ISSN 0975 -8542

Journal of Global Pharma Technology

Available Online at www.jgpt.co.in

Research Paper

Sequencing of Proteus Toxic Agglutinin (Pta) Gene in Proteus

mirabilis and Cytotoxic Effect of Pta on Human Colon Cancer Cell
and Human Kidney Cell
Lamees A. Abdul-Lateef

University of Babylon, College of Medicine, Department of Microbiology, Iraq.

Abstract

Objective:- Study the sequencing of Pta gene and the cytotoxic effect of pta gene on SW480 and ACHN
cell line.
Material and method:- Detection of pta gene by using PCR technique, detection of mutation in the Pta
gene by used automated sequencing. Also the cytotoxic effect of Pta toxin on cell lines of SW480 and
ACHN cell were used in vitro.
Results:- The result was revealed that the Pta gene is present in 17 isolates (15 isolated from urine and 2
isolates from stool). Sequencing of Pta gene from isolates of Proteus mirablis reveals of 43 mutations in
five isolates and gives identity in percentage (92-95%) with standard strand in NCBI web site. However,
the cytotoxic effect of Pta on cells line of SW480 and ACHN were used in vitro was also investigated. The
result was shown that the effect of Pta toxin on SW480 lead to the proliferation of cell was significantly
elevated when Pta toxin at 12.5%, 25%, and 50% concentrations. The concentration 50% of Pta toxin a
significantly better effect on cell growth On the other hand, ACHN cell was gradually increase in
growth at concentrations (6.25%, 12.5%%, 25%, and 50%)

Keywords: Proteus toxic agglutinin gene, Sequencing, Human colon cancer cell line, Human kidney cell
line.

Introduction
Proteus mirabilis is the causative
microorganism of urinary tract infection
(UTI) in the complicated urinary tract, most
recurrently in patients with the indwelling
catheters or structural abnormalities of the
urinary tract [1]. However, Proteus is one of
the causative agent of gastroenteritis
especially this organism considered normal
micro flora of intestine. It expresses various
virulence factors which are included
adhesions, toxins, motility, enzymes,
quorum-sensing and immune invasion [2].
Pta (Proteus toxic agglutinin), an auto-
transporter with subtilis in-like serine
protease activity, anchored at the surface of
bacterial. It is one of six putative auto-
transporters encoded in the genome of
Proteus mirabilis strain HI4320 [3]. Proteus
toxic agglutinin is the first characterized
auto-transporter that remains membrane-
bound and exhibits both activities.
©2009-2017, JGPT. All Rights Reserved
Cytotoxicity, but not auto-agglutination,
requires serine protease activity. Generally,
secreted auto-transporters have cytotoxic
properties while membrane-bound auto-
transporters mediate aggregation or
adhesion. Proteus toxic agglutinin is more
active at pH is alkaline, since the activity of
the urease enzyme result in a local elevates
the pH of urine during infection. Certainly,
the transcription and protein levels of
Proteus toxic agglutinin are elevated when
Proteus mirabilis is cultured in alkaline
conditions [4].
However, the mechanism of Pta cytotoxicity
is unknown, intoxication of host cell with
Pta result in membrane damage, actin
depolymerisation, and final lysis [4].
Pta is a bi-functional outer-membrane auto-
transporter that mediates cell–cell
accumulation and furthermore contains a
112
 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

catalytically active α-domain equipped of
lysing bladder and kidney cells [5].
The irregular adhesin–toxin was early
distinguished as an outer-membrane surface-
expressed protein that is recognized by the
mouse immune system [6], and the loss of
Proteus toxic agglutinin results in a critical
colonization imperfection in the kidneys and
bladder, and in addition lessened pathology
[4].
Inactivation of Proteus toxic agglutinin
results in a greater diminishment in
cytotoxicity. Proteus toxic agglutinin describe
as cytotoxin with no bacterial homologues that
works optimally in the alkalinized urinary
tract, a characteristic of urease-mediated urea
hydrolysis during Proteus mirabilis infection
[7].
Proteus toxic agglutinin is a surface-
associated, alkaline protease, calcium-
dependent that exhibits time-dose-dependent
cytotoxicity with cultured epithelial
cells. Proteus mirabilis cytotoxicity was
diminished in an isogenic Proteus toxic
agglutinin mutant in vitro, and the mutant
strain was likewise outcompeted by the wild-
type strain during co challenge in a mouse
model of Proteus urinary tract [8].
Materials and Methods
Patients
A total of 100 samples only 20 isolates of
Proteus mirabilis were recovered from clinical
samples, this include 16 isolates were isolated
from urine sample with UTI patients, and 4
isolates were isolated from stool from patients
complaining with diarrhea. All samples or
individual were admitted to Al-Hilla surgical
teaching hospital in Al-Hilla city/ Iraq.
Diagnosis of Bacteria
All samples were obtained from patients with
UTI and diarrhea was cultured on blood agar
and MacConkey agar and the plates were
incubated at 37⁰ C overnight. Diagnosis of the
bacteria was carried out by biochemical
methods (oxidise test, catalyse test, swarming,
unease test, and IMViC test) according to
Bergy,s Manual for Determinative
Bacteriology [9].
DNA Extraction
DNA was extracted from bacterial isolate
according to the kit (Promega/ U.S.A.)
Molecular Detection of Pta Gene by PCR
(Polymerase Chain Reaction)
Primer and PCR conditions were used to
detect gene of Pta are present in table (1).
However, each 25μl of PCR consist of each
upstream and downstream primer (2.5 μl ),
free nuclease water (2.5 μl ), DNA extraction
in concentration 0.1μg/ml (5μl ), and master
mix (12.5 μl). The polymerase chain reaction
amp icon was detected by gel electrophoresis
on 1.5% agarose gels for 40 min at 70 V.

Table 1: Primer sequence and PCR condition

Gene Primer sequence PCR condition Product Reference
size (bp)
Pta F:5'- GTGGATAGCGCATTCCCGTA-3' 95 ⁰ C 5min 1x 187 This study
R:5'- CAAAAAGACTGGGGGCTTGC-3' 95 ⁰ C 30sec
59.3 ⁰ C 30sec 30x
72 ⁰ C 20sec
72 ⁰ C 5min 1x

Detection of Pta Gene by Automated This method was performed according to

Sequencing [10] with some modification which is
According to the results of PCR product, include the flow rate of 1.2 ml / min and
several DNA samples were subjected to detector (florescence) at
sequencing by Macro gene Company/ USA, excitation=340nm and emission=440nm
which give the identity of the genes and the column used was C18- ODS (25
comprised with the original genes in gene cm * 4.6 mm).
bank by blast program which is available at
the national centre biotechnology information The system was formulated as the
(NCBI) following: 5 min elution with 20 %
acetonitrile, followed by a 30 min
Purification of Pta by HPLC (High
gradient to 80 % acetonitrile.
Performance Liquid Chromatography)

©2009-2017, JGPT. All Rights Reserved 113

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

Cell-line the crystal violet staining solution was added

The Sw480 is a model for human colon
cancers and ACHN is the model of for human
kidney cell line. The two cells line was kindly
obtained and cultured at cancer research lab
/ medical college – University of Babylon.
The viable cells number was determined by
using crystal violet assay before and after
using the toxin. The toxin (Pta) was cultured
96 well plates with SW480 and ACHN cell
line separately with different volume of
toxins. Then the 96 well plates was incubated
at 37Cº for 24 hours. We divided the plated
cells into six groups: group 1 as a control (not
treated); group 2 (add 3.13 µl of toxin); group
3 (add 6.25 µl of toxin); group 4 (add 12.5 µl
of toxin); group 5 (add 25µl of toxin) and
group 6 (add 50µl of toxin). The final cells
volume with toxin was 200µl. The plated cells
were incubated at 37°C for 24 hours before
counting [11].
Crystal Violet Assay
The cultured cells were washed with 100µl of
Phosphate buffer saline (PBS) and 200µL of
to the cells in the 96 well plate. These cells
were fixed and stained for 20 minutes at
room temperature. Next plate was
generously rinsed and allowed to dry
overnight. The next day the dried and
stained cells were measured at an
absorbance of 570nm by micro plate reader
[12].
Results and Discussions
Detection of Pta Gene by PCR
Pta is a recently recognized as virulence
factor in Proteus mirabilis. The PCR
technique was used investigation of the pta
gene through the use of pieces of DNA with a
limited number of oil go nucleotide which act
as primer specialized a virulence gene of
Proteus mirabilis. The result of the current
study was shown that pta gene was present
in 15 isolates out 16 isolates at rate (93.75%)
from urine samples and 2 isolates out of 4
isolates at rate (50%) from stool samples as
shown in fig (1).

M 1 2 3 4 5 6 7 8 9 10 11 12

1500bp
1000bp
500bp
187bp
100bp

Fig. 1: Agarose gel electrophoresis of PCR product of Pta gene. M: DNA marker (100-1500bp);
Lane (1): Negative control; Lane (2): Positive control, Lanes (3-10) isolates obtained from
urine; Lanes (11, 12) isolates obtained from stool

The result of current study is identical with
result obtained by [7] who were found that
the pta gene is present in almost isolates of
Proteus mirabilis. [2] Were found the
expression of pta was distinguished in
urinary isolates Proteus mirabilis negative
pta gene had reduced pathology as well as,
defect in colonization of kidneys and bladder
Proteus mirabilis may not be as homogeneous
as once thought as genetic variance is
possible, especially when pathogen specific
factor (e.g. auto transporter)
Sequencing of Pta Gene
The results of gene sequence analysis pta
was shown that there were 43 mutation in 5
isolates of the gene pta as shown in fig (2)
and table (2)

©2009-2017, JGPT. All Rights Reserved 114

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

1-Isolate number (1)

2- Isolate number (2)

3- Isolate number (3)

4- Isolate number (4)

©2009-2017, JGPT. All Rights Reserved 115

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

5- Isolate number (5)

Fig. 2: Sequencing results of pta gene of Proteus mirabilis in five isolates

Table 2: Type of mutations in the pta gene sequence in Proteus mirabilis

No. of Wild Mutant Site Change in amino acid Type of Effect
isolates type type mutation
GCT GC- 2556502 Deletion T Deletion Frame shift
GCA GC- 2556511 Deletion A Deletion Frame shift

TGA TG- 2556514 Deletion A Deletion Frame shift

1 AAA AAG 2556517 Lysine/Lysine Substitution Silent

CGA CAA 2556571 Arginine/Glutamine Substitution Missense

CAC CTC 2556580 Histidine/Leucine Substitution Missense

TAG TAA 2556614 Stop Substitution Nonsense

CAT AAT 2556618 Histidine/Asparagine Substitution Missense

TGG GGG 2556623 Tryptophan/Glycine Substitution Missense

AGT TTT 2556638 Serine/Phenylalanine Substitution Missense

2556639
GCT GGC 2556501 Alanine/Glycine Substitution Missense
2556502
2
AAA AAG 2556517 Lysine/Lysine Substitution Silent

CGA CGT 2556520 Arginine/Arginine Substitution Silent

CGA CAA 2556571 Arginine/Glycine Substitution Missense

CAC CTC 2556580 Histidine/Leucine Substitution Missense

CAT AAT 255618 Histidine/Asparagine Substitution Missense

AGT TTT 255639 Serine/Phenylalanine Substitution Missense

255640
TTT ttAT 2556504/2556505 Insertion A Insertion Frame shift

3 AAA AAG 2556517 Lysine/Lysine Substitution Silent

CAG CGT 2556520 Arginine/Arginine Substitution Silent

GAG AAG 2556557 Aspartic acid/Lysine Substitution Missense

CGA CAA 2556571 Arginine/Glycine Substitution Missense

TAG TAA 2556614 Stop Substitution Missense

AGT ATT 2556640 Serine/Isoleucine Substitution Missense

TCA TCG 2556493 Serine/Serine Substitution Missense

CCT CTT 2556495 Proline/Leucine Substitution Missense

TTG TTGG 2556498/2556499 Insertion G Insertion Frame shift

4 GCT GTCT 2556500/2556501 Insertion T Insertion Frame shift

ACT -CA 2556505 Deletion A Deletion Frame shift

2556507 Isoleucine/Threonine Substitution Missense

©2009-2017, JGPT. All Rights Reserved 116

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

TGA TG- 2556513 Deletion A Deletion Frame shift

AAA AAG 2556516 Lysine/Lysine Substitution Silent

CGA CGT 2556519 Arginine/Arginine Substitution Silent

CGA CAA 2556571 Arginine/Glutamine Substitution Missense

TAG TAA 2556614 Stop Substitution Nonsense

CAT AAT 2556618 Histidine/Asparagine Substitution Missense

GCT GGC 25564501 Alanine/Glycine Substitution Missense
25564502
5
AAA AAG 25564516 Lysine/Lysine Substitution Silent

GAT GAC 25564522 Asparagine/Asparagine Substitution Silent

GAG AGAG 25564541/25564542 Insertion A Insertion Frame shift

AGT AAT 25564549 Serine/Asparagine Substitution Missense

TAG TAA 25564614 Stop Substitution Nonsense

GTC TTC 25564640 Alanine/Phenylalanine Substitution Missense

The result of DNA sequencing should
examined to verify the nucleotide sequence
with other word strain (Proteus mirabilis
strain HI4320). The test was used to verify
by using National Centre of Biotechnology
Information- BLAST online, it was precise
program and give the accurate result of
identity percentage with standard strain
(Proteus mirabilis strain HI4320) and they
were ranged from (92-95%).
The result of current study was shown there
is more than one mutation in each isolate,
and this displays that the type and location
of mutations that were found could lead to a
difference in the effect of these mutations
and some of these mutations leading to
change in the genetic code and then change
in the amino acids at the translation.
The amp icon products of the gene show
nucleotide variation which demonstrated the
polymorphism of this gene. The alignment
between all isolates show that the little
conservation of pta gene. However this
mutations in isolates which alter the function
of gene.
Effect of Mutations
Mutations affect the pta gene through the
creation of change in the organization of the
gene. The result was shown that there is
8(18.60%) frame shift mutations, this
mutation lead to reading shift and to
completely different type of translation
originally, and then a big change in the
translated protein.
However, 10(23.25%) silent mutations, this
type of mutation do not lead to a change in
the sequence of amino acid in the protein and
do not alter function of protein.
Besides, there is 21(48.83%) missense
mutations, this type of mutation influence
the phenotype because they lead to
substitution of amino acids and thus in
protein, amino acid can replace another
amino acid very similar of chemical
characteristic, the protein is still work
naturally. There are also amino acid encode
by more than one code which could result in
mutation but does not produce any change in
the translation. Finally the result show
4(9.30%) nonsense mutations, this kind of
mutation lead to change code of amino acid
stop codon and then get a reduced function of
the protein as shown in table (3).

Table 3: Effect of the type and percentage of mutation in pta gene

Effect of mutation Number Percentage
Frame shift 8 18.60%
Silent 10 23.25%
Missense 21 48.83%
Nonsense 4 9.30%
Total 43 99.98%

©2009-2017, JGPT. All Rights Reserved 117

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

Effect of Pta Toxin on SW480 and toxin at 12.5%, 25%, and 50%
ACHN Cells concentrations with compared to control
group. The concentration 50% of Pta toxin a
The effect of Pta toxin on SW480 cell was
significantly better effect on cell growth as
investigated and the result was shown that
shown in Fig (3).
the proliferation of cell was significantly
elevated after 24 hours incubation with Pta

Fig. 3: Sw480 cell proliferation rate after incubation 24 hr. with different concentration of Pta
toxin

The result showed that there was a high
effect on cancer cell line SW 480 through
increasing of the concentration of Pta toxin
and the effect was reduced in the minimum
concentration. This toxin leads to increase
proliferation of cancer cell, so this toxin acts
as carcinogenic. There is no previous study
on the cytotoxic effect of pta toxin on human
colon cancer. On the other hand, viable
ACHN cell was incubated with Pta toxin for
24hr., after incubation with the toxin the
result was showed that gradually increase of
cell at concentrations (6.25%, 12.5%%, 25%,
and 50%) compared with control group as
shown in Fig (4).

Fig 4: ACHN cell proliferation rate after incubation 24hr. with different concentration of Pta
toxin

©2009-2017, JGPT. All Rights Reserved 118

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126
However, this toxin leads to proliferation of
cell and cause cytopathic effect. The
cytotoxicity was seen after toxin addition as
shown in Fig (5), change of the morphology of
A B
Figure 5: Purified Pta toxin interaction with cells line; A: SW480 cell, B: ACHN cell
Proteus toxic agglutinin is the cytotoxin that
has been implicated in damage of host. The
functions associated with Proteus toxic
agglutinin was an essential in the persistence
of the microbes in the host. However, Proteus
mirabilis caused the cytopathic effects in
infected person have been a critical clinical
importance
Proteus toxic agglutinin is present in Proteus
mirabilis that has agglutinin and cytotoxin
properties when tested in vitro using human
kidney and bladder epithelial cell lines,
verifying that auto-transporter proteins could
be cytotoxins [4].
Proteus toxic agglutinin as essential
virulence factor in the uropathogen Proteus
mirabilis The bacteria have ability to cause
necrosis to invade tissue though the ability to
produce toxin as Pta toxin [13].
Because Proteus toxic agglutinin is not only a
key cytotoxin in Proteus mirabilis but also a
surface exposed protein that is a critical for
establishing an infection in the host. P.
mirabilis produce Pta, which is cause damage
of tissue and dissemination to the kidneys,
initiating acute pyelonephritis [14], [15].
Proteus toxic agglutinin promoted cell–cell
aggregation of the microbe and, when the Pta
is interaction with the host, evoked a
cytopathic effect. These features have strong
implications for the pathogenesis of Proteus
mirabilis infection in the host [16].
©2009-2017, JGPT. All Rights Reserved
the host cell due to the destruction of
membrane was followed by outflow and
condensation of the cell cytoplasm, and
breakdown of the cell components.
Moreover, Proteus toxic agglutinin hole the
host cell membrane, leading to outflow of the
cytosol, osmotic stress and de-polymerization
of act in filaments; the structural integrity of
the cell is therefore compromised, resulting
in bladder and kidney damage [4], [2].
Proteus toxic agglutinin acts as auto-
agglutination of Proteus mirabilis in addition
toxicity against kidney and bladder cells of
human when cultured in vitro [17].
Conclusion
The genome sequence gives a significant clue
to understand the regulatory and metabolic
network that link chromosomal genes.
However, the isolates have mutation in pta
gene that is having no role in the
pathogenesis. In this regard, I establish the
role of Proteus toxic agglutinin in the
pathogenesis in Proteus mirabilis; also the
Proteus toxic agglutinin toxin is considered
the cytotoxic effect on normal and cancer cell
Acknowledgement
I thankful to Department of Microbiology,
college of medicine, University of Babylon ,
Iraq, for the facilities provided in the
completion of the work, I also thankful Dr.
Hameed Najei for their cooperation.
Ethical Approval
Agreement from patients for sampling
collection and carrying out this work is
obtained from each patient.
119
 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

Proteus mirabilis Pta gene, toxic agglutinin, partial sequence, strain: LA1
GenBank: LC318372.1
LOCUS LC318372 164 bp DNA linear BCT 02-SEP-2017
DEFINITION Proteus mirabilis Pta gene, toxic agglutinin, partial sequence,
strain: LA1.
ACCESSION LC318372
VERSION LC318372.1
KEYWORDS .
SOURCE Proteus mirabilis
ORGANISM Proteus mirabilis
Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacterales;
Morganellaceae; Proteus.
REFERENCE 1
AUTHORS Lamees A.A.
TITLE Sequencing of Proteus toxic agglutinin (Pta) gene in Proteus
mirablis and cytotoxic effect of Pta on human colon cancer cell and
human kidney cell
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 164)
AUTHORS Lamees A.A.
TITLE Direct Submission
JOURNAL Submitted (28-AUG-2017) Contact:Lamees A.Abdul-LateeF Ministry of
Higher Education and Scientific Research/Babylon University
/College of Medicine, Microbiology; 40 street, Al-Hilla, Babil
0000, Iraq
FEATURES Location/Qualifiers
source 1..164
/organism="Proteus mirabilis"
/mol_type="genomic DNA"
/strain="LA1"
/isolation_source="urine of colon cancer patient 1"
/host="Homo sapiens"
/db_xref="taxon:584"
/country="Iraq"
/collection_date="2016-12-01"
/collected_by="Lamees A. Abdul-LateeF"
/PCR_primers="fwd_seq: gtggatagcgcattcccgta, rev_seq:
caaaaagactgggggcttgc"
gene <1..>164
/gene="Pta"
misc_feature <1..>164
/gene="Pta"
/note="coding region not determined;
toxic agglutinin"
ORIGIN
1 gtttcctttt tgggctttac tgcatgaaag cgtgatccac tcaactcttg atgtgagagc
61 agtgcaccag agtccatcac cccaacttta gctccttgac catgaaaacc cagagcataa
121 gcactagagg aattcatggc tgcaagcccc ctttcttttt ggaa

©2009-2017, JGPT. All Rights Reserved 120

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

//

Proteus mirabilis Pta gene, toxic agglutinin, partial sequence, strain: LA2
GenBank: LC318373.1
LOCUS LC318373 160 bp DNA linear BCT 02-SEP-2017
DEFINITION Proteus mirabilis Pta gene, toxic agglutinin, partial sequence,
strain: LA2.
ACCESSION LC318373
VERSION LC318373.1
KEYWORDS .
SOURCE Proteus mirabilis
ORGANISM Proteus mirabilis
Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacterales;
Morganellaceae; Proteus.
REFERENCE 1
AUTHORS Lamees A.A.
TITLE Sequencing of Proteus toxic agglutinin (Pta) gene in Proteus
mirablis and cytotoxic effect of Pta on human colon cancer cell
and human kidney cell
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 160)
AUTHORS Lamees A.A.
TITLE Direct Submission
JOURNAL Submitted (28-AUG-2017) Contact:Lamees A.Abdul-LateeF Ministry of
Higher Education and Scientific Research/Babylon University
/College of Medicine, Microbiology; 40 street, Al-Hilla, Babil
0000, Iraq
FEATURES Location/Qualifiers
source 1..160
/organism="Proteus mirabilis"
/mol_type="genomic DNA"
/strain="LA2"
/isolation_source="urine of colon cancer patient 2"
/host="Homo sapiens"
/db_xref="taxon:584"
/country="Iraq"
/collection_date="2016-12-01"
/collected_by="Lamees A. Abdul-LateeF"
/PCR_primers="fwd_seq: gtggatagcgcattcccgta, rev_seq:
caaaaagactgggggcttgc"
gene <1..>160
/gene="Pta"
misc_feature <1..>160
/gene="Pta"
/note="coding region not determined;
toxic agglutinin"
ORIGIN
1 gtaccctttt ggctttactg ctgaagcgtg atccactcaa ctcttgatgt gagagcagtg
61 caccagagtc catcacccca actttagctc cttgaccatg aaaacccaga gcataagcac

©2009-2017, JGPT. All Rights Reserved 121

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

121 taaaggaatt cagggctgca agcccccttt ctttttggaa

//

Proteus mirabilis Pta gene, toxic agglutinin, partial sequence, strain: LA3
GenBank: LC318374.1
LOCUS LC318374 166 bp DNA linear BCT 02-SEP-2017
DEFINITION Proteus mirabilis Pta gene, toxic agglutinin, partial sequence,
strain: LA3.
ACCESSION LC318374
VERSION LC318374.1
KEYWORDS .
SOURCE Proteus mirabilis
ORGANISM Proteus mirabilis
Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacterales;
Morganellaceae; Proteus.
REFERENCE 1
AUTHORS Lamees A.A.
TITLE Sequencing of Proteus toxic agglutinin (Pta) gene in Proteus
mirablis and cytotoxic effect of Pta on human colon cancer cell
and human kidney cell
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 166)
AUTHORS Lamees A.A.
TITLE Direct Submission
JOURNAL Submitted (28-AUG-2017) Contact:Lamees A.Abdul-LateeF Ministry of
Higher Education and Scientific Research/Babylon University
/College of Medicine, Microbiology; 40 street, Al-Hilla, Babil
0000, Iraq
FEATURES Location/Qualifiers
source 1..166
/organism="Proteus mirabilis"
/mol_type="genomic DNA"
/strain="LA3"
/isolation_source="urine of colon cancer patient 3"
/host="Homo sapiens"
/db_xref="taxon:584"
/country="Iraq"
/collection_date="2016-12-01"
/collected_by="Lamees A. Abdul-LateeF"
/PCR_primers="fwd_seq: gtggatagcgcattcccgta, rev_seq:
caaaaagactgggggcttgc"
gene <1..>166
/gene="Pta"
misc_feature <1..>166
/gene="Pta"
/note="coding region not determined;
toxic agglutinin"
ORIGIN

©2009-2017, JGPT. All Rights Reserved 122

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

1 atgtggcttt ttttttttat actgcatgaa agcgtgatcc actcaactct tgatgtgaga

61 gcagtgcacc aaagtccatc accccaactt tagcaccttg accatgaaaa cccagagcat
121 aagcactaaa ggcattcatg gctgcaagcc cccattcttt ttggaa
//

Proteus mirabilis Pta gene, toxic agglutinin, partial sequence, strain: LA4
GenBank: LC318375.1
LOCUS LC318375 163 bp DNA linear BCT 02-SEP-2017
DEFINITION Proteus mirabilis Pta gene, toxic agglutinin, partial sequence,
strain: LA4.
ACCESSION LC318375
VERSION LC318375.1
KEYWORDS .
SOURCE Proteus mirabilis
ORGANISM Proteus mirabilis
Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacterales;
Morganellaceae; Proteus.
REFERENCE 1
AUTHORS Lamees A.A.
TITLE Sequencing of Proteus toxic agglutinin (Pta) gene in Proteus
mirablis and cytotoxic effect of Pta on human colon cancer cell and
human kidney cell
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 163)
AUTHORS Lamees A.A.
TITLE Direct Submission
JOURNAL Submitted (28-AUG-2017) Contact:Lamees A.Abdul-LateeF Ministry of
Higher Education and Scientific Research/Babylon University
/College of Medicine, Microbiology; 40 street, Al-Hilla, Babil
0000, Iraq
FEATURES Location/Qualifiers
source 1..163
/organism="Proteus mirabilis"
/mol_type="genomic DNA"
/strain="LA4"
/isolation_source="urine of colon cancer patient 4"
/host="Homo sapiens"
/db_xref="taxon:584"
/country="Iraq"
/collection_date="2016-12-01"
/collected_by="Lamees A. Abdul-LateeF"
/PCR_primers="fwd_seq: gtggatagcgcattcccgta, rev_seq:
caaaaagactgggggcttgc"
gene <1..>163
/gene="Pta"
misc_feature <1..>163
/gene="Pta"
/note="coding region not determined;

©2009-2017, JGPT. All Rights Reserved 123

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

toxic agglutinin"
ORIGIN
1 agttcgcttt tgggtctttt cagcatgaag cgtgatccac tcaactcttg atgtgagagc
61 agtgcaccag agtccatcac cccaacttta gcaccttgac catgaaaacc cagagcataa
121 gcactaaagg aattcatggc tgcaagcccc cagtcttttt gga
//

Proteus mirabilis Pta gene, toxic agglutinin, partial sequence, strain: LA5
GenBank: LC318376.1
LOCUS LC318376 164 bp DNA linear BCT 02-SEP-2017
DEFINITION Proteus mirabilis Pta gene, toxic agglutinin, partial sequence,
strain: LA5.
ACCESSION LC318376
VERSION LC318376.1
KEYWORDS .
SOURCE Proteus mirabilis
ORGANISM Proteus mirabilis
Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacterales;
Morganellaceae; Proteus.
REFERENCE 1
AUTHORS Lamees A.A.
TITLE Sequencing of Proteus toxic agglutinin (Pta) gene in Proteus
mirablis and cytotoxic effect of Pta on human colon cancer cell and
human kidney cell
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 164)
AUTHORS Lamees A.A.
TITLE Direct Submission
JOURNAL Submitted (28-AUG-2017) Contact:Lamees A.Abdul-LateeF Ministry of
Higher Education and Scientific Research/Babylon University
/College of Medicine, Microbiology; 40 street, Al-Hilla, Babil
0000, Iraq
FEATURES Location/Qualifiers
source 1..164
/organism="Proteus mirabilis"
/mol_type="genomic DNA"
/strain="LA5"
/isolation_source="urine of colon cancer patient 5"
/host="Homo sapiens"
/db_xref="taxon:584"
/country="Iraq"
/collection_date="2016-12-01"
/collected_by="Lamees A. Abdul-LateeF"
/PCR_primers="fwd_seq: gtggatagcgcattcccgta, rev_seq:
caaaaagactgggggcttgc"
gene <1..>164
/gene="Pta"
misc_feature <1..>164

©2009-2017, JGPT. All Rights Reserved 124

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

/gene="Pta"
/note="coding region not determined;
toxic agglutinin"
ORIGIN
1 cccccttttt gggctttact gcatgaaagc gagacccact caactcttga tgtagagagc
61 aatgcaccag agtccatcac cccgacttta gcaccttgac catgaaaacc cagagcataa
121 gcactaaagg cattcatggc tgcaagcccc cattcttttt ggaa
//

References
1. Warren JW, Tenney JH, Hoopes JM, 7. Alamuri P, Eaton KA, Himpsl SD,
Muncie HL, Anthony WC (1982) A Smith SN, Mobley HLT (2009)
prospective microbiologic study of Vaccination with proteus toxic
bacteraemia in patients with chronic agglutinin, a haemolysin-independent
indwelling urethral catheters. J Infect cytotoxin in vivo, protects
Dis 146: 719-723. against Proteus mirabilis urinary tract
2. Armbruster CE, Mobley HL (2012) infection. Infect Immun,77:632–641
Merging mythology and morphology: 8. Chippendale GR., Warren JW, Trifillis,
the multifaceted lifestyle of Proteus AL, Mo- bley HLT (1994)
mirabilis. Nature Rev Microbial. Internalization of Proteus mirabilis by
10:743–754. human renal epithelial cells. Infection
and Immunity, 62, 3115-3121.
3. Pearson MM, Sebaihia M, Churcher C,
Quail MA, Seshasayee AS, Abdellah Z 9. Holt JC, Krieg NR, Sneath A, Stachley
(2008) The complete genome sequence JT, William ST (1994) Bergy,s manual
of uro pathogenic Proteus mirabilis, a of determinative bacteriology, 9thed.
master of both adherence and motility. USA, 552.
J Bacterial (in press). 10. Cock IE; van Vuurenc SF (2014) Anti-
4. Alamuri P, Mobley HL (2008) A novel Proteus Activity of South African
auto transporter of uro pathogenic Medicinal Plants: Their Potential for
Proteus mirabilis is both a cytotoxin the Prevention of Rheumatoid
and an agglutinin. Mol. Microbial, Arthritis. Inflammo pharmacology,
68:997–1017. 22(1), 23-36.
5. Flannery EL, Mody L, Mobley HLT 11. Kaiser NM, Rana AG, Firas MG,
(2009) Identification of a modular Zaineb HA (2015) The Effects of.
pathogen city island that is widespread Zizyphus Stem Bark and Termite
among urease-producing uropathogens Shelter Tubes on HeLa cell Growth.
and shares features with a diverse Research Journal of Pharmaceutical,
group of mobile elements. Infect Biological and Chemical Sciences.
Immun. 77:4887–4894. RJPBCS, 6(6):620.
6. Nielubowicz GR, Smith SN, Mobley 12. Zhenbo Xu, Yanrui Liang, Shiqi Lin,
HLT (2008) Outer membrane antigens Dingqiang Chen, Bing Li1, Lin Li1
of the uropathogen Proteus Yang Deng (2016) Crystal Violet and
mirabilis recognized by the humoral XTT Assays on Staphylococcus aureus
response during experimental murine Bio film Quantification .Curr
urinary tract infection. Infect Immun. Microbial, DOI 10.1007/s00284-016-
76:4222–4231. 1081-1.

©2009-2017, JGPT. All Rights Reserved 125

 Lamees A. Abdul-Lateef : Journal of Global Pharma Technology. 2017; 09(9):112-126

13. Choubini E, Asadi Karam MR, 16. Stickler D, Ganderton L, King J,

Khorshidi A, Habibi M, Ghasemi A, Nettleton J, Winters C (1993) Proteus
Bouzari S (2016) Bioinformatics mirabilis bio films and the
analysis and expression of a truncated encrustation of urethral catheters.
form of Proteus mirabilis Pta protein Urol Res, 21: 407–411.
as a novel vaccine target against 17. Hutton JC (1990) Subtilisin-like
urinary tract infection. Vaccine proteinases involved in the activation
Research, 3(7), 30-35. of proportions of the eukaryotic
14. Jacobsen SM, Stickler DJ, Mobley HL, secretory pathway. Curr Opin Cell
Shortleaf ME (2008) Complicated Biol 2: 1131–1142
catheter-associated urinary tract
infections due to Escherichia
coli and Proteus mirabilis. Clin
Microbiol Rev, 21:26–59.
15. Cestari SE, Ludovico MS, Martins
FH, da Rocha SPD, Pelayo JS (2013)
Molecular detection of HpmA and
HlyA hemolysin of
uropathogenic Proteus mirabilis. Curr
Microbial. 67:703–707.

©2009-2017, JGPT. All Rights Reserved 126