Letters

https://doi.org/10.1038/s42255-020-0190-0

Exercise rejuvenates quiescent skeletal muscle

stem cells in old mice through restoration of
Cyclin D1
Jamie O. Brett   1,2,3,9, Marina Arjona   1,2,9, Mika Ikeda   1,2,9, Marco Quarta1,2,4, Antoine de Morrée   1,2,
Ingrid M. Egner1,5, Luiz A. Perandini   1,6, Heather D. Ishak1,2, Armon Goshayeshi1,2, Daniel I. Benjamin1,2,
Pieter Both1,2,3, Cristina Rodríguez-Mateo   1,2, Michael J. Betley1,7, Tony Wyss-Coray   1,2,4 and
Thomas A. Rando   1,2,4,8 ✉

Ageing impairs tissue repair. This defect is pronounced in
skeletal muscle, whose regeneration by muscle stem cells
(MuSCs) is robust in young-adult animals, but inefficient in
older organisms. Despite this functional decline, old MuSCs
are amenable to rejuvenation through strategies that improve
the systemic milieu, such as heterochronic parabiosis. One
such strategy, exercise, has long been appreciated for its
benefits on healthspan, but its effects on aged stem-cell func-
tion in the context of tissue regeneration are incompletely
understood. Here, we show that exercise in the form of volun-
tary wheel running accelerates muscle repair in old mice and
improves old MuSC function. Through transcriptional profil-
ing and genetic studies, we discovered that the restoration of
old MuSC activation ability hinges on restoration of Cyclin D1,
whose expression declines with age in MuSCs. Pharmacologic
studies revealed that Cyclin D1 maintains MuSC activation
capacity by repressing TGF-β signalling. Taken together,
these studies demonstrate that voluntary exercise is a prac-
ticable intervention for old MuSC rejuvenation. Furthermore,
this work highlights the distinct role of Cyclin D1 in stem-cell
quiescence.
To study the effects of exercise on MuSC function and muscle
regeneration, we used an established model of exercise in rodents1,2:
we provided young-adult and old mice three weeks of access to
freely rotating running wheels (+Ex) or, as the control condition,
to locked wheels (–Ex) (Extended Data Fig. 1a). Within one week,
young and old mice reached a stable exercise routine, running
10 ± 2 (n = 39, mean ± s.d.) and 4.9 ± 2.7 (n = 91, mean ± s.d.) km
per night, respectively. This short-term, non-strenuous, voluntary
exercise regimen was selected to avoid confounding the study of
stem-cell quiescence by the muscle injury and overt MuSC acti-
vation known to occur during resistance training or more intense
endurance exercise3–6. With voluntary wheel running, MuSCs
exhibited at most minor changes from quiescence in any marker
for cells in a proliferative or activated state, including thymidine
analog incorporation, total RNA content, cell size, Ki67 expression
and myogenic differentiation factor (MyoD) expression (Extended
Data Fig. 1b–g). Voluntary wheel running also did not induce a
significant increase in the total number of MuSCs (Extended Data
Fig. 1h) and caused at most minor changes in muscle size or signs
of muscle damage, such as inflammation or fibre degeneration
(Extended Data Fig. 1i–n). Our results are consistent with previ-
ous observations that voluntary wheel running does not expand the
MuSC pool in adult mice3. This is in contrast to resistance exer-
cise, which causes muscle hypertrophy and the activation of MuSCs
and many other cell types in muscle5–8; to exercise in the postna-
tal development period, which can expand the MuSC pool3; and
to forced-endurance exercise, which above a certain intensity level
causes animal stress and muscle injury, and also activates MuSCs3,4.
In a prior study of voluntary wheel running in adult mice, exercise
increased the expression of myogenic genes and Wnt signalling in
muscle, but MuSC pool size, MuSC function and muscle repair abil-
ity were not examined9. In summary, voluntary wheel running is a
form of exercise that allows analysis of the MuSC populations that
remain in a quiescent state.
We first tested the effects of exercise on muscle regeneration,
the primary function of adult MuSCs. After three weeks of free
or locked wheel access, we removed mice from exercise cages and
injured the tibialis anterior (TA) muscles with barium chloride.
After either 4–5 d or 28 d of recovery, we isolated the TA muscles
and examined regeneration histologically (Fig. 1a,b and Extended
Data Fig. 2a–d). Compared with that in young(–Ex) mice, forma-
tion of new muscle was delayed in old (–Ex) mice, as has been
well-established10. Exercise significantly accelerated the regenera-
tion efficiency of muscle in old mice toward more youthful levels.
Notably, exercise did not benefit young muscle repair, even when
examined at an earlier time point (Extended Data Fig. 2a).
To examine the extent to which exercise rejuvenates old muscle
repair through intrinsic changes in MuSCs, we performed trans-
plantation assays, in which old MuSCs are known to exhibit severe
defects11,12. Donor mice were tamoxifen-treated Pax7CreER;R26RYFP,
and thus expressed yellow fluorescent protein (YFP) specifically in

Department of Neurology and Neurological Sciences, Stanford University School of Medicine, Stanford, CA, USA. 2Paul F. Glenn Laboratories for the
1

Biology of Aging, Stanford University School of Medicine, Stanford, CA, USA. 3Stem Cell Biology and Regenerative Medicine Graduate Program, Stanford
University School of Medicine, Stanford, CA, USA. 4Center for Tissue Regeneration, Repair, and Restoration, Veterans Affairs Palo Alto Healthcare
System, Palo Alto, CA, USA. 5Department of Biosciences, University of Oslo, Oslo, Norway. 6Department of Immunology, Institute of Biomedical Sciences,
University of São Paulo, São Paulo, Brazil. 7Neurosciences Interdepartmental Graduate Program, Stanford University School of Medicine, Stanford, CA,
USA. 8Neurology Service, Veterans Affairs Palo Alto Health Care System, Palo Alto, CA, USA. 9These authors contributed equally: Jamie O. Brett, Marina
Arjona, Mika Ikeda. ✉e-mail: rando@stanford.edu

Nature Metabolism | www.nature.com/natmetab

Letters NATurE METAbOlISm

a b
Young(–Ex) Young(+Ex) Old(–Ex) Old(+Ex) 0.3
*

(eMHC+/injured area)
Regeneration extent
*
eMHC Laminin DAPI

0.2

0.1

0.0
–Ex +Ex –Ex +Ex
Young Old

c d e
Young(–Ex) Old(–Ex) Old(+Ex) 1.8 400

(donor fibers per 10 sections)

(relative donor fiber CSA)
1.5 *

Regeneration capacity
*

Regeneration rate
300
YFP Laminin DAPI

1.2
Y(–Ex)
0.9 200 Y(–Ex)

0.6
100
0.3

0.0 0
–Ex +Ex –Ex +Ex
Old Old

f 800
g 0.6 h 0.5
* *
*

(fraction of wells with ≥8 cells at 6 d)

0.4
(median fl volume at 18 h)

600 *
(fraction EdU+ after 2 d)
Exit from quiescence

Exit from quiescence

* 0.4
*

Clonogenicity
0.3
400
0.2
0.2
200
0.1

0 0.0 0.0
–Ex +Ex –Ex +Ex –Ex +Ex –Ex +Ex –Ex +Ex –Ex +Ex
Young Old Young Old Young Old

Fig. 1 | Exercise improves old-muscle repair and MuSC function. a, Three weeks after exercise or no exercise, mice were transferred to new cages without
wheels, and TA muscles were injured. After 4.5 d, muscles were isolated and stained to detect regeneration. Regenerating myofibers are marked by eMHC,
the basal lamina surrounding all myofibers is marked by laminin, and nuclei are stained with DAPI. b, The injured area occupied by eMHC+ myofibers was
quantified (n = 6 mice per group). c, Ten thousand freshly isolated YFP+ MuSCs from each donor mouse were transplanted into pre-injured TA muscles of
host NOD-SCID mice. Ten days after the transplant, muscles were stained to detect donor-derived (YFP+) myofibers. d, The mean cross-sectional areas
(CSA) of YFP+ myofibers were quantified and then normalized to the mean young(–Ex) (Y(–Ex)) level in each experiment (n = 9 for old(–Ex) (O(–Ex)),
9 for O(–Ex) and 6 for Y(–Ex) muscles). e, The numbers of YFP+ myofibers in recipient muscles were counted (n = 9 for O(–Ex), 9 for O(+Ex), and 6 for
Y(–Ex) muscles). f, FACS-isolated MuSCs were cultured, and enlargement was measured with a Coulter counter (n = 15 mice per group); fl, femtolitre.
g, MuSCs were cultured continuously in EdU to assess S-phase progression (n = 4 for Y(–Ex), 5 for Y(+Ex), 7 for O(–Ex) and 7 for O(+Ex) mice).
h, Single MuSCs were sorted during FACS isolation into individual wells to assess clonogenic capacity (n = 4 for Y(–Ex), 5 for Y(+Ex), 7 for O(–Ex) and 7
for O(+Ex) mice). Scale bars in a and c, 100 μm. Data are summarized with mean + s.e.m. *P < 0.05; two-tailed Welch’s t-test in b and d–h.

adult MuSCs13. We transplanted MuSCs from old(–Ex) or old(+Ex) culture using a battery of assays. One of the earliest processes of
mice, or those from young(–Ex) mice, into injured muscles of MuSC activation is enlargement in size, which we measured 18 h
young hosts. Ten days later, we examined host muscles for the pres- after collection using a Coulter counter. We found that old MuSCs
ence of YFP-labelled muscle fibres. Compared with young(–Ex)- had defects in enlargement compared with young MuSCs, and these
donor MuSCs, old(–Ex)-donor MuSCs formed smaller and fewer were restored by exercise (Fig. 1f). We also found that accrual of
fibres (Fig. 1c–e). Both parameters were significantly restored back total RNA, another measure of cell growth during the exit from qui-
to young levels by exercise. escence, was increased with exercise in old MuSCs (Extended Data
Old MuSCs harbour striking defects in activation compared Fig. 2f). Old MuSCs had a lower rate of entry into this first S-phase,
with young MuSCs14,15. Because exercise accelerated muscle repair, as measured by EdU incorporation, compared with young MuSCs,
we hypothesized that exercise would restore old MuSC activation. and this was rescued by exercise (Fig. 1g). Analysis of other aspects
To test this, we used fluorescence-activated cell sorting (FACS) to of activation, completion of the first division and gain in motility,
isolate MuSCs (Extended Data Fig. 2e) from young and old mice further demonstrated that exercise enhanced the rate at which old
without or with exercise and assayed their activation over time in MuSCs activate (Extended Data Fig. 2g,h). Analysis of MuSC death

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm
during activation revealed that exercise improved MuSC survival
(Extended Data Fig. 2i). In addition, exercise increased clone for-
mation by old MuSCs (Fig. 1h). Taken together, these experiments
show that non-strenuous voluntary exercise improves old MuSC
function, not because exercise itself activates MuSCs, but rather
because exercise prepares these cells for activation.
To investigate the perdurance of old MuSC enhancement by
exercise, we compared the activation rates of MuSCs from old(–Ex)
mice, from old(+Ex) mice and from old(+Ex) mice that had exer-
cised for three weeks and then had their wheels removed for one or
two weeks (Extended Data Fig. 3a). The benefit of exercise on old
MuSC activation was significantly diminished one week after exer-
cise cessation and was completely gone, back to old(–Ex) levels, two
weeks after exercise cessation (Extended Data Fig. 3b).
To examine whether the benefits of exercise on old MuSCs could
be mediated at least partly through humoral factors, we collected
serum from old(–Ex) and old(+Ex) mice. We then intravenously
injected this serum into old(–Ex) mice at 0.3 mL daily (about 15%
of total blood volume) for three consecutive days. On the fourth
day, we isolated MuSCs from these recipient mice and tested activa-
tion rate in the ex vivo EdU-incorporation assay (Extended Data
Fig. 4a). Compared with injections of serum from old(–Ex) mice,
injections of serum from old(+Ex) mice increased the activation
rate of old MuSCs (Extended Data Fig. 4b).
These functional studies show that exercise alters old MuSCs in
their quiescent state. To probe the molecular changes underlying
these phenotypic improvements, we performed RNA sequencing
(RNA-seq) on young and old quiescent MuSCs from non-exercised
and exercised mice. Globally, exercise partially rejuvenated the
transcriptional changes of ageing: principal-component analysis
(PCA) revealed patterns of genes that were changed with ageing but
were not restored by exercise, as well as patterns that were changed
with ageing and were restored by exercise (Fig. 2a). At a 10% false-
discovery rate (FDR), 248 genes differed between old(–Ex) and
old(+Ex) MuSCs, 130 of which could be considered rejuvenated in
the context of the old(–Ex) versus young(–Ex) comparison. We per-
formed quantitative reverse transcription PCR (RT–qPCR) to vali-
date the changes for select rejuvenated genes implicated in muscle
development and regeneration (Extended Data Fig. 5a). By contrast,
young(–Ex) MuSCs were transcriptomically similar to young(+Ex)
MuSCs, with only 35 genes differing at a 10% FDR.
To explore the pathways involved in the benefits of exercise, we
performed gene-set enrichment analysis (GSEA) using the Hallmark
gene-set collection. Compared with young(–Ex) MuSCs, old(–Ex)
MuSCs exhibited upregulation of inflammation (including TGF-β,
NF-κB, IL-6, IFN-α and IFN-γ) and oxidative-stress-response gene
sets, and downregulation of cell-cycle-promoting, myogenesis and
Notch-signalling gene sets (Fig. 2b and Extended Data Fig. 5b,c).
In old MuSCs, exercise restored the cell-cycle and myogenesis gene
sets, but not the Notch-signalling gene set. Exercise suppressed some
of the inflammation (TGF-β, NF-κB and IL-6) but not other inflam-
mation (IFN-α and IFN-γ) or oxidative-stress-response gene sets.
Gene sets changed by exercise in old MuSCs that were not altered by
ageing included angiogenesis (upregulated) and Hedgehog and IL-2
signalling (downregulated). To summarize, exercise ameliorates
some but not all molecular signatures of cell stress in old MuSCs
and restores some patterns of genes likely to be important for MuSC
function.
To more deeply investigate the mechanisms by which exercise
enhances old MuSCs, we examined the transcriptional differences
between old(–Ex) MuSCs and old(+Ex) MuSCs in the RNA-seq
data (Fig. 2c). The top hit of this analysis was the transcript Ccnd1
(encoding Cyclin D1), which was strongly decreased during ageing
and restored by exercise. We confirmed this result with RT–qPCR
using samples independent of those used in the RNA-seq experi-
ments (Fig. 2d). To determine whether these differences in Ccnd1
Nature Metabolism | www.nature.com/natmetab
Letters
expression in MuSCs might represent a large change in a small
subset of cells, we analysed expression at the single-cell level. Using
RNA fluorescence in situ hybridization (RNA-FISH), we found that
levels of Ccnd1 transcript changed across the population at large,
rather than only in a few high-expressing MuSCs (Fig. 2e). This was
corroborated by single-cell RT–qPCR experiments (Extended Data
Fig. 5d). Western blot analyses demonstrated that protein levels of
Cyclin D1 were also restored by exercise (Fig. 2f). Thus, MuSCs in
the quiescent state differentially express Cyclin D1, on the basis of
age and exercise history.
Cyclin D1 has been extensively studied in the context of myoblast
expansion and differentiation. At these stages of myogenesis, which
notably occur multiple days after MuSCs exit from quiescence,
Cyclin D1 is upregulated and functions to sustain progenitor-cell
expansion and prevent premature differentiation16–18. The func-
tions of Cyclin D1 in MuSC quiescence and exit from quiescence,
despite the observation that Cyclin D1 is expressed in the quies-
cent state, however, are not known. Cyclin D1 is known to influ-
ence stem-cell-related transcriptional networks19,20 and has been
examined in other stem-cell populations, such as developing and
adult haematopoietic stem cells21,22, adult mammary epithelial stem
cells23, developing and postnatal neural stem cells24,25 and human
embryonic stem cells20,26. In these other cell types, Cyclin D1 has
been found to affect proliferation and differentiation, but its roles
in early stem-cell exit from quiescence in response to regenerative
requirements have not been studied. Intriguingly, Cyclin D1 has
been shown not only to be involved in exit from quiescence in cul-
ture27,28, but to be important for adult Schwann-cell exit from qui-
escence in vivo29. We set out to determine the role of Cyclin D1 in
quiescent, adult MuSCs.
We first investigated whether exercise restores activation rate in
old MuSCs through Cyclin D1. To counter the induction of Cyclin
D1 by exercise, we transfected freshly isolated MuSCs with a pool of
short interfering RNAs (siRNAs) targeting Ccnd1 (siD1), or a pool
of control siRNAs that do not target any known mouse transcripts
(siCtrl). Western blot analyses one day after isolation and transfec-
tion showed that siD1 treatment reduced Cyclin D1 to about half
of siCtrl levels, for any MuSC age and exercise history (Fig. 3a).
Therefore, this knockdown reduced Cyclin D1 levels in old(+Ex)
MuSCs back to the levels in old(–Ex) MuSCs. RNA-FISH and
immunofluorescence analyses of individual cells confirmed that
this knockdown affected the population as a whole rather than just
a few cells (Fig. 3b–d). Examining MuSC activation ability through
the ex vivo EdU-incorporation assay, we found that Cyclin-D1-
depleted old(+Ex) MuSCs, unlike control old(+Ex) MuSCs, were
no longer improved relative to control old(–Ex) MuSCs (Fig. 3e).
Thus, countering the induction of Cyclin D1 by exercise attenuates
the restoration of activation by exercise in old MuSCs.
We then turned to a genetic model of Cyclin D1 reduction. This
allowed us to test whether Cyclin D1 is important for activation of
MuSCs and for the benefits of exercise in vivo after injury. This fur-
ther allowed us to circumvent the possibility of off-target effects of
the Ccnd1 siRNA pool. Therefore, we obtained mice with conditional
loss-of-function alleles of Ccnd1, in which the first and third introns
of the Ccnd1 gene contain loxP sites30. We bred Pax7CreER;R26RYFP
mice with mice that were Ccnd1+/+, Ccnd1flox/+ or Ccnd1flox/flox,
generating mice in which tamoxifen administration caused
MuSC-specific ablation of zero (WT), one (HET) or both (KO)
alleles of Ccnd1. We then allowed the mice access to running wheels,
or prevented access. Western blot analyses showed that Cyclin
D1 levels were halved in HET MuSCs and restored to WT levels
by exercise, similar to old MuSCs (Fig. 3f). KO MuSCs expressed
negligible levels of Cyclin D1, and these levels were not increased
significantly by exercise. Immunofluorescence analyses confirmed
that these reductions in Cyclin D1 expression occurred in the
populations at large rather than in a few cells (Fig. 3g,h). Standard
Letters NATurE METAbOlISm

a b O(+Ex) vs. O(–Ex)

c
20 O(–Ex) vs. Y(–Ex) 12
Young(+Ex) Ccnd1
PC2 (15% of variance) score

HALLMARK E2F TARGETS HALLMARK E2F TARGETS

Old(+Ex) 0.1 9
0.3

–log10(q value)
10 0
0.2

ES

ES
–0.1 NES = –1.530 NES = 1.640
0.1 6
–0.2 q = 0.025 q = 0.068
Young(–Ex) –0.3 0.0
0
3
Old(–Ex) 2.0
2.0 1.0

S2N

S2N
–10 0 0 0
–15 0 15 30 –2.0 –1.0 –2 –1 0 1 2
PC1 (40% of variance) score O(–Ex) Y(–Ex) O(+Ex) O(–Ex) log2(Old(+Ex) / Old(–Ex))

d e f Y(–Ex) O(–Ex) O(+Ex)

2.5 60 120
* * * Cyclin D1
Ccnd1 mRNA per single cell

Gapdh
(detectable transcripts)
Relative Ccnd1 mRNA

2.0
2.5
40 80 *
1.5 2.0

cyclin D1 protein
Relative
1.0 1.5
Y(–Ex)
20 40
1.0 Y(–Ex)
0.5
0.5

0 0 0 0.0
–Ex +Ex Young(–Ex) Old(–Ex) Old(+Ex) Injured –Ex +Ex
Old Old

Fig. 2 | Exercise partly restores the old MuSC transcriptome and enhances Cyclin D1 expression. a, PCA of RNA-seq profiles of MuSCs from young or
old mice that were exercised or were not exercised. Each profile (triangle) represents the MuSCs of an individual mouse. b, GSEA enrichment plots for the
E2F TARGETS gene set, representing cell-cycle genes. NES, normalized enrichment score. c, Volcano plot of transcripts in the RNA-seq profiles of MuSCs
from old non-exercised or old exercised mice. Ccnd1 is labelled as the transcript most strongly upregulated by exercise. d, RT–qPCR for Ccnd1 in MuSCs
from mice independent of those used in the RNA-seq experiment. Ct values were normalized first to the mean of Gapdh, Hprt and Actb1 and then to the
mean Y(–Ex) level in each experiment (n = 13 for O(–Ex), 14 for O(+Ex) and 13 for Y(–Ex) mice). e, Single-molecule RNA-FISH for Ccnd1 in freshly isolated
MuSCs. For comparison, also shown are results for Y(Activated) MuSCs isolated from mice 3 d after injury (n = 54 cells in each group, pooled from 3
Y(–Ex), 4 O(+Ex), 4 O(–Ex), and 3 Y(Activated) mice). f, Western blot analysis of Cyclin D1 in MuSCs. Each lane represents a pool of two to three mice.
Shown is a representative blot and quantification of two blots (n = 6 for O(–Ex), 6 for O(+Ex) and 5 for Y(–Ex) lanes). ES, running enrichment score; NES,
normalized enrichment score; S2N, GSEA Signal2Noise ranking metric in b. Data are summarized with mean and s.e.m. in d and f. For box-and-whisker
plots in e: bottom whisker, minimum; box bottom, 25th percentile; box middle, median; box top, 75th percentile; top whisker, maximum; +, mean.
*P < 0.05; two-tailed Welch’s t-test in d and e; two-tailed Mann–Whitney U-test in f.

histology and flow-cytometry analyses showed that short-term (6 To investigate the effects of Cyclin D1 upregulation in  vivo on
weeks) or long-term (9 months) loss of Cyclin D1 in MuSCs did not old MuSC activation, we generated mice in which Cyclin D1 can
alter MuSC number or cause MuSCs to exit their sublaminar loca- be induced specifically in MuSCs. For this, we used Pax7rtTA mice
tion (Extended Data Fig. 6a,b). To evaluate MuSC activation rates crossed with mice transgenic for Ccnd1 controlled by the tetracy-
in  vivo, we injured TA and gastrocnemius muscles, injected EdU cline-responsive element (TRE)31,32. We studied the wild-type form
intraperitoneally (i.p.) at 1.5 d after injury, and collected MuSCs of Cyclin D1 as well as a mutant form of Cyclin D1 (K112E) that
from these muscles for analysis of EdU incorporation at 2 d after cannot activate the Cdk4 and Cdk6 cyclin-dependent kinases33–35.
injury. Compared with young(WT) MuSCs, young(HET) MuSCs When mice were 20 months of age, we administered doxycycline to
and young(KO) MuSCs were impaired in S-phase entry during Pax7rtTA mice transgenic for wild-type Ccnd1 (TetD1-WT), trans-
activation (Fig. 3i). This impairment was rescued by exercise in genic for Ccnd1 encoding the K112E variant (TetD1-KE) or without
young(HET) MuSCs, but not in young(KO) MuSCs. Similar results a Cyclin D1 transgene (Tet-Ctrl). Western blot assays showed that
were obtained in ex vivo EdU-incorporation assays of activation Cyclin D1 was induced two-fold by doxycycline in MuSCs from mice
(Extended Data Fig. 6c). Thus, Cyclin D1 is crucial for MuSC acti- containing the transgene compared with mice lacking the transgene
vation ability, and exercise benefits MuSC activation through Cyclin (Fig. 3m). Analysis of activation by assaying ex vivo cell enlargement
D1 restoration. or EdU incorporation showed that increased expression of Cyclin D1
To examine the extent to which upregulation of Cyclin D1 would (including the mutant form that does not activate Cdk4 and Cdk6)
restore youthful properties to old MuSCs, we generated lentiviral in old MuSCs restored activation rate (Fig. 3n,o). Taken together,
vectors to increase expression of Cyclin D1 in MuSCs (Fig. 3j and these rescue experiments ex vivo and in vivo indicate that Cyclin D1
Extended Data Fig. 6e,f). Increased Cyclin D1 expression in old upregulation is sufficient to improve old MuSC activation.
MuSCs accelerated enlargement compared with that in old MuSCs Next, we investigated molecular roles of Cyclin D1 in quiescent
infected with a control lentivirus (Fig. 3k). We then tested the effects MuSCs and performed RNA-seq on young(WT), young(HET) and
of increased Cyclin D1 expression on MuSCs maintained in quies- young(KO) MuSCs, as well as old(WT) MuSCs for comparison.
cence ex vivo (Extended Data Fig. 6d). When the cells were then Loss of Cyclin D1 from quiescent young MuSCs resulted in broad
allowed to activate in the presence of EdU, increased Cyclin D1 led transcriptomic changes (Fig. 4a). At a 10% FDR, 633 genes were dif-
to an acceleration of the exit from quiescence of old but not young ferentially expressed between young(WT) and young(HET) MuSCs,
MuSCs (Fig. 3l). and 530 genes were differentially expressed between young(WT)

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm Letters
a b c d e
Y(–Ex) O(–Ex) O(+Ex) 300 4
siCtrl siD1

(relative MFI above background)

Cyclin D1 protein per single cell
siRNA: Ctrl D1 Ctrl D1 Ctrl D1 * *

Ccnd1 mRNA per single cell

0.6
* *
Cyclin D1

(detectable transcripts)

(fraction EdU+ after 2 d)

3

Cyclin D1

Exit from quiescence

Gapdh 200
1.5 0.4
2
*
Relative cyclin

* *
D1 protein

1.0
100
* 1
0.2
0.5

DAPI
0 0 0 0
siRNA: Ctrl D1 Ctrl D1 Ctrl D1 siCtrl siD1 siCtrl siD1 siRNA: Ctrl D1 Ctrl D1 Ctrl D1
Y(–Ex) O(–Ex) O(+Ex) Y(–Ex) O(–Ex) O(+Ex)

f (–Ex) (+Ex) g h i
WT HET KO 5 * 0.4

(relative MFI above background)

Cyclin D1 protein per single cell
WT HET KO WT HET KO * *
Cyclin D1

(fraction EdU+ after 2 d)

4
Cyclin D1

Exit from quiescence

Gapdh 0.3
1.5 3 WT(–Ex)
*
0.2
Relative cyclin
D1 protein

1.0 WT(–Ex) 2

0.1
0.5 1
DAPI

0.0 0 0
–Ex +Ex –Ex +Ex WT HET KO –Ex +Ex –Ex +Ex
HET KO HET KO

j k n.s. l n.s.
m n 700 o
GFP-V5 700 0.8 Ctrl D1-WT 0.5
Tet:
* *
Cyclin D1 600

(median fl volume at 24 h)
*
(fraction EdU+ after 2 d)

(fraction EdU+ after 2 d)

(median fl volume at 20 h)

600 0.4
Exit from quiescence
V5 DAPI

Exit from quiescence

Exit from quiescence

0.6 Histone 3
*
Exit from quiescence

500
*
500 8.0 400 0.3
*
cyclin D1 protein

0.4
6.0
*
Cyclin D1-V5 400 300
0.2
Relative

4.0 200
0.2
V5 DAPI

300 0.1
2.0 100
200
0 0 0.0 0 0
lenti: lenti: Tet:
trl
1
trl
1
trl
1
trl
1

trl
Tet:
trl

Tet:
trl

T
KE
T
KE
T
D

D
D

C
C

C
C

W
C

W
W

1-
1-

1-
1-
1-

Young Old Young Old

D
D

D
D
D

Old Old

Fig. 3 | Exercise improves MuSC activation through Cyclin D1. a, Freshly isolated MuSCs were transfected with non-targeting (Ctrl) or Ccnd1-targeting
(D1) siRNA pools. One day later, MuSCs were collected for western blot. Shown is a representative blot and quantification of three blots. Each lane
represents a pool of two to four mice split into the two siRNA conditions (n = 3 lanes per group). b, Ccnd1 single-molecule RNA-FISH on MuSCs
transfected as in a and fixed after 2 d (n = 127 cells in each group, pooled from 2 mice split into the two siRNA conditions). c,d, Cyclin D1
immunofluorescence on MuSCs transfected as in a and fixed after 2 d (n = 99 cells per group, pooled from 8 mice split into the two siRNA conditions)
(c), and quantification of expression (d). Nuclei were stained with DAPI. e, MuSCs transfected as in a were grown continuously in EdU (n = 3 for Y(–Ex),
4 for O(–Ex) and 3 for O(+Ex) mice). f, Western blot of MuSCs from WT, HET or KO mice, without or with exercise. Shown is a representative blot and
quantification of three blots. Each lane represents a pool of one to four mice (n = 5 for HET(–Ex), 7 for HET(+Ex), 3 for KO(–Ex), 3 for KO(+Ex) and
12 for WT(–Ex) lanes). g,h, Cyclin D1 immunofluorescence on MuSCs from WT, HET or KO mice fixed after 2 d (n = 99 cells per group, pooled from 6
WT, 3 HET and 2 KO mice). i, Lower hindlimb muscles were injured to activate MuSCs in vivo. After 1.5 d, mice received an i.p. injection of EdU. MuSCs
from these muscles were isolated 12 h later for EdU staining (n = 7 for HET(–Ex), 7 for HET(+Ex), 6 for KO(–Ex), 6 for KO(+Ex) and 11 for WT(–Ex) mice).
j, MuSCs from each mouse were split into the two infection conditions: GFP-V5 (Ctrl) lentiviruses and Ccnd1-V5 (D1) lentiviruses. While being infected,
MuSCs were held in tubastatin A (TubA) to maintain quiescence. After 3 d, MuSCs were fixed and stained for the V5 tag. Analysis of these images
showed infection rates of 47 ± 9% (n = 3, mean ± s.d.) for lentiCtrl and 54 ± 3% (n = 3, mean ± s.d.) for lentiD1 infections. k, MuSCs from each mouse
were infected with Ctrl or D1 lentiviruses immediately upon isolation, and enlargement was measured with a Coulter counter (n = 3 mice per group).
l, MuSCs infected as in j were activated in the presence of EdU for 2 d by removing TubA (n = 3 mice per group). m, Western blot of MuSCs from Tet-Ctrl
and TetD1-WT mice. Shown is a representative blot and quantification of two blots. Each lane represents MuSCs from one mouse (n = 4 lanes per group).
n,o, Exit from quiescence was measured by cell size (n) and S-phase entry (o) (n = 6 for Tet-Ctrl, 6 for TetD1-WT, and 4 for TetD1-KE hindlimbs). Scale
bars in c, g and j, 50 μm. Data are summarized with mean and s.e.m. in f, i and m–o. For box-and-whisker plots in b, d and h: bottom whisker, minimum;
box bottom, 25th percentile; box middle, median; box top, 75th percentile; top whisker, maximum; +, mean. n.s., not significant; *P < 0.05; one-tailed
ratio-paired t-test in a, one-tailed Welch’s t-test in b, d, h, i, n and o, one-tailed unpaired t-test in k, one-tailed paired t-test between groups connected by
dotted lines in e, one-tailed Welch’s t-test between O(–Ex)(siCtrl) and O(+Ex)(siD1) in e and between Y(lentiCtrl) and O(lentiCtrl) in l, one-tailed Mann–
Whitney U-test in f and m.

Nature Metabolism | www.nature.com/natmetab

Letters NATurE METAbOlISm

a b TGF-β signalling
c Hallmark TGF-β signalling
d e TRANSFAC
40 Smad3
PC2 (16% of variance) score

–2.0

Normalized enrichment score

–2.5 Smad3
Young(WT)
0 0
20 –2.0 –1.5 –0.1
NES = –2.076

ES
–0.2 NES = –1.841

ES
–0.2
Young(KO) –1.5 q = 0.001 q = 0.003

NES
0 –0.4 –1.0 –0.3
Old(WT) –0.4
–1.0
–20

Ccnd1 corr.
–0.5

Ccnd1 corr.
1.0 1.0
–0.5 0.5
0.5
Young(HET) 0 0
–40 0 –0.5 0.0 –0.5
–40 –20 0 20 40 Hallmark TRANSFAC
gene sets Positive Negative gene sets Positive Negative
PC1 (25% of variance) score

f Y O O g WT HET HET h
(–Ex) (–Ex) (+Ex) (–Ex) (–Ex) (+Ex)

p-Smad3 p-Smad3
150 *
Histone 3 Histone 3
Y(Veh)

(mean µm2 area after 18 h)

Exit from quiescence
3 3
* 100
C-term. phosphorylation
C-term. phosphorylation

*
Relative Smad3
Relative Smad3

2 2

50
1 1
WT(–Ex)
Y(–Ex)

0 0 0
–Ex +Ex –Ex +Ex Veh LY
Old HET Old

i 0.4 j k 0.4 l

(relative fraction EdU+ after 2 d)

0.4 2.0
* * *
*
(fraction EdU+ after 2 d)

(fraction EdU+ after 2 d)

(fraction EdU+ after 2 d)
Exit from quiescence

Exit from quiescence

Exit from quiescence

Exit from quiescence

Y(Veh)
0.3 0.3 0.3 1.5
WT(Veh) WT(Veh)

0.2 0.2 0.2 1.0

0.1 0.1 0.1 0.5

0 0 0 0
Veh LY Veh LY Veh LY Veh LY
Old HET KO Old (ex vivo)

Fig. 4 | Cyclin D1 represses TGF-β signalling activity in quiescent MuSCs. a, PCA of RNA-seq profiles (triangles) of MuSCs from young WT, HET or KO
mice (with respect to Ccnd1), or old(WT) mice. Each profile represents the MuSCs of an individual mouse. b, GSEA was performed with the Hallmark gene
sets using the Ccnd1 correlation coefficients. Shown are the NES values for the negatively enriched sets. TGF-β signalling is labelled as the top negatively
correlated gene set. c, Enrichment plot for the TGF-β signalling gene set. d, GSEA using experimentally determined TFT gene sets in the TRANSFAC/
Harmonizome database. Smad3 is labelled as the transcription factor with the top negatively correlated TFT gene set. e, Enrichment plot for the Smad3
TFT gene set. f,g, Western blots on freshly isolated MuSCs to assess for activating C-terminal phosphorylation of Smad3. Each lane’s phospho-Smad3
level was normalized to Histone 3 and then to the grand mean of each blot; blots quantified in each figure contained equals numbers of each replicate type.
f, MuSCs were from Y(–Ex), O(–Ex) and O(+Ex) mice. Shown is a representative blot and quantification of three blots. Each lane represents a pool of one
to three mice (n = 8 lanes per group). g, MuSCs were from WT(–Ex), HET(–Ex) and HET(+Ex) mice. Shown is a representative blot and quantification of
two blots. Each lane represents MuSCs from one mouse (n = 6 lanes per group). h–k, Mice were treated with TGF-β receptor 1 inhibitor (LY, LY364947) or
vehicle (Veh, DMSO) via i.p. injection daily for 5 d. h, On the sixth day, FACS-isolated MuSCs were cultured and then fixed to analyse cell enlargement by
staining for α-tubulin and quantification of cell area (n = 3 for O(DMSO), 3 for O(LY364947) and 1 for Y(DMSO) mice). i–k, On the sixth day, MuSCs were
isolated and cultured continuously with EdU to assess S-phase progression. i, n = 6 for O(DMSO), 5 for O(LY364947), and 2 for Y(DMSO) mice. j, n = 5
for HET(DMSO), 6 for HET(LY364947) and 6 for WT(DMSO) mice. k, n = 5 for KO(DMSO), 8 for KO(LY364947) and 4 for WT(DMSO) mice. l, MuSCs
isolated from old(WT) mice were treated with LY or Veh for 12 h. During the treatment, MuSCs were held in TubA to maintain quiescence. MuSCs were
then activated in the presence of EdU for 2 d by removing TubA (n = 9 mice per group). ES, running enrichment score. Data are summarized with mean +
s.e.m. *P < 0.05; one-tailed unpaired t-test in f–g and l; two-tailed Welch’s t-test in h–k.

and young(KO) MuSCs. Indeed, Cyclin D1 deficiency caused the did not mimic ageing included apical surface polarity and epithe-
young MuSC transcriptome to resemble that of old MuSCs. GSEA lial–mesenchymal transition gene sets.
showed that Cyclin D1 deletion resulted in the upregulation of some Because Cyclin D1 is present in non-cycling MuSCs, and because
of the gene sets also upregulated with ageing, such as TGF-β, IFN-α Cyclin D1-K112E induction restored old MuSC activation, we
and IFN-γ and NF-κB/inflammatory gene sets, and, as with ageing, sought to identify potential non-canonical functions of Cyclin D1
the downregulation of cell-cycle-promoting gene sets (Extended in quiescent MuSCs. In terms of non-canonical roles beyond pocket
Data Fig. 7). Gene sets changed in Cyclin-D1-deficient MuSCs that protein (pRb, p107 and p130) inactivation, Cyclin D1 is known for

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm
repressing the activity of numerous transcription factors36,37, which
was intriguing in light of the global transcriptome changes observed
when Cyclin D1 was deleted from quiescent MuSCs. We therefore
conducted a focused analysis of our RNA-seq datasets with the
following question: in the context of ageing, exercise and genetic
deficiency of Cyclin D1, which transcription factors are repressed
by Cyclin D1 in quiescent MuSCs? As our approach, we calculated
the correlation of each gene’s expression level with the expression
level of Cyclin D1 across all samples, weighting samples so that
each group—young(WT)(–Ex), young(WT)(+Ex), old(WT)(–Ex),
old(WT)(+Ex), young(HET)(–Ex) and young(KO)(–Ex)—con-
tributed equally to the final correlation coefficient (Extended Data
Fig. 8a). This generated a single list of genes and their correlation
coefficients with Cyclin D1, allowing standard analysis by GSEA.
We analysed the Hallmark gene set collection and four independent
collections of transcription-factor target (TFT) genes, two based on
binding determined in chromatin immunoprecipitation followed by
sequencing (ChIP–seq) and microarray hybridization (ChIP–chip)
studies, and two based on computationally predicted motif pres-
ence (Extended Data Fig. 8b,c). The most prominent Hallmark gene
set anticorrelated with Cyclin D1 was TGF-β signalling (Fig. 4b,c),
which was matched by anticorrelation of Smad3 TFT gene sets
(Fig. 4d,e and Extended Data Fig. 8c). Retrospective analysis of
pairwise RNA-seq data comparisons confirmed that the TGF-β sig-
nalling gene set was increased in old MuSCs compared with young
MuSCs, HET MuSCs compared with WT MuSCs and KO MuSCs
compared with WT MuSCs, and was decreased in old(+Ex) MuSCs
compared to old(–Ex) MuSCs (Extended Data Fig. 8d). We cor-
roborated these results by analysing the activating carboxy-termi-
nal phosphorylation of Smad3 in MuSCs in western blots, finding
that Smad3 activation was higher in old and genetically Cyclin-
D1-deficient MuSCs and was lower after exercise (Fig. 4f,g). Also
anticorrelated with Cyclin D1 in these analyses was TNF-α–NF-κB
signalling, as well as TFT gene sets of transcription factors known
or likely to be non-canonically regulated by Cyclin D1, such as the
p65/RelA subunit of NF-κB, CCAAT-enhancer-binding protein
beta (C/EBPβ) and hypoxia-inducible factor 1-alpha–aryl hydro-
carbon receptor nuclear translocator (Hif1α-ARNT)31,38,39, and TFT
gene sets of transcription factors involved in cellular stress and
inflammation, such as nuclear factor, erythroid 2 like 2 (Nfe2l2,
also known as Nrf2), aryl hydrocarbon receptor (AhR), heat shock
transcription factor 1 (HSF1) and activating transcription factor 2
(Atf2) (Extended Data Fig. 8b,c).
Because TGF-β signalling and Smad3 activity are strongly anti-
correlated with Cyclin D1 levels in MuSCs in the context of age-
ing and exercise, because Cyclin D1 is known in the literature to
repress Smad3 activity26,40 and because excessive TGF-β signalling
suppresses MuSC function41,42, we hypothesized that inhibition of
TGF-β–Smad3 signalling would improve MuSC activation in genet-
ically Cyclin-D1-deficient MuSCs and in old MuSCs. Although
TGF-β inhibition improves muscle repair in old mice41,42, the cel-
lular targets responding to that inhibition have not been demon-
strated. To suppress TGF-β–Smad3 signalling in quiescent MuSCs
in vivo, we used the small molecule LY364947, which inhibits TGF-β
receptor 1 and has been shown to act directly on the MuSC lin-
eage in vitro41,43. Administration of LY364947 i.p. inhibited Smad3
C-terminal phosphorylation in MuSCs (Extended Data Fig. 9a–c).
LY364947 treatment of old mice resulted in improved activation of
MuSCs as assayed by ex vivo cell enlargement and EdU incorpora-
tion (Fig. 4h, i). In addition, LY364947 treatment also improved the
activation ability of young(HET) and young(KO) MuSCs (Fig. 4j,k),
showing that the effects of loss of Cyclin D1 could be ameliorated
by TGF-β–Smad3 signalling suppression. To test whether the inhi-
bition of TGF-β signalling systemically might be acting directly on
MuSCs, we treated MuSCs ex vivo with LY364947 and found that
this accelerated their exit from quiescence (Fig. 4l). This repression
Nature Metabolism | www.nature.com/natmetab
Letters
Exercise
Young Old
Cyc
lin D
1
Quiescent Ageing Quiescent
MuSCs MuSCs
Cyclin D1 Cyclin
clin
cl in D1
TGF-β–Smad3 TGF-β–Smad3
Inefficient activation
Normal activation
Inefficient muscle
Normal muscle regeneration
regeneration
Fig. 5 | Schematic of old MuSC rejuvenation by exercise. Ageing impairs
MuSC activation, which encompasses the first MuSC division after
stimulation and includes processes such as cell enlargement and DNA
replication. Voluntary wheel running for 3 weeks in old mice restores
MuSC activation ability and muscle regeneration. Mechanistically, this
rejuvenation occurs through restoration of the expression of Cyclin D1 in
quiescent MuSCs, which plays a distinct role of preparing these cells for
efficient activation. This function of Cyclin D1 in stem-cell readiness for
activation involves suppression of the pro-ageing TGF-β–Smad3 signalling
pathway in the quiescent state. Taken together, the results of this work
demonstrate that voluntary exercise is a practicable intervention for old-
MuSC rejuvenation.
of Smad3 by Cyclin D1 may be through linker phosphorylation by
Cdk4, as has been shown40, direct binding, a common mechanism
of action of Cyclin D136,37, or through indirect effects on TGF-β–
Smad3 pathway components or other impinging pathways44.
Together, these experiments show that Cyclin D1 is important for
suppressing TGF-β signalling in quiescent MuSCs, although addi-
tional effects of inhibition of TGF-β signalling could also contribute
to enhancement of MuSC function.
In conclusion, we show that voluntary, non-strenuous exercise
accelerates muscle repair and improves MuSC function of old mice
(Fig. 5). These improvements in MuSC activation ability hinge on
the restoration towards youthful levels of Cyclin D1, which in qui-
escent MuSCs is necessary and sufficient for prompt activation.
Cyclin D1 expression is associated with restraint of the pro-ageing
TGF-β–Smad3 signalling axis. Thus, this work has uncovered a new
practicable intervention for old MuSC rejuvenation, new roles for
Cyclin D1 in quiescent stem cells and specific molecular circuits
impaired in old MuSCs that can be ameliorated through exercise or
pharmacologic intervention.
Letters
Methods
Animals. Animal procedures were approved by the Administrative Panel on
Laboratory Animal Care of the VA Palo Alto Health Care System. Young C57BL/6J
mice (strain 000664) and R26RYFP mice on the C57BL/6J background (strain
006148) were purchased from The Jackson Laboratory. NOD-SCID mice were
purchased from Taconic Biosciences. Old C57BL/6N mice were obtained from
Charles River Laboratories through the National Institute on Aging. Pax7CreER
mice on the C57BL/6 × 129/SvJ background were kindly provided by C. Keller
(Oregon Health & Science University). Ccnd1flox mice on the C57BL/6J × 129/
Sv background were kindly provided by P. Sicinski (Dana-Farber Cancer
Institute). TRE-Ccnd1WT and TRE-Ccnd1K112E mice on the FVB background were
kindly provided by R. Pestell (Thomas Jefferson University). Pax7rtTA mice were
generated by genOway on the C57BL/6J background (details below in ‘Cyclin D1
overexpression in MuSCs in vivo’). Mice were housed in specific-pathogen-free
conditions in barrier-protected rooms under a 12-h light–dark cycle and were
fed ad libitum. All mice used for analysis were male. Young-adult mice, Pax7CreER
mice and Ccnd1flox mice were 3-4 months old, R26RYFP mice were either 4 or 20–22
months old, NOD-SCID mice were 4–5 months old and old mice were 18–22
months old. When possible, littermate controls were used.
Exercise. Mice were housed individually for 3 weeks in polycarbonate cages
with 12.7-cm-diameter wheels equipped with optical rotation sensors (Lafayette
Instrument, 80820). For non-exercised control mice housed with locked wheels,
rubber brakes or cable ties were used to immobilize the wheels.
Muscle injury. Mice were anaesthetized with isoflurane. For regeneration
assays, each TA muscle received 30 µL 1.2% barium chloride (Sigma) distributed
over 10 intramuscular punctures. For MuSC isolation, each lower hindlimb
(TA and gastrocnemius muscles) received 50 µL barium chloride distributed
over 30 intramuscular punctures. Mice then received routine post-operative
buprenorphine analgesia and enrofloxacin antibiotic care.
MuSC isolation. MuSC isolation by FACS was performed as previously
described45,46 using surface-antigen-based isolation (Extended Data Fig. 2e) and
YFP-based isolation (Extended Data Fig. 6a), with the inclusion of DAPI (0.5 µg
mL–1) as a viability stain. Briefly, hindlimb and triceps muscles were collected,
thinly chopped with scissors and digested using Collagenase II and Dispase
(Thermo Fisher). MuSCs were then dissociated from the myofibers with a 20-G
needle, and the resulting cellular suspension was filtered using 40-µm cell strainers.
Sorters used for the final isolation of a pure MuSC population were Aria II and
Aria III machines (BD Biosciences). YFP-based isolation was used in the transplant
experiments and for all samples with the (WT), (HET) or (KO) descriptor;
otherwise, MuSC isolations were done by immunophenotype-based sorting
(CD31−CD45+Sca1–VCAM+). Purity was routinely assessed by plating an aliquot
of cells and fixing them 1 h later with 4% formaldehyde. These samples were then
stained with antibodies to detect Pax7 (1:50, DSHB AB_528428) and, for YFP-
based sorts, antibodies to detect YFP (10 μg mL–1, Abcam ab13970).
MuSC transplantation. At three months of age, Pax7CreER;R26RYFP mice received
tamoxifen (80 mg per kg (body weight) in 100% corn oil via i.p. injection daily for
7 d) to label MuSCs with YFP. Mice were then aged until their use as MuSC donors.
Host TA muscles of young NOD-SCID mice were injured 1 d before they received
transplants. Each muscle was transplanted with 10,000 freshly isolated YFP-
positive MuSCs. Each transplant was performed in a volume of 20 µL over a single
injection track using a Hamilton syringe (Gastight 1800 series), injecting at 0.1 µL
second–1. Ten days after transplantation, TA muscles were collected for analysis.
MuSC culture. Unless otherwise indicated, MuSCs were cultured at 21,000 cells
per cm2 in Ham’s F-10 medium containing 10% horse serum, 100 U mL–1 penicillin
and 100 μg mL–1 streptomycin. MuSCs were plated on glass chamber slides coated
with poly-d-lysine (0.1 mg mL–1, EMD Millipore) and ECM (25 µg mL–1, Sigma)
for assays involving immunofluorescence or on plastic tissue-culture plates coated
with ECM for assays involving time-lapse microscopy, cell volume measurements,
RNA content measurements or western blot analysis.
Cyclin D1 knockdown in culture. FACS-isolated MuSCs were plated at 40,000
cells per cm2 in Ham’s F-10 medium containing 10% foetal bovine serum for
immediate reverse transfection using Lipofectamine 2000 (Thermo Fisher)
and Ccnd1-targeting or non-targeting SMARTpool ON-TARGETplus siRNAs
(Dharmacon) at 50 nM. After 4 h, medium was changed to Ham’s F-10 medium
containing 10% horse serum, 100 U mL–1 penicillin and 100 μg mL–1 streptomycin,
with the addition of 10 µM EdU for S-phase-entry assays.
Cyclin D1 overexpression in culture. Ccnd1 human complementary DNA in
the pDONR221 backbone was obtained from the Harvard PlasmID repository
(HsCD00040407). EGFP cDNA in the pDONR221 backbone was obtained
through Addgene as a gift from D. Root (Addgene plasmid no. 25899), as was
pLEX_306 (Addgene plasmid no. 41391). Using the Gateway recombination-
based cloning system (Thermo Fisher), each cDNA was cloned into the pLEX_306
NATurE METAbOlISm
destination vector, which contains a PGK promoter and a C-terminal V5 tag.
Final constructs were sequenced to confirm the absence of mutations. Ccnd1-V5
or GFP-V5 lentiviruses were produced in HEK 293T cells by co-transfecting the
pLEX_306 vector with psPAX2 packaging and pMD2.G envelope plasmids (ratio
3:2:1). Viral supernatants at 48 and 72 h were combined, filtered through 0.45-
µm polyvinylidene difluoride (PVDF) and concentrated with the PEG-it Virus
Precipitation Solution (System Biosciences). FACS-isolated MuSCs were plated at a
density of 40,000 cells per cm2 in Ham’s F-10 medium containing 10% horse serum,
100 U mL–1 penicillin, 100 μg mL–1 streptomycin and 40 µM tubastatin A (TubA,
Cayman 10559). TubA is a derivative of tubacin, the histone deacetylase (HDAC)
inhibitor47. One hour after plating, cells were infected by addition of equal volumes
of viral concentrates and polybrene (10 µg mL–1), underwent spinoculation (2,550g
for 1 h) and then were washed twice with TubA-containing medium. Subsequently,
TubA-containing medium was replaced daily. Seventy-two hours after infection,
MuSCs were released from TubA by washing four times and were then cultured
in Ham’s F-10 medium containing 10% horse serum, 100 U mL–1 penicillin, and
100 μg mL–1 streptomycin, with the addition of 10 µM EdU for S-phase-entry
assays. To assess S-phase entry, cells were then fixed after a further 48 h. To assess
infection efficiency, cells were fixed immediately at the end of the 72 h and stained
with antibodies against V5 (11.2 µg mL–1, Thermo Fisher R960-25). To assess
overexpression levels, cells were lysed immediately at the end of the 72 h for the
indicated assays.
Cyclin D1 deletion in MuSCs in vivo. Mice with floxed alleles of Ccnd1 that
generate null recombination alleles have been described previously30. Pax7CreER
mice containing IRES followed by CreER knocked in to the 3′ untranslated region
(UTR) of Pax7 have been described previously13. R26RYFP mice containing a
transcription termination sequence flanked by loxP sites (loxP-stop-loxP) before
EYFP in the Rosa26 locus have been described previously48. Lines were maintained
as Pax7CreER/CreER;Ccnd1flox/flox, Pax7CreER/CreER;Ccnd1+/+, R26RYFP/YFP;Ccnd1flox/flox and
R26RYFP/YFP;Ccnd1+/+ mice. Experimental animals (Pax7CreER/+;R26RYFP/+;Ccnd1+/+,
Pax7CreER/+;R26RYFP/+;Ccnd1flox/+ and Pax7CreER/+;R26RYFP/+;Ccnd1flox/flox) were
generated by intercrossing appropriate lines and then confirming genotype by tail-
tip PCR. Tamoxifen (Sigma) was administered to all animals at the ages indicated
via i.p. injection at 80 mg per kg (body weight) in 100% corn oil daily for 7 d.
MuSCs were isolated on the basis of YFP expression via FACS, as described above.
Cyclin D1 overexpression in MuSCs in vivo. TRE-Ccnd1WT and TRE-Ccnd1K112E
mice transgenic for human Ccnd1 with or without the K112E mutation under
TRE regulation have been published previously31,32. Pax7rtTA mice contain rtTA-M2
followed by an IRES, mouse Pax7 and a polyadenylation tail knocked in to the
first exon of the Pax7 locus. Both lines were maintained by breeding heterozygous
animals to wild-type animals. Experimental animals (Pax7rtTA/+, Pax7rtTA/+;TRE-
Ccnd1WT and Pax7rtTA/+;TRE-Ccnd1K112E) were generated by intercrossing the two
lines and ageing the appropriate genotypes until use. All transgenic animals were
treated for 7 d with doxycycline by providing doxycycline hyclate chow (Envigo,
TD.120769), delivering a daily dose of 2–3 mg doxycycline based on consumption
of 4–5 g each day. On the sixth and seventh days, doxycycline hyclate (Thermo
Fisher) was injected i.p. at 50 mg per kg (body weight) in 0.9% NaCl. MuSCs
were isolated on the eighth day on the basis of immunophenotype via FACS as
described above.
Serum transfers. Serum was isolated from mice via post-mortem cardiac
puncture and stored at −80 °C until use. Recipient mice were all old(–Ex) animals
and were injected via tail vein with 0.3 mL serum daily for 3 d before analysis on
the fourth day.
TGF-β receptor 1 inhibition. LY364947 (Cayman) was dissolved in PBS
containing 2% DMSO and administered via i.p. injection daily for 5 consecutive
days at 0.2 mg per kg (body weight). For vehicle control mice, injections consisted
of PBS containing 2% DMSO. Analyses were conducted on the sixth day. For ex
vivo experiments, MuSCs isolated from old WT mice were treated with TGF-β
receptor 1 inhibitor (LY364947 at 3.7 nM) or vehicle (Veh, DMSO) for 12 h.
During the treatment, MuSCs were held in TubA to maintain quiescence. MuSCs
were then activated in the presence of EdU for 2 d by removing TubA.
TA muscle histology. To test for MuSC regenerative ability in transplantation
assays, muscles were fixed with 0.5% formaldehyde for several hours, cryoprotected
with 20% sucrose and frozen. Transverse 7-µm sections were generated and
stained for laminin using a rat anti-laminin α1 antibody (1:1,000, EMD Millipore
MAB1903) and for YFP using a rabbit anti-GFP antibody (10 µg mL–1, Thermo
Fisher A11122). DAPI was used to visualize nuclei. For each muscle, ten sections,
collected at evenly spaced intervals along the rostro-caudal axis of the muscle, were
analysed in a blinded fashion for YFP-positive fibre area and number in Volocity
software (PerkinElmer).
To test for MuSC quiescence after exercise, muscles were fresh-frozen in liquid-
nitrogen-cooled isopentane. Transverse 10-µm sections were generated, fixed with
2% formaldehyde and stained for laminin using a rat anti-laminin α2 antibody
(1.5 µg mL–1, Abcam ab11576). After heat-induced epitope retrieval (HIER) as
Nature Metabolism | www.nature.com/natmetab
NATurE METAbOlISm
described49, antibodies against Ki67 (rabbit, 20 µg mL–1, Abcam ab15580) and Pax7
(mouse, 1:50, DSHB AB_528428) or MyoD1 (mouse, 10 µg mL–1, BD Biosciences
554130) were applied with the M.O.M. Basic Kit (Vector Laboratories). Briefly,
immediately after laminin staining, samples were boiled for 45 min in HIER
buffer (10 mM sodium citrate, 0.05% Tween-20, pH 6.0). After this boiling step,
samples were incubated with M.O.M. blocking buffer for 2 h and stained overnight
for either Ki67, Pax7 or MyoD1. DAPI was used to visualize nuclei. Images were
quantified manually using Volocity. To assess muscle inflammation and repair
after exercise, muscles were fresh-frozen, sectioned and fixed as described above
in this paragraph. For macrophage detection, sections were stained with a rabbit
anti-laminin antibody (1 µg mL–1, Sigma L9393) and with an antibody against
macrophages (rat anti-F4/80, 10 µg mL–1, Thermo Fisher 14-4801-82). For eMHC
detection, sections were first stained for laminin using a rat anti-laminin α2
antibody (1.5 µg mL–1, Abcam ab11576). After HIER, an antibody against eMHC
(mouse, 1:50, DSHB F1.652) was applied using the M.O.M. kit. DAPI was used to
visualize nuclei. Images were quantified manually using Volocity.
To assess myofiber cross-sectional area after exercise, muscles were fixed,
cryoprotected, and frozen as described above, and transverse 8-μm sections
midway along the muscle proximal-distal axis were stained with haematoxylin and
eosin. Average cross-sectional areas were determined by automatically quantifying
the total fibre area with the SIOX segmentation plugin for ImageJ and manually
counting the number of fibres.
To assess MuSC pool size after Cyclin D1 deletion from MuSCs, muscles were
fixed, cryoprotected, and frozen as described above, and transverse 7-µm sections
were stained for laminin using a rat anti-laminin α2 antibody (10 µg mL–1, Abcam
ab11576) and for YFP using a rabbit anti-GFP antibody (10 µg mL–1, Thermo
Fisher A11122). After HIER, antibodies against Pax7 (1:10, DSHB AB_528428)
were applied with the M.O.M. Kit. DAPI was used to visualize nuclei. Pax7-positive
cells and fibre numbers were quantified manually using Adobe Photoshop.
To assess muscle regeneration after injury, injured TA muscles were fresh-
frozen in liquid-nitrogen-cooled isopentane. Transverse 7-µm sections were
generated and fixed with 2% formaldehyde. Laminin was detected using a rabbit
anti-laminin antibody (1 µg mL–1, Sigma L9393). Regenerating myofibers were
detected using a mouse anti-eMHC antibody (1 µg mL–1, DSHB F1.652) applied
with the M.O.M. Kit. DAPI was used to stain nuclei. Sections were imaged with a
Zeiss Observer Z1 fluorescent microscope equipped with a Hamamatsu Orca-ER
camera. Non-injured or non-muscle areas (areas with large myofibers lacking
central nuclei or areas containing aponeurosis tissue) were manually excluded, and
then the fraction of each area occupied by eMHC was quantified automatically
using Volocity software.
MuSC flow cytometry. To test for cell size and RNA content in quiescence,
FACS-isolated MuSCs were immediately blocked for 45 min at 37 °C with Ham’s
F-10 containing 10% horse serum and 10 µM Hoechst 33342 (Thermo Fisher),
stained with 0.1 mg mL–1 Pyronin Y (Santa Cruz) for 15 min at 37 °C in Ham’s F-10
containing 10% horse serum, and analysed on an Aria III machine. Forward scatter
values for cell size and PE or PE-Cy5 values for RNA content were normalized to
the mean young(–Ex) level of each experiment.
To test cell size and RNA content in MuSCs exiting quiescence, FACS-
isolated MuSCs were plated in Ham’s F-10 medium containing 20% foetal bovine
serum, 2.5 ng mL–1 bFGF (PeproTech), 100 U mL–1 penicillin and 100 μg mL–1
streptomycin. Eighteen hours later (unless otherwise indicated), cells were
trypsinized gently using TrypLE Select (Thermo Fisher). To determine cell size,
cells were then immediately assayed with a Moxi Flow combined Coulter counter
and flow cytometer (Orflo Technologies). To determine RNA content, MuSCs were
stained with Hoechst 33342 and Pyronin Y as above.
To assess cell survival, FACS-isolated MuSCs were grown for 1 d. Detached
cells were collected and pooled with attached cells after gentle detachment with
TrypLE Select. Cells were then stained with 7AAD (2.5 µg mL–1, BioLegend) to
mark dead cells and assayed on an Aria II machine.
MuSC immunocytochemistry. To quantify Cyclin D1 protein expression, MuSCs
were fixed with 4% formaldehyde and then stained with antibodies against
Cyclin D1 (2 µg mL–1, Abcam ab134175) and counterstained with DAPI. The
mean fluorescence intensity over each DAPI-positive region was determined
automatically with Volocity software. Background staining, calculated as the mean
fluorescence intensity over the DAPI-negative area of each frame, was subtracted.
To ensure equal cell numbers for the visualization of single-cell data distributions
in graphs, the same number of cells, equal to that in the specimen with the fewest
cells, was randomly sampled from each specimen using the ‘sample’ function in R.
To assess for MyoD1 expression, MuSCs were fixed with 4% formaldehyde and
then stained with antibodies against MyoD1 (mouse, 1:100, Dako M3512) and
counterstained with DAPI. The fraction of MyoD1-positive cells was determined
automatically using Volocity software.
In experiments in which cell area was assessed by immunocytochemistry,
FACS-isolated MuSCs were grown for 18 h and then fixed with 25 °C 4%
formaldehyde followed by −20 °C methanol to preserve cytoskeletal architecture.
Cells were stained using an antibody against α-tubulin (0.2 µg mL–1, Sigma T6199)
and counterstained with DAPI. Areas occupied by α-tubulin were quantified
Nature Metabolism | www.nature.com/natmetab
Letters
automatically using the contour functions (findContours, contourArea and
arcLength) of the OpenCV2 Python library.
S-phase entry. To assess S-phase entry of MuSCs exiting quiescence in culture,
FACS-isolated MuSCs were plated with 10 µM EdU (Thermo Fisher). After 2 d,
cells were fixed and stained with the Click-iT EdU Imaging Kit (Thermo Fisher)
and DAPI. The fraction of EdU-positive cells was determined automatically with
Volocity software.
To assess S-phase entry of MuSCs after injury in vivo, lower hindlimb muscles
were injured, and 1.5 days later, mice received 50 mg per kg (body weight) EdU via
i.p. injection. After another 12 h, MuSCs were FACS-isolated and fixed 2 h after
plating. Cells were then stained and quantified as described above.
To assess S-phase entry of MuSCs in the absence of injury in vivo, mice
received 0.8 mg mL–1 EdU or BrdU (Sigma) in the drinking water along with 2%
sucrose throughout the final week of exercise. MuSCs were then FACS-isolated
and fixed 2 h after plating. Cells were stained with an anti-BrdU antibody (5 µg
mL–1, Bio-Rad OBT0030G) or with the Click-iT EdU Imaging Kit. Cells were
counterstained with DAPI. The fraction of BrdU-positive or EdU-positive cells was
determined automatically using Volocity software.
Clonogenicity. FACS-isolated MuSCs were immediately re-stained with DAPI to
exclude dead cells and re-sorted as one cell per well into 96-well plates (Corning)
coated with 1 μg mL–1 collagen (Sigma) and 10 μg mL–1 laminin (Thermo Fisher).
Cells were cultured in Ham’s F-10 medium with 20% horse serum, 5 ng mL–1 bFGF,
100 U mL–1 penicillin and 100 μg mL–1 streptomycin for 6 d, with bFGF replenished
daily50. Cells were then stained with Hoechst 33342 (2 ng mL–1) and CellTracker
Green CMFDA (1 μM, Thermo Fisher) to aid visualization, and were then fixed
and counted.
Motility and time to first division. MuSCs were plated at 7,800 cells per cm2 to
facilitate single-cell tracking. After allowing the cells to adhere overnight, plates
were transferred to a Zeiss Axiophot 200M microscope coupled to an AxioCam
and maintained at 37 °C in 5% carbon dioxide. Images were captured every 10
min. Cells were segmented with iTrack4U51. For motility, segmented images
were stabilized with the Image Stabilizer plugin for ImageJ and tracked with the
wrMTrck plugin for ImageJ52 to determine the average distance traversed by all the
cells of an image frame between sequential image frames. The median velocity in
each well, and then the mean of the technical replicate wells for each mouse, was
used to calculate biological replicate motility values. For division times, segmented
images were analysed with the Baxter Laboratory KTH-SE cell-tracking program53
to determine over time the fraction of cells present in the first image frame,
excluding the cells that migrated out of the frame, that had completed cytokinesis.
The mean of the technical replicate wells for each mouse was used to calculate
biological replicate first division times.
RNA-seq. FACS-purified quiescent MuSCs from individual mice were snap-
frozen, and RNA was extracted with the Nucleospin RNA XS kit (Machery-Nagel).
RNA (10 ng) was reverse transcribed using oligo(dT) priming with the SMARTer
Ultra Low Input system (Takara). The cDNA was then sheared with a Covaris
S2 ultrasonicator. End repair, multiplexed adapter ligation and 13–15 cycles of
library amplification were performed using the Ovation Ultralow Multiplex system
(NuGEN). Libraries underwent paired-end 101-bp sequencing at the Stanford
Genome Sequencing Service Center with an Illumina HiSeq 2000 to a depth of
20–40 million reads.
For RNA-seq processing, reads were adapter- and quality-trimmed with
trim_galore (https://www.bioinformatics.babraham.ac.uk/projects/trim_galore)
(quality cutoff 20, adapter stringency 1, final length filter 50). Trimmed reads were
mapped to mm10 (Ensembl release 89, no patches) using transcript annotations
from GENCODE with STAR54 (mismatch cutoff 4% of read length, no non-
canonical junction alignments). Exonic reads that mapped uniquely (~70% of
total reads) were summarized over genes with the featureCounts module of the
Subread package55.
For RNA-seq gene-expression analysis, genes lacking an Entrez ID or lacking
a raw fragments per kilobase of exon per million reads (FPKM) of at least 1.5 in
at least three samples were filtered out, resulting in 11,337 genes. Raw count data
were then normalized for library preparation and sample collection batch effects
using RUVs56 (variation factors k = 6). Differential gene-expression analysis was
performed for genes with a normalized FPKM value of at least 6 in at least three
samples using edgeR57, with Cox–Reid estimations of tagwise dispersions and
negative binomial GLM likelihood ratio tests. The Benjamini–Hochberg FDR
control for multiple-hypothesis testing was used to produce q values. GSEA58 for
coherent biological processes was performed using the MSigDB Hallmark gene
sets59 (enrichment statistic P =1, ranking metric Signal2Noise, expressed gene set
size range 15–500, which excluded only Hallmark PANCREAS BETA CELLS). FDR
q values were calculated by gene permutation.
For the Ccnd1 correlation analysis, Ccnd1 Pearson correlation coefficients
were calculated using log-transformed post-normalization FPKM values, using
the ‘weights’ package in R (https://CRAN.R-project.org/package=weights). To
give each replicate group equal contribution to the correlation coefficient, sample
Letters
weights were assigned to be 1/(group size). GSEA was performed in pre-ranked
mode (enrichment statistic P = 1, ranking metric Ccnd1 Pearson correlation
coefficient). The Hallmark gene sets size range was 15–500. TFT gene sets were
the TRANSFAC curated gene sets60,61, the MotifMap gene sets62,and the ChEA
gene sets63, all obtained from the Harmonizome database64, and the MSigDB TFT
gene sets65, with size range 25–2100. For these TFT gene sets, multiple-hypothesis
testing was minimized by pre-analysis exclusion of gene sets associated with non-
transcription factors or transcription factors that had no or minimal expression (no
RNA-seq FPKM greater than six in any young(WT)(–Ex) or old(WT)(–Ex) MuSC
profile). FDR q values were calculated by gene permutation.
Immunoblotting. Equal numbers of MuSCs from pools of one to four mice
were lysed in Laemmli buffer (3% SDS, 15% glycerol, 0.5% 2-mercaptoethanol,
0.015% bromophenol blue, 100 mM Tris-Cl pH 6.8) followed by boiling and
centrifugation. Supernatants containing whole-cell extracts were resolved by SDS–
PAGE and then transferred to PVDF membranes and stained with antibodies to
detect the following proteins: Cyclin D1 (0.2 µg mL, Abcam ab134175), Smad2/3
phosphorylated at the C-terminus (1:200, BD Biosciences 624084), Gapdh (1 µg
mL–1, Thermo Fisher AM4300) and Histone 3 (1:10,000, EMD Millipore 07-
690). Bands were detected with WesternBright Sirius or Quantum ECL reagents
(Advansta) and imaged with a ChemiDoc XRS+ (Bio-Rad). Intensities were
quantified with ImageJ and normalized first to Gapdh or Histone 3 and then the
mean young(WT)(–Ex) level of each blot, unless otherwise indicated.
RT–qPCR. RNA was isolated using the RNeasy Plus Micro Kit (Qiagen) and
reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit
(Thermo Fisher). qPCR was performed with the LightCycler 480 I SYBR Green
PCR Master Mix (Roche). Technical triplicate or duplicate Ct values were averaged
and normalized to the mean of Gapdh, Hprt and Actb1 housekeeping transcript
values. Within each experiment, expression levels were normalized to the mean
young(WT)(–Ex) level. Primer sequences were, from 5′ to 3′:
Ccnd1: AGACCATTCCCTTGACTGC, AAGCAGTTCCATTTGCAGC
Sbk2: TGGGGACCTAATCACCTTCATC, GCCATGCGAGTGAATGTGT
Mest: CTCCAGAACCGCAGAATCAAC,
AGATACCTCCATTCGACAGACAG
Popdc2: GTGTCCGGGTGAATACCCTC, CAGCGTCAAGACCTGCTCA
Dag1: CTTGAGGCGTCCATGCACT, GGCAATTAAATCCGTTGGAATGC
Gapdh: TCAAGAAGGTGGTGAAGCAG, GTTGAAGTCGCAGGAGACAA
Hprt: CAGTACAGCCCCAAAATGGTTA, AGTCTGGCCTGTATCCAACA
Actb1: GATCATTGCTCCTCCTGAGC, ACATCTGCTGGAAGGTGGAC
Single-molecule RNA-FISH. FACS-isolated MuSCs were immediately re-stained
with DAPI and re-sorted to minimize debris. Cells were cytospun onto glass
slides coated with poly-d-lysine and ECM and prepared for smFISH as described
previously66. Briefly, cells were fixed with 4% formaldehyde and permeabilized
with 70% ethanol overnight at 4 °C. Cells were equilibrated in 10% formamide
and stained overnight with a library of 48 Stellaris RNA-FISH probes (Biosearch
Technologies) specific to Ccnd1. Cells were washed, mounted in 2× SSC Buffer
and counterstained with DAPI. Images were deconvolved with Volocity software,
and transcript counts were quantified with FISH-quant67. The same number
of cells was randomly sampled from each specimen as described in the ‘MuSC
immunocytochemistry’ section.
Single-cell RT–qPCR. FACS-isolated MuSCs immediately re-stained with DAPI
and re-sorted as 1 cell per well into 96-well plates prepared with the CellsDirect
One-Step qRT–PCR Kit (Thermo Fisher). Primers were added, and reverse
transcription followed by 20 cycles of pre-amplification was performed. Reactions
were then treated with Exonuclease I (NEB) to remove primers and diluted 10-
fold. Primers for qPCR were prepared with Assay Loading Reagent (Fluidigm),
SsoFast EvaGreen SuperMix with Low ROX (Bio-Rad) and DNA Binding Dye
Sample Loading Reagent (Fluidigm) in 48.48 Dynamic Array IFC chips (Fluidigm).
Samples were added to each PCR mixture, and qPCR was conducted with the IFC
Controller MX in the BioMark System (Fluidigm). Primer sequences were, from
5′ to 3′:
Ccnd1: GCCGAGAAGTTGTGCATCTA, GTTCACCAGAAGCAGTTCCA
Gapdh: TCAAGAAGGTGGTGAAGCAG, GTTGAAGTCGCAGGAGACAA
Statistics. No statistical methods were used to predetermine sample size. The
experiments were not randomized, and the investigators were not blinded to
allocation during experiments and outcome assessment. For unpaired experiments,
data points represent biological replicates and are summarized with a column
showing the mean and an error bar showing the s.e.m., except for experiments
analysing single cells, for which data are summarized with a box-and-whisker plot
(indicating the minimum, 25th percentile, median, 75th percentile and maximum) in
which + shows the mean. For paired experiments, each individual sample is shown as
a pair of points connected between the different conditions. Groups were compared
in unpaired experiments using two-tailed Welch’s t-tests or, for non-parametric data,
two-tailed Mann–Whitney U-tests. When in specific follow-up experiments the
null hypothesis clearly included differences in one direction, one-tailed tests were
NATurE METAbOlISm
used. When the same sample was split into two conditions, two-tailed paired t-tests
were used; when the effect was that of a fold-change rather than a change in absolute
values, two-tailed ratio-paired t-tests were used. Specific data representation details
and statistical procedures are also indicated in the figure legends.
Reporting Summary. Further information on research design is available in the
Nature Research Reporting Summary linked to this article.
Data availability
The data that support the findings of this study are available from the
corresponding author upon request. RNA-seq data have been deposited in the
NCBI Gene Expression Omnibus with the accession code GSE77178. Source data
for Figs. 2–4 and Extended Data Figs. 6 and 9 are presented with the paper.
Received: 5 February 2020; Accepted: 12 March 2020;
Published: xx xx xxxx
References
1. Sherwin, C. Voluntary wheel running: a review and novel interpretation.
Anim. Behav. 56, 11–27 (1998).
2. van Praag, H., Shubert, T., Zhao, C. & Gage, F. H. Exercise enhances learning
and hippocampal neurogenesis in aged mice. J. Neurosci. 25, 8680–8685 (2005).
3. Abreu, P., Mendes, S. V. D., Ceccatto, V. M. & Hirabara, S. M. Satellite cell
activation induced by aerobic muscle adaptation in response to endurance
exercise in humans and rodents. Life Sci. 170, 33–40 (2017).
4. Kurosaka, M., Naito, H., Ogura, Y., Machida, S. & Katamoto, S. Satellite cell
pool enhancement in rat plantaris muscle by endurance training depends on
intensity rather than duration. Acta Physiol. (Oxf.) 205, 159–166 (2012).
5. Dungan, C. M. et al. Elevated myonuclear density during skeletal muscle
hypertrophy in response to training is reversed during detraining. Am. J.
Physiol. Cell Physiol. 316, C649–C654 (2019).
6. Egner, I. M., Bruusgaard, J. C. & Gundersen, K. Satellite cell depletion prevents
fiber hypertrophy in skeletal muscle. Development 143, 2898–2906 (2016).
7. Kadi, F., Johansson, F., Johansson, R., Sjöström, M. & Henriksson, J. Effects of
one bout of endurance exercise on the expression of myogenin in human
quadriceps muscle. Histochem. Cell Biol. 121, 329–334 (2004).
8. Begue, G. et al. Early activation of rat skeletal muscle IL-6/STAT1/STAT3
dependent gene expression in resistance exercise linked to hypertrophy.
PLoS One 8, e57141 (2013).
9. Fujimaki, S., Hidaka, R., Asashima, M., Takemasa, T. & Kuwabara, T. Wnt
protein-mediated satellite cell conversion in adult and aged mice following
voluntary wheel running. J. Biol. Chem. 289, 7399–7412 (2014).
10. Conboy, I. M. et al. Rejuvenation of aged progenitor cells by exposure to a
young systemic environment. Nature 433, 760–764 (2005).
11. Cosgrove, B. D. et al. Rejuvenation of the muscle stem cell population
restores strength to injured aged muscles. Nat. Med. 20, 255–264 (2014).
12. Price, F. D. et al. Inhibition of JAK–STAT signaling stimulates adult satellite
cell function. Nat. Med. 20, 1174–1181 (2014).
13. Nishijo, K. et al. Biomarker system for studying muscle, stem cells, and
cancer in vivo. FASEB J. 23, 2681–2690 (2009).
14. Schultz, E. & Lipton, B. H. Skeletal muscle satellite cells: changes in prolifera­
tion potential as a function of age. Mech. Ageing Dev. 20, 377–383 (1982).
15. Conboy, I. M., Conboy, M. J., Smythe, G. M. & Rando, T. A. Notch-mediated
restoration of regenerative potential to aged muscle. Science 302,
1575–1577 (2003).
16. Rao, S. S. & Kohtz, D. S. Positive and negative regulation of D-type cyclin
expression in skeletal myoblasts by basic fibroblast growth factor and
transforming growth factor beta. A role for cyclin D1 in control of myoblast
differentiation. J. Biol. Chem. 270, 4093–4100 (1995).
17. Skapek, S. X., Rhee, J., Spicer, D. B. & Lassar, A. B. Inhibition of myogenic
differentiation in proliferating myoblasts by cyclin D1-dependent kinase.
Science 267, 1022–1024 (1995).
18. Panda, A. C. et al. Novel RNA-binding activity of MYF5 enhances Ccnd1/
Cyclin D1 mRNA translation during myogenesis. Nucleic Acids Res. 44,
2393–2408 (2016).
19. Ju, X. et al. Identification of a cyclin D1 network in prostate cancer that
antagonizes epithelial-mesenchymal restraint. Cancer Res. 74, 508–519 (2014).
20. Pauklin, S., Madrigal, P., Bertero, A. & Vallier, L. Initiation of stem cell
differentiation involves cell cycle-dependent regulation of developmental
genes by Cyclin D. Genes Dev. 30, 421–433 (2016).
21. Zou, P. et al. p57(Kip2) and p27(Kip1) cooperate to maintain hematopoietic
stem cell quiescence through interactions with Hsc70. Cell Stem Cell. 9,
247–261 (2011).
22. Chaves-Ferreira, M. et al. The cyclin D1 carboxyl regulatory domain controls
the division and differentiation of hematopoietic cells. Biol. Direct. 11, 21 (2016).
23. Jeselsohn, R. et al. Cyclin D1 kinase activity is required for the self-renewal of
mammary stem and progenitor cells that are targets of MMTV-ErbB2
tumorigenesis. Cancer Cell. 17, 65–76 (2010).
Nature Metabolism | www.nature.com/natmetab
NATurE METAbOlISm
24. Ma, J. et al. Proliferation and differentiation of neural stem cells are selectively
regulated by knockout of cyclin D1. J. Mol. Neurosci. 42, 35–43 (2010).
25. Bizen, N. et al. A growth-promoting signaling component cyclin D1 in neural
stem cells has antiastrogliogenic function to execute self-renewal. Stem Cells
32, 1602–1615 (2014).
26. Pauklin, S. & Vallier, L. The cell-cycle state of stem cells determines cell fate
propensity. Cell 155, 135–147 (2013).
27. Quelle, D. E. et al. Overexpression of mouse D-type cyclins accelerates G1
phase in rodent fibroblasts. Genes Dev. 7, 1559–1571 (1993).
28. Resnitzky, D., Gossen, M., Bujard, H. & Reed, S. I. Acceleration of the G1/S
phase transition by expression of cyclins D1 and E with an inducible system.
Mol. Cell. Biol. 14, 1669–1679 (1994).
29. Kim, H. A. et al. A developmentally regulated switch directs regenerative
growth of Schwann cells through cyclin D1. Neuron 26, 405–416 (2000).
30. Choi, Y. J. et al. The requirement for cyclin D function in tumor maintenance.
Cancer Cell. 22, 438–451 (2012).
31. Casimiro, M. C. et al. ChIP sequencing of cyclin D1 reveals a transcriptional
role in chromosomal instability in mice. J. Clin. Invest. 122, 833–843 (2012).
32. Casimiro, M. C. et al. Kinase-independent role of cyclin D1 in chromosomal
instability and mammary tumorigenesis. Oncotarget. 6, 8525–8538 (2015).
33. Hinds, P. W., Dowdy, S. F., Eaton, E. N., Arnold, A. & Weinberg, R. A.
Function of a human cyclin gene as an oncogene. Proc. Natl Acad. Sci. USA
91, 709–713 (1994).
34. Du, Z., Tong, X. & Ye, X. Cyclin D1 promotes cell cycle progression through
enhancing NDR1/2 kinase activity independent of cyclin-dependent kinase 4.
J. Biol. Chem. 288, 26678–26687 (2013).
35. Li, Z. et al. Alternate cyclin D1 mRNA splicing modulates p27KIP1 binding
and cell migration. J. Biol. Chem. 283, 7007–7015 (2008).
36. Hydbring, P., Malumbres, M. & Sicinski, P. Non-canonical functions of cell
cycle cyclins and cyclin-dependent kinases. Nat. Rev. Mol. Cell Biol. 17,
280–292 (2016).
37. Pestell, R. G. New roles of cyclin D1. Am. J. Pathol. 183, 3–9 (2013).
38. Rubio, M. F. et al. Cyclin D1 is a NF-κB corepressor. Biochim. Biophys. Acta
1823, 1119–1131 (2012).
39. Liu, Q. et al. Cyclin D1 and C/EBPβ LAP1 operate in a common pathway to
promote mammary epithelial cell differentiation. Mol. Cell. Biol. 34,
3168–3179 (2014).
40. Matsuura, I. et al. Cyclin-dependent kinases regulate the antiproliferative
function of Smads. Nature 430, 226–231 (2004).
41. Carlson, M. E., Hsu, M. & Conboy, I. M. Imbalance between pSmad3
and Notch induces CDK inhibitors in old muscle stem cells. Nature 454,
528–532 (2008).
42. Yousef, H. et al. Systemic attenuation of the TGF-β pathway by a single drug
simultaneously rejuvenates hippocampal neurogenesis and myogenesis in the
same old mammal. Oncotarget 6, 11959–11978 (2015).
43. Sawyer, J. S. et al. Synthesis and activity of new aryl- and heteroaryl-
substituted pyrazole inhibitors of the transforming growth factor-beta type I
receptor kinase domain. J. Med. Chem. 46, 3953–3956 (2003).
44. Luo, K. Signaling cross talk between TGF-β/Smad and other signaling
pathways. Cold Spring Harb. Perspect. Biol. 9, a022137 (2017).
45. Liu, L. et al. Chromatin modifications as determinants of muscle stem cell
quiescence and chronological aging. Cell Rep. 4, 189–204 (2013).
46. Liu, L., Cheung, T. H., Charville, G. W. & Rando, T. A. Isolation of skeletal
muscle stem cells by fluorescence-activated cell sorting. Nat. Protoc. 10,
1612–1624 (2015).
47. Butler, K. V. et al. Rational design and simple chemistry yield a superior,
neuroprotective HDAC6 inhibitor, tubastatin A. J. Am. Chem. Soc. 132,
10842–10846 (2010).
48. Srinivas, S. et al. Cre reporter strains produced by targeted insertion of EYFP
and ECFP into the ROSA26 locus. BMC Dev. Biol 1, 4 (2001).
49. Luo, D. et al. Deltex2 represses MyoD expression and inhibits myogenic
differentiation by acting as a negative regulator of Jmjd1c. Proc. Natl Acad.
Sci. USA 114, E3071–E3080 (2017).
50. Burzyn, D. et al. A special population of regulatory T cells potentiates muscle
repair. Cell 155, 1282–1295 (2013).
51. Cordelières, F. P. et al. Automated cell tracking and analysis in phase-contrast
videos (iTrack4U): development of Java software based on combined
mean-shift processes. PLoS One 8, e81266 (2013).
52. Nussbaum-Krammer, C. I., Neto, M. F., Brielmann, R. M., Pedersen, J. S. &
Morimoto, R. I. Investigating the spreading and toxicity of prion-like proteins
using the metazoan model organism C. elegans. J. Vis. Exp. https://doi.
org/10.3791/52321 (2015).
Nature Metabolism | www.nature.com/natmetab
Letters
53. Gilbert, P. M. et al. Substrate elasticity regulates skeletal muscle stem cell
self-renewal in culture. Science 329, 1078–1081 (2010).
54. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29,
15–21 (2013).
55. Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose
program for assigning sequence reads to genomic features. Bioinformatics 30,
923–930 (2014).
56. Risso, D., Ngai, J., Speed, T. P. & Dudoit, S. Normalization of RNA-seq
data using factor analysis of control genes or samples. Nat. Biotechnol. 32,
896–902 (2014).
57. Robinson, M. D., McCarthy, D. J. & Smyth, G. K. edgeR: a Bioconductor
package for differential expression analysis of digital gene expression data.
Bioinformatics 26, 139–140 (2010).
58. Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based
approach for interpreting genome-wide expression profiles. Proc. Natl Acad.
Sci. USA 102, 15545–15550 (2005).
59. Liberzon, A. et al. The Molecular Signatures Database (MSigDB) hallmark
gene set collection. Cell Syst. 1, 417–425 (2015).
60. Wingender, E. Compilation of transcription regulating proteins. Nucleic Acids
Res. 16, 1879–1902 (1988).
61. Matys, V. et al. TRANSFAC and its module TRANSCompel: transcriptional
gene regulation in eukaryotes. Nucleic Acids Res. 34, D108–D110 (2006).
62. Daily, K., Patel, V. R., Rigor, P., Xie, X. & Baldi, P. MotifMap: integrative
genome-wide maps of regulatory motif sites for model species. BMC
Bioinformatics 12, 495 (2011).
63. Lachmann, A. et al. ChEA: transcription factor regulation inferred from
integrating genome-wide ChIP-X experiments. Bioinformatics 26, 2438–2444
(2010).
64. Rouillard, A. D. et al. The harmonizome: a collection of processed datasets
gathered to serve and mine knowledge about genes and proteins. Database
(Oxford) 2016, baw100 (2016).
65. Xie, X. et al. Systematic discovery of regulatory motifs in human
promoters and 3′ UTRs by comparison of several mammals. Nature 434,
338–345 (2005).
66. Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A. & Tyagi, S.
Imaging individual mRNA molecules using multiple singly labeled probes.
Nat. Methods 5, 877–879 (2008).
67. Mueller, F. et al. FISH-quant: automatic counting of transcripts in 3D FISH
images. Nat. Methods 10, 277–278 (2013).
Acknowledgements
We thank J. T. Rodgers, L. Liu and Z. De Miguel for intellectual support, and M. Wagner
and I. Akimenko for technical assistance. This work was supported by funding from
the Stanford University School of Medicine Medical Scientist Training Program (T32
GM007365) and CIRM Scholar Training Program (TG2 01159) to J.O.B., funding from
FAPESP (BEPE 2015/26767-1) to L.A.P., funding from the NIH (TR01 AG047820) to
T.W-C. and T.A.R., and funding from the Glenn Foundation for Medical Research,
the NIH (P01 AG036695, R37 AG023806, and R01 AR062185) and the Department of
Veterans Affairs (Merit Review) to T.A.R.
Author contributions
J.O.B, M.A., M.I., T.W-C., and T.A.R. designed experiments. J.O.B., M.A., M.I., M.Q.,
A.d.M., I.M.E., L.A.P., H.D.I., A.G., C.R-M., P.B, D.I.B., and M.J.B. conducted and
analysed experiments. J.O.B., M.A. and T.A.R. wrote the manuscript.
Competing interests
The authors declare no competing interests.
Additional information
Extended data is available for this paper at https://doi.org/10.1038/s42255-020-0190-0.
Supplementary information is available for this paper at https://doi.org/10.1038/
s42255-020-0190-0.
Correspondence and requests for materials should be addressed to T.A.R.
Peer review information Primary Handling Editor: Pooja Jha.
Reprints and permissions information is available at www.nature.com/reprints.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
© The Author(s), under exclusive licence to Springer Nature Limited 2020
Letters NATurE METAbOlISm

Extended Data Fig. 1 | See next page for caption.

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm Letters
Extended Data Fig. 1 | Effects of voluntary wheel running on muscle. a, Non-strenuous voluntary exercise by wheel running in mice. Young or old mice are
provided access to a freely rotating wheel or to a locked wheel as a control. Three weeks later, muscles are either assayed with MuSCs in their quiescent
state, without injury or MuSC isolation, or assayed for MuSC exit from quiescence, induced by experimental injury or MuSC isolation into culture.
b, Throughout the final week of locked wheel (-Ex) or free wheel (+Ex) access, thymidine analog (EdU or BrdU) was administered continuously in the
drinking water. MuSCs were FACS-isolated and immediately fixed for EdU staining. For comparison, also shown are the results from young mice receiving
muscle injury at the time of onset of labeling (n=12 for Y(-Ex), 6 for Y(+Ex), 9 for O(-Ex), 9 for O(+Ex), and 2 for Inj mice). c, FACS-isolated MuSCs were
assayed for cell size based on forward scatter in flow cytometry. For comparison, also shown are results from young muscles injured three days prior to
analysis. Data were normalized to the mean injured level in each experiment (n=5 for Y(-Ex), 5 for Y(+Ex), 6 for O(-Ex), 6 for O(+Ex), and 3 for Inj mice).
d, FACS-isolated MuSCs were assayed for RNA content based on Pyronin Y intensity in flow cytometry. For comparison, also shown are results from
young muscles injured three days prior to analysis. Data were normalized to the mean injured level in each experiment (n=5 for Y(-Ex), 5 for Y(+Ex), 6 for
O(-Ex), 6 for O(+Ex), and 3 for Inj mice). e, FACS-isolated MuSCs were assayed for MyoD expression based on immunocytochemistry. For comparison,
also shown are results from young muscles partially injured three days prior to analysis (n=3 for Y(-Ex), 3 for Y(+Ex), 3 for O(-Ex), 3 for O(+Ex), and
1 for Inj mice). f-h, TA muscles were sectioned and assayed for MyoD-expressing cells (f), Ki67-expressing cells (g), and Pax7-expressing cells (h) by
immunohistochemistry. For comparison, also shown are results from young muscles injured seven days prior to analysis (n=3 mice per group). i, TA
muscle cross-sections were stained with H&E. Representative images (quantified in (j) are shown). j, The mean CSA of myofibers was quantified (n=8
mice per group). k, For each mouse, left and right TA muscles were isolated and their weights averaged (n=6 for Y(-Ex), 6 for Y(+Ex), 5 for O(-Ex),
and 5 for O(+Ex) mice). l-n, TA muscles were sectioned and assayed for macrophages expressing F4/80 (l), regenerating myofibers expressing eMHC
(m), and regenerating myofibers with central nuclei (n) by immunohistochemistry. For comparison, also shown are results from muscles injured seven
days prior to analysis (n=3 mice per group). Scale bar in l, 100 μm. Data are summarized with mean + s.e.m. NS, not significant; *P<0.05; two-tailed
Welch’s t-test in b-h, j-n.

Nature Metabolism | www.nature.com/natmetab

Letters NATurE METAbOlISm

Extended Data Fig. 2 | Exercise improves multiple aspects of old MuSC regenerative ability. a–d, Exercise and muscle injury were performed as in Fig.
1a. After either four days (a), five days (b) or twenty-eight days (c-d), muscles were isolated and stained to examine regeneration. a-b, Muscles were
sectioned and assayed for eMHC+ myofibers (a, n=7 for Y(-Ex), 5 for Y(+Ex), 7 for O(-Ex), and 4 for O(+Ex) mice. b, n=4 for Y(-Ex), 7 for O(-Ex), and 8
for O(+Ex) mice. Y(+Ex) at five days was not done (N.D.)). c-d, Twenty-eight days post-injury (dpi), the mean cross-sectional areas (CSA) of myofibers
(c) and the number of Pax7-expressing cells (d) were quantified (n=3 mice per group). e, Gating strategy for FACS isolation of MuSCs, following a
published protocol45,46. Purity of isolated MuSCs is >98% as assessed by routine staining for Pax7 of cells fixed one hour after plating. f, FACS-isolated
MuSCs were cultured for eighteen hours and then analyzed for RNA content by flow cytometry based on Pyronin Y staining (n=6 mice per group).
g, FACS-isolated MuSCs were tracked by time-lapse microscopy to determine time to first division (n=7 for O(-Ex), 7 for O(+Ex), and 5 for Y(-Ex) mice).
h, FACS-isolated MuSCs were tracked by time-lapse microscopy to determine the distance migrated by each cell between serial images (n=7 for O(-
Ex), 7 for O(+Ex), and 5 for Y(-Ex) mice). i, FACS-isolated MuSCs were cultured for one day and then stained with 7AAD to determine viability by flow
cytometry. Shown is the gating strategy for analysis and the quantification of the fraction of dead cells (n=3 mice per condition). Scale bar in e, 50 μm.
Data are summarized with mean + s.e.m. *P<0.05; one-tailed Welch’s t-test in a-d, f-i.

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm Letters

Extended Data Fig. 3 | The exercise-induced improvement in old MuSC activation gradually subsides after exercise cessation. a, Mice were given
no access or free access to a running wheel, followed by wheel removal for zero, one, or two weeks. The onset of exercise was staggered so that MuSC
isolation was performed at the same time for all groups. b, FACS-isolated MuSCs were cultured continuously in EdU to assess S-phase progression (n=8
for O(-Ex), 7 for O(+Ex)(0 wk), 8 for O(+Ex)(1 wk), and 3 for O(+Ex)(2 wk) mice). Data are summarized with mean + s.e.m. *P<0.05; two-tailed Welch’s
t-test in b.

Nature Metabolism | www.nature.com/natmetab

Letters NATurE METAbOlISm

Extended Data Fig. 4 | The exercise-induced improvement in old MuSC activation is transferable through serum. a, Old recipient mice that had never
exercised received three consecutive daily tail-vein injections with serum collected from old non-exercising or exercising mice. MuSCs were isolated from
recipient mice one day after the last injection. b, FACS-isolated MuSCs were cultured continuously in EdU to assess S-phase progression (n=8 recipient
mice for O(-Ex), comprising 4, 3, and 1 recipients for three different serum pools, and n=6 recipient mice for O(+Ex), comprising 3, 2, and 1 recipients for
three different serum pools). Data are summarized with mean + s.e.m. *P<0.05; two-tailed Mann-Whitney U-test in b.

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm Letters

Extended Data Fig. 5 | See next page for caption.

Nature Metabolism | www.nature.com/natmetab

Letters NATurE METAbOlISm
Extended Data Fig. 5 | Transcriptional effects of aging and exercise in quiescent MuSCs. a, RT-qPCR in MuSCs from mice independent of those used
in the RNA-Seq experiment. Ct values were normalized first to the mean of Gapdh, Hprt, and Actb1 and then to the mean Y(-Ex) level in each experiment,
with Y(-Ex) shown as a dotted line at relative expression 1.0 for comparison (n=13 for O(-Ex), 14 for O(+Ex), and 13 for Y(-Ex) mice). b, GSEA results
for the Hallmark gene sets in comparisons of RNA-Seq profiles for O(-Ex) vs. Y(-Ex), O(+Ex) vs. O(-Ex), and Y(+Ex) vs. Y(-Ex) MuSCs. Gene sets are
in descending order based on the O(+Ex) vs. O(-Ex) NES. c, Enrichment plots for the INFLAMMATORY RESPONSE gene set. d, Single-cell RT-qPCR for
Ccnd1 in freshly isolated MuSCs. For comparison, also shown are results for young MuSCs isolated three days after injury. The pairs on each chip were
O(-Ex) vs. O(+Ex) and Y(-Ex) vs. Injured (n=24 cells from one mouse in each group). Data are summarized with mean and s.e.m. in a, box-and-whisker
plots (bottom whisker, min; box bottom, 25th percentile; box middle, median; box top, 75th percentile; top whisker, max; “+”, mean) in d. NES, normalized
enrichment score in b, c; ES, running enrichment score; S2N, GSEA Signal2Noise ranking metric in c. *P<0.05; two-tailed Welch’s t-test in a, d.

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm Letters

Extended Data Fig. 6 | Characterization of Cyclin D1 reduction and expression in MuSCs. a, Gating strategy for FACS isolation of YFP+ MuSCs after
tamoxifen administration to transgenic mice. Shown are MuSC yields in terms of the percentage of size- and doublet-gated cells that are YFP+DAPI-;
NS, WT vs. HET and WT vs. KO (n values represent individual mice). Purity of isolated MuSCs is >94% or >98% as assessed by routine staining and
quantification of YFP or Pax7, respectively, of cells fixed one hour after plating. b, TA muscles were isolated from twelve-month-old mice that had received
tamoxifen injections at three months of age. Muscle sections were stained for Pax7 to identify MuSCs, YFP to identify recombined cells, and laminin to
delimit muscle fibers and MuSCs from the interstitium. No MuSCs or YFP+ cells were identified in the interstitium, and no YFP+ cells were Pax7-. The MuSC
pool was quantified by counting Pax7+ cells in sections (n=3 mice per group). c, FACS-isolated MuSCs were cultured continuously in the presence of EdU
to assess S-phase progression (n=4 for HET(-Ex), 6 for HET(+Ex), 5 for KO(-Ex), 5 for KO(+Ex), and 6 for WT(-Ex) mice). d, To confirm maintenance
of ex vivo quiescence by TubA, MuSCs were kept in culture for three days either in quiescence (with TubA) or during activation (with DMSO vehicle) in
the continuous presence of EdU and then fixed for analysis. MuSCs were then released for two days in the presence of EdU by removing TubA. MuSCs
were then fixed for analysis of exit from quiescence (n=3 mice per condition). e, MuSCs were infected as in Fig. 3j for three days and then harvested for
Western blot. Each lane represents a pool of three to six mice split into the two infection conditions. f, MuSCs infected as in Fig. 3j were harvested for RT-
qPCR analysis (n=3 mice per group). Scale bar in a, 50 μm, in b, 10 μm. Data are summarized with mean + s.e.m. NS, not significant; *P<0.05; two-tailed
Welch’s t-test in a-c, one-tailed Welch’s t-test in d, one-tailed ratio-paired t-test in f.

Nature Metabolism | www.nature.com/natmetab

Letters NATurE METAbOlISm

Extended Data Fig. 7 | Gene sets altered by Cyclin D1 reduction and by aging in MuSCs. a, GSEA results for the Hallmark gene sets in comparisons of
RNA-Seq profiles for Y(HET) vs. Y(WT), Y(KO) vs. Y(WT), and O(WT) vs. Y(WT) MuSCs. Gene sets are in ascending order based on the mean NES.
b, Enrichment plots for gene sets representing cell cycle genes (E2F TARGETS) and inflammation genes (INFLAMMATORY RESPONSE). NES, normalized
enrichment score in a, b; ES, running enrichment score; S2N, GSEA Signal2Noise ranking metric in b.

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm Letters

Extended Data Fig. 8 | See next page for caption.

Nature Metabolism | www.nature.com/natmetab

Letters NATurE METAbOlISm
Extended Data Fig. 8 | TGFβ-Smad3 activity is anti-correlated with Ccnd1 in MuSCs. a, For each gene in the RNA-Seq datasets, a weighted correlation
coefficient against Ccnd1 was calculated across all samples. Shown are examples of negative, zero, and positive correlations, in which expression is
plotted in log scale and point size conveys sample weight. b, GSEA results for the Hallmark gene sets using the Ccnd1 correlation coefficient of each gene
across all samples. Gene sets are in ascending order based on NES. c, GSEA results for TFT gene sets obtained from the Harmonizome database that are
experimentally determined (TRANSFAC and ChEA) and computationally predicted (MSigDB and MotifMap). Shown are the top twelve anticorrelated
gene sets based on NES for each gene set collection (total gene sets screened: 72 for TRANSFAC, 74 for ChEA, 140 for MSigDB, and 34 for MotifMap).
Smad3 is highlighted in each collection. d, Enrichment plots for the Hallmark gene set TGF BETA in each of the previously mentioned RNA-Seq
comparisons. NES, normalized enrichment score in b-d; ES, running enrichment score; S2N, GSEA Signal2Noise ranking metric in d.

Nature Metabolism | www.nature.com/natmetab

NATurE METAbOlISm Letters

Extended Data Fig. 9 | TGFβ-Smad3 activity in MuSCs with aging, Cyclin D1 deficiency, and pharmacologic modulation. a-c, Western blots on freshly
isolated MuSCs to assess for activating C-terminal phosphorylation of Smad3. Each lane’s phospho-Smad3 level was normalized first to Histone 3 and
then to the grand mean of each blot; blots quantified in each figure contained equals numbers of each replicate type. a, MuSCs were from Y(Veh), O(Veh),
and O(LY) mice. Shown is a representative blot and quantification of two blots. Each lane represents MuSCs from one mouse (n=6 lanes per group).
b, MuSCs were from WT(Veh), HET(Veh), and HET(LY) mice. Shown is a representative blot and quantification of two blots. Each lane represents MuSCs
from one mouse (n=6 lanes per group). c, MuSCs were from WT(Veh), KO(Veh), and KO(LY) mice. Shown is a representative blot and quantification of
two blots. Each lane represents MuSCs from one mouse (n=6 lanes per group). *P<0.05; one-tailed Mann-Whitney U-test in a-c.

Nature Metabolism | www.nature.com/natmetab

 α

α
 α

β
β β