research papers
Binding of hydroxycitrate to human ATP-citrate
ISSN 2059-7983
Received 23 December 2016
Accepted 3 July 2017
Edited by A. Berghuis, McGill University,
Canada
Keywords: ATP-citrate lyase; hydroxycitrate;
domain movement; TEV cleavage; disorder;
linker; affinity crystallography; enzyme kinetics;
inhibition constants.
PDB references: human ATP citrate lyase,
TEV-cleaved, bound to citrate, 5tde; bound to
4S-hydroxycitrate and ADP, 5tdf; bound to
4R-hydroxycitrate and ADP, 5tdm; bound to
citrate and ADP, 5tes; bound to 4S-hydroxy-
citrate, 5tet; bound to tartrate and ADP, 5tdz;
C20S, C293G mutant, bound to 4R-hydroxy-
citrate, 5te1; C20S, C293G mutant, bound to
citrate, 5teq
Supporting information: this article has
supporting information at journals.iucr.org/d
# 2017 International Union of Crystallography
660 https://doi.org/10.1107/S2059798317009871
lyase
Jinhong Hu, Aruna Komakula and Marie E. Fraser*
Department of Biological Sciences, University of Calgary, 2500 University Drive NW, Calgary, Alberta T2N 1N4,
Canada. *Correspondence e-mail: frasm@ucalgary.ca
Hydroxycitrate from the fruit of Garcinia cambogia [i.e. (2S,3S)-2-hydroxy-
citrate] is the best-known inhibitor of ATP-citrate lyase. Well diffracting crystals
showing how the inhibitor binds to human ATP-citrate lyase were grown by
modifying the protein. The protein was modified by introducing cleavage sites
for Tobacco etch virus protease on either side of a disordered linker. The protein
crystallized consisted of residues 2–425-ENLYFQ and S-488–810 of human
ATP-citrate lyase. (2S,3S)-2-Hydroxycitrate binds in the same orientation as
citrate, but the citrate-binding domain (residues 248–421) adopts a different
orientation with respect to the rest of the protein (residues 4–247, 490–746 and
748–809) from that previously seen. For the first time, electron density was
evident for the loop that contains His760, which is phosphorylated as part of the
catalytic mechanism. The pro-S carboxylate of (2S,3S)-2-hydroxycitrate is
available to accept a phosphoryl group from His760. However, when co-crystals
were grown with ATP and magnesium ions as well as either the inhibitor or
citrate, Mg2+-ADP was bound and His760 was phosphorylated. The phosphoryl
group was not transferred to the organic acid. This led to the interpretation that
the active site is trapped in an open conformation. The strategy of designing
cleavage sites to remove disordered residues could be useful in determining the
crystal structures of other proteins.
1. Introduction
Acetyl-CoA is produced in mitochondria, but it cannot cross
the mitochondrial membranes to the cytosol. Instead, citrate is
exported from mitochondria. In the cytosol, ATP-citrate lyase
(ACLY; EC 2.3.3.8) catalyses the reaction to produce acetyl-
CoA and oxaloacetate from citrate and ATP. Since acetyl-
CoA is a precursor of fatty acids and cholesterol, human
ACLY (hACLY) has been targeted to treat diseases such as
diabetes and obesity (Groot et al., 2003), and cancer (Mashima
et al., 2009).
The best-known inhibitor of hACLY is the hydroxycitrate in
the fruit of Garcinia cambogia (Watson et al., 1969). Four
stereoisomers of hydroxycitrate exist (Fig. 1) and that from
G. cambogia is (2S,3S)-2-hydroxycitrate (Lewis & Neela-
kantan, 1965; Glusker et al., 1969; Stallings et al., 1979). To
avoid changes in nomenclature with different substituents, this
stereoisomer was renamed (4S)-OHcit-(pncit) (Sullivan et al.,
1977), and will be referred to here as 4S-hydroxycitrate.
4S-Hydroxycitrate inhibits rat liver ACLY competitively with
respect to citrate with a micromolar inhibition constant
(Watson et al., 1969; Sullivan et al., 1977).
Understanding how 4S-hydroxycitrate inhibits hACLY
could aid in the design of drugs to inhibit hACLY. Catalysis by
ACLY is proposed to occur via four partial reactions (Fig. 2).
The first step involves phosphorylation of a histidine residue
Acta Cryst. (2017). D73, 660–671
 research papers
Table 1 et al., 2016), is common to all members
Oligonucleotides for mutagenesis. of the acyl-CoA synthetase (ADP- or
C20S forward primer AK1.9 CAGCGATACCATCTCTGATCTAGGGGGTGTC GDP-forming) superfamily (Galperin et
C20S reverse primer AK2.0 GACACCCCCTAGATCAGAGATGGTATCGCTG al., 1997). The loop has been proposed
C293G forward primer MFB.1 CCTTTACAAGTTCATCTCTACCACCTCAGCCATCC
C293G reverse primer MFB.2 GGATGGCTGAGGTGGTAGAGATGAACTTGTAAAGG to swing during the catalytic cycle to
V811stop forward primer JHH4.1 GCGAACGGTGTGATTTAACCGGCGCAGGAAGTGCCG transport the phosphoryl group 35 Å
V811stop reverse primer JHH4.2 CGGCACTTCCTGCGCCGGTTAAATCACACCGTTCGC from ATP or GTP to the site where the
organic acid binds (Fraser et al., 1999).
by ATP (Cottam & Srere, 1969). In the second step, the Two conformations of the segment, one near the nucleotide-
phosphoryl group is thought to be transferred to the pro-S binding site and the second at the acetyl-CoA-binding site,
carboxylate of citrate to form citryl-phosphate (Walsh & have been observed in crystal structures of the ADP-forming
Spector, 1969). In the third step, CoA attacks citryl-phosphate acetyl-CoA synthetase from Candidatus Korarchaeum
to form citryl-CoA (Wells, 1991). Finally, citryl-CoA is cleaved cryptofilum (Weisse et al., 2016).
to produce acetyl-CoA and oxaloacetate (Srere & Bhaduri, The second stretch of residues missing from the model of
1964). Crystal structures of residues 2 to 817 of hACLY the amino-terminal portion of hACLY (Sun et al., 2010, 2011)
showed the binding sites for the substrate citrate, the product includes residues 426–486. These residues are referred to
Mg2+-ADP and the inhibitor tartrate (Sun et al., 2010, 2011). as the linker because some forms of ACLY do not have
This protein could also be used to show how 4S-hydroxycitrate equivalent residues and instead consist of separate subunits. In
binds to hACLY. 4S-Hydroxycitrate could inhibit hACLY by hACLY, this linker includes residues that are phosphorylated
binding in such a way that the pro-S carboxylate is not in the regulation of hACLY by kinases (Pierce et al., 1981;
available for transfer of the phosphoryl group. A second Ramakrishna et al., 1990; Berwick et al., 2002). The first two
possibility is that 4S-hydroxycitrate binds in a similar orien- structures (Sun et al., 2010) were from protein crystallized
tation to citrate, but 4S-hydroxycitryl-CoA cannot be formed after in situ proteolysis with chymotrypsin (Dong et al., 2007).
from hydroxycitryl-phosphate. A third possibility is that It was possible that chymotrypsin cleaved the phosphohisti-
4S-hydroxycitryl-CoA is formed but cannot be cleaved. The dine loop and the linker. However, crystals of the complex
crystal structure of 4S-hydroxycitrate bound to the amino- with Mg2+-ADP grew without chymotrypsin (Sun et al., 2011)
terminal portion of hACLY would show whether the pro-S and still showed no electron density for either the phospho-
carboxylate is available for transfer of the phosphoryl group. histidine loop or the linker. All three structures had two
The model from the crystal structures of the amino-terminal disulfide bonds, one between Cys293 and Cys748, and the
portion of hACLY is not complete (Sun et al., 2010, 2011). second between Cys20 and a symmetry-related Cys20. Disul-
There was no electron density for residues 751–766, so the fide bonds would not be expected in the reducing environment
loop containing the active-site histidine residue, His760, was of the cytoplasm. It was hypothesized that the disulfide bond
not modelled. The phosphohistidine loop, or segment (Weisse between Cys293 and Cys748 repositioned Cys748, leading to
disorder of the phosphohistidine loop.
The goal was to obtain a crystal structure that showed how
4S-hydroxycitrate bound in relation to the active-site histidine
residue. Cys20 and Cys293 were mutated to prevent the
formation of disulfide bonds. The new crystal form for the
mutant protein showed electron density for the phospho-
histidine loop, but no electron density for the linker. We
hypothesized that the presence of the disordered linker

Figure 1
The four stereoisomers of hydroxycitrate. The compound produced
by G. cambogia is ()-hydroxycitrate or (2S,3S)-2-hydroxycitrate. The
nomenclature defined by Sullivan et al. (1977) gives the pro-R branch
lower numbering than the pro-S branch (Sullivan et al., 1977) and this
stereoisomer was renamed (4S)-OHcit-(pncit) (Stallings et al., 1979). In
this work, it is referred to as 4S-hydroxycitrate, while ()-allohydroxy-
citrate or (2R,3S)-2-hydroxycitrate is referred to as 4R-hydroxycitrate.
Figure 2
Partial reactions proposed for ACLY. The catalytic reaction is thought to
occur via four partial reactions: (1) phosphorylation of the enzyme (E) by
ATP, (2) transfer of the phosphoryl group to citrate, (3) attack by CoA on
the citryl-phosphate and (4) cleavage of citryl-CoA to form acetyl-CoA
and oxaloacetate. The symbol * indicates that the compound remains
bound to the enzyme.

Acta Cryst. (2017). D73, 660–671 Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase 661
research papers
Table 2
Crystallization conditions.
Method Vapour diffusion in hanging drops
Plate type Hampton Research VDX
Temperature (K) 294
Protein C20S, C293G Nter hACLY C20S, C293G Nter hACLY TEV-Nter hACLY TEV-Nter hACLY
Protein concentration (mg ml1) 5 5 5 5
Buffer composition of 10 mM Tris–HCl pH 8, 10 mM Tris–HCl pH 8, 10 mM Tris–HCl pH 8, 10 mM Tris–HCl pH 8,
protein solution 20 mM ammonium citrate 25 mM potassium 20 mM ammonium citrate 6 mM 4S-hydroxycitrate
4R-hydroxycitrate pH 7.5, 5 mM TCEP pH 7.5, 5 mM TCEP
Composition of reservoir 12.5% PEG 3350, 12.5% PEG 3350, 12.5% PEG 3350, 12.5% PEG 3350,
solution† 100–200 mM MES pH 7, 200 mM MES pH 5.9, 100 mM Tris–HCl pH 7.0, 100 mM Tris–HCl pH 7.5,
125 mM ammonium 125 mM ammonium 125 mM ammonium 125 mM ammonium
citrate pH 4.5 acetate pH 5 phosphate pH 7.5 phosphate pH 7.5
Volume and ratio of drop 0.5 ml, 1:1
Volume of reservoir (ml) 1

Method Vapour diffusion in hanging drops

Plate type Hampton Research VDX
Temperature (K) 294
Protein TEV-Nter hACLY TEV-Nter hACLY TEV-Nter hACLY TEV-Nter hACLY
Protein concentration (mg ml1) 10 5 5 10
Buffer composition of 10 mM Tris–HCl pH 8, 10 mM Tris–HCl pH 8, 10 mM Tris–HCl pH 8, 10 mM Tris–HCl pH 8,
protein solution 25 mM potassium tartrate, 25 mM potassium 6 mM 4S-hydroxycitrate 10 mM ammonium citrate
5 mM TCEP, 10 mM MgCl2, 4R-hydroxycitrate pH 7.5, 5 mM TCEP, pH 7.5, 5 mM TCEP,
25 mM ATP pH 7.5, 5 mM TCEP, 10 mM MgCl2, 25 mM ATP 10 mM MgCl2, 25 mM ATP
10 mM MgCl2, 25 mM ATP
Composition of reservoir 13% PEG 3350, 13% PEG 3350, 15% PEG 3350, 12.5% PEG 3350,
solution† 100 mM Tris–HCl pH 8.8, 100 mM Tris–HCl pH 8.7, 100 mM Tris–HCl pH 8.4, 100 mM Tris–HCl pH 8.8,
100 mM ammonium 125 mM ammonium 150 mM ammonium 125 mM ammonium
chloride chloride chloride chloride
Volume and ratio of drop 0.5 ml, 1:1
Volume of reservoir (ml) 1

† The pH values for the reservoir solutions refer to the pH of a 1 M stock solutions.

prevented much of the surface of the molecule from forming
crystal-packing interactions. To obtain crystals that diffracted
better, a new gene was designed that included a TEV protease
cleavage site (Phan et al., 2002) at each end of the linker. TEV
protease was used to remove the linker during the purification
of the protein. Crystals of the TEV-cleaved amino-terminal
portion of hACLY were grown with 4S-hydroxycitrate to show
the binding mode of the inhibitor in relation to the phos-
phohistidine loop.
2. Experimental procedures
2.1. Mutagenesis, production and purification of the
amino-terminal portion of hACLY
The gene for the 817 amino-terminal residues of hACLY
with a carboxy-terminal His tag (Nter hACLY; Sun et al., 2010)
was mutated using the QuikChange II XL Site-Directed
Mutagenesis Kit. The primers to introduce the two mutations,
C293G and C20S, are given in Table 1. The sequences of the
genes were verified at the University Core DNA Services,
University of Calgary.
Escherichia coli BL21(DE3) competent cells were trans-
formed with plasmids for the two mutants. Transformed cells
were streaked onto an LB–agar plate containing 30 mg ml1
kamamycin and incubated overnight at 37 C. 50 ml LB broth
containing 30 mg ml1 kanamycin was inoculated with a single
colony and shaken overnight at 37 C and 225 rev min1. 25 ml
of the overnight culture was transferred into 500 ml Terrific
Broth containing 30 mg ml1 kanamycin and shaken at 37 C
and 225 rev min1 until the optical density reached 2. The
temperature was then decreased to 18 C and IPTG was added
to achieve a final concentration of 0.2 mM. The protein was
produced overnight at 18 C and 250 rev min1.
Cells were harvested by centrifugation at 2600g for 15 min
and resuspended in lysis buffer using a ratio of 2 ml lysis buffer
[50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, 5 mM
2-mercaptoethanol (2ME) at pH 8] to 1 g wet cells. Resus-
pended cells were lysed by sonication and centrifuged at 4 C
and 11 000g for 1 h. After centrifugation, the supernatant was
loaded onto an Ni–nitrilotriacetic acid (NTA) agarose
(Qiagen) column pre-equilibrated with lysis buffer. The load/
wash speed was 1 ml min1. The wash was performed using
the same lysis buffer for 10 column volumes. Bound protein
was eluted with 50 mM NaH2PO4, 250 mM imidazole, 300 mM
NaCl, 5 mM 2ME at pH 8. The eluted fractions were collected
and the protein was precipitated by adding 7 ml saturated
ammonium sulfate solution to 3 ml protein solution. The
precipitant was collected by centrifugation at 9000g and 4 C
for 1 h, dissolved in gel-filtration buffer (50 mM KH2PO4, 150
mM NaCl, 10% glycerol, 5 mM 2ME at pH 7.5) and loaded
onto the gel-filtration column (Superdex 200 Prep Grade, GE
Healthcare). Fractions containing the protein were collected
and diluted with low-salt buffer (50 mM MES, 20 mM
KH2PO4, 10% glycerol, 5 mM 2ME at pH 6) to achieve a
conductivity of less than 10 mS cm1. This diluted solution was

662 Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase Acta Cryst. (2017). D73, 660–671
 research papers
Table 3
Data collection and processing.
Values in parentheses are for the outer shell.
PDB code 5teq 5te1 5tde 5tet 5tdz 5tdm 5tdf 5tes

Diffraction source 08B1-1, CLS 08ID-1, CLS 08ID-1, CLS 08ID-1, CLS 08ID-1, CLS 08ID-1, CLS 08ID-1, CLS 08ID-1, CLS
Wavelength (Å) 0.97951 0.97944 0.9795 1.00000 1.00003 1.00003 1.00000 0.97948
Temperature (K) 100 100 100 100 100 100 100 100
Detector Rayonix MAR Mosaic MAR Mosaic MAR Mosaic MAR Mosaic MAR Mosaic MAR Mosaic MAR Mosaic
MX300HE 300 mm CCD 300 mm CCD 300 mm CCD 300 mm CCD 300 mm CCD 300 mm CCD 300 mm CCD
CCD
Space group P21 P21 P212121 P212121 P212121 P212121 P212121 P212121
Unit-cell parameters
a (Å) 95.11 98.77 55.828 55.21 55.672 55.379 55.05 56.17
b (Å) 73.10 73.32 84.084 83.51 84.291 84.814 83.87 85.14
c (Å) 131.12 131.37 194.781 193.00 195.594 193.869 195.74 199.01
 = ( ) 90 90 90 90 90 90 90 90
 ( ) 97.89 97.06 90 90 90 90 90 90
Mosaicity ( ) 0.32 0.87 0.50 0.253 0.62 0.32 0.63 0.73
Resolution range (Å) 45.08–2.30 49.01–2.25 51.39–1.70 53.09–2.20 48.38–2.00 63.77–2.10 41.94–1.80 49.75–2.40
(2.34–2.30) (2.29–2.25) (1.73–1.70) (2.26–2.20) (2.05–2.00) (2.14–2.10) (1.83–1.80) (2.49–2.40)
Total No. of 302028 (14944) 228141 (12455) 373304 (18075) 168502 (12105) 228342 (16739) 273939 (12769) 310662 (16332) 136907 (14189)
reflections
No. of unique 79319 (3919) 82560 (4653) 100886 (4910) 45650 (3337) 61452 (4438) 53911 (2558) 84385 (4480) 37140 (3892)
reflections
Completeness (%) 99.7 (99.9)† 93.2 (95.7)‡ 99.4 (99.2)§ 99.0 (99.7)} 97.6 (96.6) 99.7 (95.2)†† 99.6 (100.0)†† 97.4 (98.5)‡‡
Multiplicity 3.8 (3.8) 2.8 (2.7) 3.7 (3.7) 3.7 (3.6) 3.7 (3.8) 5.1 (5.0) 3.7 (3.6) 3.7 (3.6)
hI/(I)i 10.6 (1.9) 6.1 (2.9) 10.0 (2.1) 14.0 (3.4) 12.0 (2.7) 8.3 (2.2) 8.4 (2.0) 7.1 (2.2)
Rr.i.m. 0.109 (0.742) 0.084 (0.317) 0.054 (0.389) 0.057 (0.371) 0.057 (0.416) 0.083 (0.578) 0.069 (0.480) 0.079 (0.336)
Rp.i.m. 0.065 (0.440) 0.084 (0.267) 0.042 (0.317) 0.043 (0.271) 0.041 (0.297) 0.039 (0.284) 0.051 (0.363) 0.059 (0.278)
Overall B factor from 28.6 18.5 16.4 28.0 25.2 39.4 17.6 37.3
Wilson plot (Å2)

† The images show ice rings, streaky diffraction in some orientations and blurring at high resolution. ‡ The diffraction is streaky at certain orientations and there is not a single-crystal
diffraction pattern at those orientations. The high-resolution data blur. § The images show a weak secondary diffraction pattern and one orientation shows streaky diffraction. } The
images show ice rings and blurring of the diffraction pattern at high resolution. †† The images show a secondary diffraction pattern. ‡‡ The diffraction shows some anisotropy.

loaded onto a cation-exchange column (HiTrap SP HP, GE
Healthcare) and eluted with buffer in which the concentration
of KCl was increased to 0.5 M. Fractions were collected and
diluted with Affi-Gel Blue buffer (50 mM KH2PO4, 5 mM
2ME at pH 7) and loaded onto an Affi-Gel Blue column
(HiTrap Blue HP, GE Healthcare). The bound protein was
eluted by increasing the concentration of KCl to 1.5 M. The
protein was concentrated to 10 mg ml1 in 5 mM 2ME,
10 mM Tris–HCl at pH 8 and flash-frozen in liquid nitrogen for
storage at 80 C.
only 0.1 mM IPTG was used for induction, and the lysis and
wash buffers for Ni–NTA contained 5 mM imidazole. The
major difference was that the precipitate from Ni–NTA was
dissolved in 3 ml TEV cleavage buffer [50 mM Tris–HCl,
0.5 mM EDTA, 1 mM dithiothreitol (DTT) at pH 7.0]. 1 ml of
1 mg ml1 TEV protease was added and the cleavage reaction
proceeded at 4 C overnight. This step was followed by gel-
filtration and anion-exchange chromatography. The buffer for

2.2. Production and purification of the TEV-cleaved

amino-terminal portion of hACLY
The expression system was redesigned to have protease
cleavage sites at each end of the linker. The His tag was moved
into the linker so that the purified protein would contain
neither the linker nor the His tag. To use TEV protease for the
cleavage, ENLYFQS was substituted for residues 426–432
and 481–487 of hACLY. His10 replaced residues 450–459.
GenScript (http://www.genscript.com) synthesized the gene
for hACLY and inserted it into the pET-42b(+) plasmid.
Oligonucleotides JHH4.1 and JHH4.2 (Table 1) were used to
terminate the protein after residue 810. The purified protein
(TEV-Nter hACLY) consisted of residues 2–425-ENLYFQ
and S-488–810 of hACLY. Figure 3
Photographs of the two crystal forms. (a) Crystals of the C20S, C293G
TEV-Nter hACLY was produced, purified and stored like mutant of Nter hACLY grow as stacks of thin plates. (b) Crystals of TEV-
the Nter hACLY mutants. Two minor differences were that Nter hACLY grow as single bipyramids.

Acta Cryst. (2017). D73, 660–671 Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase 663
research papers
Table 4
Statistics for the crystallographic models.
Values in parentheses are for the outer shell.
PDB code 5teq 5te1 5tde 5tet 5tdz 5tdm 5tdf 5tes

Protein C20S, C293G C20S, C293G TEV-Nter TEV-Nter TEV-Nter TEV-Nter TEV-Nter TEV-Nter
Nter hACLY Nter hACLY hACLY hACLY hACLY hACLY hACLY hACLY
Ligand(s) Citrate, 4R-Hydroxy- Citrate, 4S-Hydroxy- Tartrate, 4R-Hydroxy- 4S-Hydroxy- Citrate, ADP
phosphate citrate, phosphate citrate, phosphate, citrate, citrate,
phosphate phosphate ADP ADP ADP
Resolution range (Å) 41.46–2.30 49.01–2.25 51.39–1.70 53.08–2.20 48.38–2.00 63.77–2.10 41.94–1.80 46.89–2.40
(2.33–2.30) (2.28–2.25) (1.72–1.70) (2.25–2.20) (2.03–2.00) (2.14–2.10) (1.82–51.80) (2.46–2.40)
Completeness (%) 99.7 (100) 92.9 (95) 99.1 (99) 98.6 (100) 97.2 (96) 94.8 (91) 99.3 (100) 97.0 (98)
 Cutoff 1.340 1.350 1.340 1.350 1.340 1.330 1.340 1.340
No. of reflections, working set 79291 (2637) 82521 (2688) 100806 (3161) 45586 (2653) 61409 (2560) 51533 (2598) 84319 (2686) 37090 (2707)
No. of reflections, test set 3988 (157) 4131 (129) 5021 (140) 2289 (140) 3073 (131) 2569 (120) 4236 (138) 1848 (145)
Final Rcryst 0.202 (0.265) 0.188 (0.248) 0.155 (0.266) 0.156 (0.181) 0.175 (0.247) 0.216 (0.398) 0.150 (0.232) 0.194 (0.290)
Final Rfree 0.246 (0.323) 0.247 (0.312) 0.185 (0.286) 0.213 (0.249) 0.222 (0.282) 0.286 (0.482) 0.191 (0.276) 0.252 (0.352)
Coordinate error, 0.31 0.27 0.15 0.21 0.21 0.31 0.16 0.34
maximum-likelihood (Å)
TLS refinement? No No No No No Yes No No
No. of non-H atoms
Protein 11408† 11488† 5820 5811 5796 5817 5813 5821
Metal ion 2 2 2 0 1 2 2 2
Ligand 36 38 28 12 42 41 41 40
Water 517 750 737 414 506 187 821 243
Glycerol/triethylene glycol/ 24 24 59 31 46
Tris/adenine
Total 11963 12278 6611 6261 6404 6078 6723 6106
R.m.s. deviations
Bonds (Å) 0.002 0.013 0.009 0.012 0.013 0.013 0.01 0.003
Angles ( ) 0.52 1.18 0.96 1.00 1.12 1.15 0.99 0.53
Average B factors (Å2)
Protein 37.9 27.0 22.2 34.0 33.0 58.9 20.8 44.6
Ligand 30.0 28.1 22.1 33.7 36.3 68.2 20.0 36.0
Water 36.4 28.3 33.4 38.7 37.8 47.9 32.3 38.3
Ramachandran plot
Favoured regions (%) 98.4 97.5 98.4 98.5 97.8 96.9 98.4 96.4
Additionally allowed (%) 1.6 2.4 1.6 1.5 2.2 3.0 1.6 3.6
Outliers (%) 0 0.1 0 0 0 0.1 0 0

† The two molecules were restrained by noncrystallographic symmetry.

anion exchange (HiTrap Q HP, GE Healthcare) was 50 mM
Tris–HCl, 5 mM 2ME at pH 8 with KCl increasing to 1 M.
2.3. Crystallization, collection and processing of diffraction
data
The proteins were crystallized in complex with one of
citrate, 4S- or 4R-hydroxycitrate or tartrate, alone and with
ATP and magnesium ions. 4R-Hydroxycitrate was purchased
from Sigma–Aldrich as potassium hydroxycitrate tribasic
monohydrate (product No. 59847). 4S-Hydroxycitrate was
purchased as Garcinia Cambogia Fit, manufactured for Schi-
noussa (http://www.schinoussa.ca). The ingredients of one
capsule of Garcinia Cambogia Fit are 500 mg Garcinia
cambogia extract 50% (HCA), 50 mg calcium citrate and
25 mg potassium chloride. The concentration of 4S-hydroxy-
citrate was calculated assuming that the HCA was pure 4S-
hydroxycitrate. The material from the capsule was dissolved in
water by adding 3 M NaOH to bring the solution to pH 7. For
each experiment, the protein solution was thawed and diluted
with 10 mM Tris–HCl pH 8. In some cases, 2ME or tris(2-
carboxyethyl)phosphine (TCEP) was added as a reducing
agent and the ligand or ligands were added to the desired
concentrations. The complex was incubated for 1 h on ice prior
to setting up crystallization experiments. Table 2 lists the
conditions for crystallization of each complex.
All crystals were cryoprotected in mother liquor containing
20%(v/v) glycerol prior to vitrification in nitrogen at 100 K.
The crystals were shipped to the Canadian Light Source (CLS)
to collect the diffraction data remotely. Images were processed
using iMosflm (Battye et al., 2011) or xia2 (Winter, 2010).
Molecular replacement was performed using Phaser (McCoy,
2007) in the PHENIX package (Adams et al., 2010), initially
with model 3mwd (Sun et al., 2010) from the Protein Data
Bank (PDB; Berman et al., 2003). The models were rebuilt
and refined using Coot (Emsley et al., 2010) and PHENIX.
Programs from the CCP4 package (Winn et al., 2011) were
used to analyze the models.
2.4. Kinetics assays
Kinetics assays were performed to measure the apparent
app
Michaelis constant, Km , for citrate of full-length hACLY and
TEV-Nter hACLY and the inhibition constant, Ki, for ADP of
full-length hACLY. To measure the rate of production of
oxaloacetate by hACLY, the coupled-enzyme assay with
malate dehydrogenase (Srere, 1959) was used. The assay mix
contained 0.5 U malate dehydrogenase, 0.2 mM CoA, 10 mM

664 Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase Acta Cryst. (2017). D73, 660–671

MgCl2, 5 mM DTT, 0.2 mM NADH, varying concentrations of
citrate (5–200 mM), 1 mM ATP, 100 mM Tris–HCl at pH 8.4
and 25 C or varying concentrations of ATP (20–500 mM) and
20 mM potassium citrate at 30 C, and the decrease in absor-
bance of NADH was measured at 340 nm. To measure the rate
of production of ADP, a different coupled-enzyme assay was
used (Srere, 1961) with 17 U pyruvate kinase, 7 U lactate
dehydrogenase, 0.2 mM CoA, 20 mM ATP, 10 mM MgCl2,
5 mM DTT, 0.2 mM NADH, 1 mM phosphoenolpyruvate,
varying concentrations of citrate (4–150 mM), 100 mM MOPS
at pH 6.7 and 30 C.
3. Results and discussion
3.1. Protein properties and rational design
Analysis of the structure of the amino-terminal portion of
hACLY suggested that Cys20 and Cys293 should be mutated
to prevent the formation of disulfide bonds and obtain a new
crystal form that would show the conformation of the phos-
phohistidine loop. The C20S mutation was chosen so that the
hydroxyl group could interact with the aqueous environment
at the surface of the protein. The C293G mutation was chosen
because glycine is at this position in ATP-citrate lyases from
other species (Altschul et al., 1997), for example Arabidopsis
thaliana.
Figure 4
Surfaces used in crystal packing. The solvent-accessible surface of TEV-
Nter hACLY is shown superimposed on its ribbon diagram. Residues 431
and 487 indicate the termini created by cleavage of the protein with TEV
protease and residue 810 indicates the C-terminus of the protein. The
active site is highlighted with the model of citrate drawn as spheres.
Residues at the crystal-packing interfaces in this crystal form are shaded
blue or yellow to contrast those also at crystal-packing interfaces of the
C2 or P21 crystal form (blue) with those only used in the TEV-Nter
hACLY crystal form (yellow). A yellow surface covers residues 426–431
and extends towards residue 487 and the C-terminus, indicating that this
surface is only used for crystal packing in the TEV-Nter hACLY crystal
form.
Acta Cryst. (2017). D73, 660–671
research papers
The purification strategy for the C20S, C293G double
mutant (DM) differed from that for the amino-terminal
portion of hACLY (Sun et al., 2011). DM did not bind to the
anion-exchange column even at different pH values, but
bound to the cation-exchange column. This was the first
indication of changes in the properties of the protein owing to
the mutations. The protein crystallized as clusters of thin
plates (Fig. 3a) over a narrow pH range (Table 2). Crystals of
DM diffracted anisotropically to 2.3 Å resolution. The statis-
tics for the diffraction data from the best crystal are presented
in Table 3. The crystal structure suggested that only one
mutation was needed to obtain the new crystal form. The C20S
mutant was purified and crystallized in the presence of 2ME.
The resulting thin plates also showed poor order in one
direction and anisotropic diffraction (data not shown).
The structures in the new crystal form showed electron
density for the phosphohistidine loop, but there was little
electron density for the linker between residues 425 and 487.
Based on the idea that the disordered linker prevented the
surface that it overlays from participating in crystal-packing
interactions, the gene was modified to include protease clea-
vage sites in the sequence of the protein to allow the removal
of the linker. It was hypothesized that this would increase the
surface area of the protein available for crystal packing,
allowing the formation of better crystals. TEV-Nter hACLY
was purified in the same way as the amino-terminal portion of
hACLY (Sun et al., 2011) except that TEV protease was used
to remove the linker after nickel-affinity chromatography.
SDS–PAGE showed two bands corresponding to molecular
weights of 47.6 kDa, calculated for residues 2–431, and
35.3 kDa, calculated for residues 487–810. The Kmapp for citrate
of TEV-Nter hACLY as measured with the pyruvate kinase
assay was 30.8  3.6 mM. This is slightly higher than the value
Figure 5
Binding of citrate and phosphate near the active-site histidine residue.
Electron density is shown for phosphate and citrate, which were omitted
from the model prior to the refinement. The resulting OMIT map (Fo  Fc,
c) is contoured at the 3 r.m.s.d. level. (a) In the complex with the C20S,
C293G double mutant, the pro-S carboxylate of citrate is turned away
from the phosphate anion, repelled by the negative charge. The side chain
of Phe347 is displaced away from the active site. (b) In the complex with
TEV-Nter hACLY, a cation, modelled as Na+, coordinates both the pro-S
carboxylate of citrate and the phosphate anion, as well as Ser308 and
three water molecules.
Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase 665
research papers
of 22.3  4.3 mM measured with the malate dehydrogenase TEV-Nter hACLY. This region includes residues that were
assay and full-length hACLY. Single, bipyramidal crystals changed from NQPPTA in the sequence of hACLY (residues
(Fig. 3b) appeared after 24 h, and the crystals continued to 426–431) to ENLYFQ to provide the cleavage site at the N-
grow for the next 3 d. Crystals grew over a wide range of pH terminal end of the linker. The residues left at this cleavage
from 7 to 9, with different buffers, including MES and Tris– site are ordered in the crystals and add 158 Å2 of buried
HCl, and a variety of salts. The crystals diffracted isotropically surface area to the largest crystal-packing interface. The
to 1.7 Å resolution (Table 3). hypothesis that removal of the disordered linker allows resi-
dues that were not previously used for crystal packing to form
crystal-packing interactions is proven to be true, but in this
3.2. Structure determination and analysis of the crystal case residues changed from the original sequence also aid in
packing crystal packing.
While DM crystallized in space group P21 with two mole-
cules in the asymmetric unit, TEV-Nter hACLY crystallized in
space group P212121 with one molecule per asymmetric unit 3.3. Conformation of the phosphohistidine loop and
(Table 3). Residues 2–135, 149–424/425 and 487–812 could be reorientation of the citrate-binding domain
fitted into the electron density for the molecules of DM (PDB The phosphohistidine loop, for which electron density was
entry 5teq in Table 4). The crystal structure of TEV-Nter not visible in previous structures (Sun et al., 2010, 2011), was
hACLY was solved by molecular
replacement using the structure
of DM. After refinement and
rebuilding, the model for TEV-
Nter hACLY included residues 2–
137, 148–431 and 487–810 (PDB
entry 5tde in Table 4).
For TEV-Nter hACLY, the
linker was cleaved to allow the
surface under the disordered
linker to participate in crystal-
packing interactions. The total
surface area of a single molecule
buried by the crystal-packing
interactions is 4423.9 Å2
(Supplementary Table S1), which
is 15.0% of the total accessible
surface area. This proportion is
higher than the 12.5 and 12.2%
buried for each molecule of DM.
Although it is not possible to
determine the location of the
disordered linker, it is possible to
compare the regions used for
crystal packing in the different
crystal forms to see which regions
are exclusive to the crystal
packing of TEV-Nter hACLY.
Fig. 4 highlights the solvent-
accessible surface of the residues
used in the crystal packing for the Figure 6
TEV-Nter hACLY crystal form, Repositioning of the citrate-binding domain. (a) This stereoview shows the C traces of the amino-terminal
contrasting with those also used portion of hACLY in the two conformations. The superposition of the C20S, C293G double mutant (DM-
for packing in either the C2 (PDB citrate, magenta) with the previously determined structure, PDB entry 3mwd (Sun et al., 2010; cyan), was
based on the results from DynDom (Hayward & Berendsen, 1998). The numbers identify residues in DM-
entry 3pff; Sun et al., 2011) or P21 citrate. (b) Residues 242–248 are identified as bending residues and have different interactions in the two
(PDB entry 5teq) crystal forms. It structures. To show these different interactions, the same two structures were superimposed based on the
shows that a region between the C positions of the residues of the citrate-binding domain (residues 248–421). The hydrogen-bonding
interactions are shown as dashed lines. In PDB entry 3mwd Glu250 and Arg244 form hydrogen bonds,
cleavage sites, i.e. between resi-
while in DM-citrate Arg244 no longer interacts with Glu250, but Glu250 still hydrogen-bonds to the
dues 431 and 487, is used for backbone amides of Tyr247 and Leu268. (c) At the active site, repositioning of the citrate-binding domain
crystal packing exclusively in moves the power helices closer to each other, forming the phosphate-binding site.

666 Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase Acta Cryst. (2017). D73, 660–671

modelled into the electron density calculated using the
diffraction data from a crystal of DM bound to citrate (DM-
citrate; PDB entry 5teq). The model shows the catalytic
histidine residue, His760, pointing towards the citrate-binding
site, and a phosphate anion was modelled into electron density
between His760 and citrate (Fig. 5a).
The residues at the tip of the phosphohistidine loop,
GHAGA, adopt similar conformations to the identical resi-
dues in succinyl-CoA synthetases [PDB entries 1eud (Fraser et
al., 2000) and 2scu (Fraser et al., 1999)], but the phospho-
histidine loop of hACLY is longer than that of succinyl-CoA
synthetases. Judging by the interactions with the rest of the
domain, the phosphohistidine loop of hACLY includes resi-
dues Thr750–Ala768. The amino-terminal residue of hACLY,
Ser2, lies close to the tip of the phosphohistidine loop, within
4 Å of Ala761. Potapova and coworkers found that hACLY
with an amino-terminal His6 tag does not bind to a nickel-
affinity column, but that the kinetics were the same as for
untagged protein (Potapova et al., 2000). Given the proximity
of the amino-terminus to the phosphohistidine loop and the
belief that this loop must swing to transport the phosphoryl
group, it is surprising that the kinetics would be unaffected.
ND1 of His760 may hydrogen-bond to Glu718, although the
distance is long at 3.2 Å to either OE1 or OE2; NE2 forms a
short hydrogen bond (2.6 Å) to phosphate. This phosphate
anion is at the amino-termini of two -helices: the ‘power
helices’ (Wolodko et al., 1994). Acetyl-CoA synthetase has two
similar power helices and the active-site histidine, but has no
comparable glutamate residue (Weisse et al., 2016).
Citrate binds as in the earlier structure (Sun et al., 2010). Its
hydroxyl interacts with the amide of Gly309 and the side chain
of Thr348, with one carboxylate forming hydrogen bonds to
Figure 7
Binding of 4R- and 4S-hydroxycitrate. Electron density is shown for the
hydroxycitrate, which was omitted from the model prior to the
refinement. The resulting OMIT map (Fo  Fc, c) is contoured at the
3 r.m.s.d. level. (a) In the complex of 4R-hydroxycitrate with the C20S,
C293G double mutant, the pro-S carboxylate of citrate is turned away
from the phosphate anion and a hydrogen bond is formed between the
4R-hydroxyl and phosphate. The side chain of Phe347 is rotated away
from the active site. (b) In the complex of 4S-hydroxycitrate with TEV-
Nter hACLY, the pro-S carboxylate is hydrogen-bonded to the phosphate
anion, while the 4S-hydroxyl does not form hydrogen bonds to either the
protein or the phosphate.
Acta Cryst. (2017). D73, 660–671
research papers
Arg379 and the hydroxyl of Thr348 and the second forming
hydrogen bonds to the backbone amide N atoms of Asn346,
Phe347 and Thr348 and the side-chain N atom of Asn346. The
third carboxylate, the pro-S carboxylate that would accept the
phosphoryl group from His760, does not hydrogen-bond to
the protein (Fig. 5a). The pro-S carboxylate is directed away
from phosphate in DM-citrate, as would be expected since
both have negative charges and would repel each other. The
phenyl ring of Phe347 has rotated away from citrate to
accommodate the orientation of the pro-S carboxylate.
A surprising result is the reorientation of the citrate-binding
domain. Comparison of the structure of DM-citrate with PDB
entry 3mwd (Sun et al., 2010) using DynDom (Hayward &
Berendsen, 1998) indicates a 13 rotation of residues 248–421,
the citrate-binding domain, with respect to residues 4–247,
490–746 and 748–809 (Fig. 6a). The orientation seen in DM-
citrate could not be accommodated in the previous crystal
form because the citrate-binding domain of one molecule
(near residues 329 and 366) would clash with the ATP-binding
domain of another molecule (near residues 153 and 168). The
analysis suggests that residue 747 moves with the citrate-
binding domain and residues 242–248, 418–490 and 746–749
are bending residues. Residues 424, 487 and 749 border
disordered regions in one or both structures, but residues 242–
248 show significant conformational changes between PDB
entry 3mwd and DM-citrate (Fig. 6b). The guanidinium of
Arg244 and the carboxylate of Glu250 hydrogen-bond to each
other and to the carbonyls of Glu245 and Leu268 and the
amide N atoms of Tyr247 and Leu268, respectively, in PDB
entry 3mwd, while in DM-citrate Arg244 interacts with the
carbonyl of Glu755 but is not well ordered. 362 Å2 of the
surface area of the phosphohistidine loop is buried by residues
248–424, while 905 Å2 is buried by residues 2–247, 487–748 or
770–812, as calculated using PISA (Krissinel & Henrick,
2007). These surfaces could not be buried in the same way if
the citrate-binding domain adopted the position seen in PDB
entry 3mwd because the rotation moves domain 248–421
towards residues 487–812, allowing the phosphohistidine loop
to pack against both domains. At the active site, the re-
orientation of the citrate-binding domain brings the amino-
terminal ends of the power helices closer to each other to bind
the phosphate anion (Fig. 6c).
While the structure of DM-citrate showed the pro-S
carboxylate to be directed away from the phosphate anion,
in the complex with TEV-Nter hACLY (TEV-4S) the pro-S
carboxylate of citrate is directed towards phosphate (Fig. 5b).
Electron density originally modelled as water was reinter-
preted as a magnesium ion, reminiscent of the magnesium ion
coordinating succinate and the phosphate ion in the complex
with succinyl-CoA synthetase (Huang & Fraser, 2016) or of
the sodium and magnesium ions coordinating the phosphate
ions in the complexes with acetyl-CoA synthetase (Weisse et
al., 2016). After refinement, the distances indicated that the
ion was not magnesium, but could be sodium, which has a
similar number of electrons. In addition to the phosphate and
citrate anions, three water molecules and the hydroxyl of
Ser308 coordinate this Na+ (Fig. 5b). Ser308 also interacts with
Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase 667
research papers
Glu306. With the pro-S carboxylate of citrate directed towards
the phosphate ion, the phenyl ring of Phe347 is directed
towards citrate, providing favourable van der Waals inter-
actions with citrate, Ala310 and Asn638. ND1 of His760 forms
a hydrogen bond to Glu718 (2.5 Å) and NE2 is 2.9 Å from the
phosphate. This would be the conformation of the active site
that is expected to lead to catalysis.
3.4. Binding of hydroxycitrate
Two of the four stereoisomers of hydroxycitrate, 4R and 4S,
were co-crystallized with the amino-terminal portion of
hACLY. The first structure of the complex with the potassium
hydroxycitrate purchased from Sigma–Aldrich showed that
this compound was 4R-hydroxycitrate (Fig. 7a). Had the
compound been a racemic mixture, the inhibitor with higher
affinity, 4S-hydroxycitrate, would be seen bound in the crys-
tals, a simple example of ‘affinity crystallography’ (Aguda et
al., 2016). 4R-Hydroxycitrate binds to DM in a similar orien-
tation to that seen for citrate: the pro-S carboxylate is directed
away from the phosphate anion. The additional hydroxyl
group adjacent to this carboxylate forms a hydrogen bond to
the phosphate ion, and the phosphate ion is oriented to
accommodate this interaction. 4S-Hydroxycitrate was crys-
tallized in complex with TEV-Nter hACLY (TEV-4S). In
contrast to 4R-hydroxycitrate, the pro-S carboxylate of 4S-
hydroxycitrate is directed towards the phosphate ion and the
4S-hydroxyl is directed towards Phe347 (Fig. 7b). The pro-S
carboxylate forms a hydrogen bond to the phosphate anion,
but the 4S-hydroxyl is not within hydrogen-bonding distance
of the protein nor of any modelled water molecules. The
conformations of residues, phosphate and either citrate or 4S-
hydroxycitrate are very similar between the structures of
TEV-citrate and TEV-4S. It is clear from these complexes that
4R- and 4S-hydroxycitrate bind to the amino-terminal portion
of ACLY in a similar fashion to citrate, with the pro-S
carboxylate exposed. It is not because the hydroxycitrates
bind in a different orientation from citrate, for example with
the pro-S carboxylate buried, that they are inhibitors.
3.5. Binding of Mg2+-ADP and tartrate, 4S- or
4R-hydroxycitrate or citrate
In the proposed partial reactions (Fig. 2), citrate accepts the
phosphoryl group from phosphohistidine. Since citrate, 4S-
and 4R-hydroxycitrate would be expected to interact differ-
ently with phosphorylated amino-terminal hACLY than with
the protein complexed with a phosphate anion, TEV-Nter
hACLY was crystallized in the presence of magnesium
chloride, ATP and one of tartrate, 4S- or 4R-hydroxycitrate or
citrate (Table 2). Tartrate was included in the series of organic
acids because it is known to be a competitive inhibitor (Sun et
al., 2011) and has no carboxylate available for phosphoryl-
ation by hACLY. Although the phosphoryl group could not be
transferred to tartrate, the phosphoryl group could be
hydrolyzed from phosphohistidine. The complex with tartrate
would indicate how quickly this hydrolysis might occur. The
structure with tartrate showed that His760 was phosphoryl-
668 Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase
ated, although only partially so (70%). Subsequent crystals
were harvested soon after they appeared to minimize hydro-
lysis of the phosphohistidine.
In each of the four crystal structures, Mg2+-ADP is bound to
the amino-terminal domain that possesses the ATP-grasp fold.
This occurred even though 25 mM ATP would be expected to
compete out the ADP. The binding of Mg2+-ADP in these
structures is very similar to that previously seen in the C2
crystal form that showed no electron density for the phos-
phohistidine loop (Sun et al., 2011).
Owing to the crystallographic results, Ki for ADP was
measured using full-length hACLY. The value determined,
150 mM, is similar to the Kmapp measured for ATP: 137 
18 mM. It is comparable to the Ki for ADP, 171 mM, measured
with ACLY from rat liver (Inoue et al., 1966) and higher than
the values of 18 mM (Antranikian et al., 1982) and 37 mM
(Kanao et al., 2002) measured with ACLY from Chlorobium
limicola. In C. limicola, ACLY is crucial for the reductive
tricarboxylic acid cycle. Sensitivity of ACLY to the ATP:ADP
ratio was proposed to be important for controlling this cycle
(Kanao et al., 2001). In humans, ACLY should only be active
when the ATP:ADP ratio is high and citrate is being exported
from the mitochondria for the production of acetyl-CoA in the
cytosol. Hence, it is biologically relevant that ADP is a
competitive inhibitor. The concentrations of ATP and ADP
have been measured as 6.18  0.62 and 0.86  0.23 mM,
respectively, in the cytosol of rat liver (Schwenke et al., 1981).
Under biological conditions, the ATP:ADP ratio is 6.94  0.59
and we would have expected the crystallization conditions to
exceed this ratio. However, Ki is measured under conditions
where the catalytic reaction proceeds, i.e. in the presence of
ATP, CoA and citrate. In contrast, the release of ADP could
not be measured by the coupled pyruvate kinase–lactate
dehydrogenase assay when only citrate and ATP, or only CoA
and ATP, were incubated with ACLY purified from chicken
liver (Srere, 1961). The crystallization conditions mimic the
assay with only citrate and ATP and the structure shows that
ADP remains bound to the enzyme under these conditions.
His760 is phosphorylated in the structures with 4S- or 4R-
hydroxycitrate or citrate. Originally, crystals of the complexes
with 4S- and 4R-hydroxycitrate were grown to determine
whether the phosphoryl group would remain on His760 or be
transferred to 4S- and 4R-hydroxycitrate. The structures of the
two complexes were discovered to be very similar (Figs. 8a and
8b). The phosphoryl group remains on His760 and hydrogen-
bonds to the amide N atom of Gly283 from one power helix
and the hydroxyl of Ser663 and the amide N atom of Gly664
from the second. One O atom of the phosphoryl group, that
near Gly282, coordinates a magnesium ion whose other five
coordination sites are occupied by water molecules in the
complex with 4S-hydroxycitrate. The structure with 4R-
hydroxycitrate is at lower resolution and only three water
molecules coordinating Mg2+ were modelled. The O atoms of
the pro-S carboxylate are in the second coordination sphere of
Mg2+, with one O atom coordinating the same water molecule
as Ser308. This contrasts with the structure of TEV-Nter
hACLY bound to citrate and phosphate, in which the pro-S
Acta Cryst. (2017). D73, 660–671

carboxylate binds directly to Na+. Other side chains coordi-
nating the water molecules bound to Mg2+ in the phosphory-
lated structures are Glu306 and Glu599. Neither the 4S- nor
the 4R-hydroxyl group forms hydrogen bonds. The distance
from the P atom of the phosphohistidine to the nearest O
atom of hydroxycitrate is 4.4 Å, which appears to be too long
for transfer of the phosphoryl group. This distance can only be
reduced by 0.2 Å when the torsion angle for the pro-S
carboxylate is adjusted. This distance and the location of the
pro-S carboxylate O atoms in the second coordination sphere
of Mg2+ led to the idea the protein is trapped in an open
conformation, preventing transfer of the phosphoryl group to
the organic acid. To test this hypothesis, TEV-Nter hACLY
was crystallized with citrate, magnesium chloride and ATP.
Citrate bound in the same way as the two hydroxycitrates,
coordinating water molecules that were bound to Mg2+
(Fig. 8c). The conformation of citrate is most similar to that of
4R-hydroxycitrate. The additional hydroxyl in 4R-hydroxy-
citrate does not appear to interfere with binding the citrate
portion to the protein, while the additional hydroxyl in
4S-hydroxycitrate is accommodated by shifts in the citrate
portion and the side chain of Phe347. In every case, the
phosphoryl group is retained on His760, supporting the
hypothesis that the protein is trapped in an open conforma-
tion.
The interpretation that the protein is trapped in an open
conformation is supported by superposition of the structures
of citrate bound to phosphorylated and unphosphorylated
TEV-Nter hACLY. When the phosphoryl group is bound to
His760, the cation binds directly to the phosphoryl group. The
interaction with citrate is via water molecules. When phos-
phate is bound at the active site, the cation binds directly to
the phosphate, citrate and Ser308 as well. The distance
between the positions of the cation in the superposed struc-
tures is 1.8 Å. This suggests that although the new confor-
Figure 8
Binding of organic acid with Mg2+ to phosphorylated TEV-Nter hACLY. In each case, the phosphoryl group is not transferred to the organic acid but
remains bound to the active-site histidine residue. Electron density is shown for the organic acid, which was omitted from the model prior to the
refinement. The resulting OMIT map (Fo  Fc, c) is contoured at the 3 r.m.s.d. level. The complexes with (a) 4R-hydroxycitrate, (b) 4S-hydroxycitrate
and (c) citrate are shown.
Acta Cryst. (2017). D73, 660–671
research papers
mation of the citrate-binding domain has resulted in the power
helices lying closer to each other (Fig. 6c), the domain would
have to move a further 2 Å for catalysis to take place.
3.6. Why is 4S-hydroxycitrate an inhibitor?
4R-Hydroxycitrate is a poor substrate of ACLY and
4S-hydroxycitrate is not a substrate, only an inhibitor, but both
lead to the dephosphorylation of ACLY (Sullivan et al., 1977).
This result was consistent with earlier experiments in which
the dephosphorylation of ACLY occurred in the presence of
tricarboxylic acids (for example dl-isocitrate, tricarballylate
and cis- and trans-aconitate), but not monocarboxylic or
dicarboxylic acids (for example acetate, succinate, fumarate
and l-malate) (Inoue et al., 1968). The crystal structures of the
complexes with both 4S- and 4R-hydroxycitrate show that
their binding modes are similar to the binding mode of citrate.
In every case, the pro-S carboxylate is available to accept the
phosphoryl group from His760. Formation of 4S- or 4R-
hydroxycitryl-phosphate would result in dephosphorylation of
ACLY. But why is 4R-hydroxycitrate a poor substrate, while
4S-hydroxycitrate is only an inhibitor?
The next step in the proposed partial reactions (Fig. 2) is
attack by CoA. A similar attack is proposed for the reaction
catalysed by succinyl-CoA synthetase, where the attack is by
CoA on succinyl-phosphate. The crystal structure of succinyl-
CoA synthetase bound to succinate, CoA, phosphate and
magnesium (PDB entry 5cae; Huang & Fraser, 2016) can be
used to indicate the expected direction of attack by the free
thiol of CoA. PDB entry 5cae was superposed on the complex
of TEV-Nter hACLY with 4S-hydroxycitrate, magnesium and
ADP, based on residues of both domains of the -subunit of
succinyl-CoA synthetase and the equivalent residues of
hACLY (Fig. 9). These domains were chosen for the super-
position because they show the fewest conformational changes
Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase 669
research papers
Figure 9
Proposed direction of attack for CoA. (a) CoA, succinate and the
phosphate and magnesium ions are shown with the active-site histidine
residue, the water molecules in the first coordination sphere of the
magnesium ion and the residues that coordinate the magnesium ion and
water molecules in the complex with succinyl-CoA synthetase. (b) To
show the direction of attack for CoA, the structure of succinyl-CoA
synthetase was superposed with that of TEV-Nter hACLY. CoA is from
the complex with succinyl-CoA synthetase, while 4S-hydroxycitrate, the
magnesium ion, water molecules, phosphohistidine and other residues are
from the complex of 4S-hydroxycitrate, magnesium and ADP with TEV-
Nter hACLY.
among the known structures. The superposition indicates that
the phosphorylated carboxylate would be available for attack
by the free thiol of CoA. Having disproven the hypothesis that
4S-hydroxycitrate is an inhibitor because it binds differently to
citrate, the current hypothesis is that 4S-hydroxycitrate is an
inhibitor because 4S-hydroxycitryl-CoA cannot be cleaved by
hACLY.
4. Conclusions
Rational design of the protein provided high-resolution data
for the structure determination of 4S-hydroxycitrate, the
inhibitor from the fruit of G. cambogia, bound to the amino-
terminal portion of hACLY. Site-directed mutagenesis
changed the crystal packing and provided crystals that showed
electron density into which to fit the phosphohistidine loop.
These crystals showed a different orientation of the citrate-
binding domain from that previously seen. They proved that
the hydroxycitrate purchased from Sigma–Aldrich was
4R-hydroxycitrate. However, no electron density was seen for
a 62-residue linker. This linker was removed from the protein
by adding two TEV protease cleavage sites. Removal of the
linker led to crystals that were well ordered and diffracted to
high resolution. Structures of the complexes with citrate,
tartrate, 4S- or 4R-hydroxycitrate, with or without magnesium
ions and ATP, showed the interactions between key catalytic
residues and the substrates or inhibitors. The conclusion was
that the inhibitor 4S-hydroxycitrate binds in the same orien-
tation as citrate. The same is true for 4R-hydroxycitrate, which
is both a competitive inhibitor and a poor substrate. The
binding mode would allow transfer of the phosphoryl group to
the pro-S carboxylate. However, the conformation crystallized
is ‘open’ and the phosphoryl group remains on the active-site
histidine residue.
670 Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase
Acknowledgements
Diffraction data were collected using beamlines 08ID-1 and
08B1-1 at the Canadian Light Source, which is supported by
the Natural Sciences and Engineering Research Council of
Canada, the National Research Council Canada, the Canadian
Institutes of Health Research, the Province of Saskatchewan,
Western Economic Diversification Canada and the University
of Saskatchewan.
Funding information
The following funding is acknowledged: Natural Sciences and
Engineering Research Council of Canada (Grant Account No.
222915).
References
Adams, P. D. et al. (2010). Acta Cryst. D66, 213–221.
Aguda, A. H., Lavallee, V., Cheng, P., Bott, T. M., Meimetis, L. G.,
Law, S., Nguyen, N. T., Williams, D. E., Kaleta, J., Villanueva, I.,
Davies, J., Andersen, R. J., Brayer, G. D. & Brömme, D. (2016). J.
Nat. Prod. 79, 1962–1970.
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z.,
Miller, W. & Lipman, D. J. (1997). Nucleic Acids Res. 25, 3389–3402.
Antranikian, G., Herzberg, C. & Gottschalk, G. (1982). J. Bacteriol.
152, 1284–1287.
Battye, T. G. G., Kontogiannis, L., Johnson, O., Powell, H. R. & Leslie,
A. G. W. (2011). Acta Cryst. D67, 271–281.
Berman, H., Henrick, K. & Nakamura, H. (2003). Nature Struct. Biol.
10, 980.
Berwick, D. C., Hers, I., Heesom, K. J., Moule, S. K. & Tavaré, J. M.
(2002). J. Biol. Chem. 277, 33895–33900.
Cottam, G. L. & Srere, P. A. (1969). Biochem. Biophys. Res. Commun.
35, 895–900.
Dong, A. et al. (2007). Nature Methods, 4, 1019–1021.
Emsley, P., Lohkamp, B., Scott, W. G. & Cowtan, K. (2010). Acta
Cryst. D66, 486–501.
Fraser, M. E., James, M. N. G., Bridger, W. A. & Wolodko, W. T.
(1999). J. Mol. Biol. 285, 1633–1653.
Fraser, M. E., James, M. N. G., Bridger, W. A. & Wolodko, W. T.
(2000). J. Mol. Biol. 299, 1325–1339.
Galperin, M. Y., Koonin, E. V. & Koonin, E. V. (1997). Protein Sci. 6,
2639–2643.
Glusker, J. P., Minkin, J. A., Casciato, C. A. & Soule, F. B. (1969).
Arch. Biochem. Biophys. 132, 573–575.
Groot, P. H. E., Pearce, N. J. & Gribble, A. D. (2003). Curr. Med.
Chem. Immunol. Endocr. Metab. Agents, 3, 211–217.
Hayward, S. & Berendsen, H. J. C. (1998). Proteins, 30, 144–154.
Huang, J. & Fraser, M. E. (2016). Acta Cryst. D72, 912–921.
Inoue, H., Suzuki, F., Fukunishi, K., Adachi, K. & Takeda, Y. (1966).
J. Biochem. 60, 543–553.
Inoue, H., Suzuki, F., Tanioka, H. & Takeda, Y. (1968). J. Biochem. 63,
89–100.
Kanao, T., Fukui, T., Atomi, H. & Imanaka, T. (2001). Eur. J.
Biochem. 268, 1670–1678.
Kanao, T., Fukui, T., Atomi, H. & Imanaka, T. (2002). Eur. J.
Biochem. 269, 3409–3416.
Krissinel, E. & Henrick, K. (2007). J. Mol. Biol. 372, 774–797.
Lewis, Y. S. & Neelakantan, S. (1965). Phytochemistry, 4, 619–625.
Mashima, T., Seimiya, H. & Tsuruo, T. (2009). Br. J. Cancer, 100,
1369–1372.
McCoy, A. J. (2007). Acta Cryst. D63, 32–41.
Phan, J., Zdanov, A., Evdokimov, A. G., Tropea, J. E., Peters, H. K.,
Kapust, R. B., Li, M., Wlodawer, A. & Waugh, D. S. (2002). J. Biol.
Chem. 277, 50564–50572.
Acta Cryst. (2017). D73, 660–671

Pierce, M. W., Palmer, J. L., Keutmann, H. T. & Avruch, J. (1981). J.
Biol. Chem. 256, 8867–8870.
Potapova, I. A., El-Maghrabi, M. R., Doronin, S. V. & Benjamin,
W. B. (2000). Biochemistry, 39, 1169–1179.
Ramakrishna, S., D’Angelo, G. & Benjamin, W. B. (1990).
Biochemistry, 29, 7617–7624.
Schwenke, W. D., Soboll, S., Seitz, H. J. & Sies, H. (1981). Biochem. J.
200, 405–408.
Srere, P. A. (1959). J. Biol. Chem. 234, 2544–2547.
Srere, P. A. (1961). J. Biol. Chem. 235, 50–53.
Srere, P. A. & Bhaduri, A. (1964). J. Biol. Chem. 239, 714–718.
Stallings, C., Blount, J. F., Srere, P. A. & Glusker, J. P. (1979). Arch.
Biochem. Biophys. 193, 431–448.
Sullivan, A. C., Singh, M., Srere, P. A. & Glusker, J. P. (1977). J. Biol.
Chem. 252, 7583–7590.
Acta Cryst. (2017). D73, 660–671
research papers
Sun, T., Hayakawa, K., Bateman, K. S. & Fraser, M. E. (2010). J. Biol.
Chem. 285, 27418–27428.
Sun, T., Hayakawa, K. & Fraser, M. E. (2011). Acta Cryst. F67, 1168–
1172.
Walsh, C. T. & Spector, L. B. (1969). J. Biol. Chem. 244, 4366–
4374.
Watson, J. A., Fang, M. & Lowenstein, J. M. (1969). Arch. Biochem.
Biophys. 135, 209–217.
Weisse, R. H.-J., Faust, A., Schmidt, M., Schönheit, P. & Scheidig, A. J.
(2016). Proc. Natl Acad. Sci. USA, 113, E519–E528.
Wells, T. N. (1991). Eur. J. Biochem. 199, 163–168.
Winn, M. D. et al. (2011). Acta Cryst. D67, 235–242.
Winter, G. (2010). J. Appl. Cryst. 43, 186–190.
Wolodko, W. T., Fraser, M. E., James, M. N. G. & Bridger, W. A.
(1994). J. Biol. Chem. 269, 10883–10890.
Hu et al.  Binding of hydroxycitrate to human ATP-citrate lyase 671