Gene 500 (2012) 93–100

Contents lists available at SciVerse ScienceDirect

Gene
journal homepage: www.elsevier.com/locate/gene

Molecular evolution of zebrafish dnmt3 genes and thermal plasticity of their

expression during embryonic development
Catarina Campos a, b, Luisa M.P. Valente b, Jorge M.O. Fernandes a,⁎
a
Faculty of Biosciences and Aquaculture, University of Nordland, 8049 Bodø, Norway
b
CIIMAR/CIMAR — Centro Interdisciplinar de Investigação Marinha e Ambiental and ICBAS — Instituto de Ciências Biomédicas de Abel Salazar, Universidade do Porto, 4050-123 Porto, Portugal

a r t i c l e i n f o a b s t r a c t

Article history: DNA reprogramming by DNA (cytosine-5)-methyltransferases (dnmts) after fertilisation is a dynamic mech-
Accepted 4 March 2012 anism that is essential for early development. Amongst the three types of dnmt genes in vertebrates, dnmt3 is
Available online 17 March 2012 the one involved in de novo methylation and comprises three related genes, termed dnmt3a, dnmt3b and
dnmt3L in mammals. Zebrafish (Danio rerio) has six dnmt3 paralogues, which have hitherto been termed
Keywords:
dnmt3 to dnmt8. Bayesian inference of phylogeny and synteny analysis revealed that dnmt6 and dnmt8 are
Danio rerio
Methyltransferases
in fact duplicated dnmt3a genes, whereas the other paralogues are closely related to dnmt3b. Hence, we
Embryonic development propose a revised nomenclature that more accurately reflects the relationship amongst zebrafish dnmt3
Positive selection genes. Both dnmt3a genes were ubiquitously expressed in adult tissues, whilst the various dnmt3b paralogues
Epigenetic regulation were differentially expressed, with notably high expression levels in the gonads. The influence of embryonic
temperature on dnmt3 expression was investigated, since it is known to have a significant impact in early
development and a long-term effect on growth in some teleost species. Embryos were incubated at 23, 27
or 31 °C and samples collected at six developmental stages from blastula until protruding mouth. Dnmt3
expression during early development was remarkably dynamic. In particular, mRNA levels of the two
dnmt3a genes showed a marked increase throughout development and several significant differences in
dnmt3a and dnmt3b transcript levels were found between temperatures at the same developmental point.
Taken together, our data indicate that dnmt3 paralogues are diverging and that dnmt3a and dnmt3b may
play different roles in thermal epigenetic regulation of gene expression during early development.
© 2012 Elsevier B.V. All rights reserved.

1. Introduction gene inactivation rather than changes in gene sequence. Cytosine

In fish, epigenetic factors like temperature can have a marked
influence on myogenesis and the expression of myogenic genes during
early development (Fernandes et al., 2006, 2007) and this early thermal
experience can have a life-long effect. The final fibre number in adult
zebrafish (Danio rerio) showed a maximum value when the embryos
had been incubated at 26 °C and it was 19% and 14% higher than in
those reared at 22 °C and 31 °C, respectively (Johnston et al., 2009).
These remarkable phenotypic differences can indeed occur by epigenetic
Abbreviations: 20S, twenty-somite stage; ASXL2, additional sex combs-like protein
2; β2m, beta-2-microglobulin; BL, blastula; BU, bud; COMMD7, copper metabolism
gene MURR1 domain containing 7; CH, calponin-homology; dN, rate of nonsynon-
ymous substitutions; Dnmt, DNA (cytosine-5)-methyltransferase; dS, rate of synony-
mous substitutions; eef1a, elongation factor 1α; GR, germ ring; HADHA, hydroxyacyl-
coenzyme A dehydrogenase/3-ketoacyl-coenzyme A thiolase/enoyl-coenzyme A
hydratase (trifunctional protein), alpha subunit; mapre1l, microtubule-associated pro-
tein, RP/EB family, member 1, like; Mya, million years ago; NF-kB, nuclear factor kappa-
light-chain-enhancer of activated B cells; PH, pharyngula; PM, protruding mouth;
qPCR, quantitative real-time polymerase chain reaction.
⁎ Corresponding author. Tel.: + 47 75517736; fax: + 47 75517349.
E-mail address: jfe@uin.no (J.M.O. Fernandes).
methylation by DNA (cytosine-5)-methyltransferases (DNMTs) is the
most common covalent modification of DNA in eukaryotes and plays
an essential role in normal development of organisms (Martin et al.,
1999; Mhanni and McGowan, 2004) . In mammals, proper patterns of
DNA methylation are essential not only for the embryonic development,
but also for normal cellular homeostasis once development is complete.
There are three DNMT families in vertebrates: dnmt1, dnmt2 and
dnmt3 (Goll and Bestor, 2005). Dnmt1 is implicated in maintaining
existing methylation patterns and has a direct role in histone methylation
(Rai et al., 2006). The functional importance of dnmt2 in vertebrates
has remained unclear but a recent study in zebrafish demonstrated its
involvement in normal development through cytoplasmic RNA methyla-
tion (Rai et al., 2007). Dnmt3a and 3b are two functionally related genes
that are essential for de novo methylation (Chen et al., 2003; Goll and
Bestor, 2005; Li et al., 2007). The corresponding Dnmt3a and Dnmt3b pro-
teins contain a PWWP domain, which is characterized by the presence of
a highly conserved proline–tryptophan–tryptophan–proline motif and is
included in their C-terminal catalytic domain (Qiu et al., 2002). As DNA
methylation patterns are stably maintained in differentiated mitotic
cells, new patterns arise during embryonic cell differentiation and germ
line specification throughout development (Reik, 2007). Dnmt3a and

0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved.
doi:10.1016/j.gene.2012.03.041
94 C. Campos et al. / Gene 500 (2012) 93–100

Dnmt3b are required for this process, and the inactivation of both genes family were performed using Bayesian (MrBayes) and maximum likeli-
causes a complete failure in the genome-wide methylation (Chen et al., hood (PhyML) methods, as reported by Fernandes et al. (2010). The
2003; Li et al., 2007). In mouse, Dnmt3a is specifically required for the ratio (ω) of nonsynonymous (dN) to synonymous (dS) substitution
methylation of imprinted genes in germ cells (Kaneda et al., 2004) and rates amongst dnmt3 paralogues was investigated using the genetic
the Xist gene on the X chromosome (Chen et al., 2003), and Dnmt3b algorithm GABranch (http://www.datamonkey.org/), which allows to
works in the methylation of centromeric minor satellite repeats (Chen assign lineages in a phylogeny to a fixed number of different classes of
et al., 2003; Okano et al., 1999). Dnmt3b was shown to play an essential ω, without a priori specification of particular lineages (Pond and Frost,
role during mouse development, as ICF-like missense mutations in the 2005). Chromosomal localization of dnmt3 genes and their synteny
catalytic domain caused Dnmt3b partial loss of functions, and mice were determined using the Genomicus v58.01 genome browser (www.
survived but with severe abnormalities (Ueda et al., 2006). It has also dyogen.ens.fr/genomicus-58.01/).
been reported that overexpression of dnmt3b1 in mice caused loss of
imprinting and increased expression of igf2 as well as methylation and
2.2. Zebrafish tissue and egg sampling
transcriptional silencing of tumour suppressor genes (Linhart et al.,
2007). A third homologue of the Dnmt3 family, Dnmt3L, stimulates the
Ninety wild type adult male and female (sex ratio 1:2) zebrafish
catalytic activity of Dnmt3a and Dnmt3b and functions as a regulatory
were obtained from a commercial supplier (Nordland Zoosenter,
factor in germ cells (Goll and Bestor, 2005; Gowher et al., 2005).
Bodø, Norway) and maintained in 100 L aquaria at 28 °C on a 12:12
Zebrafish is one of the few non-mammalian vertebrates in which
light–dark cycle (pH 7.45). Fertilised eggs were collected after natural
DNA methylation reprogramming has been investigated. Significant
spawning and incubated at 3 different temperatures (23.1 ± 0.2 °C,
differences in genome DNA methylation status were found in zebrafish
27.1 ± 0.3 °C and 31.0±0.2 °C). Four independent pools of 25 embryos
early embryos and germ cells (MacKay et al., 2007; Mhanni and
were collected at the following developmental stages: fertilised egg, blas-
McGowan, 2004), and it has been shown that dnmt1 promotes
tula (128 cells), germ-ring, bud, 20 somites, beginning of pharyngula and
tissues-specific terminal differentiation of multiple organs (Rai et al.,
hatching (protruding mouth). The corresponding time post-fertilisation is
2006). A zebrafish homologue of the murine dnmt3 gene was first iden-
indicated in Supplementary Table S2. Additionally, brain, eye, kidney,
tified by Xie et al. (1999) and five additional dnmt3 genes, originally
heart, gill, gut, liver, spleen, ovary, testis, muscle, skin and blood were
termed dnmt4 to dnmt8, were subsequently reported (Shimoda et al.,
carefully dissected from three adult zebrafish killed by immersion in an
2005). Dnmt3 is required for neurogenesis in zebrafish and its knock-
anaesthetic bath (0.6 g·l− 1 3-aminobenzoic acid ethyl ester, Sigma).
down results in profound defects in brain and retina (Rai et al., 2010).
Blood was collected with a glass capillary from the caudal vein following
Also, dnmt7 (a dnmt3 paralogue) is known to play a specific role in
transection of the tail fin. All animal handling protocols were performed
methylation of the no tail gene (Shimoda et al., 2005).
in accordance with the guidelines recommended by the National Animal
In the present study, we describe the molecular evolution of the
Research Authority (Forsøksdyrutvalget, Norway). Embryos and tissues
dnmt3 paralogues in zebrafish and propose a revised nomenclature
were snap-frozen in liquid nitrogen and conserved at −80 °C until RNA
that more accurately reflects their phylogenetic relationship. We
extraction.
also profile the developmental expression of all dnmt3 paralogues in
zebrafish, since these genes are likely to be involved in the thermally-
induced phenotypic plasticity observed in many teleost species. 2.3. RNA extraction and cDNA synthesis

2. Material and methods
2.1. In silico analysis
Dnmt3 sequences were obtained through TBLASTN searches against
the NCBI (http://www.ncbi.nlm.nih.gov/) and Ensembl (www.ensembl.
org) nucleotide databases, using zebrafish or human protein sequences
as a query. A total of 44 complete dnmt3 coding sequences (Table 1,
Supplementary Table S1) were aligned using MUSCLE (www.drive5.
com/muscle/) and divergent regions of the alignment were selectively
removed with Gblocks (molevol.cmima.csic.es/castresana/Gblocks.html),
so as not to negatively affect the subsequent analyses. A codon alignment
was then obtained with the CodonAlign tool available at the HCV server
(http://hcv.lanl.gov/). Phylogenetic reconstructions of the dnmt3 gene
Total RNA was extracted from the above tissues and embryos as
previously reported (Fernandes et al., 2006). Ten picograms of luciferase
mRNA (Promega) were added to each embryo sample as an exogenous
standard, since the expression of housekeeping genes tends to vary
markedly during early development (Fernandes et al., 2008). Assess-
ment of RNA quality was performed by agarose gel electrophoresis
on a 1.2% (w/v) agarose gel stained with SYBR safe (Invitrogen, Oregon,
USA) and the RNA was then quantified with a Nanodrop spectropho-
tometer (Nanodrop Technologies/Saven Werner, Kristiansand, Norway).
Absorbance ratios (260/280 nm) were greater than 1.9, indicating high
purity RNA. Any contaminating genomic DNA was removed by treat-
ment with the gDNA wipeout buffer (Qiagen) and reverse transcriptions
were performed from 1 μg total RNA for 30 min at 42 °C using the
QuantiTect reverse transcription kit (Qiagen). The cDNAs were re-
quantified by spectrophotometry as above.

Table 1
List of specific primers used for real-time PCR.

Gene Accession Fwd sequence (5′ → 3′) Rev sequence (5′ → 3′) Size (bp) E (%) Ta

dnmt3 AB196914 GCTCAGGTGCTGCTTTTTGTC TTTTTGAATCTGTGCTTTGCTG 152 93 60 °C

dnmt4 AB196915 CGTGTTGCCAAGTTCGGG ATCCTCTTTGCCATTCATCA 105 91 60 °C
dnmt5 AB196916 CAACACACTGACAACATCAAGAG TCAATGACATCTAGCATCTCTGG 140 99 60 °C
dnmt6 AB196917 GCTAAGTTTGGTAAAGTGCGG GGATGTCCTCCTTATCATTCA 103 104 60 °C
dnmt7 AB196918 CGCTACATTGCCTCTGAGA GCCAGATGTTTCCTAGTGATG 113 107 60 °C
dnmt8 AB196919 TAGGAAAGGCTTGTTTGAGGG GCGTGAGATGTCTTTCTTGTC 157 93 60 °C
luc M15077 TCATTCTTCGCCAAAAGCACTCTG AGCCCATATCCTTGTCGTATCCC 198 98 60 °C
β2m BC062841 GCCTTCACCCCAGAGAAAGG CCCGGTTTGGATTTACATGTTG 102 95 60 °C
elfα AY422992 CTTCTCAGGCTGACTGTGC CCGCTAGCATTACCCTCC 358 90 60 °C

For each gene, its GenBank accession number, amplicon size (bp), amplification efficiency (E) and annealing temperature (Ta) are indicated.
 C. Campos et al. / Gene 500 (2012) 93–100
2.4. Semi-quantitative reverse transcription-PCR (RT-PCR)
Relative expression levels of the 6 dnmt3 paralogues were deter-
mined by RT-PCR using the qPCR primer sets indicated on Table 1.
Beta-2-microglobulin (β2m) (forward 5′-GCCTTCACCCCAGAGAAAGG;
reverse 5′-CCCGGTTTGGATTTACATGTTG) was used as reference gene
(McCurley and Callard, 2008), after experimental confirmation of the
amplicon sequence. PCR amplifications were performed on a C1000
Thermo Cycler (Bio-Rad, Norway), according to the following parame-
ters: initial denaturation for 2 min at 95 °C, 30 cycles of 15 s at 95 °C,
30 s at 58 °C and 2 min at 72 °C, followed by a final extension of 7 min
at 72 °C. Amplicons were visualised on a 1.2% agarose gel stained with
SYBR safe and the gels were photographed and analysed using the
Kodak Molecular Imaging Software v.4.0.5.
2.5. Quantitative real-time PCR (qPCR)
Specific qPCR primers were designed for the six available dnmt3
zebrafish sequences (GenBank ID: AB196914, AB196915, AB196916,
AB196917, AB196918 and AB196919) (Table 1). Whenever possible,
primers that span at least one intron/exon border were designed to
avoid amplification of potential contaminating genomic DNA, as described
by Fernandes et al. (2008). Netprimer (http://www.premierbiosoft.com/
netprimer) was used to estimate the melting temperatures of the
primers and to investigate the presence of potential dimers and hairpins.
Firefly luciferase was used as an exogenous reference gene (Pennetier et
al., 2006) to compare dnmt3 transcript levels throughout development,
since it has been shown in Atlantic halibut that expression of commonly
used housekeeping genes is not stable in this period, especially if
it encompasses maternal–zygotic transition (Fernandes et al., 2008).
In order to examine thermal plasticity effects within the same devel-
opmental stage, elongation factor 1α (eef1a) and β2m were used as
endogenous reference genes. Primer sequences, amplicon sizes and
qPCR amplification efficiencies are shown in Table 1. Quantification
of gene expression was performed by qPCR with SYBR Green chem-
istry (Qiagen) on a LightCycler® 480 (Roche), as detailed elsewhere
(Campos et al., 2010; Fernandes et al., 2008). The identity of each
amplicon was confirmed by Sanger sequencing and specificity of
qPCR reactions was evaluated by melting curve analysis (Campos et
al., 2010). Efficiencies were calculated using a 5-point standard curve
from a 5-fold dilution series (1:1 to 1:625) of pooled RNA. All samples
were run in duplicate and minus reverse transcriptase and no template
controls were included in all plates. CT values were determined using the
LightCycler® 480 software with a fluorescence threshold arbitrarily set
to 0.3. Relative expression of target genes at each temperature and de-
velopmental stage using luciferase as a standard was evaluated using
the ΔΔCT method, according to Fernandes et al. (2006). Expression
levels in fertilised eggs were used as calibrators for relative expression
calculations throughout development. For gene expression analyses
within each developmental stage, data were normalised against eef1a
and β2m expression using geometric normalisation factors obtained
from GeNorm (medgen.ugent.be/~jvdesomp/genorm), as previously
reported (Fernandes et al., 2008; Nagasawa et al., 2012). Differences in
the expression of target genes with temperature were examined by a
One-Way ANOVA with Tukey HSD post-hoc tests using the STATISTICA
8.0 statistical package (StatSoft Inc., Tulsa, USA). When the data did
not meet the normality or equal variance requirements, a Kruskal–
Wallis one-way ANOVA on ranks with a median test was performed
instead. Significance levels were set at P b 0.05.
3. Results and discussion
3.1. Molecular evolution of dnmt3 sequences in vertebrates
DNA methylation reprogramming after fertilisation is a dynamic
mechanism that is essential for vertebrate development. Dnmt3a and
95
dnmt3b play an essential role in this process, and there is evidence of
differential regulation, as well as multiple functions of their isoforms
(Chen et al., 2002).
Phylogenetic reconstruction of the dnmt3 gene family in zebrafish
using Bayesian and likelihood methods revealed that amongst the six
dnmt3 homologues, dnmt6 and dnmt8 are duplicated dnmt3a genes
whereas the other paralogues are closely related to dnmt3b (Fig. 1).
Zebrafish dnmt6 and dnmt8 are more similar to dnmt3a1 and dnmt3a2
genes from other Acanthopterygii species. It is likely that dnmt3a paralo-
gues originate from the third round of whole genome duplication that
is thought to have occurred during teleostean evolution (Jaillon et al.,
2004). The position of dnmt3a genes in this phylogenetic tree is in gen-
eral accordance with the currently accepted taxonomic relationship
between these organisms. Teleostean dnmt3b genes form two separate
clades: i) one that is evolutionarily closer to dnmt3a and includes zebra-
fish dnmt4, and ii) a larger group that is more related to mammalian
dnmt3b (Fig. 1). It is noteworthy that this latter clade comprises three
dnmt3b paralogues from zebrafish (dnmt3, dnmt5 and dnmt7) that
show little similarity with other dnmt3b genes in zebrafish (Supplemen-
tary Table S3). For example, zebrafish dnmt3 shares only 25% and 23%
identity with dnmt4 and dnmt6, respectively. Dnmt3L genes form a clear-
ly distinct cluster that is more closely related to mammalian and avian
dnmt3b than to dnmt3a (Fig. 1). Extensive homology searches against
the available Ensembl genome assemblies failed to identify dnmt3L
orthologues in fish, frogs or chicken, indicating that this gene is likely
to have arisen during mammalian evolution. The presence of dnmt3L
in eutherians and metatherians suggests that the emergence of this
gene might be associated with the evolution of genomic imprinting
(Yokomine et al., 2006).
The current naming of zebrafish dnmt3 genes is misleading, since
it is based solely on the time of their discovery. Hence, we propose
a new nomenclature system for zebrafish dnmt3 paralogues that
reflects their phylogenetic relationships. Herein after the various
zebrafish dnmt3 genes will be referred to as detailed in Table 2.
When examining ratios of non-synonymous and synonymous sub-
stitutions, GABranch analysis showed that zebrafish dnmt3 paralogues
are evolving differently (Fig. 2), consistently with the above sequence
analysis. In particular, dnmt3b3 and dnmt3b4 (dnmt3 and dnmt5) are
evolving faster than dnmt3a1, dnmt3a2, dnmt3b1 or dnmt3b2 genes
(dnmt6, dnmt8, dnmt4 and dnmt7, respectively), with overall dN/dS
values of 0.221. This substantially higher dN/dS ratio may indicate
that dnmt3b3 and dnmt3b4 are under positive selection and that the
corresponding proteins may be acquiring different functions as they
accumulate non-synonymous substitutions. Interestingly, zebrafish
Dnmt3b3 and Dnmt3b2 putative proteins have a calponin-homology
(CH) domain in their N-terminal regions (Shimoda et al., 2005), which
is absent in any other DNA methyltransferases. This domain is com-
monly found in proteins that have cytoskeletal functions and may pro-
vide an additional function to zebrafish Dnmt3b3 and Dnmt3b2.
Comparative mapping of dnmt3a and dnmt3b related genes
showed that they are in regions of conserved synteny between zebrafish
and other fish species or other vertebrates (Figs. 3A–B). Dystrobrevin,
which is involved in synapse maturation and required for normal
muscle function is located in the vicinity of dnmt3a1 in fish as well as
in mammals (Fig. 3A). In mice, it was shown that ablation of dnmt3a in
the nervous system leads to neuromuscular defects (Nguyen et al.,
2007), thus indicating a role for Dnmt3a in neuromuscular control of
motor movement. The fact that dnmt3a and dystrobrevin are closely
located across a variety of species suggests that they share common
regulatory elements. Similarly, dnmt3a1 is nearby ASXL2, which is
required to maintain the transcriptionally repressive state of homeotic
genes throughout development (Katoh, 2003) and HADHA, which is
involved in fatty acid-beta oxidation (Yang et al., 2005).
In the vicinity of zebrafish dnmt3b paralogues are genes associated
with microtubule stability (as mapre1l) and COMMD7, which associates
with the NF-kB complex and suppresses its transcriptional activity
96 C. Campos et al. / Gene 500 (2012) 93–100

Fig. 1. Phylogenetic inference on the Dnmt3 family, using Bayesian and maximum likelihood methods. Abbreviations: Bt, Bos taurus; Ci, Ciona intestinalis; Dl, Dicentrarchus labrax;
Dr, Danio rerio; Ga, Gasterosteus aculeatus; Gg, Gallus gallus; Hs, Homo sapiens; Ip, Ictalurus punctatus; Ol, Oryzias latipes; Om, Onconrhynchus mykiss; Pp, Pimephales promelas; Sa,
Sparus aurata; Ss, Salmo salar; Tn, Tetraodon nigroviridis; Tr, Takifugu rubripes and Xt, Xenopus tropicalis. Accession numbers can be found in Table 1 and Supplementary Table S1.
The scale bar indicates phylogenetic distance.

affecting cell cycle regulation (Burstein et al., 2005) (Fig. 3B). Most of
the dnmt3b related genes (dnmt3b1, dnmt3b3 and dnmt3b4) are located
on chromosome 23, except dnmt3b2 which is located in chromosome 8.
Dnmt3b3 is flanked by dnmt3b1 and dnmt3b4. The sequence similarity
between dnmt3b3 and dnmt3b4, together with the phylogenetic and
synteny analyses, strongly support that these two paralogues have
arisen from a relatively recent tandem duplication event, as also noted
by Whitlock et al. (2005).

Table 2
Proposed nomenclature for dnmt3 genes in zebrafish.

Original name Proposed nomenclature

Dnmt3 Dnmt3b3
Dnmt4 Dnmt3b1
Fig. 2. Substitution rates in Dnmt3s sequences. The ratio (ω) of nonsynonymous
Dnmt5 Dnmt3b4
(dN) to synonymous (dS) was determined using the genetic algorithm GABranch.
Dnmt6 Dnmt3a1
Nonsynonymous substitutions are higher in the dnmt3b3 and dnmt3b4. Dnmt3a1 and
Dnmt7 Dnmt3b2
dnmt3a2 show the higher synonymous substitutions rates. The scale bar indicates
Dnmt8 Dnmt3a2
phylogenetic distance as a fraction of sequence mismatches at aligned positions.
 C. Campos et al. / Gene 500 (2012) 93–100 97

Fig. 3. Partial synteny map of dnmt3a and surrounding genes. Genomic neighbourhood of dnmt3a (A) and dnmt3b (B) in D. rerio and its orthologues in Human (Homo sapiens),
mouse (Mus musculus), cow (Bos taurus), chicken (Gallus gallus), frog (Xenopus laevis), fugu (Takifugu rubripes), Tetraodon nigroviridis, stickleback (Gasterosteus aculeatus) and
medaka (Oryzias latipes) are shown. Genes are colour coded and represented by block arrows.

3.2. Expression of dnmt3 homologues in zebrafish
Dnmt3b paralogues were differentially expressed between tissues,
generally with higher expression levels in gonads, as observed for
dnmt3b2, dnmt3b3 and dnmt3b4 (Fig. 4). The prominent dnmt3
expression in ovary and testis is not surprising, since extensive de novo
methylation occurs during gametogenesis (MacKay et al., 2007). In con-
trast to other dnmt3b paralogues, dnmt3b1 was expressed at similar
levels in all tissues, except blood. Dnmt3b3 and dnmt3b4 showed the
most variable expression pattern across tissues. This is in agreement
with the fact that these two genes have similar sequences that are rather
different from all the other dnmt3 homologues in zebrafish. It is plausible
that these genes are undergoing subfunctionalisation to differentially
target specific cells/tissues. In fact, absence of Dnmt3b3 is known to
result in profound defects in zebrafish brain and retina, but organs
such as the intestine remained unaffected (Rai et al., 2010), thus
supporting the hypothesis of target specificity for this gene. Unlike
dnmt3b genes, both dnmt3a1 and dnmt3a2 were ubiquitously expressed
98 C. Campos et al. / Gene 500 (2012) 93–100
Fig. 4. Semi-quantitative expression of dnmt3 genes in zebrafish adult tissues by
RT-PCR. The expression of the dnmt3a related genes (dnmt3a1 and dnmt3a2) was
more stable across tissues than dnmt3b genes.
in all tissues examined (Fig. 4). A similar expression pattern in zebrafish
muscle, brain and ovary has recently been reported (Smith et al., 2011).
Considering their high similarity across vertebrate taxa and low dN/dS
substitution ratios, it is likely that dnmt3a genes have a more conserved
function in vertebrate physiology than dnmt3b.
3.3. Thermal plasticity of dnmt3 expression during embryonic development
External conditions like the temperature are known to influence
the developmental rate and gene expression in fish. For example,
the myogenic regulatory factor myogenin shows delayed expression
with respect to developmental stage in Takifugu rubripes embryos as
the incubation temperature increases (Fernandes et al., 2006). On
the other hand, higher embryonic temperatures at later developmen-
tal stages promoted higher foxk1 transcript levels in the same species
(Fernandes et al., 2007). Thermal plasticity of gene expression could
be observed to some extent in all dnmt3 paralogues (Figs. 5 and 6).
Similarly to what was observed in adult tissues, dnmt3a1and dnmt3a2
had a similar expression profile during development, which was different
from dnmt3b-related genes (Fig. 5).
Dnmt3a1 relative expression increased markedly during embryonic
development, with transcript levels at the protruding mouth (PM)
stage being 400 to 700 times superior to the blastula (BL) stage. Expres-
sion levels at the PM stage were significantly higher than BL and germ
ring (GR) at 27 °C and 31 °C (P b 0.05), and at 31 °C the expression
during the 20 somite stage (20S) was higher than BL (Pb 0.05). At
23 °C, dnmt3a1 expression was higher in PM than GR and bud (BU) stages
(Pb 0.05, Fig. 5, Supplementary Tables S4–S6). Significant differences
Fig. 5. Heat map representing the unsupervised hierarchical clustering analysis of dnmt3a1, dnmt3a2, dnmt3b1, dnmt3b2, dnmt3b3 and dnmt3b4 according to their expression trend
during zebrafish embryo development. Transcripts were quantitated by qPCR and normalised using luciferase as an external reference (n = 4 per treatment and stage). Expression
levels are colour-coded, with red representing the highest levels (1) and blue the lowest expression levels (0). Abbreviations are BL, blastula; GR, germ-ring; BU, bud; 20S, 20
somites; PH, start of pharyngula and PM, protruding mouth.
were observed for dnmt3a1 at the 20S and PM stages between the
embryos from 23 to 31 °C (Pb 0.05), with higher expression in the 31 °C
group. At the pharyngula (PH) stage, dnmt3a1 transcript levels were
10% and 38% higher at the intermediate temperature compared to 23 or
31 °C (pb 0.05, Fig. 6A). A similar profile was observed for dnmt3a2. At
23 °C and 31 °C, dnmt3a2 mRNA levels were higher at the PM stage
compared to GR and BU stages (Pb 0.05), and at 23 °C the expression
was also superior in PM than in BU (Pb 0.05). At 27 °C, transcript levels
were higher in PH and PM stages than in BU (Pb 0.05) (Fig. 5, Supplemen-
tary Tables S7–S9). At the (20S), significant differences were observed
with embryonic temperature, since transcript levels at 31 °C were
1.9-fold higher than expression at 23 or 27 °C (Pb 0.05, Fig. 6B). At the
PH stage, dnmt3a2 expression was significantly higher at the interme-
diate temperature and at the PM stage it was lower at 23 °C than at 27
or 31 °C (P b 0.05, Fig. 6B). Okano et al. (1999) reported that in mice,
dnmt3a methylates genes that are critical during late development or
after birth, which seems consistent with the great increase observed
in zebrafish dnmt3a expression during development.
Expression of dnmt3b-related genes was found to be more dynamic
than dnmt3a paralogues. Relative expression of dnmt3b1 at the PM
stage was significantly higher than all other stages for all temperature
groups (P b 0.05), except for BU and PH in embryos incubated at 27 °C
(Fig. 5, Supplementary Tables S10–S12). Across temperatures, expres-
sion was significantly higher at 23 °C than 27 or 31 °C during blastula-
tion and gastrulation (P b 0.05, Fig. 6C). At the BU stage, there was a
2.9-fold difference in mRNA levels between 23 and 31 °C (P b 0.05,
Fig. 6C). Dnmt3b2 transcript levels in the BL, GR and BU stages were
significantly lower than the PH and PM stages in embryos incubated
at 23 °C (P b 0.05). In the 27 °C group, expression during BL was
lower than 20S, PH and PM stages (P b 0.05) and BL had also lower
expression than BU, 20S and PM at 31 °C (Fig. 5, Supplementary Tables
S13–S15). Significant differences between incubation temperatures
were observed at the PH stage (P b 0.05) and dnmt3b2 expression at
23 or 27 °C was 1.7- and 1.9-fold higher than at 31 °C, respectively
(Fig. 5D). Dnmt3b2 is known to specifically methylate the ntl (no
tail) gene in zebrafish (Shimoda et al., 2005), but morpholino knock-
down of this gene induced no phenotypic changes. The relative
expression profiles of dnmt3b3 and dnmt3b4 during zebrafish devel-
opment were found to be quite different from all the other studied
genes (Fig. 5). These two paralogues code for proteins with similar
primary structures, which are rather different from all the others
Dnmt3 proteins in zebrafish. The general trend for dnmt3b3 was an
increase in expression from the BL to BU stages, followed by a decrease
until the PM stage. In embryos from 31 °C, significant differences were
observed between BL and BU stages, as well as between BU and PM
stages (P b 0.05). At 23 °C, BU stage expression was significantly different
from the PM stage (P b 0.05, Fig. 5, Supplementary Tables S16–S18).
Significant differences were also observed at the PH stage between
 C. Campos et al. / Gene 500 (2012) 93–100 99

Fig. 6. Relative expression of dnmt3a1 (A), dnmt3a2 (B), dnmt3b1(C), dnmt3b2 (D), dnmt3b3 (E) and dnmt3b4 (F) in zebrafish embryos incubated at 23 °C (yellow bars), 27 °C (light
green bars) or 31 °C (dark green bars). Transcript levels were determined by qPCR and normalised within each developmental stage, using eef1a and b2m as endogenous reference
genes. Error bars indicate the standard error of the mean for each treatment (n = 4). Different superscript letters indicate significant differences with embryonic temperature.
Separate analyses were performed for each gene and developmental stage. Abbreviations are BL, blastula; GR, germ-ring; BU, bud; 20S, 20 somites; PH, start of pharyngula and
PM, protruding mouth.

embryos incubated at 27 and 31 °C, as dnmt3b3 transcript levels were
1.9-fold higher at 27 °C (Fig. 6E). The profile of dnmt3b4 through de-
velopment showed that after BL its expression drops significantly re-
gardless of incubation temperature (P b 0.05, Fig. 5, Supplementary
Tables S19–S21). Within temperature groups, a significant decrease by
1.6-fold in dnmt3b4 mRNA levels was seen at the PH stage between
27 and 31 °C (P b 0.05, Fig. 6F).
During somitogenesis and tail-stage embryos, the zebrafish genome
becomes highly methylated (Martin et al., 1999). We have also found
that during somitogenesis (20S) there is a general up-regulation of
dnmt3 genes with increasing embryonic temperature. The opposite
trend could be observed at the pharyngula stage (Figs. 5 and 6). At
this stage the embryo develops its phylotypic shape and already
possesses a well-developed notochord as well a complete set of somites.
The circulatory system is formed at this stage, and the fins begin to
appear (Kimmel et al., 1995). It seems that an increase in temperature
represses expression of methyltransferases, particularly for dnmt3b-
related genes. The differential response of dnmt3 paralogues to embryonic
temperature suggests that they play different roles in thermal epigenetic
gene regulation during development.
4. Conclusions
Phylogenetic and synteny analyses revealed that dnmt6 and dnmt8
are homologues of vertebrate dnmt3a, whereas the other zebrafish
dnmt3 genes (dnmt3, dnmt4, dnmt5 and dnmt7) are homologous to
dnmt3b. Based on our data we propose a model for the origin of the
various zebrafish dnmt3 paralogues (Fig. 7). The ancestral dnmt3a
and dnmt3b genes seem to have arisen during the 2R whole genome
duplication that occurred after the emergence of urochordates and
before the radiation of jawed vertebrates (Kasahara, 2007). This
dnmt3a has probably been duplicated circa 350 Mya through the 3R
whole genome duplication that took place in the ray-finned fish lineage
before the diversification of teleosts (Ravi and Venkatesh, 2008), giving
rise to dnmt3a1 and dnmt3a2. Duplication of dnmt3b during the 3R event
produced dnmt3b2 and another dnmt3b paralogue that underwent two
100 C. Campos et al. / Gene 500 (2012) 93–100
Fig. 7. Origin of zebrafish dnmt3 genes. Ancient dnmta3 and dnmt3b diverged into
several dnmt3a and dnmt3b genes. Dnmt3 and dnmt5 were the last dnmt3b genes to
appear. 2R and 3R whole genome duplication evens are indicated by green and yellow
stars, respectively.
consecutive lineage-specific duplications to create dnmt3b1, dnmt3b3
and dnmt3b4. Unlike the other dnmt3b paralogues, dnmt3b3 and
dnmt3b4 have very similar sequences, indicating that they have arisen
from a relatively recent tandem duplication event. Whilst dnmt3a1
and dnmt3a2 show a high degree of conservation and similar expression
patterns, the four dnmt3b paralogues are more diverse and have a
different tissue distribution in adult fish, which is indicative of subfunc-
tionalisation. This is indeed the most common mechanism for preser-
vation of duplicated genes, as this partition makes the total loss of
function unlikely and increases the chances of survival (Lynch and
Force, 2000). Incubation temperature was found to influence differen-
tial expression of dnmt3 paralogues during embryonic development in
zebrafish and this effect depended on the developmental stage. Our
data support the hypothesis that dnmt3 paralogues play different
roles in thermal epigenetic regulation of early development in zebra-
fish. Further work is required to ascertain if these expression changes
induce modifications in the methylation status of key genes involved
in normal development.
Supplementary materials related to this article can be found
online at doi:10.1016/j.gene.2012.03.041.
Acknowledgments
The authors gratefully acknowledge Ms. Anusha Dhanasiri, Mr.
Arvind Sundaram and Dr. Alessia Giannetto (University of Nordland,
Norway) for their invaluable assistance during the experiments.
This work was financed by a grant from the Research Council of
Norway to J.M.O.F. (ref. 190350). C.C. was supported by a grant from
the Fundação para a Ciência e Tecnologia (ref. SFRH/BD/43633/2008),
Portugal.
References
Burstein, E., et al., 2005. COMMD proteins, a novel family of structural and functional
homologs of MURR1. J. Biol. Chem. 280, 22222–22232.
Campos, C., Valente, L.M., Borges, P., Bizuayehu, T., Fernandes, J.M., 2010. Dietary lipid
levels have a remarkable impact on the expression of growth-related genes in
Senegalese sole (Solea senegalensis Kaup). J. Exp. Biol. 213, 200–209.
Chen, T., Ueda, Y., Xie, S., Li, E., 2002. A novel Dnmt3a isoform produced from an alter-
native promoter localizes to euchromatin and its expression correlates with active
de novo methylation. J. Biol. Chem. 277, 38746–38754.
Chen, T., Ueda, Y., Dodge, J.E., Wang, Z., Li, E., 2003. Establishment and maintenance of
genomic methylation patterns in mouse embryonic stem cells by Dnmt3a and
Dnmt3b. Mol. Cell. Biol. 23, 5594–5605.
Fernandes, J.M., et al., 2006. Myogenin in model pufferfish species: comparative geno-
mic analysis and thermal plasticity of expression during early development. Comp.
Biochem. Physiol. Part D Genomics Proteomics 1, 35–45.
Fernandes, J.M., MacKenzie, M.G., Kinghorn, J.R., Johnston, I.A., 2007. FoxK1 splice variants
show developmental stage-specific plasticity of expression with temperature in the
tiger pufferfish. J. Exp. Biol. 210, 3461–3472.
Fernandes, J.M., Mommens, M., Hagen, O., Babiak, I., Solberg, C., 2008. Selection of suit-
able reference genes for real-time PCR studies of Atlantic halibut development.
Comp. Biochem. Physiol. B 150, 23–32.
Fernandes, J.M., Ruangsri, J., Kiron, V., 2010. Atlantic cod piscidin and its diversification
through positive selection. PLoS One 5, e9501.
Goll, M.G., Bestor, T.H., 2005. Eukaryotic cytosine methyltransferases. Annu. Rev. Bio-
chem. 74, 481–514.
Gowher, H., Liebert, K., Hermann, A., Xu, G.L., Jeltsch, A., 2005. Mechanism of stimula-
tion of catalytic activity of Dnmt3A and Dnmt3B DNA-(cytosine-C5)-methyltrans-
ferases by Dnmt3L. J. Biol. Chem. 280, 13341–13348.
Jaillon, O., et al., 2004. Genome duplication in the teleost fish Tetraodon nigroviridis re-
veals the early vertebrate proto-karyotype. Nature 431, 946–957.
Johnston, I.A., et al., 2009. Embryonic temperature affects muscle fibre recruitment in
adult zebrafish: genome-wide changes in gene and microRNA expression associated
with the transition from hyperplastic to hypertrophic growth phenotypes. J. Exp.
Biol. 212, 1781–1793.
Kaneda, M., et al., 2004. Essential role for de novo DNA methyltransferase Dnmt3a in
paternal and maternal imprinting. Nature 429, 900–903.
Kasahara, M., 2007. The 2R hypothesis: an update. Curr. Opin. Immunol. 19, 547–552.
Katoh, M., 2003. Identification and characterization of ASXL2 gene in silico. Int. J. Oncol.
23, 845–850.
Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., Schilling, T.F., 1995. Stages of
embryonic development of the zebrafish. Dev. Dyn. 203, 253–310.
Li, J.Y., et al., 2007. Synergistic function of DNA methyltransferases Dnmt3a and
Dnmt3b in the methylation of Oct4 and Nanog. Mol. Cell. Biol. 27, 8748–8759.
Linhart, H.G., et al., 2007. Dnmt3b promotes tumorigenesis in vivo by gene-specific de
novo methylation and transcriptional silencing. Genes Dev. 21, 3110–3122.
Lynch, M., Force, A., 2000. The probability of duplicate gene preservation by subfunc-
tionalization. Genetics 154, 459–473.
MacKay, A.B., Mhanni, A.A., McGowan, R.A., Krone, P.H., 2007. Immunological detection
of changes in genomic DNA methylation during early zebrafish development.
Genome 50, 778–785.
Martin, C.C., Laforest, L., Akimenko, M.A., Ekker, M., 1999. A role for DNA methylation in
gastrulation and somite patterning. Dev. Biol. 206, 189–205.
McCurley, A.T., Callard, G.V., 2008. Characterization of housekeeping genes in zebra-
fish: male–female differences and effects of tissue type, developmental stage and
chemical treatment. BMC Mol. Biol. 9, 102.
Mhanni, A.A., McGowan, R.A., 2004. Global changes in genomic methylation levels dur-
ing early development of the zebrafish embryo. Dev. Genes Evol. 214, 412–417.
Nagasawa, K., Lazado, C., Fernandes, J.M.O., 2012. Validation of endogenous reference
genes for qPCR quantification of muscle transcripts in Atlantic cod subjected to
different photoperiod regimes. In: Muchlisin, Z.A. (Ed.), Aquaculture, vol. 1. InTech,
Croatia, pp. 81–92.
Nguyen, S., Meletis, K., Fu, D., Jhaveri, S., Jaenisch, R., 2007. Ablation of de novo DNA
methyltransferase Dnmt3a in the nervous system leads to neuromuscular defects
and shortened lifespan. Dev. Dyn. 236, 1663–1676.
Okano, M., Bell, D.W., Haber, D.A., Li, E., 1999. DNA methyltransferases Dnmt3a and Dnmt3b
are essential for de novo methylation and mammalian development. Cell 99, 247–257.
Pennetier, S., et al., 2006. MATER protein expression and intracellular localization
throughout folliculogenesis and preimplantation embryo development in the
bovine. BMC Dev. Biol. 6, 26.
Pond, S.L., Frost, S.D., 2005. A genetic algorithm approach to detecting lineage-specific
variation in selection pressure. Mol. Biol. Evol. 22, 478–485.
Qiu, C., Sawada, K., Zhang, X., Cheng, X., 2002. The PWWP domain of mammalian DNA
methyltransferase Dnmt3b defines a new family of DNA-binding folds. Nat. Struct.
Biol. 9, 217–224.
Rai, K., et al., 2006. Zebra fish Dnmt1 and Suv39h1 regulate organ-specific terminal dif-
ferentiation during development. Mol. Cell. Biol. 26, 7077–7085.
Rai, K., et al., 2007. Dnmt2 functions in the cytoplasm to promote liver, brain, and
retina development in zebrafish. Genes Dev. 21, 261–266.
Rai, K., et al., 2010. Dnmt3 and G9a cooperate for tissue-specific development in zebra-
fish. J. Biol. Chem. 285, 4110–4121.
Ravi, V., Venkatesh, B., 2008. Rapidly evolving fish genomes and teleost diversity. Curr.
Opin. Genet. Dev. 18, 544–550.
Reik, W., 2007. Stability and flexibility of epigenetic gene regulation in mammalian
development. Nature 447, 425–432.
Shimoda, N., Yamakoshi, K., Miyake, A., Takeda, H., 2005. Identification of a gene required
for de novo DNA methylation of the zebrafish no tail gene. Dev. Dyn. 233, 1509–1516.
Smith, T.H., Collins, T.M., McGowan, R.A., 2011. Expression of the dnmt3 genes in zebrafish
development: similarity to Dnmt3a and Dnmt3b. Dev. Genes Evol. 220, 347–353.
Ueda, Y., Okano, M., Williams, C., Chen, T., Georgopoulos, K., Li, E., 2006. Roles for
Dnmt3b in mammalian development: a mouse model for the ICF syndrome. Devel-
opment 133, 1183–1192.
Whitlock, K.E., Smith, K.M., Kim, H., Harden, M.V., 2005. A role for foxd3 and sox10 in
the differentiation of gonadotropin-releasing hormone (GnRH) cells in the zebra-
fish Danio rerio. Development 132, 5491–5502.
Xie, S., et al., 1999. Cloning, expression and chromosome locations of the human
DNMT3 gene family. Gene 236, 87–95.
Yang, S.-Y., He, X.-Y., Schulz, H., 2005. 3-Hydroxyacyl-CoA dehydrogenase and short chain 3-
hydroxyacyl-CoA dehydrogenase in human health and disease. FEBS J. 272, 4874–4883.
Yokomine, T., Hata, K., Tsudzuki, M., Sasaki, H., 2006. Evolution of the vertebrate
DNMT3 gene family: a possible link between existence of DNMT3L and genomic
imprinting. Cytogenet. Genome Res. 113, 75–80.