, 209, 213
Swimbladder, 3
retinoic-acid response elements, 180, 188
Syntabulin, 71, 101
Index 301
Tukey multiple comparison test, 274

T
T11 antibody, 147, 150, 158 V

T4 antibody, 143, 144, 151, 158, 170
TALENs, viii, 176, 179, 181, 193, 197, 198, 199, vasa, 8, 67, 70, 71, 72, 73, 77, 79, 81, 82, 83, 84, 86,
200, 201, 202, 203, 204, 205, 208, 209, 210, 211, 91, 94, 98, 99, 100, 101, 105
212, 213 Vasa, 65, 71, 72, 75, 79, 80, 81, 82, 83, 84, 87, 89,
testes, 3, 4, 9, 13, 93, 99, 104, 129 91, 94, 96, 97, 99, 102, 103
testis, 3, 8, 11, 12, 73, 81, 85, 120, 121 vegetal cortex, 70, 88, 98
tetrabromobisphenol A, 267 Vitellogenesis, 36, 108, 121
TG (β-actin vitellogenin, 4, 15, 16, 17, 31, 32, 33, 34, 35, 36, 37,
EGFP), 107, 109 113, 127, 266, 287, 288
Tg(cmlc2 vitellogenin (vtg1), 4, 15, 16, 17, 31, 32, 33, 34, 35,
egfp), 17, 24, 26, 27, 28, 33, 34, 35, 221 36, 37, 113, 127, 266, 287, 288
Tg(fabp10
dsRed), 17, 24, 26, 27, 28, 33, 34, 35, 221
Tg(ins W
mCherry), 17, 24, 26, 27, 28, 33, 34, 35, 221
TGF- walleye, Stizostedion vitreum, 266
theca cells, 16, 111 water quality guidelines, 265, 266
thick ascending limb, 180, 185 western blots, 39, 55
thyroglobulin, 44 whole mount in situ hybridization, 181, 194, 208,
thyroid stimulating hormone, 267 215, 216, 217
Titin, 137, 147, 149, 155, 156, 158, 171, 172, 174, whole-mount in situ hybridization, 84, 215, 216, 218
177 wild-type, vii, 4, 5, 17, 18, 33, 34, 42, 67, 68, 76, 78,
titina, 155, 156, 164, 165, 173, 174 88, 110, 123, 124, 125, 126, 130, 138, 151, 157,
titinb, 155, 156, 164, 165, 173 159, 160, 161, 162, 163, 164, 165, 166, 167, 168,
Toxic, 238 169, 170, 171, 172, 174, 181, 190, 223
toxicants, viii, 215, 217, 218, 220, 232, 245, 246, Wnt signaling, 71
247, 248, 249, 250, 251, 253, 255, 257
Toxicogenomic, 222 X
toxicology, vii, 37, 181, 215, 217, 218, 219, 221,
225, 232, 233, 242, 246, 258, 262, 288, 292 xenobiotics, 113, 267, 285, 286, 290, 292
trans-activating crRNA, 181, 199 Xenopus laevis, 35, 59, 89, 97, 100, 117, 121, 212,
transcription activator-like effector, 181, 197, 210, 222
211
transcription factor TFIIIA, 80
transcriptome, 36, 155, 173, 241 Y
transgenic (TG) line, 108, 203
transparency scanner, 123, 126, 157, 160, 176 yolk globules, 16, 33
transparent transgenic line, 107 yolk granules, 74
transposable elements, 66, 79 yolk proteins, 34, 40, 50, 51
transverse (t) tubules, 137, 170
tricaine methanesulfonate, 18
Z
triclosan, 216, 223, 260
trimethyltin chloride (TMT), 250
z-discs, 167, 172
Tri-Pure Isolation Reagent, 269
zebrafish, vii, viii, 1, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13,
tropomyosin, 137, 158, 169, 170
15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28,
trypan blue, vii, 15, 18, 20, 22, 23, 24, 25, 26, 27, 28,
30, 31, 33, 34, 35, 36, 37, 39, 40, 42, 44, 45, 46,
29, 31, 32, 35, 36, 37
49, 50, 51, 52, 53, 55, 56, 57, 58, 59, 60, 61, 62,
trypsin (try), 220
65, 66, 67, 68, 70, 71, 72, 73, 75, 76, 77, 78, 80,
tubule, 153, 180, 183, 185, 186, 187, 189, 191, 192,
82, 83, 84, 85, 86, 87, 88, 89, 91, 93, 94, 95, 96,
196, 210
302 Index
97, 98, 99, 100, 101, 102, 103, 104, 105, 107, 269, 270, 274, 276, 277, 281, 283, 284, 285, 286,
108, 109, 110, 111, 112, 113, 115, 116, 117, 118, 287, 288, 289, 290, 291, 292
119, 120, 121, 122, 123, 124, 125, 126, 128, 129, zebrafish embryogenesis, 175, 213, 216, 235
130, 131, 135, 136, 138, 139, 140, 141, 142, 143, zebrafish embryos, vii, 67, 72, 78, 82, 83, 88, 99,
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 141, 152, 176, 191, 196, 201, 205, 206, 210, 212,
154, 155, 156, 157, 158, 160, 164, 165, 170, 173, 213, 215, 217, 219, 234, 247, 255, 256, 261, 262,
174, 175, 176, 177, 179, 181, 182, 183, 184, 185, 263, 265, 266, 267, 268, 274, 276, 277, 281, 284,
186, 187, 188, 189, 190, 191, 193, 194, 195, 196, 285, 286, 287, 289, 290
197, 198, 199, 200, 201, 202, 203, 204, 205, 206, Zebrafish International Resource Center, 158
207, 208, 209, 210, 211, 212, 213, 214, 215, 216, zebrafish larvae, 243, 247, 256, 259, 262, 274, 277,
217, 218, 219, 220, 221, 222, 223, 225, 231, 232, 283, 284, 285, 287
233, 234, 235, 236, 237, 238, 239, 240, 241, 242, zeitgeber time, 129
243, 245, 246, 247, 248, 249, 251, 255, 256, 258, ziwi, 8, 12, 73, 78, 91
259, 260, 261, 262, 263, 264, 265, 266, 267, 268, Zm3 monoclonal antibody, 158
Znp1 monoclonal antibody, 158

Zebra Fish PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Zebra Fish PDF

Uploaded by

Copyright:

Available Formats

FISH, FISHING AND FISHERIES

Additional books in this series can be found on Nova‘s website

Additional e-books in this series can be found on Nova‘s website

NOTICE TO THE READER

Library of Congress Cataloging-in-Publication Data

ISBN:  (eBook)

Published by Nova Science Publishers, Inc. † New York

immunohistochemistry using a variety of muscle specific antibodies reveal a lack of

Ethan A. Carver and Charles A. Lessman, Editors

AGE DETERMINATION OF GONAD MATURATION

Kathryn D. Jones and Charles A. Lessman*

Keywords: Ovary, testes, ovarian follicle, sexual maturity, gametes, gonads

MATERIALS AND METHODS

RESULTS AND DISCUSSION

Table 1. Puberty in female casper transparent zebrafish juveniles. Days post

in presumptive germ cells, activation of hypothalamic-pituitary-gonad axis, beginning with

Average Ovarian Follicle Diameter (largest size class in

Female B female Z female W female O female J female V

female B female J female O female V female W female Z

Girth Diameter (microns) 3000

casper B casper J casper O casper V casper W casper Z

male R male S male U male X

OVARIAN FOLLICLE DYNAMICS ASSESSED IN VIVO

Gayathri Kaushik and Charles A. Lessman

Keywords: Oogenesis, ovarian follicle, oocyte endocytosis, vitellogenin, ovarian cycle

MATERIALS AND METHODS

Intraperitoneal (i.p.) Injection

To visualize zebrafish ovaries, the fluorescent-marker-treated zebrafish were anesthetized

Fluorescent marker excitation filter set emission filter set

Estimating Protein-Trypan Blue Binding

An in vitro assay was performed to determine TB binding to proteins. Different

Ovarian Follicle Diameter Measurement

Ovarian Follicle Fluorescence Intensity Measurement

oocyte diameter vs trypan blue intensity

oocyte diameter vs trypan blue intensity

oocyte diameter vs trypan blue intensity

oocyte diameter vs trypan blue intensity

oocyte diameter vs trypan blue intensity

In addition, TB fluorescence was determined in follicle-enclosed oocytes 8 and 14 days

95% confidence band

oocyte diameter vs trypan blue intensity

trypan blue fluorescence intensity

trypan blue fluorescence intensity

oocyte diameter vs trypan blue intensity

Figure 11. 150

Trypan Blue Binding to Proteins

Injection of TB into the peritoneal cavity of zebrafish resulted in an increase in

200 zero trypan blue

Other Fluorescent Markers Are Not Endocytosed

Injection of i.p. mCherry protein, fluoroscein-conjugated casein (FITC-casein) or FITC-

200 µm 200 µm 200 µm

200 µm 200 µm 200 µm

200 µm 200 µm 200 µm

Fluorescent Trypan Blue Localizes to Yolk Vesicles

Trypan Blue Uptake into Follicle-Enclosed Oocytes

In both wild-type and Tg(fli1:EGFP)y1 zebrafish, intraperitoneal injection of TB resulted

Harrisson, F., Callebaut, M. & Vakaet, L. 1981., "Microspectrographic analysis of trypan

THE PROTEIN PHOSPHATASE INHIBITOR, OKADAIC

MATERIALS AND METHODS

Computer-Aided Meiotic Maturation Assay (CAMMA)

17-, 20-dihydroxyprogesterone (DHP), (Steraloids.Inc) and okadaic acid (OA),

Images were stacked and animated in ImageJ (http://rsb.info.nih.gov/ij/) to allow a

RNA Isolation and Microarray

ISBN: (eBook)