European Journal of Scientific Research

ISSN 1450-216X Vol.72 No.1 (2012), pp. 64-73

© EuroJournals Publishing, Inc. 2012
http://www.europeanjournalofscientificresearch.com

Nucleotide Mutation Variants on D-Loop HVS1/HVS2

Mitochondrial DNA Region: Studies on Papuan
Population, Indonesian

Yohanis Ngili
Department of Chemistry, Faculty of Mathematics and Natural Sciences
University of Cenderawasih, Jayapura 99351, Papua, Indonesia
E-mail: joe_ngili@yahoo.com

Richardo Ubyaan
Chemistry Study Program, Faculty of Teacher Training and Education
University of Cenderawasih, Jayapura 99351, Papua, Indonesia
E-mail: r_ubyaan@yahoo.com

Epiphani I. Y. Palit
Biostatistics Division, Department of Mathematics
Faculty of Mathematics and Natural Sciences
University of Cenderawasih, Jayapura, Papua, Indonesia
E-mail: vlz16@yahoo.com

Hendrikus M. B. Bolly
Division of Biochemistry, Faculty of Medicine
University of Cenderawasih, Jayapura, Papua, Indonesia
E-mail: hendrikus_bolly@gmail.com

Achmad Saifuddin Noer

Biochemistry Research Group, Chemistry Study Program
Faculty of Mathematics and Natural Sciences
Institut Teknologi Bandung, Bandung 40315, Indonesia
E-mail: noer@chem.itb.ac.id

Abstract

Genomic region of mitochondrial DNA (mtDNA) of humans which have the

highest rate of polymorphisms is D-loop. MtDNA D-loop region consist of the HVS1
(hypervariable segment 1) and HVS2. Determination of nucleotide sequence and mutation
rate of 12 individuals in Biak and Serui tribe, Papuan northern regions that have not been
reported previously. The aim of this studies is to analyze the nucleotide D-loop region
using direct sequencing methods to determine the nucleotide sequence and patterns of
mutation. Here we showed that the variability in the mutations that occur in both D-loop
region of mtDNA on HVS1 and HVS2. Comparison of mutations of the revised-Cambridge
Referente Sequence (rCRS) indicate the presence of nine variants of the mutation at
position 16111, 16223, 16290, 16319, 73, 146, 153, 235, and 263. The existence of
polymorphism mutations position, type, and number of mutations indicates that mutations
Nucleotide Mutation Variants on D-Loop HVS1/HVS2 Mitochondrial
DNA Region: Studies on Papuan Population, Indonesian 65

are not spesific to a spesific population or tribe as the mtDNA Population Database of
Federal Bareau of Investigation (FBI) and data of the Internacional Nucleotide Sequence
Collaboration Databases (INSDC).

Keywords: Variants, D-loop, mtDNA, Papuan Population

1. Introduction
The complete sequence of human mtDNA with the size of 16569 bp arranged in a circular shape and
consists of genes coding regions and non-coding region (D-loop) have been published previously [1].
Human mtDNA is relatively easy to have a genetic mutation that causes a high degree of
polymorphism between individuals which are not descendants of the mother line [2]. Mitochondrial
genome regions that have the highest level of polymorphism is D-loop [3]. Another distinctive nature
of mtDNA is which specific pattern of inheritance is through the maternal lineage and has its own
genetic system [4-6]. Discovery and determination of the nucleotide sequence is then used as the
standard rCRS in a variety of moleculer genetic studies, especially relating to human mtDNA
polymorphisms. Analysis of nucleotide sequence variation and the D-loop can be used to determine the
identity of a person or a specific ethnic and evolution and global migration pattern of human [7-8].
Mitochondria are organelles of eukaryotic cell plays an important role in maintaining cell
viability, this is related to its function as a source of energy in the form of the compound adenosine
triphosphate (ATP) [9]. Most of the energy needs of cells generated through a series of oxidation-
reduction reactions that occur in multy-subunit enzyme complexes I, II, III, IV, V, which is integrated
in the membrane of the mitochondria, this process is aerobic because it involves a compound of
oxygen and ultimately result in high energy such as ATP [10]. Complete nucleotide sequence of
mitochondrial DNA of human as much as 16569 base pairs (bp) used as reference standard in
interpreting the normal nucleotide variants and variants associated with diseases [1,2,7,11]. The
structure of mtDNA consists of genes that encode proteins that two genes namely 12S rRNA and 16S
rRNA ribosomal RNA, 22 tRNA genes and 13 genes that encode protein of 70 polypeptide subunits of
complex respiratory enzymes and protein coding regions which not the D-loop and some regions
between genes [12].
MtDNA mutation rate is ten times faster than nuclear DNA and the mtDNA highest mutation
rate is D-loop [3,13]. This happens because the mitochondria are more free radicals and formed as by
product of respiration reaction and enzyme DNA polymerase χ has no repair system during replication
[14]. D-loop region is relatively more tolerant of mutation because it does not encode a specific
protein. This tolerance led to D-loop mutations can accumulate, so the difference or D-loop variation
between individuals is relatively high and hence is also call the hypervariable [15]. There are two areas
hypervariable on mtDNA D-loop that is HVS1 at position 15971-16414 and HVS2 region at position
15-389 [15]. D-loop region play a role in determining the identity or identification is mostly done in
the field of forensic medicine, moleculer biology and bioethnoanthropology [16]. D-loop diversity
between individual human being in the world used as a constituent of human phylogenetic tree [17].
This study is part of an effort to create a database of normal variants of Indonesian human
mtDNA, including Papuan ethnicity that have not been published in DDBJ (DNA Data Bank of Japan)
and GenBank (National Center for Biotechnology Information/NCBI). In the previous studies have
found 64 nucleotide variations in Indonesian human mtDNA from 33 different tribes in both coding
and non-coding regions [18-20]. In another study carried out fragments of 0.4 kb D-loop HVS1 region
determined the nucleotide sequence of the 24 Indonesian human and found 35 nucleotide variations
[21]. The study was specifically conducted to determine and analyze the nucleotide of the D-loop
region of human mtDNA on individuals in Biak and Serui tribe, the northern province of Papua,
Indonesia.
66 Yohanis Ngili, Richardo Ubyaan, Epiphani I. Y. Palit,
Hendrikus M. B. Bolly and Achmad Saifuddin Noer

2. Material and Methods

Materials and Preparation of Template mtDNA
The samples used in this study is a forensic blood samples from 12 individual on Biak dan Serui tribes,
Papua Province, Indonesia. Samples were stored in eppendorf tube 1.5 mL in a frozen state (temp -20
°C). Preparation of simples carried out by meeting the frozen blood cells at room temperature. Blood
cells are then washed with TE buffer pH 8 (10mM Tris-HCl pH 8 (Pharmacia Biotech) and 1 mM
EDTA pH 8 (J.T. Baker)) several times until the white pellets produced. MtDNA template to be
amplified is obtained directly from the results of blood cell lysis without prior purification. Lysis
carried out by mixing the blood cell pellet with 40 µL lysis buffer 10x (500 mM Tris-HCl pH 8,5
(Pharmacia Biotech), 10 mM EDTA pH 8,5 (J.T. Baker), and 5% Tween–20 (Merck)), 8 µL enzyme
proteinase K 10 mg/mL (USB Corporation) and added ddH2O sterile until the volume 400 µl,, then the
reaction mixture was incubated at 55 °C for an hour in incubator (Waterbath-Grant Instrument Ltd) and
continued at temperature 95 °C for 5 minute to inactivate proteinase K enzyme. Alter incubation the
reaction mixture was centrifuged using microcentrifuge type 5417C (Eppendorf) at 20000 g for 3
minute, then the supernatant was taken for use as a template for PCR reactions [22].

MtDNA in Vitro Amplification by PCR

Amplification process in D-loop HVS1/HVS2 human mitochondrial performed along the 1 kb. PCR
reaction mixture was carried out in the tube 0.5 mL (Eppendorf), that consists of 10 µL template
mtDNA lysis result, 1 µL primer Mfor (20 pmol/µL), 1 µL primer Mrev (20 pmol/µL), 5 µL buffer
PCR 10x (Amersham life science: 500 mM KCl, 100 mM Tris-HCl pH 9,0 on temp 25 °C, 1,0 %
Triton X-100, 15 mM MgCl2), 2 unit enzyme Taq DNA Polymerase (Amersham life science), 1 µL
mixture dNTP (Amersham life science) and then added sterile ddH2O till volume reach 50 µL [23-24].

Table 1: The nucleotide sequences of PCR primers

Primer Name Position 5’→3’ sequence % GC Tm/°°C

Mfor L15978-15997 CACCATTAGCACCCAAAGCT 50 62,23
Mrev H429-409 CTGTTAAAAGTGCATACCGCC 48 61,29

PCR process is done by engine Automatic thermal cycler (Perkin Elmer) by 30 cycles. The
early stages of the PCR process is the stage of initial denaturation at 95 °C for 3 minute, then go to
program PCR cycles with each cycle consists of three stages, namely denaturation step performed at
temperature 94 °C for 1 minute, annealing step performed at temperature 50 °C for 1 minute and
extention or polimerization step at temperature 72 °C for 1 minute. End of all cycles carried out
additional polymerization process at temperature 72 °C for ten minute with the intention of perfecting
the reaction. DNA PCR results were stored at –20 °C.

Analysis of PCR Results

The results of the PCR amplification is then analyzed by agarose gel electrophoresis 1,2 % (b/v) using
subTM DNA electrophoresis cell (Biorad). Agarose gel composition can be prepared by dissolving
agarose (Boehringer-Manheim) in buffer TAE 1 x (Merck: tris-asetat 0,04 M, EDTA 0,001 M pH 8,0).
Agarose solution was heated to dissolve complete, then colled to the temperature of the solution
reached 50-60 °C. Before the gel is poured into a mold which has a well-forming comb as a gel, is
added 2 µL solution EtBr 10 µg/mL (Merck). Wells on each gel included 10 µL sample PCR result
mixed with 2 µL loading buffer (Merck: sucrose 50 %, EDTA 0,1 M pH 8,0 , bromphenol blue 0,1 %
pH 8,0 ) [22]. Electrophoresis process was performed in TAE 1x as the current in the conductive
Nucleotide Mutation Variants on D-Loop HVS1/HVS2 Mitochondrial
DNA Region: Studies on Papuan Population, Indonesian 67

medium voltage 75 volts for 45 minute. Marker used was 1 kb ladder (Amersham life science) which
has 7 band (each measuring 4000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, and 250 bp). The
result of electrophoresis visualized with UV lamp series 9814-312 nm (Cole Parmer). DNA
concentration predictions can be made by comparing the thickness of the band to be analyzed against
the bands of marker whose concentration had been determined previously.

Purification of PCR Results

Purification of PCR result performed with ethanol precipitation method is PCR result was added
ethanol p.a (Merck) total of 2 times sample volume PCR result and sodium acetate 3M, pH 5,2 (Merck)
as many as 0.1 x volume of sample product. The mixture was incubated at –20 °C for the overnight
(14-16 hour) at freezer –20 °C (General Electric). The results of centrifuged incubation with micro-
centrifuges series 5417R (Eppendorf) at temperature 4 °C, speed centrifuged 15000 g for 30 minutes.
Supernatant was decanted and disposed of pellets attached to the tube wall was added ethanol 70 %
(Merck) cooled 5x as many PCR product. Then centrifuged with the same instrument at temperature 4
°C with speed 15000 g for ten minute. In the same way as above, the supernatant was discarded and the
pellets were dried in a vacuum concentrator type 5301 (Eppendorf) for 15 minute, then dissolve it in
7,5 µL ddH2O sterile. DNA purification was electrophoresed on agarose gel 1,2 % to estimate the
DNA concentration by using marker pUC19/HinfI [22].

mtDNA Sequencing by the Method of Dideoxy-Sanger

DNA sequencing is the final step in determining the nucleotide sequence of product fragment
amplified by PCR. Dideoxy sequencing was performed by the Sanger method using the Automatic
DNA Sequencer based on the method of the terminator labeling reagent with the material and
substance dari ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer).
Stages of DNA sequencing performed on the study include: (1) preparation of DNA templates, (2)
PCR amplification process by using universal primers (M13 Reverse dan T7), (3) DNA purification with
column of sephadex G-50, (4) polyacrylamide gel electrophoresis, and (5) nucleotide sequence analysis
of mtDNA.

Nucleotide Sequence Analysis of mtDNA

Analysis of nucleotide sequence data 1 kb mtDNA sequencing result performed using the computer
program DNASTAR, version 4. DNASTAR programs used are Editseq, Seqman, and MegAlign. Each
sample was analyzed for homology and mutation of specific on rCRS sequence and mitomap data.
From the results of these studies can be known of the sides of both monomorphic nucleotides (without
mutation) or that are polymorphic (mutation).

3. Results and Discussions

The Results of Amplification of 1 kb Fragment of Human mtDNA by PCR
Preparation of DNA template for PCR starts with sampling of blood cells for individual simples from
Biak dan Serui tribes, the northern province of Papua, Indonesia. The number of samples of each tribe
are 6 individual, not a line descendants of the mother (maternal lineage). Cell lysis is then performed to
obtain mitochondrial DNA using standard procedures without prior purification [22]. The results of
lysis is a template for the polymerase chaín reaction (PCR) (table 2). In figure 1 are shown the
fragments 1 kb D-loop region obtained through the amplification of human mtDNA in vitro using
primer pair, Mfor and Mrev. The results showed that the detection of mtDNA amplification yield of
simples is about 1 kb fragment indicated the of band that lies between the 1000 and 1500 bp (see figure
68 Yohanis Ngili, Richardo Ubyaan, Epiphani I. Y. Palit,
Hendrikus M. B. Bolly and Achmad Saifuddin Noer

1). These results are as expected, the amplification of the D-loop region consisting of HVS1 and HVS2
with length of 1 kb.

Table 2: PCR conditions used

Time Temp
Steps
(minute) (°°C )
Step I
Initial denaturation 3 95
Step II*
Denaturation 1 94
Annealing 1 50
Polimerization / Elongation 1 72
Step III
Final extention 10 72
*
Repeated 30 times

Figure 1: PCR Fragment. Amplification using the primers Mfor and Mrev. lane 1: ladder marker 1 kb, lane 2:
control (+), lane 3 : control (-), and lane 4-9 is samples (1 kb) individual from papuan individual
human mtDNA.

In the results showed the presence of DNA fragments at position 1 kb for the samples indicate
that the mtDNA template amplification occurs in the Mfor dan Mrev primars. Function of the positive
control in PCR process is to determine the course of the PCR process. The emergence of bands on
positive control to prove that the PCR is progressing well and the band that appears in the sample are
band of fragment D-loop region. This is reinforced by the negative control in the PCR process.
Negative control in the PCR process, aims to determine the possible presence of contaminants in the
PCR reaction mixture. No appearance of bands in negative controls to prove that in the reaction
mixture contained no contaminants that could interfere with PCR [24]. One kb fragment obtained
bands are shown in the results of electrophoresis showed that the blood, mitochondrial DNA is found
much. The main function of mitochondria is the energy-producing organelles in the form of ATP in
human cells. Cells regeneration process requires energy derived from oxidation of food in the
mitochondria, therefore the blood cells was found to be quite a lot of mitochondria. In large amouts,
mitochondria are found in cells that have a high metabolic activity such as sperm in the active split
tails, heart muscle cells, and cells are actively dividing cells such as epithelium, hair follicles, and skin
epidermis [25, 26].

The Results of Direct Sequencing Analysis

Análisis of the region 1 kb D-loop of mtDNA performed on 16024-301 and used as a standard
nucleotide sequence that is rCRS by Andrews sequence (revised-Cambridge Reference Sequence) [2].
To find the nucleotide sequence of the mutation análisis was performed using the Megalign and
Nucleotide Mutation Variants on D-Loop HVS1/HVS2 Mitochondrial
DNA Region: Studies on Papuan Population, Indonesian 69

Seqman program and nucleotide position by placing the sample parallel to the nucleotide sequence,
rCRS. On this program can also be seen the cirled electrophoregram display showed the difference
between the nucleotide sequence of the sample with standard sequence, rCRS (figure 2-4).
Based on the análisis of mutations in the D-loop mtDNA of the 12 individual simples of human
Papuan: Biak and Serui tribe, found some amount, type, and position of mutations in the D-loop
mtDNA. The number of mutations in two tribes majority of the population of Papuan is the 15
mutations analyzed, while the smallest is 9 to type of mutation as whole are randomly scattered in the
16024-301 region. In detail, mutations in each sample are shown in table 3.

Figure 2: Example of the results of mutation analysis of the sequence Papua 1 (Biak tribe) on the D-loop
electroforegram mutation HVS1 through the display using the Seqman program. In the figure shown
in the position of 16223, there is a difference between the sequence of mutations of Papuan
individual 1 with rCRS, the nucleotide cytosine to thymine (C→t).

Figure 3: The results of comparative analysis of mutations at position 16223 by using the Seqman program. In
the figure shows the nucleotide sequence at positions 16223 on Papua 1 is Thymine (T) as indicated
by the red spectral peaks, while in Papuan 2 shows the bases Cytosine (C), the spectra are blue,
same with revised-Cambridge Reference Sequence (rCRS).

Figure 4: The results of nucleotide sequence alignment at position 16223 by using the MegAlign program. In
the figure above shows the sequence of nucleotides at Papuan 1 is Thymine (T), while in Papuan 2
shows the bases Cytosine (C).
70 Yohanis Ngili, Richardo Ubyaan, Epiphani I. Y. Palit,
Hendrikus M. B. Bolly and Achmad Saifuddin Noer

In Table 3 show that the mutations that occur in all samples vary in the position, type, and
number. Types of mutations that occur among the transition and transversion mutation. The results of
the overall genetic pattern analysis of samples as specified in Table 3 shows the type of nucleotide
mutations found in populations in northern Papuan, Biak and Serui tribe.

Table 3: Number and type of individual mutations variants in Biak dan Serui tribe, Papuan Province,
Indonesia

Tribes di Papuaa
Nucleotide Nucleotide
rCRSc Biak Serui
positionb changesd
Papua 1 Papua 2 Papua 3 Papua 4 Papua 5 Papua 6 Papua 7 Papua 8 Papua 9 Papua 10 Papua 11 Papua 12
16 086 T . . c . . . . . . . . . T→c
16 111 C t t t t t t . t t t t t C→t
16 183 A . c c . . . . . . c . . A→c
16 189 T . c c . . . c . . c . . T→c
16 209 T . . . . . . . . c . . . T→c
16 217 T . c c . . . . . . c . . T→c
16 192 C t . . t . t . . . . . t C→t
16 223 C t . . t t t . t t . t t C→t
16 233 A g . . g . g . . . . . g A→g
16 278 C . . . . . . t . . . . . C→t
16 290 C t . . t t t . t t . t t C→t
16 319 G a . . a a a . a a . a a G→a
16 331 A g . . g . g . . . . . g A→g
16 362 T . . . . c . . c c . c . T→c
73 A g g g g g g g g g g g g A→g
146 T c . . c c c . c c . c c T→c
152 T . c . . . . . . . c . . T→c
153 A g . . g g g g g g . g g A→g
195 T . c . . . . c . . c . . T→c
225 G . . . . . . a . . . . . G→a
226 T . . . . . . c . . . . . T→c
235 A g . . g g g . g . . g g A→g
263 A g g g g g g g g g g g g A→g
a
Individual papuan 1-6 from Biak tribe, while individual Papuan 7-12 from Serui tribe.
b
Nucleotide sequence position to rCRS
c
rivised-Cambridge Reference Sequence (rCRS), was published by Andrews et al., 1999
d
Nucleotide base changes at specific positions using the genetic code of mtDNA

From the data presented in Table 3, shows that the mutations that occur in human derived
Papuan tribe of Biak dan Serui very hypervariable. Mutations that occured did not show a specific
pattern of rCRS. The results of further analysis and comparative test on the D-loop: HVS1 and HVS2
against Mitomap data shows no new mutation in these tribes (Table 4). Largest mutation occur at
position 73 and 263 on the D-loop: HVS2 of mtDNA, which amounted to 100 percent or mutation
occurs in the overall individual. While the smallest mutations were 5 variants found in the HVS1
region are 16085, 16209, 16278, while in HVS2 region are at position 225 and 226. The smallest
persentage of mutations is 8 percent or mutation only occurs in one individual in Papuan population.
Total number of nucleotide mutations in the D-loop mtDNA along 16024-301 to rCRS is 23 variants.
Of the overall mutation occured, the unique transversion substitution mutation at position 16183,
adenine nucleotide changes into cytosine, A→c (A16183c).

Table 4: Analysis of the pattern of mutations in the population of Papua: Biak and Serui tribe

Biak tribe Serui tribe

Papua 1 Papua 2 Papua 3 Papua 4 Papua 5 Papua 6 Papua 7 Papua 8 Papua 9 Papua 10 Papua 11 Papua 12
The number of variants per
12 8 7 12 10 12 8 10 10 8 10 12
individual a
Percentage of variants b (in
52 35 30 52 43 52 35 43 43 35 43 52
percent)
The number of variants are
11 15 16 11 13 11 15 13 13 15 13 11
not mutations
Most variants of the D-loopc 1 3 1 1 3 1 2 3 1 3 3 1
 Nucleotide Mutation Variants on D-Loop HVS1/HVS2 Mitochondrial
DNA Region: Studies on Papuan Population, Indonesian 71

Table 4: Analysis of the pattern of mutations in the population of Papua: Biak and Serui tribe - continued

Comparison of mutation
variants of the variant is not 1,09 0,33 0,43 1,09 0,77 1,09 0,53 0,77 0,77 0,53 0,77 1,09
mutatedd
The identity of the highest

→
→

→
A

A
T

T
6

g
4

g
4

g
6

g
g
4
4

g
3

g
6

g
c

c
mutation e
Types of substitution

si

si

si

si

si

si

si

si

si

si

si

si
ti

ti

ti

ti

ti

ti

ti

ti

ti

ti

ti

ti
n

o
n

o
n

o
n

o
n

o
n

o
n

o
n

o
n

o
n

o
n

o
a

oa

a
mutations that occur f
a
The number of mutations per individual (number of mutation variants Biak tribe is 59, while the tribe Serui is 58) [number
of nucleotide mutations in all individuals in all positions of D-loop (HVS1-HVS2)].
b
Percent the number of variants per individual (calculated per total variance, ie per 23)
c
Comparison of D-loop variants (1 is HVS1, 2 is HVS2, while the number of variants HVS1/HVS2 is same)
d
The calculation result if more than 1 then the mutated variant more than the homology with rCRS and vice versa
e
The results of the analysis of the number and type of mutation that occurs in an individual without regard to the position of
the mutation
f
Types of mutations that occurred only ever seen by the number of mutations

Submission Nucleotide Sequences to DDBJ and Genbank

Nucleotide sequence analysis have been deposited to DDBJ (DNA Data Bank of Japan) with accession
number: AB495403-AB495404 and GenBank (National Center for Biotechnology Information/NCBI)
with accession number: FN357127-FN357136.

4. Conclusions
Based on the result of the research done, obtained the nucleotide sequence of human mitochondrial
DNA D-loop region: HVS1/HVS2 through direct sequencing for samples of two tribes in Papuan
Population. The number of dominant mutations in Biak and Serui tribe is nine position, that is 16111,
16223, 16290, 16319, 73, 146, 153, 235 and 263. Analysis of nucleotide sequence variability of
individual samples on Biak dan Serui tribe provide identifying information both mutation are highly
variable positions, number, and type of mutation that occurred. The variability in mutation position,
number, and type of mutations in individuals Papua indicate that mutations are not spesific to certain
populations such as the mtDNA population database from Federal Bareau of Investigation (FBI). The
analysis showed that almost all mutations are transition substitution mutation and interesting data on
the position 16183, has a mutation of transversion nucleotide substitution of adenine to cytosine
(A16183c).

5. Acknowledgments
This study was supported by Ministry of Research and Technology that has provided research funding
through Basic Research Incentive Program and DP2M-Dikti, through Inter-University Research
Cooperation Grant.

References
[1] Anderson, S., Bankier, A. T., Barrell, B. G., de Brujin, M. H., Coulson, A. R., Drouin, J.,
Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J., Staden, R.,
Young, I. G. (1981): Sequence and organization of the human mitochondrial genome, Nature,
290, 457- 465.
[2] Andrews, R. M., I. Kubacka, P. F. Chinnery, R. N. Lightowlers, D. M. Turnbull, and N. Howell
N. (1999): Reanalysis and revision of the Cambridge reference sequence for human
mitochondrial DNA, Nature Genetics, 23, 147.
72 Yohanis Ngili, Richardo Ubyaan, Epiphani I. Y. Palit,
Hendrikus M. B. Bolly and Achmad Saifuddin Noer

[3] BioMed Central, Human Genome project leaves much of human variation unsampled (Press
release December 1st) (2000): http://genomebiology.com/2000/1/5/ comment/2004
[4] Cavalli - Sforza, L. L., P. Menozzi, and A. Piazza. (1994): The history and geography of
Human genes. Princeton University Press. New Jersey.
[5] Divne, A. M., Nilsson, M., Calloway, C., Reynolds, R., Erlich, H., Allen, M. (2005): Forensic
casework analysis using the HVI/HVII mtDNA linear array assay, Journal of Forensic Science,
50, 548 - 554.
[6] Grishin, V. N. and Grishin, N. V. (2002): Euclidian space and grouping of biological objects,
Bioinformatics, 18(11), 1523-1533.
[7] Harpending, H. C., Batzer, M. A., Gurven, M., Jorde, L. B., Rogers, A. R., Sherry, S. T. (1998):
Genetic traces of ancient demography, Proceeding National Academy of Sciences USA, 95,
1961-1967.
[8] Horai, S. and Hayasaka, K. (1990): Intraspecific nucleotide sequence differences in the major
noncoding region of human mitochondrial DNA, American Journal of Human Genetics, 46,
828-842.
[9] Horai, S, Hayasaka, K., Kondo, R., Tsugane, K., Takahata, N. (1995): Recent African origin of
modern humans revealed by complete sequences of hominoid mitochondrial DNAs,
Proceeding National Academy of Sciences USA, 92, 532-536.
[10] Ingman, M., Kaessmann, H., Pääbo, S., Gyllensten, U. (2000): Mitochondrial genome variation
and the origin of modern humans, Nature, 408, 708-712.
[11] Laloë, D., Moazami-Goudarzi, K., Chessel, D. (2002): Contribution of individual markers to
the analysis of the relationships among breeds by correspondence analysis, 7th World Congress
on Genetics Applied to Livestock Production, August 19-23, 2002, Montpellier, France.
[12] Nei, M. (1973): Analysis of gene diversity in subdivided populations, Proceeding National
Academy of Sciences USA, 70, 3321-3323.
[13] Ngili, Y, and Noer, A.S, Polymorphism mtDNA on Papuan Population, International New
Guinea Biology Conference, Port Moresby, 2006.
[14] Ngili, Y, dan Noer, A.S. (2007): Studi Polimorfisme Nukleotida Daerah D-Loop DNA
Mitokondria Manusia: HVSI/HVSII pada Populasi Papua, Buku Program JSChem ITB-UKM
ke-7.
[15] Scozzari, R., Cruciani, F., Pangrazio, A., Santolamazza, P., Vona, G., Moral, P., Latini, V.,
Varesi, L., Memmi, M. M., Romano, V., De Leo, G., Gennarelli, M., Jaruzelska, J., Villems,
R., Parik, J., Macaulay, V., Torroni, A. (2001): Human Y-Chromosome variation in the
Western Mediterranean area: implications for the peopling of the region, Human Immunology,
62, 871–884.
[16] Starikovskaya, E. B., Sukernik, R. I., Derbeneva, O. A., Brown, M. D., Torroni, A., Lott, M. T.,
Volodko, N. V., Ruiz-Pesini, E., Hosseini, S. H., Wallace, D. C. (2003): Mitochondrial DNA
Diversity in Indigenous Populations of Southern Siberia and its implications on the Origin and
Evolution of Native American Haplogroups (unpublished).
[17] van Holst Pellekaan, S. M., Frommer, M., Sved, J. A., Boettcher, B. (1998): Mitochondrial
control-region sequence variation in Aboriginal Australians, American Journal of Human
Genetics, 62, 435-449.
[18] Gaffar, S. (1998) Varian normal fragmen 0,4 Kb daerah D-loop DNA mitokondria manusia
Indonesia. Tesis, Bidang Studi Magister Kimia Program Pascasarjana, ITB.
[19] Miller, K.W.P., Dawson, J.L., and Hagelberg, E. (1996): A concordance of nucleotide
substitution in the first and second hypervariable segment of the human mtDNA control region.
Int J Leg Med. 109: 107-113.
 Nucleotide Mutation Variants on D-Loop HVS1/HVS2 Mitochondrial
DNA Region: Studies on Papuan Population, Indonesian 73

[20] Parsons, T.J., Muniee, K., Sullivan, R., Allison-Greiner, R., Wilson, M.R., Berry, D.L.,
Holland, K.A., Weedn, P., and Holland, M.M. (1997): A high observed substitution rate in the
human mitochondrial DNA control region. Nature Genetics. 15: 363-268.
[21] Marzuki, S., Noer, A. S., Letrit, P., Thyagarajan, D., Kapsa, R., Utthanaphol, P., Byrne, E.
(1991): Normal variants of human mitochondrial DNA and translation products: the building of
a reference data base. Human Genetics. 88 (2): 139-45.
[22] Sensabaugh, G.F. and von Beroldingen, C (1991). Forensic DNA Technology. Lewis
Publishers, Inc. Michigan.
[23] Qiagen. (1995) Qiaprep Plasmid Handbook, GFXTM PCR DNA and Gel Band Purification Kit,
Amersham Pharmacia biotech, Inc.
[24] Vigilant, L., Stoneking, M., Harpending, H., Hawkes, K., Wilson, A. C. (1991): African
populations and the evolution of human mitochondrial DNA. Science, 253, 1503-1507.
[25] Watson, E., Bauer, K., Aman, R., Weiss, G., von Haesler, A., Pääbo, S. (1996): mtDNA
sequence diversity in Africa, American Journal of Human Genetics, 59, 437-444.
[26] Federal Bureau of Investigation and California Association of Crime Laboratory Directors.
(1991): TWGDAM Guidelines on Validation: TWGDAM Guidelines for a Quality Assurance
Program for DNA Analysis.

All in-text references underlined in blue are linked to publications on ResearchGate, letting you access and read them immediately.