Veterinary Parasitology 223 (2016) 210–213

Contents lists available at ScienceDirect

Veterinary Parasitology
journal homepage: www.elsevier.com/locate/vetpar

Short communication

Aberrant Ancylostoma sp. in the brain of a dog

Amie Perry ∗ , Sriveny Dangoudoubiyam, Melanie Bolling, Aline Rodrigues-Hoffmann
Department of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA

a r t i c l e i n f o a b s t r a c t

Article history: A 14-month-old, male American Bulldog presented to Texas A&M University Veterinary Medical Teach-
Received 4 November 2015 ing Hospital in August of 2012 for anorexia, hydrophobia and gradually worsening neurologic signs.
Received in revised form 1 April 2016 Grossly hemorrhage on the left side of the caudal cerebrum and cerebellum was observed and histolog-
Accepted 18 April 2016
ically corresponded with necrohemorrhagic and lymphoplasmacytic encephalitis associated with adult
nematodes. Based on morphology and molecular analysis, these were identified as Ancylostoma sp.
Keywords:
© 2016 Elsevier B.V. All rights reserved.
Aberrant
Ancylostoma
Canine
Encephalitis

A 14-month-old, male American Bulldog presented to the Texas
A&M University Veterinary Medical Teaching Hospital in August of
2012 for a two-day history of anorexia, one-day history of apparent
hydrophobia or dysphagia (staring at the water bowl but refusing
to drink) and gradually worsening lethargy and depressed men-
tation. Approximately ten days prior to presentation right pelvic
limb lameness was observed and two days later the owner reported
that the left eye was “bloodshot.” The patient lived in a suburban
environment indoors with one other dog but was allowed out-
doors including wooded areas and an adjacent city park for several
hours each day. The patient had received no vaccinations and par-
asite control and treatment history was not provided in the clinical
history. On presentation, the patient was approximately 8% dehy-
drated, quiet, dull, and depressed with generalized ataxia, head
pressing, and photophobia. Temperature, heart rate, and respira-
tory rate were within normal limits. Serum chemistry analysis,
complete blood count, and urinalysis were within normal limits.
Differential diagnoses for neurologic signs in a young adult,
unvaccinated dog include trauma or congenital disease, as well as
infectious agents including rabies virus and canine distemper virus,
protozoa such as Neospora caninum or Toxoplasma gondii, fungi such
as Aspergillus spp., or Cryptococcus neoformans, and migration of
larval helminths. Another possible cause for neurologic signs in a
dog is metabolic disease, such as hepatic encephalopathy.
∗ Corresponding author at: Department of Veterinary Pathobiology, College of Vet-
erinary Medicine and Biomedical Sciences, Texas A&M University, MS 4467 TAMU,
College Station, TX 77843-4467, USA.
E-mail address: aperry@cvm.tamu.edu (A. Perry).
Due to neurologic signs, including apparent hydrophobia, and
lack of vaccination, rabies was suspected. No diagnostic imaging
was performed. The patient was euthanized and the body submit-
ted for limited post mortem examination, which only requested
brain examination and submission for rabies testing.
On postmortem examination, there was extensive hemorrhage
of the left side of the brainstem from the caudal colliculi to the
caudal cerebellar peduncles (Fig. 1). The appropriate sample was
collected and submitted for rabies testing at the Texas Depart-
ment of State Health Services and the remaining brain was fixed
in 10% neutral buffered formalin for histologic evaluation. A neg-
ative result was reported for rabies testing. The fixed sections of
cerebrum, brainstem and cerebellum were routinely processed,
paraffin embedded, sectioned at 5um, and stained with hema-
toxylin and eosin. Sections of the cerebrum were unremarkable
on microscopic examination. In the cerebellum and brainstem
there was marked local necrosis and loss of gray and white mat-
ter. The sections had extensive hemorrhage mixed with gitter
cells, fibrin, edema, lymphocytes, plasma cells, fewer neutrophils,
rare eosinophils and multinucleate giant macrophages surround-
ing cross and tangential sections of adult nematodes (Figs. 2–4
). Throughout the remaining parenchyma there was significant
edema and wide perivascular cuffs of lymphocytes and plasma
cells with scattered eosinophils with similar inflammatory infil-
trates extending into the meninges. Occasionally vascular walls
were brightly eosinophilic and hyaline (fibrinoid necrosis). There
were scattered spheroids and neurons with central chromatoly-
sis. Nematodes were approximately 500 ␮m in diameter with an
approximately 15 ␮m smooth, eosinophilic hyaline cuticle, vac-
uolated low lateral cords divided into sublaterals, pseudocoelom,
bulbous internal cuticular ridges, platymyarian musculature, ovary,

http://dx.doi.org/10.1016/j.vetpar.2016.04.023
0304-4017/© 2016 Elsevier B.V. All rights reserved.
 A. Perry et al. / Veterinary Parasitology 223 (2016) 210–213
Fig. 1. Brainstem at the level of the mesencephalon. Multifocal hemorrhage and
necrosis.
Fig. 2. Brainstem. 20× magnification photomicrograph. Hematoxylin and eosin.
Necrohemorrhagic encephalitis with intralesional adult Ancylostoma spp.
Fig. 3. Brainstem. 200× magnification photomicrograph of an adult Ancylostoma
spp. from the same section as Fig. 2. Cuticle, lateral cord, and intestine containing
host erythrocytes indicated by arrow, arrowhead, and star, respectively.
and a large central intestine composed of multinucleate cells with
a prominent brush border whose lumen contained a moderate
amount of host blood (Fig. 3). Based on these morphologic features,
the nematode was identified as an adult female Ancylostoma sp.
211
Fig. 4. Brainstem. 400× magnification photomicrograph. Hematoxylin and eosin.
Lesions in the brainstem were characterized by necrosis and hemorrhage with
numerous gitter cells.
Fig. 5. Agarose gel electrophoresis showing amplification of the rRNA gene
sequence. Genomic DNA from formalin fixed tissue curls of brain (patient) and intes-
tine (positive control) sections showing hookworm like nematodes was used as
template. L: 100 bp molecular ruler, N: negative control, C: patient case, P: positive
control.
Generic primers were custom designed to amplify the riboso-
mal RNA sequence of hookworm species (Table 1). Genomic DNA
isolated from formalin-fixed paraffin embedded tissue curls of the
brain from the patient, and positive control tissue that showed
presence of nematode sections on the intestine was used as tem-
plate for polymerase chain reaction (PCR). Conventional PCR was
performed using Phusion high-fidelity (NEB, Ipswich, MA) poly-
merase and amplifications were performed on T100 Thermal Cycler
(Bio-Rad, Hercules, CA). Amplified PCR products were sequenced,
and a blast search against sequences in GenBank was performed to
confirm the identity of the nematode in the brain of this patient.
Both primer pairs were tested on the patient sample and posi-
tive control. Successful amplification of 366 bp product with primer
pair-1 was achieved only using positive control tissue as template.
The 293 bp product using primer pair-2 was successfully amplified
using the patient sample as template (Fig. 5). Since both primers
target the ribosomal RNA gene, no further attempts were made to
amplify the alternate targets. Blast search of the sequence of both
PCR products indicated that the nematode seen in the brain tissue
sections was Ancylostoma caninum.
212 A. Perry et al. / Veterinary Parasitology 223 (2016) 210–213
Table 1
Generic primer sequences custom designed using the published hookworm ribosomal RNA gene sequences available in GenBank. The table shows primer sequences, annealing
temperature, anticipated product sizes, and the rRNA gene region amplified by respective primer pairs.
Primer combination Primer sequence
Pair-1 5 - ttgatcctgagaaaccaacg-3
HW-Fw-1 HW-Rv-1 5 -accgatccatcgctgaag-3
Pair-2 5 -tggtgaaattttgaacgcata-3
HW-Fw-2 HW-Rv-2 5 - ggttgcattgcaaataacag −3
To the authors’ knowledge this is the first report of an adult
hookworm in the central nervous system of any animal. Although
the mechanism for introduction of adult Ancylostoma sp. into
the brain cannot be explained, the hemorrhage and inflamma-
tory reaction surrounding the nematodes favors their presence at
this location as the cause of the neurologic signs in this dog. This
nematode was determined to be from the order Strongylida based
upon its intestine, which is composed of few multinucleated cells
with a prominent brush border and further classified into family
Ancylostomidae based on the lack of longitudinal cuticular ridges
characteristic of Trichostrongyles, and lack of the coelomyarian
musculature and accessory hypodermal cords of Metastrongyles.
Based on the division of the lateral cords into sublaterals, the bul-
bous appearance of the internal cuticular ridge, and the presence
of multiple sections of ovary it was determined that the nematode
was an adult female Ancylostoma sp.
Cerebrospinal nematodiasis involving adult parasites is uncom-
monly reported in the central nervous system of veterinary species.
Among the most commonly reported are Halicephalobus gingivalis
in horses (Eydal et al., 2012; Hermosilla et al., 2011) and Pare-
laphostrongylus tenuis predominantly in camelids. In reports from
Chile, adult Gurltia paralysans have been found in the spinal cord
of cats and infection is associated with chronic pelvic limb para-
paresis (Moroni et al., 2012). Horses with central nervous system
halicephalobiasis commonly show neurologic signs depending on
the site of infection including ataxia, recumbency, hypermetria, and
hyperesthesia (Eydal et al., 2012; Hermosilla et al., 2011). These
neurologic signs are associated with rapid proliferation of the para-
site within the central nervous system and the resultant destruction
and granulomatous inflammation induced by the parasites. P. tenuis
has also been reported to cause meningomyelitis or encephalitis in
other wild ruminants (Nagy, 2004), and domestic animals includ-
ing cattle (Mitchell et al., 2011), horses (Tanabe et al., 2010; Tanabe
et al., 2007), and guinea pigs (Southard et al., 2013), and rarely
is found in other locations (Reinstein et al., 2010). In its defini-
tive host, the white-tailed deer (Odocoileus virginianus), larvae of
P. tenuis enter the dorsal horn of the spinal cord, mature to adults,
and migrate into the subarachnoid space. In animals other than
the definitive host, the larvae aberrantly migrate in the spinal cord,
resulting in inflammation and disease (Nagy, 2004). In halicephalo-
biasis and parelaphostrongyliasis gross lesions may range from
inapparent (Hermosilla et al., 2011) to varying degrees of edema
and hemorrhage in affected tissues (Eydal et al., 2012; Tanabe et al.,
2007) and in some cases of parelaphostrongyliasis, discrete nodules
in the meninges (Mitchell et al., 2011).
The majority of reports of central nervous system nematodiasis
in animals are of larval migration. Organisms reported in the central
nervous system of dogs include Baylisascaris procyonis (Rudmann
et al., 1996), Angiostrongylus vasorum (Denk et al., 2009; Negrin
et al., 2008), Angiostrongylus cantonensis in Australia (Lunn et al.,
2012), Dirofilaria immitis, Spirocerca lupi (Du Plessis et al., 2007; Dvir
et al., 2007), and Strongyloides sp. (Snook et al., 2009). A common
route of migration into the central nervous system by larval nema-
todes and cestodes is hematogenous spread after penetration of the
intestinal tract and entrance into the systemic circulation via the
Annealing temperature Product size (bp) Region of rRNA
used (◦ C) gene amplified
56 366 18S and ITS1
54 293 5.8S and ITS2
portal vein (Katchanov and Nawa, 2010). Nematode larval migra-
tion through central nervous system tissues may result in various
neurologic signs, depending on the location of the main lesions.
These signs include depression, ataxia, seizures, paresis, hyperes-
thesia, abnormal reflex responses, and blindness. Gross lesions are
variable, ranging from inapparent (Snook et al., 2009) to large areas
of parenchymal necrosis, loss, and hemorrhage (Denk et al., 2009).
Microscopic lesions are often more severe than gross lesions, and
frequently include sections of the larvae, facilitating diagnosis of
a specific cause for the central nervous system clinical signs and
lesions. In the case of the patient reported here, gross and histologic
lesions were evident, including hemorrhage in the brainstem, and
cross sections of adult nematodes within the areas of inflammation
and hemorrhage but confirmation of the causative organism was
made utilizing polymerase chain reaction.
Conflicts of interest
The author(s) declared no potential conflicts of interest with
respect to the research, authorship, and/or publication of this arti-
cle.
Funding
The author(s) received no financial support for the research,
authorship, and/or publication of this article.
References
Denk, D., Matiasek, K., Just, F.T., Hermanns, W., Baiker, K., Herbach, N., Steinberg, T.,
Fischer, A., 2009. Disseminated angiostrongylosis with fatal cerebral
haemorrhages in two dogs in Germany: a clinical case study. Vet. Parasitol.
160, 100–108.
Du Plessis, C.J., Keller, N., Millward, I.R., 2007. Aberrant extradural spinal migration
of Spirocerca lupi: four dogs. J. Small Anim. Pract. 48, 275–278.
Dvir, E., Perl, S., Loeb, E., Shklar-Hirsch, S., Chai, O., Mazaki-Tovi, M., Aroch, I.,
Shamir, M.H., 2007. Spinal intramedullary aberrant Spirocerca lupi migration in
3 dogs. J. Vet. Intern. Med. 21, 860–864.
Eydal, M., Bambir, S.H., Sigurdarson, S., Gunnarsson, E., Svansson, V., Fridriksson, S.,
Benediktsson, E.T., Sigurdardottir, O.G., 2012. Fatal infection in two Icelandic
stallions caused by Halicephalobus gingivalis (Nematoda: Rhabditida). Vet.
Parasitol. 186, 523–527.
Hermosilla, C., Coumbe, K.M., Habershon-Butcher, J., Schoniger, S., 2011. Fatal
equine meningoencephalitis in the United Kingdom caused by the
panagrolaimid nematode Halicephalobus gingivalis: case report and review of
the literature. Equine Vet. J. 43, 759–763.
Katchanov, J., Nawa, Y., 2010. Helminthic invasion of the central nervous system:
many roads lead to Rome. Parasitol. Int. 59, 491–496.
Lunn, J.A., Lee, R., Smaller, J., MacKay, B.M., King, T., Hunt, G.B., Martin, P.,
Krockenberger, M.B., Spielman, D., Malik, R., 2012. Twenty two cases of canine
neural angiostronglyosis in eastern Australia (2002–2005) and a review of the
literature. Parasites Vectors 5, 70.
Mitchell, K.J., Peters-Kennedy, J., Stokol, T., Gerhold, R.W., Beckstead, R.B., Divers,
T.J., 2011. Diagnosis of Parelaphostrongylus spp. infection as a cause of
meningomyelitis in calves. J. Vet. Diagn. Invest. 23, 1097–1103.
Moroni, M., Munoz, P., Gomez, M., Mieres, M., Rojas, M., Lillo, C., Aguirre, F.,
Acosta-Jamett, G., Kaiser, M., Lindsay, D.S., 2012. Gurltia paralysans
(Wolffhugel, 1933): description of adults and additional case reports of
neurological diseases in three domestic cats from southern Chile. Vet.
Parasitol. 184, 377–380.
Nagy, D.W., 2004. Parelaphostrongylus tenuis and other parasitic diseases of the
ruminant nervous system. Vet. Clin. North Am. Food Anim. Pract. 20, 393–412,
viii.
 A. Perry et al. / Veterinary Parasitology 223 (2016) 210–213
Negrin, A., Cherubini, G.B., Steeves, E., 2008. Angiostrongylus vasorum causing
meningitis and detection of parasite larvae in the cerebrospinal fluid of a pug
dog. J. Small Anim. Pract. 49, 468–471.
Reinstein, S.L., Lucio-Forster, A., Bowman, D.D., Eberhard, M.L., Hoberg, E.P., Pot,
S.A., Miller, P.E., 2010. Surgical extraction of an intraocular infection of
Parelaphostrongylus tenuis in a horse. J. Am. Vet. Med. Assoc. 237,
196–199.
Rudmann, D.G., Kazacos, K.R., Storandt, S.T., Harris, D.L., Janovitz, E.B., 1996.
Baylisascaris procyonis larva migrans in a puppy: a case report and update for
the veterinarian. J. Am. Anim. Hosp. Assoc. 32, 73–76.
Snook, E.R., Baker, D.G., Bauer, R.W., 2009. Verminous myelitis in a pit bull puppy. J.
Vet. Diagn. Invest. 21, 400–402.
213
Southard, T., Bender, H., Wade, S.E., Grunenwald, C., Gerhold, R.W., 2013. Naturally
occurring Parelaphostrongylus tenuis-associated choriomeningitis in a guinea
pig with neurologic signs. Vet. Pathol. 50, 560–562.
Tanabe, M., Gerhold, R.W., Beckstead, R.B., de Lahunta, A., Wade, S.E., 2010.
Molecular confirmation of Parelaphostrongylus tenuis infection in a horse with
verminous encephalitis. Vet. Pathol. 47, 759.
Tanabe, M., Kelly, R., de Lahunta, A., Duffy, M.S., Wade, S.E., Divers, T.J., 2007.
Verminous encephalitis in a horse produced by nematodes in the family
protostrongylidae. Vet. Pathol. 44, 119–122.