HYBRIDIZATION CLONING

“Molecular Cloning of an Amino Acid Permease Gene and Structural

Characterization of the Protein in Common Bean (Phaseolus vulgaris L.)"

Disusun Oleh;

dr. Selli Novita Belinda 04042722024005

Pembimbing :
Sri Nita, S.Si., M.Si

DEPARTEMEN ILMU PENYAKIT DALAM

FAKULTAS KEDOKTERAN UNIVERSITAS SRIWIJAYA
RSUP DR. MUHAMMAD HOESIN PALEMBANG 2020
Artikel

“Molecular Cloning of an Amino Acid Permease Gene and Structural

Characterization of the Protein in Common Bean (Phaseolus vulgaris L.)”
Nibedita Chakraborty · Alfred Besra · Jolly Basak

Purpose

Amino acids have been considered as an essential nitrogen source in plants. Being the
building blocks for enzymes and proteins, amino acids serve as an essential nutrient source for
plant metabolism. The computational prediction of protein structure is receiving attention in
recent years. Various databases are available to predict and characterize the protein structure.
Therefore, the computational prediction of protein structure is a good alternative; since three-
dimensional protein structures of a family are apparently more conserved than the protein
sequences. In this study, we have isolated and sequenced P. vulgaris AAP and computational
prediction of three-dimensional structure of P. vulgaris AAP gene and its validation has
performed.

Materials and Methods

The seeds of P. vulgaris cultivar ‘Malgudi’ (Mal) were collected from Bidhan Chandra
KrishiViswaVidyalaya, Mohanpur. Surface sterilization was done using 0.1% HgCl2
followed by washing with dH2O. The seeds were sown in soilrite and kept in plant growth
chamber at 22 ± 2 °C, under 300 µmol m−2 s−1 light intensity (16:8 h light:dark photoperiod)
and 50–60% relative humidity. DNA was isolated from the leaves of 7 days old seedlings at
their first trifoliate stage.

The AAP gene sequences from the Fabaceae family were collected from NCBI database with
the parameters which includes species as plants, molecule type as mRNA and sequence type
as nucleotide. A total of 72 sequences were collected and subjected to multiple sequence
alignment. The conserved sequence was obtained through multiple sequence alignment using
CLUSTALW with default parameters.

The primer pairs (permease forward: 5′GTGGACTGCAAGTGCTCACATAA3′, permease

reverse: 5′AAGGCCAAAACCCAATTGCTCCA3′) were designed using Primer3plus
software based on the conserved sequence obtained from multiple sequence alignment
analysis. The AAP gene from P. vulgaris cv. Malgudi was amplified using BIORAD T100
thermal cycler. PCR condition consisted of the following steps: initial denaturation for 3 min
at 94 ℃ followed by 30 cycles of 45 s at 94 ℃, 45 s at 53.5 ℃, 1 min at 72 ℃ and final
extension for 7 min at 72 ℃. The 25 µl reaction mixture contained 100 ng genomic DNA, 1 ×
Taq reaction buffer, 1 mM dNTPs, 50 unit of Taq polymerase and 100 ng of gene specific
forward and reverse primer.
Cloning and Sequencing

The amplified products were cloned into the pJET1.2 cloning vector (Thermo Scientific,
#K1231). At this step, the PCR products with 3′-dA overhangs are blunted with a
thermostable DNA blunting enzyme and then ligated to the linearized pJET1.2 cloning vector.
The cloned PCR products were transformed into Escherichia coli DH5α competent cells. This
vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert
into the cloning site. As a result, only bacterial cells with recombinant plasmids are able to
form colonies. The transformed recombinant colony was then subjected to colony PCR and
the band intensities of the amplified products were checked in 2% agarose gel. The desire
band was eluted using QIAGEN gel extraction kit and sent for sequencing to Xcelris Pvt. Ltd
(Ahmedabad).

Result

Amino acids are one of the essential sources of organic nitrogen in plants. Amino acids are
transported through phloem to xylem transport system to the developing sink organs of plant
tissues. A large number of amino acid transporters were found which control the transport of
amino acid distribution from source to sink tissues. In this work, a computational-based study
was performed to generate and validate the three-dimensional structure of an amino acid
transporter, Pv_AAP considering it’s physicochemical, structural and functional
characterization. The present AAP was predicted to be thermostable, alkaline protein of
fabaceae family and the computational validation of 3D structure of Pv_AAP protein through
Ramachandran plot predicted to be a good quality protein. Although this work needs further
experimental validation, but as there is no structural information of Pv_AAP, authors believe
that this information will be very much useful to understand the structure of this important
amino acid permease as well as the binding of different ligands to this transporter.