Journal of Experimental Marine Biology and Ecology 347 (2007) 144 – 154

www.elsevier.com/locate/jembe

Detecting prey from DNA in predator scats: A comparison

with morphological analysis, using Arctocephalus
seals fed a known diet
Ruth M. Casper a,b,⁎, Simon N. Jarman a , Bruce E. Deagle b ,
Nicholas J. Gales a , Mark A. Hindell b
a
Southern Ocean Ecosystems, Australian Antarctic Division, 203 Channel Highway, Kingston, Tasmania, 7050, Australia
b
Antarctic Wildlife Research Unit, School of Zoology, University of Tasmania, GPO Box 252-05, Hobart, Tasmania, 7001, Australia

Received 20 October 2006; received in revised form 8 April 2007; accepted 11 April 2007

Abstract

The diet of free-living pinnipeds is most frequently estimated through identification of otoliths, squid mouth-parts and exoskeletons
of prey in scats. This is because, although important prey types may not always be detected, sample collection is non-invasive and
analysis is easy. Identification of prey DNA in scats is a nascent approach to determining the diet of marine vertebrates that may
overcome some of the limitations of hard part analysis. This is the first study to experimentally compare the utility of genetic scatology for
identifying consumption of prey types by seals with the occurrence of morphological remains of prey in scats. The occurrences of DNA
and hard part remains of one squid and two fish taxa in scats of captive Arctocephalus seals fed mixed prey diets were compared. Both
methods detected ingestion of these taxa 7.5–39.5 h prior to defaecation. Although all test prey had robust hard parts, detecting
consumption during this period was 1.4 to 5.8 times more likely using genetic analysis than morphological analysis of scats. Based on
frequency of occurrence calculations, neither method provided quantitative descriptions of the known diet. Identification of prey using
DNA was not compromised by complexity of the diet; each test taxon was unambiguously detected against a background of a multi-
species diet. Our results suggest that where diagnostic hard remains of prey are not well represented in scats, or the sample size is small,
genetic scatology provides a valuable addition to morphological scat analysis for identifying the recent diet of free-living seals.
© 2007 Elsevier B.V. All rights reserved.

Keywords: Generalist; Marine mammal; Otolith; Predator; Southern Ocean

1. Introduction
Trophic connections of marine vertebrates are seldom
observed directly. The diet of predators can be inferred
indirectly where morphologically diagnostic remains of
prey are present in gut or faecal contents, referred to as
⁎ Corresponding author. Southern Ocean Ecosystems, Australian Antarctic
Division, 203 Channel Highway, Kingston, Tasmania, 7050, Australia.
E-mail address: Ruth.Casper@aad.gov.au (R.M. Casper).
0022-0981/$ - see front matter © 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.jembe.2007.04.002
hard part analysis. While this approach has improved the
understanding of many food webs, it is not useful in all
situations. For example, collection of gut contents from
vertebrates, particularly higher order predators, may be
prevented by logistic or ethical considerations. The utility
of hard part analysis of faeces is also limited where the
contributions of delicate or soft bodied prey to diet are
poorly represented, such as in pinnipeds (Harvey, 1989;
Tollit et al., 1997), and in predators such as seabirds and
dolphins, where prey hard parts generally do not survive
 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154
digestion (Duffy and Jackson, 1986; Parsons et al., 1999,
RM Casper, unpublished data).
To improve detection of prey types, a variety of non-
morphological techniques have been applied to marine
vertebrate diet studies, the most widespread of which are
fatty acid and stable isotope analyses. These techniques can
provide information on trophic level interactions and shifts
in diet patterns, and may also indicate specific taxa con-
sumed (Hobson et al., 1997; Iverson et al., 1997a; Iverson
et al., 1997b; Bradshaw et al., 2003). However, interpre-
tation of these analyses can be difficult, depending on the
tissue sampled and the energy balance status of the animal
(Iverson, 1993; Hobson et al., 1997; Arnould et al., 2005;
Birkeland et al., 2005; Grahl Nielsen et al., 2005; Herman
et al., 2005; Staniland and Pond, 2005; Sweeting et al.,
2005), and especially in systems with a wide prey base
(Herman et al., 2005; Nyssen et al., 2005). Also, sampling
is limited by the need to collect blood, milk or tissues.
In response to these difficulties, DNA based analyses
are now also being applied to marine vertebrate systems
(Jarman et al., 2002; Jarman et al., 2004; Jarman and
Wilson, 2004; Orr et al., 2004; Purcell et al., 2004; Kvitrud
et al., 2005; Parsons et al., 2005). DNA techniques for
identifying prey in diet samples rely on specific recognition
of DNA sequences unique to those taxa. Prey DNA can be
identified from amorphous remains in scats, and collection
of scats is relatively easy and non-invasive compared to
other sampling regimes. Identifying prey DNA from scats
shows promise for improving diet assessment of higher
order marine animals, most obviously where prey cannot
be identified by their hard remains in scats, such as in
penguins (Jarman et al., 2002), or detecting consumption of
fragile prey by seals (Kvitrud et al., 2005; Parsons et al.,
2005). Importantly, there is potential to identify the diet of
animals consuming a wide variety of prey (Deagle et al.,
2005; Jarman et al., 2006).
Fur seals (Arctocephalus spp.) are apex generalist
predators in Southern Hemisphere marine ecosystems and
their diet is the focus of ongoing research investigating
predator–prey relationships (Daneri and Carlini, 1999;
Harcourt et al., 2002; de Bruyn et al., 2003; Beauplet
et al., 2004; Page et al., 2005), interactions with fisheries
(Green et al., 1989; Crawford et al., 1992; Croll and
Tershy, 1998; Boyd, 2002; Lea et al., 2002; Naya et al.,
2002; Goldsworthy et al., 2003; Hume et al., 2004) and
monitoring the marine environment (Agnew, 1997). The
diet of free-living seals is most frequently estimated from
morphological analysis of scats. Although not the only
diagnostic structure, sagittal otoliths are most commonly
used to identify fish taxa, numbers and sizes, because they
are relatively easy to classify and are the most consistently
useful structure across fish species. Cephalopod mouth-
145
parts and exoskeleton remains are used to identify cepha-
lopod and crustacean prey respectively (Cottrell et al.,
1996; Bowen, 2000; Tollit et al., 2003). However, seal
scats do not always contain diagnostic hard parts. This is
because otoliths may be eroded beyond identification or
completely digested, and the excretion of prey hard parts
over time is uneven (Casper et al., 2006). As a conse-
quence, even consumption of fish with robust otoliths
may not be evident in all scats resulting from those meals.
Also, although squid mouth-parts are robust, they some-
times accumulate in the stomach and are regurgitated,
rendering them under-represented in scats (Richardson
and Gales, 1987; Pierce and Boyle, 1991).
Further, the use of otoliths and squid beaks in scats to
quantify diet is problematic. Although frequency of occur-
rence (the proportion of samples in which a particular prey
type is detected; FO) is the most common measure used
(Trites and Joy, 2005), it is not accurate (Pierce and Boyle,
1991; Casper et al., 2006). Quantifying consumption of
prey, even those with robust hard parts, requires the appli-
cation of correction factors (CF) to account for partial
and complete digestion, or regurgitation, of hard parts.
Reliable CF have proven difficult to ascertain because these
may vary both between and within any predator and prey
species combination (Tollit et al., 1997; Bowen, 2000;
Staniland, 2002). Grellier and Hammond (2006) developed
dependable CF for grey seals (Halichoerus grypus) and a
variety of prey species, but this required an extensive
(n = 86) series of feeding trials. Given these difficulties, it is
important to assess the utility of FO of prey DNA in scats as
a method for quantitative estimation of diet. If successful,
this approach may provide a simple alternative or addition
to conventional quantification of diet.
Despite the recent application of genetic techniques
to marine diet studies, there have been no reported at-
tempts to experimentally compare DNA based methods
with conventional hard part analysis. While the advantage
of genetic technology for identifying delicate prey of
pinnipeds is apparent (Orr et al., 2004; Purcell et al., 2004;
Kvitrud et al., 2005; Parsons et al., 2005), differences
between the two approaches are not obvious where prey
have robust hard parts. Addressing this issue is a crucial
step in assessing the utility of DNA based identification of
diet in pinnipeds.
In a feeding experiment on captive Arctocephalus
seals, we compared detection of prey consumed using hard
part and DNA remains in scats. Our aims were to (1)
provide a multi-species diet because Arctocephalines are
generalist foragers, (2) carry out this comparison on prey
with robust hard parts, (3) determine the period following
ingestion that prey are detected in scats with each method,
(4) compare the consistency of the respective signals of
146 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154

each method over this period, and (5) assess the utility of
genetic scatology for identifying the diet of free-living seals.
2. Materials and methods
2.1. Study animals
Experiments were carried out on three sub-adult male
New Zealand fur seals (A. forsteri) and one sub-adult
male sub-Antarctic fur seal (A. tropicalis) at Sea World,
Gold Coast, Australia during August and September
2002. The animals were housed in pairs in enclosures
8.3 m × 2.9 m containing a pool 4.0 m × 2.1 m × 1.2 m
deep. Each day they underwent two 20 min training ses-
sions, during which they consumed their daily food intake.
They were also given free access to a large show pool
40 m × 25 m × 4 m deep for 90 min each day.
2.2. Feeding regime and test prey
Two experimental diets were fed alternately for 9 days
each over a total of 45 days. Each 9 day period is referred to
sequentially as Diet A1, Diet B1, Diet A2, Diet B2 and Diet
A3 (Table 1). Diet A comprised 3 fish species, while Diet B
comprised 5 fish species (different to Diet A), 1 squid and 1
crustacean species (Table 2). A 9 day period was chosen
because retention of otoliths in New Zealand fur seals may
be as long as 7.7 days (Fea and Harcourt, 1997). This
should ensure that from day 10 the digestive tracts of the
study animals would be cleared of remains of the pre-
experimental diet, and that there should be no confusion as
to which diet period a particular otolith originated from.
Hard part analysis of scats was carried out as described in
Casper et al. (2006). Scats were tested for DNA remains of
Sillago spp. and Arripis georgianus (Diet A), and squid
(Nototodarus sp.; Diet B). Sillago spp. and A. georgianus
were chosen as test prey because they had the most robust
otoliths of all fish species fed and were also the best
represented in scats (Casper et al., 2006). Squid were
chosen because their mouth-parts survive digestion well,
and the presence of squid beaks in fur seal scats is often
relied upon to detect consumption of squid (Acuna and
Francis, 1995; Daneri et al., 1999; Fea et al., 1999; Naya et
al., 2002; de Bruyn et al., 2005). Eye lenses are also
sometimes used to identify consumption of cephalopods
and fish, but these are not useful for species identification
and were not collected. Species not tested were genetically
unrelated to test prey at the level of family (Table 2).
2.3. Sample collection
To identify the producer of a particular scat, the seals
were fed a fish each morning and afternoon containing
either 1 mL of food colouring (prior to day 18) or a
0.95 mL gelatine capsule of Microgrits® (corn cob grits
impregnated with food colouring, www.microtracers.
com; from day 18 on). Seals NZ1 and NZ3 were dosed
with blue/green colours and were always housed with
either NZ2 or SubA who were dosed with pink/red
colours. Scats were collected from days 10 to 45 inclusive
(Table 1). Enclosures and the pools within were checked
for scats by 0730 h each day and then at least every 2 h
until 1630 h. It was not possible to observe any scats
produced in the large show pool.
Scats were placed in 70% ethanol at a ratio of 1:3 and
dispersed by gentle agitation on a Ratek Platform Mixer®
for 20 min. Hard part remains were recovered by washing
the scats with 70% ethanol through disposable sieves. A
separate sieve was made up for each sample by securing a
square of 500 μm nylon gauze (PA-38GG, www.ausfilter.
com.au) over a 1 L plastic jar using the perimeter of a screw
on lid. Otoliths, beaks and exoskeletons were removed
from the top of the sieve, rinsed and stored dry. Material
washed through the sieve was used for genetic analysis.
2.4. DNA extraction
DNA was extracted from scats using the Ultra Clean™
Fecal DNA Isolation Kit (MO BIO Laboratories, Inc.). A
300 μL aliquot of each ethanol/scat slurry sample was

Table 1
Chronology of 2 experimental diets (A and B) fed alternately for 9 days each to captive Arctocephalus spp
Diet A1 B1 A2 B2 A3
Day 1 9 10 18 19 27 28 36 37 45
Signal Otolith DNA Beak DNA Otolith DNA Beak DNA Otolith DNA
#
Initial detection (h) 15.0Sq 7.5Sq 39.0Arr 15.0Arr NDSq 15.0Sq 39.0Arr 15.0Arr
39.0Sill 15.0Sill 15.0Sill 15.0Sill
Final detection (h) 56.0Arr 32.0Arr 104.0Sq 32.0Sq 104.0Arr 8.0Arr NDSq 8.0Sq
176.0Sill 32.0Sill 8.0Sill 8.0Sill
Test prey: Arr = Arripidae (A), Sill = Sillaginidae (A), Sq = squid (B). Scats were collected days 10–45 inclusive. Initial detection after first meal and final
detection after last meal of each test prey in scats as determined by morphological (otolith/beak) and DNA signals (±7.5 h; #exact). ND not detected.
 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154 147

Table 2 from a test taxon, but not from fur seals or the other
Components of two diets in feeding experiment prey species in the trial. The primers for Arripidae and
Family Species % Consumption Sillaginidae were designed by eye on an alignment of
by mass mitochondrial large sub-unit ribosomal DNA genes
Diet A (GenBank accession nos. DQ660418–DQ660428). The
Arripidae a Arripis georgianus 35 squid specific primers were designed to amplify a region of
Sillaginidae a Sillago robusta, S. flindersi 35
nuclear large sub-unit ribosomal DNA. An initial assess-
Mullidae Upeneus tragula 30
ment of primer quality was made using Primer3 (Rozen and
Diet B Skaletsky, 2000). Each primer set was then tested empiri-
Ommastrephidae a Nototodarus sp. 13 cally for specificity and to determine optimum PCR condi-
Carangidae Trachurus novaezelandiae 25 tions. Primer sets and product sizes are presented in Table 3.
Decapterus russelli 10
Real-time PCRs were carried out on a Chromo 4™
Clupeidae Sardinella lemuru 25
Amblygaster clupeoides 5 Continuous Fluorescence Detector and analysed using
Scombridae Scomber australasicus 20 Opticon Monitor™ software (MJ Research). Amplifica-
Penaeidae 2 tion of DNA was visualised using the fluorescent dye
a
Taxa tested for DNA remains in scats. SYBR Green® I (Molecular Probes) that selectively binds
to dsDNA. Although dyes such as SYBR® Green I pro-
centrifuged for 5 s at 10,000 ×g. The supernatant was vide a simple generic method for product detection, all
poured off, and the sediment resuspended in 100 μL Bead dsDNA products are detected. Use of the dye to identify
Solution from the kit by vortexing at medium speed for target sequences therefore depends on the specificity
5 min. Manufacturer's instructions were then followed inherent in the amplification primers (Wittwer et al., 1997;
using 100 μL of the resulting mixture. Extraction blanks Morrison et al., 1998). To provide evidence that
(no faecal material) were included to check for cross- amplifications from scat DNA represented target product,
contamination. DNA extracted from 15–20 mg prey tis- we incorporated a melting curve analysis into the cycling
sue using the Ultra Clean™ Tissue DNA Isolation Kit protocol for internal primer sets. The melting temperature
(MO BIO Laboratories, Inc.) provided positive controls of nucleic acids is affected by factors such as length, G + C
for PCRs. content and presence of base mismatches (Anon, 2004).
As fluorescence of SYBR® Green I is related to the
2.5. Design and testing of primers amount of dsDNA, the melting temperature of a PCR
product corresponds to a sudden decrease in fluorescence.
As prey DNA in scat samples occurs in small, degraded If primers are specific, the melting temperature of product
and impure quantities (Kohn and Wayne, 1997), we used a amplified from scat DNA should be similar to product
nested PCR technique targeting short DNA sequences. amplified from target prey tissue DNA (positive control).
With low quality template, nested PCRs are often success- Establishing that the product has only one major melting
ful in dramatically and selectively increasing amplification temperature also provides confidence of primer specific-
of target sequences (Roux, 1995; Deagle et al., 2003). PCR ity. We further confirmed target product by repeating
primer pairs were designed to amplify a target sequence nested PCRs on all samples that had amplified (omitting

Table 3
PCR primers used and product sizes
Primer name Sequence 5′-3′ Product size Target (gene:taxon)
Squid28SF⁎, a CGCCGAATCCCGTCGCMAGTAAAMGGCTTC Nuclear 28S rDNA:squid
⁎
Squid28SR , a CCAAGCAACCCGACTCTCGGATCGAA 180 bp Nuclear 28S rDNA:squid
Squid28S2F# CCTTCGGGACGWGTGGCGCA Nuclear 28S rDNA:squid
Squid28S2R# CCGTCGCTCGCCGTCCGCACC 100 bp Nuclear 28S rDNA:squid
Arripidae16SF⁎,# GAGCTTCAGACACTCGAGCA mtDNA 16S:Arripidae
Arripidae16SR⁎ CGCTGTTATCCCTATGGTAACT 237 bp mtDNA 16S:Arripidae
Arripidae16S2R# GTCTTGCCGGATCTGTTT 202 bp mtDNA 16S:Arripidae
Sillaginidae16SF⁎,# ACCGGTATGAATGGCAAGAC mtDNA 16S:Sillaginidae
Sillaginidae16SR⁎ GCAGGGTCCGCTTAGTTTAG 180 bp mtDNA 16S:Sillaginidae
Sillaginidae16S2R# AGATCTTTATTTTAGGGTGC 160 bp mtDNA 16S:Sillaginidae
⁎External and #internal primers in nested PCRs.
a
From Deagle et al. (2005).
148 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154

the melting cycle), and compared product size with the
positive control using 1.5% agarose gel electrophoresis.
The nucleic acid stain Gelstar® (BioWhittaker Molecular
Applications) was added to the loading dye and bands
were visualised by fluorescence N 500 nm when the dye
was excited by b420 nm illumination with a Dark Reader
(Clare Scientific).
2.6. PCR amplification
Each 20 μL test reaction contained DNA template
combined with 2 μL 10× AmpliTaq PCR Gold buffer, 2 μL
25 mM MgCl2, 1 μL 1× SYBR® Green I, and 0.2 µL each
of 100× BSA, 10 mM dNTPs, 10 mM forward primer,
10 mM reverse primer and AmpliTaq Gold (Applied
Biosystems). Template for external PCRs consisted of 4 μL
DNA extracted from scat for Arripidae and Sillaginidae
tests, and 1 μL for squid tests. PCR product from these
reactions provided the template for internal PCRs, 4 μL for
Arripidae and Sillaginidae, and 1 μL for squid. Cycling
conditions for all Arripidae and Sillaginidae PCRs were
95 °C for 10 min, followed by 45 cycles of 94 °C for 5 s,
60 °C for 30 s, 72 °C for 20 s, then 72 °C for 10 min.
Cycling conditions for squid were similar, except that
annealing temperatures and number of cycles for external
and internal PCRs were 61 °C and 30, and 62 °C and 35
respectively. Melting curves were resolved after comple-
tion of internal PCRs by reading fluorescence every 0.2 °C
from 55 °C to 96 °C. All PCR runs included a positive
control to confirm suitable reaction conditions, and a PCR
blank and a DNA extraction blank to check for cross-
contamination. Aerosol resistant tips were used for prepa-
ration of all reactions and open PCR products were handled
in a separate laboratory. All PCRs were prepared under
a laminar flow hood using UV sterilised equipment and
consumables. All samples classified as positive for target
DNA using real-time PCR amplification curves were sup-
ported by melting curve and gel electrophoresis results,
confirming that each PCR product had the expected size
and sequence.
2.7. Data analysis
DNA and hard part methods were compared by calcu-
lating the frequency of occurrence that each prey type was
detected. To compare the likelihood of identifying test prey
between the two techniques, we estimated the minimum
sample size required to detect each test taxon with each
method. Based on initial and final detection times (see
Results), scats collected from 7.5 h after first consumption
to 39.5 h after last consumption of each test prey were used
for this. A sample of 10 scats was randomly selected and
the FO calculated. The sample was replaced and the pro-
cedure repeated 1000 times and a distribution curve of
observed FO generated. Sample size was then increased
and the process carried out for 20, 30 and 40 scats respec-
tively. The minimum sample size for detection was as-
sessed as the sample size where all 1000 samples had a
FO N 0. The standard error (SE) is given as a measure of
variability about the mean. Data were analysed using JMP
Version 3.2.2 (SAS Institute Inc.) and PopTools Version
2.6.6. (Hood, G.M. 2005, http://www.cse.csiro.au/
poptools).
3. Results
A total of 182 scats were collected over 36 days, with
a daily mean of 5.06 ± 0.31. All scats collected were
analysed for the presence of DNA and hard parts of all
3 test taxa. An example of these results, illustrating a
transition between the 2 experimental diets, is presented
in Table 4.
3.1. Initial and final detection times
The majority (80%) of scats collected were produced
overnight, when access to enclosures for observation or
scat collection was not possible. In most cases, this limited
the precision of initial and final detection times of test prey
in faeces to ±7.5 h (Table 1). Initial detection of squid
DNA during Diet B1 was in a scat produced 7.5 h after

Table 4
An example of results indicating presence (+) absence (−) data for DNA and hard parts of test prey fed from all scats collected over 4 consecutive days
Diet period A2 A2 B2 B2
Day 8 9 1 2
Test prey fed Arr and Sill Arr and Sill Squid Squid
Arripidae DNA/otolith −/− +/− −/− +/− −/+ +/+ +/− −/+ −/− +/− −/+ +/− −/− −/+ +/− +/− −/− −/− −/− −/− −/− −/+
Sillaginidae −/+ +/+ +/+ +/+ −/+ +/+ +/+ +/+ −/+ +/+ +/+ +/− +/− +/+ +/+ +/− +/− −/− −/− −/− −/− −/−
DNA/otolith
Squid DNA/beak −/− −/− −/− −/− −/− −/− −/− −/− −/− −/− −/− −/− −/− −/− −/− −/− −/− +/− −/− +/− +/− −/−
Each column represents a single scat. Arr = Arripidae, Sill = Sillaginidae.
 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154 149

Table 5 and minimum values). The range of cumulative FO values

Frequency of occurrences (%) of prey detected in scats (n) comparing using DNA remains (mean: 20.82± 4.41, n = 6) was statis-
hard part (otolith/beak) and genetic (DNA) methods, and both combined
tically lower than that using hard parts (mean: 34.75 ± 6.78,
Taxon (n) Otolith/beak DNA Both n= 5; Wilcoxon signed-rank test for paired samples, T =
Squid (79) 7.6 44.3 48.1 7.500, p = 0.031). These results infer that, in a random
Arripidae (109) 22.9 44.0 61.5 sample of scats, consumption of test prey is more likely to
Sillaginidae (109) 52.3 74.3 86.2
be detected using DNA than hard parts because excretion
of prey DNA not only occurs in a higher proportion of scats
first ingestion of squid. Otherwise, all initial detections than hard parts, but is also more consistent over time. This
of test species DNA were 15 ± 7.5 h after first ingestion suggestion is supported by the results of random sampling
(n = 5). Otoliths or squid beaks of test species were ini- simulations, where minimum sample sizes for detection
tially excreted in scats produced 15 ± 7.5 h (n = 2) or 39 ± of all test taxa were similar and lowest when using the
7.5 h (n = 3) after first ingestion. No squid beaks fed DNA method (Table 6). In a sample of 10 scats, detection
during Diet B2 were excreted in scats collected during of squid and Sillaginidae DNA could be expected in at
Diets B2 and A3 (n = 92). The last detection of test prey least one scat with a probability of N 99.9%, while detection
DNA occurred in scats produced either 8 ± 7.5 h (n = 3) of Arripidae DNA had a probability of 99.8%. The proba-
or 32 ± 7.5 h (n = 3) after final ingestion. Final detection bility of detecting Sillaginidae otoliths from 10 scats was
of prey hard parts was much more variable, ranging from comparable (99.7%), but a similar detection level of
8 ± 7.5 h to 176 ± 7.5 h (mean = 89.6 ± 28.0, n = 5). The Arripidae otoliths required at least 20 scats. Squid beaks
variability in hard part excretion is emphasised by the fact were not reliably detected through sampling. In 20 ran-
that both these extremes represent Sillaginidae otoliths domly collected scats, a number representing N 25% of the
(for Diets A2 and A1 respectively). Despite this, both sampled population, the probability of squid beaks being
DNA and hard part remains of prey in samples can be absent was nearly 20%.
generally considered to infer ingestion within the previous
39.5 h because excretion of otoliths or beaks after this time 3.3. Quantitative diet reconstruction
was uncommon, occurring in only 5.2% of scats.
Neither DNA nor hard part methods accurately reflected
3.2. Consistency of DNA and hard part signals the relative importance of test prey to diet using the FO
index (Tables 2 and 5). Arripidae and Sillaginidae contrib-
We compared FO of each test species as determined by uted equally to diet in terms of mass daily intake (35%), and
DNA and hard part methods, using scats collected from were fed on the same occasions and as part of the same diet
7.5 h after first consumption to 39.5 h after last consump- mix (Diet A). Despite this, FO of Sillaginidae otoliths and
tion. Calculations for Arripidae and Sillaginidae during DNA were 2.3 and 1.7 times greater respectively than FO
Diet A3 did not include scats produced after final con-
sumption because scats were not collected beyond day 45
Table 6
(Table 1). By dosing the seals with food dyes, 73.4% of Proportion of 1000 random samples where FO N 0 for hard part and
scats could be attributed to a particular animal. Among DNA remains of test prey in scats
these scats, there was no significant difference in FO Prey and method of Sample size
between study animals for either prey hard parts or DNA detection
10 20 30 40
(Kruskal–Wallis test, χ2 = 0.116, df = 3, p = 0.990, and
χ2 = 3.407, df = 3, p = 0.333 respectively). There was no Squid DNA (79) 100
44.4 ± 0.5
difference in FO between A. tropicalis and A. forsteri for
Squid beaks (79) 58.2 81.7 94.3 98.8
either prey hard parts or DNA (Wilcoxon test, χ2 = 0.000, 7.8 ± 0.3 7.6 ± 0.2 7.6 ± 0.1 7.2 ± 0.1
df = 1, p = 0.999, and χ2 = 2.505, df = 1, p = 0.114 respec- Arripidae DNA (109) 98.8 100
tively). Further analyses were carried out on pooled data 43.3 ± 0.5 44.1 ± 0.3
from all 4 seals. Arripidae otoliths (109) 93.5 99.5 100
22.9 ± 0.4 22.5 ± 0.3 23.1 ± 0.2
Frequencies of occurrence of prey DNA in scats were
Sillaginidae DNA (109) 100
higher than hard parts for all test taxa (Table 5; Wilcoxon 74.1 ± 0.4
signed-rank test for paired samples, T = 27.500, p= 0.001). Sillaginidae otoliths 99.7 100
To compare variability between the two methods, we cal- (109) 52.0 ± 0.5 52.6 ± 0.3
culated the daily cumulative FO values for each diet period Mean ± SE of FO distribution curve. Size of population from which
and compared the ranges (difference between maximum samples were drawn in parentheses.
150 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154
of Arripidae otoliths and DNA. Conversely, the FO of
squid DNA was similar to that of Arripidae, even though
squid comprised only 13% of mass daily intake. Squid
consumption was under-estimated by hard part analysis,
and as a component of Diet B2, was not detected.
4. Discussion
4.1. Limitations of captive experiments
Feeding experiments on captive marine mammals are
subject to unavoidable methodological limitations. Due to
the lack of large numbers of animals that are available and
suitable for these kinds of studies, small sample sizes with
restricted animal classes and species tested are ubiquitous
features of pinniped captive feeding trials (e.g. see review
of Bowen, 2000). As a consequence, multiple scats are
collected from few individuals, as opposed to the field
situation where it is assumed that mostly single scats are
collected from larger numbers of individuals. Further, the
effects of hyperphagia, fasting and diving activity on the
digestive physiology of wild pinnipeds are unlikely to be
reproduced by the activity and feeding regimes of their
captive counterparts. With recognition of these inherent
uncertainties, we extrapolate our findings to estimating
diet in free-living seals.
4.2. Initial and final detection times
The ranges of initial or final detection times using each
method were generally not continuous. For example, oto-
liths or squid beaks of test species were initially excreted in
scats produced 7.5–22.5 h or 31.5–46.5 h after first
ingestion (Table 1), with no initial detections between 22.5
and 31.5 h after first ingestion. These gaps are primarily
because scat production itself was highly discontinuous,
with 80% of scats produced overnight. It is likely that these
gaps would narrow progressively with increasing numbers
of study animals.
Detection of prey in scats using hard part or DNA
remains both inferred consumption over a similar time
scale. Under the conditions of our study, this was within
7.5–39.5 h prior to excretion. Although we were only
able to collect samples produced over 22.5 h of each
day, this conclusion is reasonable because it is unlikely
that a disproportionate number of scats were produced
during the other 90 min and it is also unlikely that scats
produced during this time contained a disproportionate
FO of prey remains (Casper et al., 2006). Other pinniped
feeding studies identifying taxa consumed using DNA
(Deagle et al., 2005) or hard part remains in scats (da
Silva and Neilson, 1985; Dellinger and Trillmich, 1988;
Harvey, 1989; Fea and Harcourt, 1997; Orr and Harvey,
2001; Staniland, 2002) have also concluded that these
methods indicate recent diet.
While it is not known how representative food passage
rates of seals in captivity are of those in free-living seals, we
surmise that the ability of both hard part and DNA analyses
to identify the most important prey consumed by seals in
field situations probably depends on individuals having
travel times of less than 24–48 h between main foraging
areas and haul outs, where scats are collected. Where travel
times are longer, stable isotope and lipid signatures would
be more appropriate analyses, as they typically describe
diet integrated over days to weeks (Tieszen et al., 1983;
Hobson et al., 1997; Iverson et al., 1997a).
4.3. Consistency of DNA and hard part signals
Even though we tested prey with robust hard parts, the
probability of detecting consumption was greater using
genetic analysis than hard part analysis of scats. This is
because FO values of prey DNA were higher for all 3 taxa
tested (Table 5) and were significantly less variable, prey
were detected sooner after initial ingestion, and both
initial and final detection times were more consistent.
These findings are reflected in the results of random
sampling simulations. Minimum sample sizes required
for detection of each test taxa were lower using the DNA
signal than otoliths or squid beaks (Table 6). The popu-
lation of scats that we sampled excluded those that were
highly unlikely to contain evidence of prey consumption,
i.e. those produced b 7.5 h or N 39.5 h after ingestion. For
this reason, the probabilities of detecting similar prey in
field collected scats by either method are likely to be lower
than those in Table 6, and minimum sample sizes re-
quired to detect these prey would be higher. Our results do
suggest, however, that prey consumed by free-living seals
are more likely to be detected using DNA analysis than
hard part analysis of scats.
4.4. Quantitative diet reconstruction
The FO index did not provide accurate quantitative
estimates of test taxa in the experimental diets using either
morphological or genetic approaches. In our study, the
means of FO distribution curves generated by random
sampling (Table 6) were similar to FO calculated using all
scats (Table 5). While this indicates that the FO of samples
are likely to reflect the population FO, this also suggests
that FO values derived from field collected scat samples
are not useful for quantitative assessment of diet. Even
though FO of prey hard parts in scats is widely used to
describe and compare diets in pinnipeds (Trites and Joy,
 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154
2005), this index does not accurately indicate the relative
amounts of prey types eaten or even correctly rank the
ordinal importance of different prey types (Pierce and
Boyle, 1991; Casper et al., 2006). Other indices used to
reconstruct diet, such as number of diagnostic hard parts
recovered or number of scats in which an otolith or beak
type is dominant, are also inaccurate. Attempts to correct
these biases are unlikely to be reliable due to the high level
of unexplained variability of hard part digestion in
pinnipeds (Bowen, 2000; Casper et al., 2006).
Consistent with our study, Deagle et al. (2005) also
found that the percent mass contribution of different taxa
to diet was not related to FO of their DNA remains in
scats. To some extent, this is not surprising because it is
unlikely that the respective protocols for detection of
different prey are equally sensitive. Success in detecting
target DNA depends on a number of factors, such as target
size and specificity of primers. As prey DNA in faeces is
of poor quality and degraded, shorter targets are more
likely be present intact and therefore amplified during
PCR (Kohn et al., 1995). In our study, squid product size
was 100 bp, which may have contributed to the relatively
high detection of squid DNA with respect to level of
consumption, compared to Arripidae DNA which had a
product size of 202 bp (Table 3). The squid primers may
also have produced more efficient amplification than the
Arripidae primers. Another factor may be the number of
prey eaten. A. georgianus individuals (196 ± 10.6 g) fed to
the study animals were N5 times heavier than Sillago spp.
individuals (37 ± 2.1 g), so that many more Sillaginidae
than Arripidae fish were consumed each day (Casper
et al., 2006). It is possible that this resulted in a more even
distribution of Sillaginidae DNA throughout the digestive
tract compared to Arripidae DNA, contributing to more
consistent detection of Sillaginidae DNA remains in scats.
4.5. Utility of DNA based identification of prey in seal scats
A substantial benefit of molecular scatology over hard
part analysis is improving the chance of detecting any
prey, regardless of morphological integrity. Despite this,
the best method to use depends not only on statistics, but
also on economics and the importance of identifying a
particular prey type. Fish with robust otoliths, such as
Sillaginidae and Arripidae, are likely to be detected by
hard part analysis of scats unless the sample size is small.
In such a case, it would be worth testing for DNA remains
if determining consumption of that prey was a central
question. In our study, detection of squid consumption
was markedly better using DNA remains in scats com-
pared to squid beaks. Squid mouth-parts are robust and
because of this, their presence in pinniped scats is widely
151
relied upon to establish if squid have been consumed.
However, the excretion of squid beaks is variable and
unpredictable (Tollit et al., 1997; Staniland, 2002; Yonezaki
et al., 2005), and in our experiment, hard part analysis of
92 scats collected during and after Diet B2 failed to identify
squid as prey. Many studies also use hard part analysis
of regurgitates to detect squid consumption. During our
feeding trial, only one regurgitate was found, and regur-
gitates of wild seals are not always present at haul outs (Fea
et al., 1999). Consequently, regurgitates cannot always be
relied upon as an alternate method to detect squid in the diet
of seals. Cephalopods are an important component of
temperate and sub-polar food webs (Cherel et al., 2004;
Cherel and Hobson, 2005), but their role in the diet of seals
may be significantly under-estimated. Our results present a
strong case for testing faecal material of free-living seals for
cephalopod DNA to establish if hard part analysis ade-
quately represents their cephalopod consumption.
The identification of all prey types is especially diffi-
cult where predators are generalists. Our study provides
evidence that DNA based techniques can offer some
practical use in determining the diet of generalists. Simple
hard part analysis is economical and easy, and can identify
ingestion of multiple prey types, but only when diagnostic
parts survive digestion. Where otoliths are not reliably
diagnostic, some workers have used bony remains of fish
to identify diet. While useful, this is an extremely lengthy
procedure and requires highly developed taxonomic skills
(Cottrell et al., 1996; Cottrell and Trites, 2002; Tollit et al.,
2003). We argue that in these situations, DNA techniques
would be more expedient. Although developing suitable
primers and protocols to reliably detect target sequences
can be time consuming, once these are established, mul-
tiple DNA samples can be analysed quickly and simul-
taneously. Importantly, identification of prey using DNA
is not compromised by the complexity of the diet. Our
experiment demonstrated this by unambiguously detect-
ing each test taxon against a background of a mixed diet.
Positive identification of the components of multiple prey
diets using DNA based tests would appear relatively un-
complicated compared to other molecular methods, such
as stable isotope and signature lipid analyses.
A limitation shared by all non-morphological methods
is that they depend on tests being developed a priori for
potential prey. Hard part analysis can identify prey more
simply, but does rely on the presence of visually diag-
nostic remains. Where no a priori knowledge of prey
exists, DNA based techniques can still provide a practical
and useful approach to investigating the diet of generalist
predators, by screening for species diversity using group
specific PCR primers. Group specific primers are de-
signed to amplify a DNA sequence unique to a range
152 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154
of species within a higher taxon (Jarman et al., 2004).
For example, scats could be tested for DNA remains of
bony fishes, cephalopods and crustaceans, or myctophids
and euphausiids, etc. These initial analyses could then be
followed up with more specific tests if necessary.
5. Conclusions and future directions
The application of genetic scatology to diet assess-
ment of marine vertebrates is very recent. Consequently,
there are many technical aspects of this approach which
have yet to be clarified. For example, feeding experi-
ments on Steller sea lions (Eumetopias jubatus, Deagle
et al., 2005) and grey seals (H. grypus, Parsons et al.,
2005) both reported detection rates of prey DNA in scats
of N 95%, much higher than we found in our study
(Table 5). These differences could be due to factors such
as pinniped species, feeding regime, sampling regime,
DNA extraction method or test protocol, amongst others.
As technical issues are resolved, and more protocols and
DNA sequence data of potential prey taxa are published,
DNA based methods will become more accessible,
practical and routine. Also, although genetic techniques
are currently limited to qualitative evaluation of diet,
there is promise that more quantitative methods may be
developed in the future. In a study on Steller sea lions fed
constant proportions of three fish species, Deagle and
Tollit (2007) explored the use of quantitative real-time
PCR (qPCR). They found that the absolute amount of
target DNA was highly variable between samples, but
concluded that semi-quantitative estimates of diet were
reasonably accurate. In our study, qPCR was not a valid
approach because nested PCRs were necessary for
successful amplification of target sequences due to the
poor quality and quantity of DNA in our samples.
Confidence intervals for qPCR data are disproportionately
large when initial template copy numbers are low (Peccoud
and Jacob, 1996), and these errors are magnified during the
second round of a nested PCR.
Genetic scatology will not replace signature lipid,
stable isotope or simple hard part analyses, but it is a
powerful addition to this suite of techniques with particu-
lar utility in certain situations. For example, DNA based
investigations into the recent diet of fur seals is a realistic
and useful option where diagnostic hard remains of prey
are not well represented in scats, or the sample size is
small. Importantly, the results of our study also imply the
broad potential of DNA scat analysis for identifying the
diet of other predators, particularly those which forage on
a wide variety of prey, or where more invasive sampling
methods are undesirable or difficult. Further research into
DNA based methods is warranted because it is highly
likely to advance our understanding of trophic relation-
ships within marine food webs.
Acknowledgements
We thank the management and marine mammal trainers
of Sea World, Australia, especially T. Long and G.
Bedford, for their enthusiastic, professional and in-kind
support of this project. We also thank S. M. Robinson for
assisting with the preparation of experimental meals and
sample collection, and the three reviewers for their
constructive comments. This research was funded by the
Australian Antarctic Division and was carried out under
University of Tasmania Animal Ethics Permit A6880.
R. M. Casper is a recipient of a University of Tasmania
Postgraduate Scholarship. [RH]
References
Acuna, H.O., Francis, J.M., 1995. Spring and summer prey of the Juan-
Fernandez fur-seal, Arctocephalus philippii. Can. J. Zool.-Rev. Can.
Zool. 73, 1444–1452.
Agnew, D.J., 1997. The CCAMLR ecosystem monitoring programme.
Antarctic Science 9, 235–242.
Anon, 2004. Chromo 4 Real-Time Detector Operations Manual. MJ
Research®, Incorporated, USA.
Arnould, J.P.Y., Nelson, M.M., Nichols, P.D., Oosthuizen, W.H., 2005.
Variation in the fatty acid composition of blubber in Cape fur seals
(Arctocephalus pusillus pusillus) and the implications for dietary inter-
pretation. J. Comp. Physiol., B. Biochem. Syst. Environ. Physiol. 175,
285–295.
Beauplet, G., Dubroca, L., Guinet, C., Cherel, Y., Dabin, W., Gagne, C.,
Hindell, M., 2004. Foraging ecology of subantarctic fur seals
Arctocephalus tropicalis breeding on Amsterdam Island: seasonal
changes in relation to maternal characteristics and pup growth. Mar.
Ecol. Prog. Ser. 273, 211–225.
Birkeland, A., Kovacs, K.M., Lydersen, C., Grahl Nielsen, O., 2005.
Transfer of fatty acids from mothers to their calves during lactation in
white whales Delphinapterus leucas. Mar. Ecol. Prog. Ser. 298,
287–294.
Bowen, W.D., 2000. Reconstruction of pinniped diets: accounting for
complete digestion of otoliths and cephalopod beaks. Can. J. Fish.
Aquat. Sci. J. Can. Sci. Halieut. Aquat. 57, 898–905.
Boyd, I.L., 2002. Estimating food consumption of marine predators:
Antarctic fur seals and macaroni penguins. J. Appl. Ecol. 39, 103–119.
Bradshaw, C.J.A., Hindell, M.A., Best, N.J., Phillips, K.L., Wilson, G.,
Nichols, P.D., 2003. You are what you eat: describing the foraging
ecology of southern elephant seals (Mirounga leonina) using blubber
fatty acids. Proc. R. Soc. Lond. Ser., B Biol. Sci. 270, 1283–1292.
Casper, R.M., Gales, N.J., Hindell, M.A., Robinson, S.M., 2006. Diet
estimation based on an integrated mixed prey feeding experiment
using Arctocephalus seals. J. Exp. Mar. Biol. Ecol. 328, 228–239.
Cherel, Y., Hobson, K.A., 2005. Stable isotopes, beaks and predators: a
new tool to study the trophic ecology of cephalopods, including
giant and colossal squids. Proc. R. Soc. Lond. Ser., B Biol. Sci. 272,
1601–1607.
Cherel, Y., Duhamel, G., Gasco, N., 2004. Cephalopod fauna of subantarctic
islands: new information from predators. Mar. Ecol. Prog. Ser. 266,
143–156.
 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154
Cottrell, P.E., Trites, A.W., 2002. Classifying prey hard part structures
recovered from fecal remains of captive Steller sea lions (Eumetopias
jubatus). Mar. Mamm. Sci. 18, 525–539.
Cottrell, P.E., Trites, A.W., Miller, E.H., 1996. Assessing the use of
hard parts in faeces to identify harbour seal prey: results of captive-
feeding trials. Can. J. Zool.-Rev. Can. Zool. 74, 875–880.
Crawford, R.J.M., Underhill, L.G., Raubenheimer, C.M., Dyer, B.M.,
Martin, J., 1992. Top Predators in the Benguela ecosystem — im-
plications of their trophic position. S. Afr. J. Mar. Sci.-Suid-Afr.
Tydsk. Seewetens. 12, 675–687.
Croll, D.A., Tershy, B.R., 1998. Penguins, fur seals, and fishing: prey
requirements and potential competition in the South Shetland
Islands, Antarctica. Polar Biol. 19, 365–374.
da Silva, J., Neilson, J.D., 1985. Limitations of using otoliths recovered
in scats to estimate prey consumption in seals. Can. J. Fish. Aquat.
Sci. 42, 1439–1442.
Daneri, G.A., Carlini, A.R., 1999. Spring and summer predation on fish
by the Antarctic fur seal, Arctocephalus gazella, at King George
Island, South Shetland Islands. Can. J. Zool.-Rev. Can. Zool. 77,
1157–1160.
Daneri, G.A., Piatkowski, U., Coria, N.R., Carlini, A.R., 1999. Predation
on cephalopods by Antarctic fur seals, Arctocephalus gazella at two
localities of the Scotia Arc, Antarctica. Polar Biol. 21, 59–63.
de Bruyn, P.J.N., Bester, M.N., Mecenero, S., Kirkman, S.P., Roux, J.P.,
Klages, N.T.W., 2003. Temporal variation of cephalopods in the
diet of Cape fur seals in Namibia. S. Afr. J. Wildl. Res. 33, 85–96.
de Bruyn, P.J.N., Bester, M.N., Kirkman, S.P., Mecenero, S., Roux, J.R.,
Klages, N.T.W., 2005. Cephalopod diet of the Cape fur seal, Arcto-
cephalus pusillus pusillus, along the Namibian coast: variation due to
location. Afr. Zool. 40, 261–270.
Deagle, B.E., Tollit, D.J., 2007. Quantitative analysis of prey DNA in
pinniped faeces: potential to estimate diet composition? Cons. Gen.
8, 743–747.
Deagle, B.E., Bax, N.J., Hewitt, C.L., Patil, J.G., 2003. Development
and evaluation of a PCR-based test for detection of Asterias
(Echinodermata: Asteroidea) larvae in Australian plankton samples
from ballast water. Mar. Freshw. Res. 54, 709–719.
Deagle, B.E., Tollit, D.J., Jarman, S.N., Hindell, M., Trites, A.W., Gales, N.,
2005. Molecular scatology as a tool to study diet: analysis of prey DNA
in scats from captive Stellar sea lions. Mol. Ecol. 14, 1831–1842.
Dellinger, T., Trillmich, F., 1988. Estimating diet composition from
scat analysis in otariid seals (Otariidae): Is it reliable? Can. J. Zool.
J. Can. Zool. 66, 1865–1870.
Duffy, D.C., Jackson, S., 1986. Diet studies of seabirds: a review of
methods. Colon. Waterbirds 9, 1–17.
Fea, N., Harcourt, R., 1997. Assessing the use of faecal and regurgitate
analysis as a means of determining diet of New Zealand fur seals.
In: Hindell, M., Kemper, C. (Eds.), Marine Mammal Research in
the Southern Hemisphere Volume 1: Status, Ecology and Medicine.
Surrey Beatty & Sons, pp. 143–150.
Fea, N.I., Harcourt, R., Lalas, C., 1999. Seasonal variation in the diet of
New Zealand fur seals (Arctocephalus forsteri) at Otago peninsula,
New Zealand. Wild. Res. 26, 147–160.
Goldsworthy, S.D., Bulman, C., He, X., Larcombe, J., Littnan, C.,
2003. Trophic interactions between marine mammals and Austra-
lian fisheries: an ecosystem approach. In: Gales, N., Hindell, M.,
Kirkwood, R. (Eds.), Marine Mammals and Humans: Fisheries,
tourism and management. CSIRO Publications, pp. 62–99.
Grahl Nielsen, O., Halvorsen, A., Bodoev, N., Averina, L., Radnaeva, L.,
Pronin, N., Kakela, R., Petrov, E., 2005. Fatty acid composition
of blubber of the Baikal seal Phoca sibirica and its marine relative,
the ringed seal P. hispida. Mar. Ecol. Prog. Ser. 305, 261–274.
153
Green, K., Burton, H.R., Williams, R., 1989. The diet of Antarctic fur
seals Arctocephalus gazella (Peters) during the breeding season at
Heard Island. Antarct. Sci. 1, 317–324.
Grellier, K., Hammond, P.S., 2006. Robust digestion and passage rate
estimates for hard parts of grey seal (Halichoerus grypus) prey.
Can. J. Fish. Aquat. Sci. 63, 1982–1998.
Harcourt, R.G., Bradshaw, C.J.A., Dickson, K., Davis, L.S., 2002.
Foraging ecology of a generalist predator, the female New Zealand
fur seal. Mar. Ecol. Prog. Ser. 227, 11–24.
Harvey, J.T., 1989. Assessment of errors associated with harbour seal
(Phoca vitulina) faecal sampling. J. Zool. 219, 101–111.
Herman, D.P., Burrows, D.G., Wade, P.R., Durban, J.W., Matkin, C.O.,
LeDuc, R.G., Barrett-Lennard, L.G., Krahn, M.M., 2005. Feeding
ecology of eastern North Pacific killer whales Orcinus orca from
fatty acid, stable isotope, and organochlorine analyses of blubber
biopsies. Mar. Ecol. Prog. Ser. 302, 275–291.
Hobson, K.A., Sease, J.L., Merrick, R.L., Piatt, J.F., 1997. Investigating
trophic relationships of pinnipeds in Alaska and Washington using
stable isotope ratios of nitrogen and carbon. Mar. Mamm. Sci. 13,
114–132.
Hume, F., Hindell, M.A., Pemberton, D., Gales, R., 2004. Spatial and
temporal variation in the diet of a high trophic level predator, the
Australian fur seal (Arctocephalus pusillus doriferus). Mar. Biol.
144, 407–415.
Iverson, S.J., 1993. Milk secretion in marine mammals in relation to
foraging: can milk fatty acids predict diet? Symp. Zool. Soc. Lond.
66, 263–291.
Iverson, S.J., Arnould, J.P.Y., Boyd, I.L., 1997a. Milk fatty acid
signatures indicate both major and minor shifts in the diet of
lactating Antarctic fur seals. Can. J. Zool. Rev. Can. Zool. 75,
188–197.
Iverson, S.J., Frost, K.J., Lowry, L.F., 1997b. Fatty acid signatures
reveal fine scale structure of foraging distribution of harbor seals
and their prey in Prince William Sound, Alaska. Mar. Ecol. Prog.
Ser. 151, 255–271.
Jarman, S.N., Wilson, S.G., 2004. DNA-based species identification of
krill consumed by whale sharks. J. Fish Biol. 65, 586–591.
Jarman, S.N., Gales, N.J., Tierney, M., Gill, P.C., Elliott, N.G., 2002.
A DNA-based method for identification of krill species and its
application to analysing the diet of marine vertebrate predators. Mol.
Ecol. 11, 2679–2690.
Jarman, S.N., Deagle, B.E., Gales, N.J., 2004. Group-specific polymer-
ase chain reaction for DNA-based analysis of species diversity and
identity in dietary samples. Mol. Ecol. 13, 1313–1322.
Jarman, S.N., Redd, K.S., Gales, N.J., 2006. Group-specific primers for
amplifying DNA sequences that identify Amphipoda, Cephalopoda,
Echinodermata, Gastropoda, Isopoda, Ostracoda and Thoracica. Mol.
Ecol. Notes 6, 268–271.
Kohn, M.H., Wayne, R.K., 1997. Facts from feces revisited. Trends Ecol.
Evol. 12, 223–227.
Kohn, M.H., Knauer, F., Stoffella, A., Schroder, W., Paabo, S., 1995.
Conservation genetics of the European brown bear — a study
using excremental PCR of nuclear and mitochondrial sequences.
Mol. Ecol. 4, 95–103.
Kvitrud, M., Riemer, S., Brown, R., Bellinger, M., Banks, M., 2005.
Pacific harbor seals (Phoca vitulina) and salmon: genetics presents
hard numbers for elucidating predator–prey dynamics. Mar. Biol.
147, 1459–1466.
Lea, M.A., Cherel, Y., Guinet, C., Nichols, P.D., 2002. Antarctic fur
seals foraging in the Polar Frontal Zone: inter- annual shifts in diet
as shown from fecal and fatty acid analyses. Mar. Ecol. Prog. Ser.
245, 281–297.
154 R.M. Casper et al. / Journal of Experimental Marine Biology and Ecology 347 (2007) 144–154
Morrison, T.B., Weis, J.J., Wittwer, C.T., 1998. Quantification of low-
copy transcripts by continuous SYBR Green I monitoring during
amplification. BioTechiques 24, 954–962.
Naya, D.E., Arim, M., Vargas, R., 2002. Diet of South American fur
seals (Arctocephalus australis) in Isla de Lobos, Uruguay. Mar.
Mamm. Sci. 18, 734–745.
Nyssen, F., Brey, T., Dauby, P., Graeve, M., 2005. Trophic position of
Antarctic amphipods — enhanced analysis by a 2-dimensional
biomarker assay. Mar. Ecol. Prog. Ser. 300, 135–145.
Orr, A.J., Harvey, J.T., 2001. Quantifying errors associated with using fecal
samples to determine the diet of the California sea lion (Zalophus
californianus). Can. J. Zool.-Rev. Can. Zool. 79, 1080–1087.
Orr, A.J., Banks, A.S., Mellman, S., Huber, H.R., DeLong, R.L.,
Brown, R.F., 2004. Examination of the foraging habits of Pacific
harbor seal (Phoca vitulina richardsi) to describe their use of the
Umpqua River, Oregon, and their predation on salmonids. Fish.
Bull. 102, 108–117.
Page, B., McKenzie, J., Goldsworthy, S.D., 2005. Dietary resource
partitioning among sympatric New Zealand and Australian fur seals.
Mar. Ecol. Prog. Ser. 293, 283–302.
Parsons, K.M., Dallas, J.F., Claridge, D.E., Durban, J.W., Balcomb,
K.C., Thompson, P.M., Noble, L.R., 1999. Amplifying dolphin
mitochondrial DNA from faecal plumes. Mol. Ecol. 8,
1766–1768.
Parsons, K.M., Piertney, S.B., Middlemas, S.J., Hammond, P.S.,
Armstrong, J.D., 2005. DNA-based identification of salmonid prey
species in seal faeces. J. Zool., Lond. 266, 275–281.
Peccoud, J., Jacob, C., 1996. Theoretical uncertainty of measurements
using quantitative polymerase chain reaction. Biophys. J. 71, 101–108.
Pierce, G.J., Boyle, P.R., 1991. A Review of Methods for Diet Analysis in
Piscivorous Marine Mammals. Oceanogr. Mar. Biol. 29, 409–486.
Purcell, M., Mackey, G., LaHood, E., 2004. Molecular methods for the
genetic identification of salmonid prey from the Pacific harbor seal
(Phoca vitulina richardsi) scat. Fish. Bull. 102, 213–220.
Richardson, K.C., Gales, N.J., 1987. Functional morphology of the
alimentary tract of the Australian sea-lion, Neophoca cinerea. Aust.
J. Zool. 35, 219–226.
Roux, K.H., 1995. Optimization and troubleshooting in PCR. PCR
Methods Appl. 4, S185–S194.
Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general users
and for biological programmers. In: Krawetz, S., Misener, S. (Eds.),
Bioinformatics Methods and Protocols: Methods in Molecular
Biology. Humana Press, Totowa, NJ, pp. 365–386.
Staniland, I.J., 2002. Investigating the biases in the use of hard prey remains
to identify diet composition using Antarctic fur seals (Arctocephalus
gazella) in captive feeding trials. Mar. Mamm. Sci. 18, 223–243.
Staniland, I.J., Pond, D.W., 2005. Investigating the use of milk fatty
acids to detect dietary changes: a comparison with faecal analysis
in Antarctic fur seals. Mar. Ecol. Prog. Ser. 294, 283–294.
Sweeting, C.J., Jennings, S., Polunin, N.V.C., 2005. Variance in isotopic
signatures as a descriptor of tissue turnover and degree of omnivory.
Funct. Ecol. 19, 777–784.
Tieszen, L.L., Boutton, T.W., Tesdahl, K.G., Slade, N.A., 1983.
Fractionation and turnover of stable carbon isotopes in animal tissues:
implications for d13C analysis of diet. Oecologia 57, 32–37.
Tollit, D.J., Steward, M.J., Thompson, P.M., Pierce, G.J., Santos, M.B.,
Hughes, S., 1997. Species and size differences in the digestion of
otoliths and beaks: Implications for estimates of pinniped diet
composition. Can. J. Fish. Aquat. Sci. J. Can. Sci. Halieut. Aquat. 54,
105–119.
Tollit, D.J., Wong, M., Winship, A.J., Rosen, D.A.S., Trites, A.W.,
2003. Quantifying errors associated with using prey skeletal
structures from fecal samples to determine the diet of Steller's sea
lion (Eumetopias jubatus). Mar. Mamm. Sci. 19, 724–744.
Trites, A.W., Joy, R., 2005. Dietary analysis from scat samples: how
many scats are enough? J. Mammal. 86, 704–712.
Wittwer, C.T., Herrmann, M.G., Moss, A.A., Rasmussen, R.P., 1997.
Continuous fluorescence monitoring of rapid cycle DNA ampli-
fication. BioTechniques 22, 130–138.
Yonezaki, S., Kiyota, M., Koido, T., Takemura, A., 2005. Effects of squid
beak size on the route of egestion in northern fur seals (Callorhinus
ursinus): results from captive feeding trials. Mar. Mamm. Sci. 21,
567–574.