Professional Documents
Culture Documents
Phân lập vi khuẩn khử sulphate (SRB) để ứng dụng trong xử lý nước thải axit từ hoạt động khai thác khoáng sản
Phân lập vi khuẩn khử sulphate (SRB) để ứng dụng trong xử lý nước thải axit từ hoạt động khai thác khoáng sản
Phân lập vi khuẩn khử sulphate (SRB) để ứng dụng trong xử lý nước thải axit từ hoạt động khai thác khoáng sản
Abstract: Nghiên cứu Acid Mine Drainage (AMD) và các vấn đề môi trường liên quan.
Xử lý AMD bằng phương pháp hóa học, sinh học. Đặc tính sinh học của Sulfate reducing
bacteria (SRB). Phân bố của SRB trong tự nhiên. Đa dạng về di truyền của SRB. Đặc
điểm sinh lý của SRB. Nhu cầu dinh dưỡng của SRB. Các yếu tố ảnh hưởng tới sinh
trưởng của SRB. Cạnh tranh của SRB với các nhóm vi khuẩn khác trong môi trường.
Nghiên cứu đặc điểm sinh học của các chủng SRB mới phân lập. Thử nghiệm xử lý
AMD trên mô hình phòng thí nghiệm.
Keywords: Sinh vật học; Nước thải axit; Vi khuẩn; Xử lý nước thải; Phân lập vi khuẩn
Content
Chƣơng 1 - TỔNG QUAN TÀI LIỆU
1.1 AMD (Acid Mine Drainage) và các vấn đề môi trƣờng liên quan
1.1.1 Sự hình thành AMD
AMD (Acid Mine Drainage) được hình thành khi các khoáng sulfide (như pyrite, FeS 2)
trong quặng tiếp xúc với oxy và nước (Brown và cs, 2002).
Hình 1.1. AMD từ khu khai thác quặng kim loại ở Việt Nam
Quá trình oxy hóa khoáng sulfide:
FeS2 + 7/2O2 +H2O → Fe2+ + 2SO 42- + 2H+
Như vậy AMD có hai điểm đặc trưng nhất là pH thấp và hàm lượng ion kim loại nặng
cao.
1.1.2. Ảnh hƣởng của AMD tới môi trƣờng
1.1.2.1. Ô nhiễm nguồn nƣớc do AMD
AMD có ảnh hưởng lâu dài đối với các nguồn nước sông, suối, cũng như cuộc sống của các sinh
vật (động, thực vật và con người) liên quan đến những nguồn nước này.
Nước bị ô nhiễm AMD có thể có pH thấp từ 2 đến 4,5, gây độc với hầu hết các dạng sinh
vật sống dưới nước (Hill, 1974). Ngoài cá, các sinh vật khác như côn trùng, tảo cũng giảm rõ rệt
về số lượng loài và số lượng cá thể khi pH trong môi trường giảm do AMD (Warner, 1971).
1.1.2.2. Ô nhiễm đất do AMD
Hoạt động khai thác mỏ và khai thác đá gây phá hủy nhiều vùng đất qua hàng trăm năm, trong
đó nhiều vùng không có khả năng phục hồi (Duffield và cs, 2000).
2011).
1.2 Xử lý AMD
1.2.1 Xử lý AMD bằng phƣơng pháp hóa học
Các chất hóa học thường được sử dụng để xử lý AMD gồm CaCO 3, Ca(OH) 2, Na2CO3 , NaOH và
NH3.
Tuy phương pháp hóa học được sử dụng từ lâu và có hiệu quả nhanh chóng nhưng tốn kém và
không an toàn, thường gây ra những vấn đề ô nhiễm thứ cấp (Skousen và cs, 1996).
Vi khuẩn khử sulfate (SRB) là các vi khuẩn sinh trưởng kỵ khí, sử dụng sulfate làm chất nhận
điện tử cuối cùng để oxy hóa hydro hay các hợp chất hữu cơ và tận thu năng lượng cho mục đích
sinh trưởng (phản ứng 1.10).
1.2.2.3. Các yếu tố ảnh hƣởng tới quá trình xử lý AMD bằng SRB
Là quy trình công nghệ dựa trên hoạt động của vi sinh vật, quá trình xử lý AMD bị chi phối bởi
các yếu tố ảnh hưởng đến tính chất sinh lý, sinh hóa của SRB, cụ thể là:
Nguồn SRB
Cơ chất
pH
Nhiệt độ
Nhóm oxy hóa hoàn toàn: Oxy hóa các hợp chất hữu cơ (bao gồm cả acetate) hoàn toàn
thành CO2.. Trong nhóm này có đa dạng các loài SRB khác nhau, như Desulfobacter
spp., Desulfobacterium spp., Desulfosarcina spp.
SRB thực hiện trao đổi chất oxy hóa các cơ chất hữu cơ sử dụng sulfate làm chất nhận
điện tử cuối cùng (Postgate, 1984). Sự khử sulfate thành sulfide tiêu thụ 8 điện tử và các quá
trình sinh hóa thông qua nhiều bước trung gian với sự tham gia của nhiều enzyme (hình 1.4)
(Fauque và cs, 199; Kremer, Hansen, 1988).
Hình 1.4. Các bước khử sulfate ở SRB và các enzyme tham gia
Phản ứng có thể được tóm tắt như sau (Peck và Lissolo, 1988):
SO42 → SO32 → HSO 3 → HS → S2 (1.12)
1.3.3.2. Các yếu tố ảnh hƣởng tới sinh trƣởng của SRB
Nhiệt độ, pH, độ muối
Nồng độ sulfide.
Mẫu nước thải AMD để thử nghiệm xử lý trong mô hình phòng thí nghiệm được thu thập
từ mỏ than Tràng Khê, Quảng Ninh.
Hình 2.1. Vị trí đoạn gen 16S rDNA được sử dụng trong phân tích DGGE ở Lactobacillus
plantarum (Lopez và cs, 2003).
2.2.5. Giải trình tự gen 16S rDNA và dựng cây phân loại
Gen 16S rDNA (1500 bp) của các chủng SRB thuần khiết được khuếch đại trong phản ứng
PCR sử dụng cặp mồi 27F (AGAGTTTGATCCTGGCTCAG) và 1492R
(GGTTACCTTGTTACGACT T) ( Weisburg và cs, 1991)
2.2.6. Phân tích hóa học
2.2.6.1. Định lƣợng Fe(II) bằng thuốc thử phenanthrolin (DIN 38406 E1-1, 1983)
Nguyên lý: O-phenanthrolin phản ứng với Fe(II) tạo phức có màu tím đỏ trong khoảng pH 3 9,
đo được ở bước sóng 510 nm. Nồng độ Fe(II) cho phép đo là 0,01 5 mg/l. Kết quả của phép đo
có thể bị ảnh hưởng bởi ion Mn và Cu.
2.2.6.2. Định lƣợng sulfate (Dinh và cs, 2004)
Nguyên lý: SO42- kết hợp với Ba2+ tạo kết tủa BaSO4 theo phương trình: Ba2+ + SO42- → BaSO4 kết tủa
trắng. Hàm lượng sulfate được xác định thông qua hàm lượng chất kết tủa BaSO4 tạo thành.
2.2.6.3. Xác định nồng độ sulfide (Cord-Ruwisch, 1985)
Nguyên lý: Ion S2 phản ứng với ion Cu2+ tạo CuS có màu nâu đen dạng huyền phù, đo được nhanh ở
bước sóng 480 nm.
2.2.7 Thiết kế mô hình xử lý AMD
Nguồn AMD: Nguồn AMD được thu thập từ mỏ than Tràng Khê ở Quảng Ninh có các đặc điểm lý hóa
như sau: pH = 4
Nồng độ sắt = 200 mg/l (tương đương 3,57 mM)
Nồng độ sulfate = 1320 mg/l (tương đương 13,75 mM)
Giá thể: Phoi bào được lót dưới lớp đáy của bể xử lý
Nguồn vi sinh vật: Dịch làm giàu SRB sau lần cấy truyền thứ 4 (E1-4)
Chu trình xử lý:
1 2 3
Hình 2.2. Mô hình xử lý AMD trong phòng thí nghiệm. 1) Bể điều hòa chứa AMD đầu vào; 2) Bể xử lý
AMD bằng SRB; 3) Bể lắng chứa nước thải đầu ra.
Mô hình xử lý AMD được hoạt động với nguồn cơ chất cho SRB sinh trưởng được bổ sung từ
bên ngoài là methanol hoặc nước thải có hàm lượng hữu cơ cao.
12
Nồng độ sulfide (mM)
10
0
E1-4 E2-4 E3-4
Hình 3.1. Hàm lượng sulfide của các mẫu làm giàu ở lần cấy truyền thứ 4
Trên cơ sở đó, E1-4 được sử dụng để tiến hành phân lập các chủng SRB thuần khiết.
(a) (b)
Hình 3.2. Làm giàu và phân lập vi khuẩn khử sulfate từ mẫu nước thải. (a) – Mẫu làm giàu vi
khuẩn SRB E1-4; (b) – Khuẩn lạc SRB hình thành trong ống thạch bán lỏng
Ba chủng SRB được phân lập từ ống pha loãng 108 dựa trên hình thái khác nhau của
khuẩn lạc (bảng 3.1).
Bảng 3.1. SRB phân lập đƣợc từ dịch làm giàu với mẫu nƣớc thải E1-4
Tên chủng Đặc điểm hình Hình dạng tế bào Đặc điểm chuyển
thái khuẩn lạc động của tế bào
SR2 Hình múi khế 4 Hình que, có độ dài khác nhau tùy Không chuyển
cạnh, màu đen thuộc thời gian và điều kiện nuôi động
cấy, kích thước tế bào nhỏ nhất
1×3,5 μm (hình 3.3)
SR3 Hình múi khế 3 Hình ovan đơn hoặc xếp chuỗi, kích Chuyển động chậm
cạnh, màu đen thước 1×1,5-2 μm (hình 3.3)
SR4 Hình đĩa lồi 2 Hình phẩy khuẩn, kích thước 1×2-3 Chuyển động
mặt, màu đen μm (hình 3.3) nhanh
Hình 3.3. Hình thái tế bào của ba chủng SRB thuần khiết phân lập được từ mẫu dịch làm giàu
với nước thải
3.2. Vị trí phân loại của ba chủng SRB dựa trên trình tự gen 16S rDNA
Hình 3.6. Cây phân loại neibourgh joining dựa trên trình tự gen 16S rDNA gần đủ của các chủng
SRB mới phân lập so sánh với các loài SRB có quan hệ gần gũi. Escherichia coli (-
Proteobacteria) được chọn làm outgroup.
3.3. Nghiên cứu đặc điểm sinh học của các chủng SRB mới phân lập
3.3.1. Ảnh hƣởng của nồng độ muối trong môi trƣờng
Nồng độ sulfide(mM)
Nồng độ sulfide(mM)
4 4 4
0.3 0.3 0.3
3 3 3
OD600
OD600
OD600
0 0 0 0 0 0
0 1 5 10 15 20 25 0 1 5 10 15 20 25 0 1 5 10 15 20 25
Nồng độ muối (g/l) Nồng độ muối (g/l) Nồng độ muối (g/l)
OD600
OD600
OD600
2 2 2
0 0 0 0 0 0
4 5 6 7 8 4 5 6 7 8 4 5 6 7 8
pH pH pH
5
Nồng độ sulfide (mM)
5
Nồng độ sulfide (mM)
0.3
0.3
4
4
OD600
OD600
3 0.2
3 0.2
2 2
0.1 0.1
1 1
0 0 0 0
4 5 6 7 4 5 6 7
pH pH
3 3 3
OD600
OD600
OD600
0.2 0.2 0.2
2 2 2
0 0 0 0 0 0
15 20 25 30 37 15 20 25 30 37 15 20 25 30 37
Nhiệt độ (oC) Nhiệt độ (oC) Nhiệt độ (oC)
Mô hình 1
16 10
Nồng độ sulfate
8
12
6
(mM)
pH
8
4
4
2
0 0
0 1 2 3 4 5 6 7 8
Thời gian (ngày)
Nồng độ sulfate pH
Hình 3.12. Mô hình xử lý AMD với cơ chất bổ sung là methanol (10 mM)
3.4.2. Xử lý AMD trong điều kiện bổ sung nƣớc thải giàu hữu cơ làm cơ chất
Mô hình 2
16 10
Nồng độ sulfate
8
12
6
(mM)
pH
8
4
4
2
0 0
0 1 2 3 4 5 6 7 8
Thời gian (ngày)
Nồng độ sulfate pH
Hình 3.13. Mô hình xử lý AMD với cơ chất là nước thải có hàm lưỡng chất hữu cơ cao
Như vậy nước thải có hàm lượng hữu cơ cao có khả năng sử dụng làm cơ chất tốt cho vi
khuẩn khử sulfate trong bể phản ứng xử lý AMD. Việc kết hợp nước thải hữu cơ để xử lý AMD
có ý nghĩa quan trọng trong việc giảm giá thành công nghệ, đồng thời góp phần bảo vệ môi
trường bởi các loại nước thải hữu cơ như nước thải từ chăn nuôi, chế biến thực phẩm, nước thải
sinh hoạt.
3.4.3. Phân tích thành phần quần xã vi sinh vật trong các mô hình xử lý AMD trong phòng
thí nghiệm
Hình 3.14. Điện di biến tính (DGGE) gen 16S rDNA phân tích thành phần của quần xã vi khuẩn
trong mô hình xử lý AMD.
KẾT LUẬN
1. Đã thiết lập được hỗn hợp SRB (mẫu E1-4) có hoạt tính tốt trong điều kiện pH thấp qua
phương pháp làm giàu.
2. Phân lập được 3 chủng vi khuẩn khử sulfate SR2, SR3 và SR4 từ mẫu làm giàu nói trên. Dựa
trên trình tự gần đủ của gen 16S rDNA các chủng này được định danh tương ứng là
Desulfomicrobium sp. SR2, Desulfobulbus sp. SR3, và Desulfovibrio sp. SR4.
3. Phân tích DGGE gen 16S rDNA cho thấy các chủng phân lập đại diện cho các nhóm SRB
chính trong mẫu làm giàu E1-4.
Cả 3 chủng đều có khả năng sinh trưởng tốt ở môi trường có hàm lượng muối 10 – 15
g/l, tương ứng với môi trường nước lợ. Đặc biệt là chủng SR4 có thể sinh trưởng tốt
tại nồng độ muối 25 g/L, tương đương môi trường nước biển.
Cả ba chủng đều bị ức chế tại pH môi trường 6, tuy nhiên mẫu làm giàu gốc E1-4
thể hiện khả năng chịu pH thấp tốt hơn các chủng thuần khiết và sinh trưởng tốt ở pH
4 và 5.
5. Mô hình thử nghiệm xử lý AMD với cơ chất bổ sung là nước thải có hàm lượng hữu cơ cao
đạt hiệu quả cao hơn khi sử dụng cơ chất đơn là methanol. Kết quả thu được sau 7 ngày xử lý
gồm: pH tăng từ 4 lên 8,15, nồng độ sulfate giảm từ 13,75 mM còn 4,5 mM, hàm lượng sắt
giảm từ 200 mg/l còn 36 mg/l thể hiện khả năng ứng dụng thực tế của công nghệ.
References
Tiếng việt
1. Công ty cổ phần tin học, công nghệ, môi trường, TCT Than & Khoáng sản Việt Nam
(2012), Kết quả phân tích nước thải mỏ than.
2. Hồ Sỹ Giao, Mai Thế Toản (2010), “Những điểm nóng môi trường trong hoạt động khai thác
mỏ ở Việt Nam”, Hội nghị khoa học kĩ thuật mỏ quốc tế 2010.
3. Bùi Công Quang (2011), “Tác động của các hoạt động khai thác mỏ đến nguồn nước và hệ
sinh thái”, Chuyên đề bảo vệ môi trường trong khai thác khoáng sản, ĐH Thủy Lợi.
4. Nguyễn Danh Sơn (2011), “Môi trường và phát triển bền vững trong quản lý khai thác tài
nguyên khoáng sản ở Việt Nam”, Chuyên đề bảo vệ môi trường trong khai thác khoáng
sản, Viện Khoa học xã hội Việt Nam.
Tiếng Anh
5. Bahr M, Crump BC, Ceraj VK, Teske A, Sogin ML, Hobbie JE (2005), “Molecular
chacterization of sulfate-reducing bacteria in a New England salt marsh”, Environ.
Microbiol., 7, pp.1175–1185.
6. Ben-Dov E, Brenner A, Kushmaro (2007), “Quantification of sulfate-reducing bacteria in
industrial wastewater by real-time polymerase chain reaction (PCR) using dsrA and apsA
genes”, Microbiol. Ecol.,54, pp. 439–451.
7. Brenner FJ (2001), “Use of constructed wetlands for acid mine drainage abatement and stream
restoration”, Water Sci. Technol., 44, pp. 449-454.
8. Benner SG, Blowes DW, Ptacek CJ (1997), “A full-scale porous reactive wall for prevention
of acid mine drainage”, Ground Water Monit. Remed., 17, pp. 99-107.
9. Bharathi PAL, Sathe V, Chandramohan D (1990), “Effect of lead, mercury and cadmium on a
Sulphate-reducing bacterium”, Environ. Pollut., 67, pp. 361–374.
10. Boetius A , Ravenschlag K, Schubert KJ, Rickert D, Widdel F, Gieseke A, Amann R,
Jùrgensen BB, Witte U, Pfannkuche O (2000), “A marine microbial consortium apparently
mediating anaerobic oxidation of methane”, Nature, 407, pp. 623–626.
11. Boschker HTS, Nold SC, Wellsbury P, Bos D, de Graaf W, Pel R, Parkes RJ,
Cappenberg (1998), “Direct linking of microbial populations to specific biogeochemical
processes by 13C-labelling of biomarkers”, Nature, 392, pp. 801–804.
12. Boularbah A, Schwartz C, Bitton G, Morel JL (2006), “Heavy metal contamination from
mining sites in South Morocco: 1. Use of a biotest to assess metal toxicity of tailings and
soils”, Chemosphere, 63, pp. 802-810.
13. Brookens AM, Schmidt WT, Branch WL (2000), The effectiveness of utilizing passive
treatment systems for leachate discharges in Western Maryland, Presented at the American
Society for Surface Mining and Reclamation 17th Annual Meeting, Tampa, Florida, June
11-15, 2000.
14. Brown M, Barley B, Wood H (2002), Minewater treatment: technology, application and
policy, IWA Publishing, London.
15. Brysch K, Schneider C, Fuchs G, Widdel F (1987), “Lithoautotrophic growth of sulphate-
reducing bacteria, and description of Desulfobacterium autotrophicum gen. nov., sp. nov.”,
Arch. Microbiol.,148, pp. 264–274.
16. Cabrera G, Pérez RJM, Gómez, Ábalos A, Cantero D (2006), “Toxic effects of dissolved
heavy metals on Desulfovibrio vulgaris and Desulfovibrio sp. strains”, J. Hazar. Mater.,
135, pp. 40-46.
17. Chaney RL, Brown SL, Angle JS, Stuczynski TI, Daniels WL, Henry CL, Siebielec G, Li
YM, Malik M, Ryan JA, Compton H (2000), In situ Remediation/ Reclamation/Restoration
of Metals Contaminated Soils using Tailor-Made Biosolids Mixtures, Symposium on
Mining, Forest and Land Restoration: The Successful Use of Residuals/Biosolids/Organic
Matter for Reclamation Activities, Denver, CO.
18. Cooper EL, Wagner CC (1973), “The effects of acid mine drainage on fish populations”,
Fish and Food Organisms in Acid Waters of Pennsylvania, US Environmental Protection,
EPA, pp. 32-114.
19. Cord-Ruwisch R (1985), “A quick method for the determination of dissolved and
precipitated sulfides in cultures of sulfate-reducing bacteria”, J. Microbiol. Meth. 4, pp.
33-36.
20. Dar SA., Kuenen JG, Muyzer G (2005), “Nested PCR-denaturing gradient gel
electrophoresis approach to determine the diversity of sulfate-reducing bacteria in complex
microbial communities”, Appl. Environ. Microbiol., 71, pp. 2325–2330.
21. Dar SA, Stams AJ, Kuenen JG, Muyzer G (2007), “Co-existence of physiologically similar
sulphate-reducing bacteria in a full-scale sulfidogenic bioreactor fed with a single organic
electron donor”, Appl. Microbiol. Biotechnol., 75, pp. 1463–1472.
22. DIN 38406-E1-1 (1983), German standard methods for the examination of water, waste
water and sludge, cation (group E), determination of iron (E1).
23. Doshi SM (2006), Bioremediation of Acid Mine Drainage Using Sulfate-Reducing Bacteria,
Report for U.S. Environmental Protection Agency.
25. Duffield S, Lucia AC, Mitchison N, Kasamas H, (2000), “Land recovery and man-made
risks: a perspective from the EU accession countries”, J. Hazard. Mater.,78, pp. 91-103.
26. Elferink OSJWH, Visser A, Hulshoff-Pol LW, Stams AJM (1994), “Sulphate reduction in
methanogenic bioreactors”, FEMS Microbiol. Rev., 15, pp. 119–136.
27. EPA (1995), Human Health and Environmental Damages from Mining and Mineral
Processing Wastes, Washington DC, Office of Solid Waste, U.S. Environmental Protection
Agency.
28. Farag, A. M., D.Skaar, D.A. Nimick, E. MacConnell, and C. Hogstrand (2003),
"Characterizing aquatic health using salmonids mortality, physiology, and biomass
estimates in streams with elevated concentrations of arsenic, cadmium, copper, lead, and
zinc in the Boulder River Watershed, Montana", Transac. Amer. Fisher. Soc., 132, pp.
450-457.
29. Felsenstein J (1985), “Confidence limits on phylogenies: an approach using the bootstrap”,
Evolution, 39, pp. 783-791.
30. Figueroa L (2005), Microbial ecology of anaerobic biosystems treating mining influenced
waters, Presented at the Mine Water Treatment Technology Conference, Pittsburgh, PA.
31. Frauque, G., J.LeGall, and L. L. Barton (1991), “Sulphate-reducing and sulphur-reducing
bacteria”, Variation in Autotrophic Life, pp. 271-337.
32. Fromm, P. O. (1980), "A review of some physiological and toxicological responses of
freshwater fish to acid stress", Environ. Biol. Fishes, 5, pp. 79-93.
33. Gadd G (2004), “Microbial influence on metal mobility and application for bioremediation”,
Geoderma, 122, pp. 109-119.
34. Gusek JJ, Wildeman TR (2002), Passive treatment of aluminum-bearing acid rock drainage,
rd
Proceedings of the 23 Annual West Virginia Surface Mine Drainage Task Force
Symposium, Morgantown, West Virginia, April 16-17, 2002.
35. Dinh TH, Kuever J, MaBmann M, Hassel AW, Martin Stratmann and Friedrich Weddel, “Iron
corrosion by novel anaerobic microorganism”, Nature, 427, pp. 829-832.
36. Hao OJ, Chen JM, Huang L, Buglass RL (1996), “Sulphate reducing bacteria”, Crit. Rev.
Enviro. Sci. Technol., 26, pp. 155-187.
37. Hao OJ, Huang L, Chen JM, Buglass RL (1994), “Effects of metal additions on sulphate
reduction activity in wastewaters”, Toxicology and Environmental Chemistyi, 46, pp. 197-
212.
38. Higgins JP, Hard BC, Mattes A (2003), Bioremediation of rock drainage using sulphate-
reducing bacteria, Proceedings of Sudbury 2003: Mining and Environment, Sudbury,
Ontario, May 25-28, 2003.
39. Hill RD (1974), Mining impacts on trout habitat, Proceedings of a Symposium on Trout
Habitat, Research, and Management, Boone, NC, Appalachian Consortium Press.
40. Hilton BL, Oleszkiewiez JA (1988), “Sulfide induced inhibition of anaerobic digestion”, J.
Environ. Eng., 114, pp. 1377–1391.
41. Hines ME, Evans RS, Genthner BRS, Willis SG, Friedman S, Rooney-Varga JN, Devereux
R (1999), “Molecular phylogenetic and biogeochemical studies of sulfate-reducing bacteria
in the rhizosphere of Spartina alterniflora”, Appl. Environ. Microbiol., 65, 2209–2216.
42. Howells GD, Brown DJA, Sadler K (1983), "Effects of acidity, calcium, and aluminum on
fish survival and productivity - a review", J. Sci. Food Agr., 34(6), pp. 559-570.
43. Itoh T, Suzuki KI, Nakase T (1998), “Thermocladium modestius gen. nov., sp. nov. a new
genus of rod-shaped, extremely thermophilic crenarchaeote”, Int. J. Syst. Bacteriol., 48, pp.
879–887.
44. Itoh T, Suzuki KI, Sanches PC, Nakase T (1999), “Caldivirga maquilingensis gen. nov., sp.
nov. a new genus of rod-shaped crenarchaeote isolated from a hot spring in the
Philippines”, Int. J. Syst. Bacteriol., 49, pp. 1157–1163.
45. Jage CR, Zipper CE, Hendricks AC (2000), Factors affecting performance of Successive
Alkalinity-Producing Systems, Presented at the American Society for Surface Mining and
Reclamation 17th Annual Meeting, Tampa, Florida, June 11-15, 2000.
46. Jennings SR, Neuman DR, Blicker PS (2008), Acid Mine Drainage and Effects on Fish
Health and Ecology: A Review, Reclamation Research Group Publication, Bozeman MT.
47. Jeanthon C, Haridon SL, Cueff V, Banta A, Reysenbach AL, Prieur D (2002),
“Thermodesulfobacterium hydrogeniphilum sp. nov., a thermophilic,
chemolithoautotrophic sulfate-reducing bacterium isolated from a deep-sea hydrothermal
vent at Guaymas Basin and emendation of the genus Thermodesulfobacterium”, Int. J.
Syst. Evol. Microbiol., 52, pp. 765–772.
48. Jong T, Parry DL (2006), “Microbial sulfate reduction under sequentially acidic conditions in
an upflow anaerobic packed bed bioreactor”, Water Res., 40, pp. 2561-2571.
49. Kaksonen AH, Plumb JJ, Franzmann PD, Puhakaka JA (2004a), “Simple organic electron
donors support diverse sulphate- reducing communities in fluidized-bed reactors treating
acid metal- and sulphate-containing wastewater”, FEMS Microbiol. Ecol., 47, pp. 279–289.
50. Kaksonen AH, Plumb JJ, Franzmann PD, Puhakaka JA (2004b), “Effects of hydraulic
retention time and sulphide toxicity on ethanol and acetate oxidation in sulphate reducing
metal-precipitating fluidized-bed reactor”, Biotechnol. Bioeng., 86, pp. 332–343.
51. Kepler DA, McCleary EC (1994), “Successive alkalinity-producing systems (SAPS) for the
treatment of acidic mine drainage”, Proceedings of the International Land Reclamation
and Mine Drainage Conference and the Third International Conference on the Abatement
of Acidic Drainage, Pittsburgh, PA, April 24-29, 1994, pp. 195-204.
52. Kniemeyer O, Musat F, Sievert SM, Knittel K, Wilkes H, Blumenberg M, Michaelis W,
Classen A, Bolm C, Joye SB, Widdel F (2007), “Anaerobic oxidation of short-chain
hydrocarbons by marine sulphate-reducing bacteria”, Nature, 449, pp. 898–901.
53. Kovacik WPJ (2006), “Molecular analysis of deep subsurface Cretaceous rock indicates
abundant Fe(III)- and S°-reducing bacteria in a sulfate-rich environment”, Environ.
Microbiol., 8, 141–155.
54. Kremer DR, Hansen TA (1988), “Pathway of propionate degradation in Desulfobulbus
propionicus”, FEMS Microbiol. Lett., 49, pp. 273-277.
55. Laanbroek HJ, Geerligs HJ, Sijtsma L, Veldkamp H (1984), “Competition for sulfate and
ethanol among Desulfobacter, Desulfobulbus, and Desulfovibrio species isolated from
intertidal sediments”, Appl. Environ. Microbiol., 47, pp. 329–334.
56. Logan MV, Reardon KF, Figueroa LA, McLain JET, Ahmann DM (2005), “Microbial
community activities during establishment, performance, and decline of bench-scale
passive treatment systems for mine drainage”, Water Res., 39, pp. 4537-4551.
57. Lopez IFR, Larrea L, Cocolin E, Orr T, Phister M, Marshall J, Gheynst V, Mills DA (2003),
“Design and evaluation of PCR primers for analysis of bacterial populations in wine by
denaturing gradient gel electrophoresis”, Appl. Environ. Microbiol., 69, pp. 6801–6807.
58. Maillacheruvu KY, Parkin GF (1996), “Kinetics of growth, substrate utilization and sulphide
toxicity for propionate, acetate and hydrogen utilisers in anaerobic systems”, Water
Environ. Res., 68, pp. 1099–1106.
59. Marmur J (1961), “A procedure for the isolation of deoxyribonucleic acid from
microorganisms”, J Mol Biol, 3, pp. 208-218.
60. McCartney DM, Oleszkiewicz JA. (1991), “Sulphide inhibition of anaerobic degradation of
lactate and acetate”, Water Res., 25, pp. 203–209.
61. McCartney DM, Oleszkiewicz JA (1993), “Competition between methanogens and sulphate
reducers: effect of COD: sulphate ratio and acclimation”, Water Environ. Res., 65, pp.
655–664.
62. Menendez R (1978), “Effects of acid water on Shavers Fork – a case history”, Surface
mining and fish/wildlife needs in the Eastern United States., U.S. DOI, Fish and Wildlife
Service, pp. 160-169.
63. Minz D, Flax JL, Green SJ, Muyzer G, Cohen Y, Wagner M, Rittmann EB, Stahl DA
(1999), “Diversity of sulfate-reducing bacteria in oxic and anoxic regions of a microbial
mat characterized by comparative analysis of dissimilatory sulfite reductase genes”, Appl.
Environ. Microbiol. 65, pp. 4666–4671.
64. Munshower FF, Neuman DR, Jennings SR, Phillips GR (1997), “Effects of land reclamation
techniques on runoff water quality from the Clark Fork River floodplain, Montana”,
Washington, DC, EPA Office of Research and Development, pp. 199-208.
65. Mussmann M, Ishii K, Rabus R, Amann R (2005), “Diversity and vertical distribution of
cultured and uncultured Deltaproteobacteria in an intertidal mud flat of the Wadden Sea”,
Environ. Microbiol., 7, pp. 405–418.
66. Muyzer G, Stams AJM (2008), “The ecology and biotechnology of sulphate-reducing
bacteria”, Nature, 6, pp. 441-454.
67. Nilsen RK, Beeder J, Thostenson T, Torsvik T (1996), “Distribution of thermophilic marine
sulfate reducers in North Sea oil field waters and oil reservoirs”, Appl. Environ. Microbiol.,
62, pp. 1793–1798.
68. Nordstrom DK, Alpers CN (1999), “Negative pH, efflorescent mineralogy, and consequences
for environmental restoration at the Iron Mountain Superfund site, California”, National
Acad. Sci., 96, pp. 3455-3462.
69. Nordstrom DK, Jenne EA, Averett RC (1977), “Heavy metal discharges into Shasta Lake and
Keswick Reservoir on the Sacramento River, California – a reconnaissance during low
flow”, U.S. Geological Survey. Open-File Report, pp. 76-49
70. Nordwick S, Zaluski M, Park B, Bless D (2006), “Advances in development of bioreactors
applicable to the treatment of ARD”, Proceedings, 7th Int. Conf. on Acid Rcok Drainage,
St. Louis, MO, March 26-30, 2006, ed. by R.I. Barnhisel, pp. 1410-1420.
71. O’Flaherty V, Colleran E (1998), “Effect of sulphate addition on volatile fatty acid and
ethanol degradation in an anaerobic hybrid reactor. I: process disturbance and
remediation”, Biores. Technol., 68, pp. 101–107.
72. Ollivier B, Caumette P, Garcia JL, Mah RA (1994), “Anearobic bacteria from hypersaline
enviroments”, Microbiol. Rev., 58, pp. 27-38.
74. Peck HD, Lissolo T (1988), “Assimilatory and dissimilatorymsulphate reduction:
enzymology and bio energentics”, The Ntrogen and Sulphur Cycles, pp. 99-132.
75. Perry RH, Green D (1984), Perry’s Chemical Engineer’s Handbook, 6th Ed. McGraw-Hill
Book Company, Singapore.
76. Pfennig N, Widdel F, Truper HG (1981), “The dissimilatory sulphate reducing bacteria”, in
The Prokaryotes, 2, pp. 926-940.
77. Postage JR (1984), The sulphate reducing bacteria, 2nd ed, Cambridge Univertsity Press,
Cambridge.
78. Ramsing NB, Kühl M, Jørgensen BB (1993), “Distribution of sulfate-reducing bacteria, O2,
and H2 S in photosynthetic biofilms determined by oligonucleotide probes and
microelectrodes”, Appl. Environ. Microbiol., 59, pp. 3840–3849.
79. Ravenschlag K, Sahm K, Knoblauch C, Jørgensen BB, Amann R. (2000), “Community
structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic
sediments”, Appl. Environ. Microbiol., 66, pp. 3592–3602.
80. Reis MAM, Almeida JS, Lemos PC, Carrondo MJT (1992), “Effect of hydrogen sulphide on
growth of sulphate-reducing bacteria”, Biotechnol. Bioeng., 40, pp. 593–600.
81. Rissati JB, Capman WC, Stahl DA (1994), “Community structure of a microbial mat: the
phylogenetic dimension”, Proc. Nat. Acad. Sci. USA, 91, pp. 10173–10177.
82. Rodríguez L, Ruiz E, Alonso-Azcárate J, Rincón, J (2009), “Heavy metal distribution and
chemical speciation in tailings and soils around a Pb–Zn mine in Spain”, J. Environ.
Manag., 90 , pp. 1106-1116.
83. Rose AW, Alcorn GS, Phelps LB, Bower PR (2001), Case study of Pot Ridge Passive
Treatment Systems, Cambria County, Pennsylvania, Presented at the American Society for
th
Surface Mining and Reclamation 18 Annual National Meeting, Albuquerque, New
Mexico, June 3-7, 2001.
84. Saitou N, Nei M (1987), “The neighbor-joining method: a new method for reconstructing
phylogenetic trees”, Mol. Biol. Evol., 4, pp. 406-425.
85. Sass H, Wieringa E, Cypionka H, Babenzien HD, Overmann J (1998), “High genetic and
physiological diversity of sulfate-reducing bacteria isolated from an oligotrophic lake
sediment”, Arch. Microbiol., 170, pp. 243–251.
86. Schink B, Stams AJM (2006), “The Prokaryotes”, Springer Verlag, New York, pp. 309–335.
87. Schönheit P, Kristjansson JK, Thauer RK (1982), “Kinetic mechanism for the ability of
sulphate reducers to out-compete methanogens for acetate”, Arch. Microbiol., 132, pp.
285–288.
88. Sen AM (2001), Acidophilic Sulphate Reducing Bacteria: Candidates for Bioremediation of
Acid Mine Drainage Pollution, Thesis, Univ. Wales.
89. Singer P, Stumm W (1970), “Acid mine drainage: the rate determining step”, Science, 167,
pp. 1121-1123.
90. Skousen J, Sextone A, Cliff J, Sterner P, Calabrese J, Ziemkiewicz P (1999), Acid mine
drainage treatment with a combined wetland/anoxic limestone drain: greenhouse and field
th
systems, Presented at the American Society for Surface Mining and Reclamation 16
Annual National Meeting, Scottsdale, Arizona, August 13-19, 1999.
91. Skousen J, Ziemkiewicz P (1996), Acid Mine Drainage Control and Treatment, 2nd Ed.
National Research Center for Coal and Energy, National Mine Land Reclamation Center,
West Virginia University, Morgantown, WV, pp. 362.
92. Spear JR, Figueroa LA, Honeyman BD (2000), “Modeling the removal of uranium U(VI)
from aqueous solution in the presence of sulfate reducing bacteria”, Environ. Sci.
Technol., 66, pp. 3711-3721.
94. Stadnitskaia A, Muyzer G, Abbas B, Coolena MJL, Hopmans EC, Baas M, van Weeringa
TCE, Ivanovb MK, Poludetkina E, Sinninghe Damste JS (2005), “Biomarker and 16S
rDNA evidence for anaerobic oxidation of methane and related carbonate precipitation in
deep-sea mud volcanoes of the Sorokin Trough, Black Sea”, Mar. Geol., 217, pp. 67–96.
95. Stams AJ, Elferink OS, Westermann P (2003), “Metabolic interactions between
methanogenic consortia and anaerobic respiring bacteria”, Adv. Biochem. Eng. Biotechnol.,
81, pp. 31–56.
96. Stephenson SL, Studiar SM, McQuattie CJ (1995), “Effects of acidification on bryophyte
communities in West Viginia moutain streams”, J. Environ. Qual., 24, pp. 116 – 125.
97. Teitzel GM, Parsek MR (2003), “Heavy metal resistance of biofilm and planktonic
Pseudomonas aeruginosa”, Appl. Environ. Microbiol., 69, pp. 2313–2320.
99. Tsukamoto TK, Killion HA, Miller GC (2004), “Column experiments for microbial treatment
of acid mine drainage: low-temperature, low-pH and matrix investigations”, Water Res.,
38, pp. 1405-1418.
100. U.S.Department of Agriculture (USDA) and EPA Region III (2000), A Handbook of
Constructed Wetlands, Report# 843F00003.
101. U.S.Department of Energy (US DOE) (1998), Research and Application of Permeable
Reactive Barriers, Document# K0002000.
102. US EPA (2004a), Nationwide Identification of Hardrock Mining Sites, Report #2004-P-
00005, Office of the Inspector General.
104. Vega FA, Covelo EF, Andrade ML (2006), “Competitive sorption and desorption of heavy
metals in mine soils: Influence of mine soil characteristics”, J. Colloid Interface Sci., 298,
pp. 582-592.
105. Warner RW (1971), "Distribution of biota in a stream polluted by acid mine drainage",
Ohio J. Sci., 71, pp. 202-215.
106. Watzlaf G, Schroeder K, Kleinmann R, Kairies C, Nairn R (2003), “The passive treatment
of coal mine drainage”, US Department of Energy NETL, pp. 72.
107. Wawer C, Jetten MS, Muyzer G (1997), “Genetic diversity and expression of the NiFe
hydrogenase large-subunit gene of Desulfovibrio spp. in environmental sample”, Appl.
Environ. Microbiol., 61, pp.4360–4369.
108. Webster G, Watt LC, Rinna J, Fry JC, Evershed RP, Parkes RJ, Weightman AJ (2006), “A
comparison of stable isotope probing of DNA and phospholipids fatty acids to study
prokaryotic functional diversity in sulfate-reducing marine sediment enrichment slurries”,
Environ. Microbiol., 8, pp. 1575–1589.
109. Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991). "16S ribosomal DNA
amplification for phylogenetic study". J. Bacteriol., 173: 697–703.
110. Weijma J, Gubbels F, Hulshoff Pol LW, Stams AJM, Lens P, Lettinga G (2002),
“Competition for H2 between sulphate reducers, methanogens and homoacetogens in a gas-
lift reactor”, Water Sci. Technol., 45, pp. 75–80.
111. Widdel F (1988), “Microbiology and ecology of sulphate- and sulphur-reducing bacteria”,
in Biology of Anaerobic Microorganism, pp. 469-585.
112. Widdel F, Bak F (1992), “Gram-negative mesophilic sulfate-reducing bacteria”, in The
Prokaryotes, 2nd ed. Spinger, Berlin Heidelberg New York, pp. 3352-3378.
113. Widdel F, Pfennig N (1984), “Dissimilatory sulfate- and sulfur-reducing bacteria”, Bergey’s
Manual of Systematic Bacteriology, 1, pp. 663-679.
114. Widdel F, Hansen TA (1991), “The dissimilatory sulphate and sulphur reducing bacteria”,
in The prokaryotes, pp. 583-624.
115. Younger PL, Banwart SA, Hedin RS (2002b), Mine water: hydrology, pollution,
remediation, Dordrecht; Boston, Kluwer Academic Publishers.16, pp. 442.
116. Zeikus JG, Dawson MA, Thompson TE, Lugvorsen K, Hatchikian EC (1983), “Microbial
ecology of volcanic sulphidogenesis: Isolation and characterization of
Thermodesulfobacteria commune gen. nov. and sp. nov. J. Gen. Microbiol., 129, pp. 1159-
1169.
117. Zhou J, Bruns MA, Tiedje JM (1996), “DNA recovery from soils of diverse composition”,
Appl. Environ. Microbiol., 62, pp. 316-322.