NORDIC JOURNAL OF

BOTANY
Research
The population genetic diversity and pattern of Pteroceltis
tatarinowii, a relic tree endemic to China, inferred from
SSR markers

Jia-Jia Fan, Xiao-Ping Zhang, Kang Liu, Hui-Jun Liu, Li Zhang, Xiao-Ping Wang and Xiao-Hong Li

J.-J. Fan (http://orcid.org/0000-0002-3306-0726), X.-P. Zhang, K. Liu, H.-J. Liu, L. Zhang and X.-H. Li (lxh79668@ahnu.edu.cn), College of Life
Sciences, Anhui Normal Univ., Wuhu, P. R. China. X-PZ also at: The Key Laboratory of Biotic Environment and Ecological Safety in Anhui Province, Anhui
Normal Univ., Wuhu, P. R. China. X-HL also at: The Key Laboratory of Conservation and Employment of Biological Resources of Anhui, Anhui Normal
Univ., Wuhu, P. R. China. – X.-P. Wang, National Conservation of Snake Island and Laotieshan Mt, Dalian, P. R. China.

Nordic Journal of Botany
2019: e01922
doi: 10.1111/njb.01922
Subject Editor: Patrik Mráz
Editor-in-Chief: Torbjörn Tyler
Accepted 19 November 2018
Pteroceltis tatarinowii (Cannabaceae), a relic tree endemic to China, is mainly
distributed in limestone mountains and has a wide geographical range. In this study,
12 microsatellite primer pairs were assayed to analyse the genetic pattern and gene flow
among 461 individuals sampled from 23 wild populations of P. tatarinowii. A high
level of genetic diversity was detected based on high values of total alleles (159), the
number of alleles (NA = 6.373), expected heterozygosity (HE = 0.696) and observed
heterozygosity (HO = 0.679). The high genetic diversity in this species may be attributed
to its long-life history, wide geographical distribution and wind dispersal. Only low
genetic differentiation (GST = 0.137, FST = 0.138) was found among populations.
Gene flow (migrants per generation, Nm) was estimated to be 1.56. This moderate
level of gene flow possibly decrease interpopulation differentiation by buffering against
genetic drift and improving gene exchange. However, spatial genetic structure was
detected throughou the sampled range of the species (r = 0.311, p < 0.05) as well as in
southern China (r = 0.453, p < 0.05), and may be related to terrain heterogeneity and
the demographic history of P. tatarinowii. The east-west high mountains of southern
China might serve as physical barriers to seed and pollen flow. The isolation and local
adaptation of different refugia may further limit gene flow. In addition, geographically
remote populations might fail to effectively disperse pollen and seeds. Based on the
above-mentioned results, some suggestions for the conservation of the species are
presented.

Keywords: Pteroceltis tatarinowii, simple sequence repeat (SSR), genetic diversity,

population structure, gene flow

Introduction
Pteroceltis tatarinowii Maxim. is a species of a monotypic species of Cannabaceae that
used to be included in Ulmaceae (Sytsma  et  al. 2002, Fu  et  al. 2003). The species
is diploid with 2n = 2x = 18 (Zhang  et  al. 2015). This deciduous tree is distributed
––––––––––––––––––––––––––––––––––––––––
© 2018 College of Life Sciences, Anhui Normal University.
www.nordicjbotany.org Nordic Journal of Botany © 2018 Nordic Society Oikos

1
in infertile limestone habitats throughout mainland China,
excluding the Tibetan Plateau and Himalayan mountains,.
The broad occurrence of P. tatarinowii indicates a high
tolerance to water and nutrition limitation. Therefore,
P. tatarinowii is an ideal pioneer tree for soil and water
conservation and greening programmes (Li  et  al. 1996), as
have been applied in Shitai County in Anhui Province and
have had a significant effect on limestone geology (Cao 2014).
Importantly, the bark of P. tatarinowii is the main raw material
for manufacturing Xuan paper, a product included in the
world’s Intangible Cultural Heritage (Cao 2012). However,
due to habitat destruction and overexploitation, the decline
and fragmentation of natural populations of P. tatarinowii are
becoming increasingly serious. Therefore, it is necessary to
take urgent effective measures to protect this unique species.
The main concern of conservation genetics is to clarify
the genetic diversity and distribution pattern of endangered
and endemic species in order to decrease the risk of genetic
loss (Frankham  et  al. 2002). Knowledge about the genetic
differentiation and structure of P. tatarinowii is vital for its
protection and to make better use of it as a natural resourse.
Several surveys of the genetic diversity and structure of
P. tatarinowii have gradually accumulated. These included
different geographical ranges and different types of markers,
including chloroplast DNA sequence variation (Li  et  al.
2012) and variation in inter simple sequence repeats (ISSRs)
(Chai et al. 2010, Li et al. 2013). In these previous studies, the
species was found to harbour relatively high levels of genetic
diversity (cpDNA: haplotype diversity = 0.71, nucleotide
diversity = 2.83 (Li. et al. 2012); ISSRs: polymorphic bands
(PPB) = 100%, I = 0.5346, H = 0.3589 (Chai  et  al. 2010);
PPB = 95.45%, I = 0.4980, H = 0.3335 (Li  et  al. 2013)),
possibly due to its long evolutionary history and broad
geographical distribution. However, these measures of
genetic differentiation were inconsistent with others based on
sequences of cpDNA and ISSRs (cpDNA: FST = 0.94; ISSR:
FST = 0.25). Conflicting results from different studies using
different markers have also been revealed in other plants,
such as Ginkgo biloba (cpDNA: FST = 0.34507, Gong et al.
2008; AFLP: FST = 0.0871, Wu et al. 2015). Due to limited
seed flow, it is frequently easier to elucidate clear geographic
patterns by using uniparental cytoplasmically inherited
markers than by using biparental genomic markers, which are
affected by gene flow from both seed and pollen. Therefore,
it is recommendabe to include both nuclear and cytoplasmic
markers to uncover and interpret potential patterns masked
by gene flow. Thus, to complement our former investigation
of P. tatarinowii based on cpDNA sequences, studies using
nuclear genomic markers are needed.
Simple sequence repeat (SSR) markers are popular and
convenient co-dominant genomic microsatellite markers
obtained by PCR (Morgante and Olivieri 1993). The evolu-
tionary rate of microsatellites is faster than that of chloroplast
DNA; therefore, microsatellites can detect recent changes
in the genetic structure among populations (Balloux  et  al.
2002). Polymorphic microsatellite DNA contains rich
2
genetic information, can be used to study the genetic struc-
ture and genetic diversity at the within-species level, and it
is more cost effective than next-generation sequencing (Gao
2005, Qiang et al. 2015).
In this study, SSR markers were used to reveal the genetic
pattern and gene flow of P. tatarinowii, with the following
specific objectives: 1) further evaluate genetic diversity;
2) elucidate the extent of genetic differentiation; and 3) clarify
genetic spatial structure and possible barriers to gene flow.
Materials and methods
Collection of materials
A total of 461 individuals from 23 populations of
P. tatarinowii were used for microsatellite analysis. The 23
populations were divided into two groups based on previousy
suggested phytogeographic divisions (Harrison et al. 2001):
13 populations are from northern China (30–42°N), and 10
belong to southern China (22–30°N) (Table 1).
DNA extraction, PCR amplification and genotyping
Total genomic DNA was extracted from silica-dried leaves
using a modified CTAB method (Doyle 1991). Then, the
DNA was amplified by the TP-M13-SSR technique (Schuelke
2000) with primer pairs that target highly polymorphic loci
(Table 2), and the forward M13 primers were labelled with
different dyes, including FAM, HEX and TAMRA. PCR
amplification was performed using a thermal cycler (Bio-Rad
Pacific Ltd., USA) under the following sequence of condi-
tions: one cycle of 5 min at 95°C; 27 cycles of 30 s at 95°C, 30
s at 50–56°C and 30 s at 72°C; 10 cycles of 30 s at 95°C, 30 s
at 53°C and 30 s at 72°C; 10 min at 72°C; and held at 4°C.
The amplification was performed in a volume of 15 μl [1.5 μl
of 10× buffer, 0.3 mM dNTPs, 3 mM MgCl2, 0.3 μM primer
pairs, 0.5 U of TaKaRa Taq polymerase (Takara Bio, Dalian)
and 1–5 ng of total DNA]. The sequencing of successfully
amplified products was performed using an ABI 3730 DNA
Analyzer (Applied Biosystems, Foster City, California, USA),
and typing was then performed by using the GeneMarker
software (ver. 2.2.0 SoftGenetics, Pennsylvania, USA).
Statistical analysis
Hardy-Weinberg equilibrium (HWE) and linkage disequi-
librium (LD) were calculated using Genepop (ver. 1.2;
Raymond and Rousset 1995) with Bonferroni’s correction.
Null alleles were identified using Micro-Checker (ver. 2.2.3;
Van Oosterhout et al. 2004). The genetic variability of each
population was estimated as the total number of alleles (NA),
expected and observed heterozygosity (HE and HO), fixation
index (FIS), allele richness (RA) and Shannon′s information
index (I) using the GenAlEx software (ver. 6.0; Peakall and
Smouse 2006). GenAlEx was also used for a principal coor-
dinates analysis (PCoA) based on individual genetic distance,
Table 1. Sample locations of P. tatarinowii.

Population code Location Longitude Latitude N

Southern China
 YF Yufeng, Guangxi 109°24′ 24°17′ 24
 LBG Lubuge, Yunnan 104°32′ 24°47′ 19
 NL Nanling, Guangdong 113°04′ 24°55′ 24
 NXS Nanxishan, Guangxi 110°16′ 25°15′ 24
 HZC Huazhangcun, Guizhou 105°31′ 25°18′ 24
 HXC Hexicun, Guizhou 106°42′ 26°21′ 20
 XN Xinning, Hunan 110°48′ 26°22′ 22
 WYS Wuyishan, Fujian 116°55′ 26°53′ 19
 YL Yuanling, Hunan 110°46′ 28°25′ 21
 ZJJ Zhangjiajie, Hunan 110°17′ 29°31′ 8
Northern China
 YHX Youhuaxiang, Anhui 118°00′ 30°40′ 24
 YA Yuanan, Hubei 111°38′ 31°3′ 9
 SNJ Shennongjia, Hubei 110°40′ 31°3′ 19
 LKS Liankangshan, Henan 114°47′ 31°39′ 23
 WX Wuxi, Chongqing 109°57′ 31°40′ 19
 LYS Langyashan, Anhui 118°17′ 32°17′ 24
 NSH Nuoshuihe, Sichuan 107°10′ 32°24′ 24
 MCS Micangshan, Sichuan 106°28′ 32°36′ 19
 YLG Yiligou, Shangxi 106°05′ 33°14 21
 DC Dongcha, Gansu 105°53′ 34°34′ 24
 QTS Qingtansi, Shandong 117°32′ 34°46′ 20
 SD Shedao, Dalian 121°0′ 38°37′ 6
 DSY Dishuiyuan, Beijing 115°31′ 39°40′ 24
Total 461

to illustrate the genetic distance among all sampled indi- (ver. 3.0; Excoffier et al. 2005). A genetic clustering analysis
viduals. The GST (coefficient of gene differentiation) was cal- was performed using the Bayesian clustering method imple-
culated using FSTAT (ver. 1.2; Goudet 1995). Analysis of mented in STRUCTURE (ver. 2.2; Pritchard  et  al. 2000).
molecular variance (AMOVA) was performed in Arlequin In addition, a phylogenetic tree was built using DISPAN
Table 2. Characteristics of 12 microsatellite loci isolated from P. tatarinowii.

Locus Sequence Ta (°C) Repeat motif Product size

QT1 F:CATATTTCCTCTTCCCCTAA 55 (CT)12A (TCT)5 225–241
R:ACAGCTCACCCATACCTTC
QT2 F:CACCTTTGCTTACTCCCTG 56 (GA)13 …(GT)8 204–250
R:AATGTACTCGCTAATGAACC
QT3 F:AGCGACTGAGGGTTTCATG 62 (GA)5…(AG)13…(GT)8 242–268
R:GCTTCTGCTCCGCCTTTCT
QT4 F:CAGGGCACTCCAATAGAATAG 60 (AG)13 242–274
R:ATGGTGCTGGGATGGGAAG
QT5 F:CATTTGGATACACCAGGAAGG 60 (CT)11 170–186
R:CAGCCATTGATGCTTAGTCC
QT6 F:TCTAGGCTGTATAAAGGGAC 54 (TC)5…(TC)12…(TC)12 226–294
R:GATGAAGTAAATGGGGAATC
QT7 F:CATGTCACCATTACCGAAC 55 (TC)19 140–166
R:ACACAGTAAGAAAACACACC
QT8 F:TGGCGATGTGAAGCCCTAAG 56 (AG)10 260–278
R:TCATTTCAACGGTCAAGATTAC
QT9 F:CAATAATAGCCTTGCATCTC 56 (TG)6…(TG)10 279–341
R:CTCCCTTTGAACAAACCTC
QT10 F:CCTGTCCAGCTACTAATTTG 56 (AT)6(GT)18 176–188
R:GTCTGCGATGGTATCTGTT
QT11 F:CAGGTCCAGAGGGAGAAAC 60 (AG)12 291–309
R:CCCAGGGTCAAATAGGTAAT
QT12 F:GCTTCCTTGGGTCTCATCC 56 (GA)9…(AG)6 343–373
R:TCCACAGACGAGTAGTTCTCC

3
(< www.softpedia.com/get/Science-CAD/DISPAN.shtml >). Table 3. The genetic diversity results of the 23 studied populations of
The formula Nm = 0.25 × (1–FST)/FST (Slatkin and Barton P. tatarinowii.
1989) was used to estimate the number of migrants between Pop I
NA RA HE Ho FIS
populations per generation and this was interpreted as the
level of gene flow. Finally, the correlation between the natu- YF 6.750 4.518 0.690 0.674 0.040 1.457
LBG 6.417 4.548 0.636 0.662 –0.046 1.389
ral logarithm of the geographical distance and genetic dis- NL 6.250 4.276 0.657 0.686 –0.049 1.370
tance of different populations was calculated using a Mantel NXS 7.500 4.922 0.715 0.714 0.012 1.571
correlation test (Mantel 1967) in the TFPGA software. HZC 7.167 4.737 0.690 0.680 0.008 1.504
The BARRIER 2.2 program (Manni and Heyer 2004) was HXC 5.250 3.874 0.639 0.730 –0.143 1.254
used to highlight geographic areas with pronounced genetic XN 6.083 4.647 0.731 0.748 –0.020 1.515
discontinuity. WYS 5.417 4.183 0.683 0.649 0.037 1.358
YL 7.333 4.951 0.743 0.794 –0.060 1.601
ZJJ 5.833 5.273 0.743 0.750 –0.005 1.544
Data deposition YHX 8.667 5.422 0.755 0.744 0.011 1.727
YA 5.333 4.756 0.728 0.657 0.090 1.461
Data is available from the Dryad Digital Repository: < https:// SNJ 6.833 4.737 0.712 0.636 0.104 1.514
doi.org/10.5061/dryad.c58539p > (Fan et al. 2018). LKS 7.917 5.200 0.752 0.696 0.077 1.670
WX 4.917 3.675 0.611 0.570 0.054 1.175
LYS 6.667 4.597 0.716 0.731 –0.014 1.503
Results NSH 6.750 4.724 0.742 0.692 0.066 1.556
MCS 6.000 4.321 0.700 0.576 0.169 1.413
Genetic diversity YLG 5.250 4.044 0.674 0.615 0.071 1.319
DC 7.750 4.813 0.734 0.697 0.049 1.582
Of the 12 loci, only a few (e.g. QT5 and QT6) deviated QTS 5.500 4.091 0.662 0.599 0.088 1.321
from Hardy-Weinberg equilibrium (HWE) in some of the SD 3.583 3.583 0.556 0.653 –0.159 1.001
DSY 7.417 5.017 0.729 0.674 0.070 1.603
populations of P. tatarinowii after Bonferroni adjustment to
Mean 6.373 4.628 0.696 0.679 0.020 1.452
p < 0.0025. No linkage disequilibrium occurred between any
loci. The test conducted using Micro-Checker indicated null
alleles at the loci QT3, QT5, QT6 and QT9 in some of the Population genetic differentiation
populations. However, no null alleles were detected when all
the sampled populations were considered. A total of 159 alleles Throughout the sampled range of the species, the coefficient of
were identified at 12 microsatellite loci in the 23 populations gene differentiation (GST = 0.137) and the results of AMOVA
of P. tatarinowii. The mean number of alleles (NA), expected (FST = 0.138) indicated that 13.82% of the genetic variation
heterozygosity (HE) and observed heterozygosity (HO) was occurs among populations, while the remaining 86.18%
6.373, 0.679 and 0.696, respectively. The number of alleles is harboured within populations. At the regional scale, the
in the 23 populations ranged from 3.583 in SD to 8.667 in genetic differentiation among populations in northern China
YHX, the expected heterozygosity ranged from 0.556 in SD to (FST = 0.130) was slightly higher than that in southern China
0.755 in YHX, and the observed heterozygosity ranged from (FST = 0.127), while the differentiation between southern and
0.570 in WX to 0.794 in YL (Table 3). Shannon’s information northern China was not significant (Table 4). The gene flow
index (I) ranged from 1.001 to 1.727, with an average value of the whole range, southern China and northern China was
of 1.452. The Shannon’s information index was highest in the 1.562, 1.719 and 1.673, respectively.
YHX population, while SD had the lowest.
Isolation by distance
Genetic structure
A Mantel test for correlation between geographic distance
The STRUCTURE, cluster (UPGMA method) and prin- and genetic distance was conducted. The result showed a low
cipal coordinates analyses (PCoA) revealed the existence of but significany correlation between geographic distance and
two major genetic groups of plants, athough with indica- genetic distance (r = 0.311, p < 0.05) (Fig. 4) in the total
tions of admixture in some of them. However, according to sample, a medium positive correlation between genetic dis-
the results presented in the STRUCTURE diagram and the tance and geographical distance in southern China (r = 0.453,
UPGMA tree, several adjacent populations were grouped p < 0.05), but no correlation in northern China (r = –0.030,
together (Fig. 1–3). Of the 10 populations from southern p > 0.05).
China, 7 (i.e., 70%) clustered together; the exceptions were In addition, a barrier analysis was performed to identify
LBG, ZJJ and WYS. Of the 13 populations from northern any barriers against ongoing gene flow among populations.
China, 7 (i.e. 53.8%) clustered together; the exceptions were This anaysis suggested six barriers were using the boot-
NXS, XN, YF, HZC, YL, NL and HXC. strapped genetic distances, as shown in Figure 5.

4
 South China North China
1.00
0.80
0.60
0.40
0.20
0.00
L

YL

YA
G

XS

TS
SD
ZC

XC

YS

G
YF

XN

SH
X
X

SY
N

ZJ

SN

LK

LY

D
LB

YL
W
YH

Q
N

W
H

M
N

D
Figure 1. STRUCTURE analysis of 23 populations of P. tatarinowii for a model with K = 2.

Discussion flow, genetic drift and geographical distribution (Nybom

Genetic diversity
A high level of genetic variation was detected across 461
individuals from 23 populations of P. tatarinowii in China,
which is consistent with the conclusion of Li et al. (2013).
The average observed heterozygosity (HO = 0.679) and
expected heterozygosity (HE = 0.696) of the 23 natural popu-
lations of P. tatarinowii are higher than the mean values for
perennial plants (HO = 0.630, HE = 0.680), cross-pollinated
plants (HO = 0.630, HE = 0.650) and mixed-pollinated plants
(HO = 0.510, HE = 0.600) (Nybom 2004).
It has been suggested that the genetic diversity of a species
results from its biological attributes and environmental fac-
tors, including evolutionary history, mating system, gene
53
70
90
58
53
80
92
91
Figure  2. UPGMA dendrogram showing genetic relationships
among the 23 populations of P. tatarinowii. The red solid lines indi-
cate the populations from southern China, and the green solid lines
indicate the populations from northern China. The numbers on the
branches denote the confidence level of genetic structure.
and Bartich 2000, Schaal et al. 2010). Li et al. (2013) pro-
posed that the high genetic diversity found in P. tatarinowii
could be the combined result of an ancient origin of the
species, high outcrossing rate, high dispersal capacity of its
wind dispersed seeds, and long life. Because P. tatarinowii is
an Oligocene relict tree (Weyland and Hermann 1937), its
long evolutionary history has allowed more time for muta-
tions and recombination. Furthermore, the wide geographi-
cal distribution covering 19 provinces and cities in China,
and the heterogeneity in habitat and climate of P. tatarinowii
populations may have contributed to increasing the genetic
diversity of this species. In addition, P. tatarinowii can repro-
duce both asexually and sexually and such species generally
have higher genetic diversity than those that reproduce only
sexually (Hamrick et al. 1992). Pteroceltis tatarinowii is mon-
oecious, and it has flowers with characteristics such as no pet-
NXS als, anthers supported by erect filaments and blossoms that
XN emerge before leaves, all of which are adaptations to the dis-
YF persal of pollen by wind, and the thin broad wings on both
HZC sides of the seeds facilitate long-distance wind dispersal (Fang
YL and Fu 2007). These characteristics shoud all facilitate gene
YHX exchange among populations, maintaining a large effective
LKS
population size and counteracting the effects of genetic drift
NL
HXC
(Glémin  et  al. 2006). Finally, as a long-lived woody plant,
there are representatives of many generations in a popula-
LYS
tion, and the replacement of generations is slow, which may
YLG
be another reason the species is able to maintain high genetic
DC
DSY
diversity (Nybom and Bartich 2000).
LBG
WYS
SD
Genetic structure and physical barriers to gene flow
QTS
Compared to the values of cross-pollinated plants
YA
(GST = 0.23, FST = 0.28), plants with anemophilous seeds
ZJJ
(GST = 0.23, FST = 0.25) and long-lived plants (GST = 0.23,
WX
FST = 0.25) (Ge  et  al. 2003), low overall genetic differen-
SNJ
tiation (GST = 0.137, FST = 0.138) was found among the 23
NSH
populations of P. tatarinowii. Instead, the genetic variation
MCS
was mostly harboured within the populations, with intra-
population and interpopulation variation accounting for
86.3% and 13.7%, respectively, of the the total variation.
Meanwhile, gene flow among populations (Nm = 1.575) was
moderate compared with that of other wind-pollinated trees
(Juglans regia: Nm = 3.01; Castanopsis sclerophylla: Nm = 2.037;

5
Figure 3. Scatterplot from principal coordinates analysis (PCoA) of individuals sampled from 23 populations of P. tatarinowii. ▲ = inside
the red outline indicates the populations from northern China, ● = inside the green outline indicates the populations from southern China.

Berchemiella wilsonii var. pubipetiolata: Nm = 0.727; Michelia
coriacea: Nm = 1.086) (Kang et al. 2008, Mohsenipoor et al.
2010, Wang et al. 2011, Zhao et al. 2012). Because of their
longevity and potential for long-distance dispersal via wind
and water, contrary to short-lived or insect-pollinated plants,
many trees have high inter-population gene flow and this can
buffer populations against the effects of genetic drift.
In general, species with limited gene flow build up
fine-scale spatial genetic structure, but there are some
exceptions in woody plants, such as balsam fir Abies
balsamea (Cinget et al. 2015). Similarly, this is also true in
P. tatarinowii. Despite contemporary gene flow, we found
a spatial genetic pattern, both throughout the sampled
range (r = 0.311, p < 0.05) and in the southern China
region (r = 0.453, p < 0.05). By combining the barrier
lines identified by our analyses and the terrain characters
in China, two possible explanations may be suggested. First,
most of the genetic barriers are located in southern China
where there are several east-west mountains, including the
Daba Mountains and Wuling Mountains which coincide
with ‘barrier line c’ and the Wuyi Mountains that corre-
sponds to ‘barrier line d’ (Fig. 5). Two main groups could
be distinguished, one with the populations MCS, NSH,
WX, SNJ, YA and SNJ and the other with YL, HXC, HZC,
XN, NXS, YF and NL. Second, the two transverse barriers
identified between the populations QTS and LBG, which
does not correspond to any high mountains, might be
indicate the location of isolated marginal refugia.
Genetically structured populations arise when gene flow
between populations is hindered by geographical, behav-
ioural or temporal barriers (Abebe et al. 2013). In addition,
geographic isolation, resulting from mountain ranges, oceans
and rivers, is often considered to play a critical role in the
genetic differentiation of plant populations (Gayden  et  al.
2013, Qiong et al. 2017). P. tatarinowii is mainly distributed
in temperate deciduous forests in northern China (30–42°
N) and subtropical laurel forests in southern China (22–30°
N) (Harrison et al. 2001, Fang and Fu 2007). Distinct east-
west high mountains are centrally distributed in southern
China, and they are likely to act as physical barriers to seed

Table 4. Analysis of molecular variance (AMOVA) in P. tatarinowii.

Variance Percentage
Regional grouping of populations Source of variation d.f. Sum of squares components of variation
Northern China Among populations 12 285.311 0.519 13.02
Within populations 499 1730.730 3.468 86.98
Southern China Among populations 9 255.981 0.597 12.73
Within populations 400 1638.280 4.096 87.27
Northern China Among groups 1 79.786 0.109 2.25
vs Among populations within groups 21 593.762 0.606 12.50
Southern China Within populations 899 3716.042 4.134 85.25
The whole region Among populations 22 673.548 0.663 13.82
Within populations 899 3716.042 4.134 86.18

6
 (A) (B) (C)
2500 r=0.3109 1500 r=0.4528 1500 r=0.0295
Geographical distance (km)

Geographical distance (km)

Geographical distance (km)

p=0.0020 p=0.0010 p=0.5230
2000
1000 1000
1500

1000
500 500
500

0 0 0
0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5 0.0 0.5 1.0 1.5
Genetic distance Genetic distance Genetic distance

Figure 4. Results from Mantel tests for correlation between geographical distance and genetic distance. (A) the whole sampling region,
(B) southern China, (C) northern China.

and pollen flow, as concluded from the results of the barrier Protection proposal and suggestions
analysis. In addition, P. tatarinowii is a relic tree whose main
refugia have been in southern China (Li et al. 2012). The iso- Knowledge of population genetic structure is beneficial
lation of, and local adaptation in, different refugia may fur- for designing conservation strategies for endangered and
ther limit gene flow. Notably, the population QTS, located endemic species. Considering the genetic data shown here,
in northern China without any nearby distinct mountains, we suggest the following considerations for conservation
appear to be separated from the other populations by bar- management of P. tatarinowii. The populations SD and WX
riers. With regard to interpopulation distance, QTS was far deserve special focus due to their low genetic diversity and
from the surrounding populations. possible loss of specific alleles. Although population SD is

Figure 5. Sample locations of P. tatarinowii and physical barriers to gene flow. ▲ = populations in northern China; ● = populations in
southern China, and the red and green colour represent the two STRUCTURE clusters. The red lines represent gene flow barriers, and
(a)–(f ) represent confidence levels. The green coarse lines represent the following mountains: ① = Taihang Mountains, ② = Qinling
Mountains, ③ = Daba Mountains, ④ = Dabie Mountains, ⑤ = Wuling Mountains, ⑥ = Xuefeng Mountains, ⑦ = Nanling Mountains,
⑧ = Wuyi Mountains.

7
a focus of the National Conservation of Snake Island, the
remaining individuals of P. tatarinowii in SD ought to be
artificially managed, including assisted seeding and improve-
ment cutting. Population WX should be subjected to in situ
conservation as soon as possible. For the isolated populations
that are separated from other populations by barriers, such
as LBG and DSY, and for QTS, which are geographically
isolated from surrounding populations, gene flow could be
artificially improved by transplanting individuals or sowing
seeds from neighbouring populations. When a programme
of ex situ conservation is implemented, sampling intensively
from one or two populations (for example, YHX and YL)
rather than using smaller collections from many different
sites can fulfil the objective of capturing most of the detected
genetic variability. In addition, because of the heavy demand
from the manufacturing of Xuan paper, artificial plantations
of P. tatarinowii may be needed to guarantee the bark sup-
ply and effectively protect wild populations as sustainable
resources.
Acknowledgements – We thank Liu Kun and Wang Ying for the field
collection work and data analysis.
Funding – This study was supported by the National Natural Science
Foundation of China (grant no. 30970292, 41401062), the Open
Fund of the National Key Laboratory of Modern Paleontology and
Stratigraphy of Nanjing Inst. of Geology and Palaeontology, Chinese
Academy of Sciences (grant no. 143115) and the Anhui Provincial
Natural Science Foundation of China (grant no. 1508085MD66).
References
Abebe T. D.  et  al. 2013. Barrier analysis detected genetic
discontinuity among Ethiopian barley (Hordeum vulgare L.)
landraces due to landscape and human mobility on gene flow.
– Genet. Resour. Crop. Evol. 60: 297–309.
Balloux, F. and Lugon-moulin, N. 2002. The estimation of popula-
tion differentiation with microsatellite markers. – Mol. Ecol.
11: 155–165.
Cao, T.-S. 2012. Probing into the idea of ‘tradition’ in traditional
manufaacture craftsmanship of Chinese Xuan paper. – Stud.
Dialect. Nat. 28: 122–126.
Cao, X.-S. 2014. Development status and cultivation techniques
of P. tatarinowii in Shitai County. – Anhui Agri. Sci. Bull.
20: 109.
Chai, X.-Y. et al. 2010. Using inter-simple sequence repeat markers
to analyze the genetic structure of natural Pteroceltis tatarinowii
populations and implications for species conservation. – Plant
Syst. Evol. 285: 65–73.
Cinget, B.  et  al. 2015. Less pollen-mediated gene flow for more
signatures of glacial lineages: congruent evidence from balsam
fir cpDNA and mtDNA for multiple refugia in eastern and
central North America. – Plos One 10: e0122815.
Doyle, J. 1991. DNA protocols for plants. – In: Hewitt, G. M. et al.
(eds), Molecular techniques in taxonomy. Springer, pp. 283–293.
Excoffier, L. et al. 2005. Arlequin (ver. 3.0): an integrated software
package for population genetics data analysis. – Evol. Bioinform.
Online 1: 47–50.
8
Fan, J. et al. 2018. Data from: The population genetic diversity and
pattern of Pteroceltis tatarinowii, a relic tree endemic to China,
inferred from SSR markers. – Dryad Digital Repository,
<https://doi.org/10.5061/dryad.c58539p>.
Fang, S.-Z. and Fu, X.-X. 2007. Pteroceltis tatarinowii Maxim. in
China. – Chinese Science and Culture Press.
Frankham R.  et  al. 2002. Introduction to conservation genetics:
glossary. – Zoologica Africana 38: 192.
Fu, L.-G. et al. 2003. Flora of China: Ulmaceae. – Science Press,
pp. 1–19.
Gao, L.-Z. 2005. Microsatellite variation within and among
populations of Oryza officinalis (Poaceae), an endangered wild
rice from China. – Mol. Ecol. 14: 4287–4297.
Gayden, T. et al. 2013. The Himalayas: barrier and conduit for gene
flow. – Am. J. Phys. Anthropol. 151: 169–182.
Ge, Y.-Q.  et  al. 2003. An ISSR analysis on population genetic
diversity of the relict plant Ginkgo biloba. – Biodivers. Sci. 11:
276–287.
Glémin, S.  et  al. 2006. Impact of mating systems on patterns of
sequence polymorphism in flowering plants. – Proc. R. Soc. B
273: 3011–3019.
Gong, W. et al. 2008. Phylogeography of a living fossil: pleistocene
glaciations forced Ginkgo biloba L. (Ginkgoaceae) into two
refuge areas in China with limited subsequent postglacial
expansion. – Mol. Phylogenet Evol. 48: 1094–1105.
Goudet, J. 1995. FSTAT ver. 1.2: a computer program to calculate
F-statistics. – J. Hered. 86: 485–486.
Hamrick, J. L.  et  al. 1992. Factors influencing levels of genetic
diversity in woody plant species. – New Forests 6: 95–124.
Harrison, S. P. et al. 2001. Palaeovegetation: diversity of temperate
plants in east Asia. – Nature 413: 129–130.
Kang, M. et al. 2008. Demographic bottlenecks and low gene flow
in remnant populations of the critically endangered Berchemiella
wilsonii var. pubipetiolata (Rhamnaceae) inferred from
microsatellite markers. – Conserv. Genet. 9: 191–199.
Li, J.-C.  et  al. 1996. Study on comprehensive exploitation and
utilization of Pteroceltis tatarinowii (Ulmaceae). – Soil Water
Conserv. China 5: 37–38.
Li, X.-H. et al. 2012. Chloroplast phylogeography of a temperate
tree Pteroceltis tatarinowii (Ulmaceae) in China. – J. Syst. Evol.
50: 325–333.
Li, X.-H.  et  al. 2013. The genetic structure of endemic plant
Pteroceltis tatarinowii by ISSR markers. – Acta Ecol. Sinica 33:
4892–4901.
Manni, F. and Heyer, E. 2004. Geographic patterns of (genetic,
morphologic, linguistic) variation: how barriers can be
detected by using Monmonier’s algorithm. – Human Biol.
76: 173–190.
Mantel, N. 1967. The detection of disease clustering and a
generalized regression approach. – Cancer Res. 27: 209–220.
Mohsenipoor, S.  et  al. 2010. Study of the genetic structure and
gene flow in Persian walnut (Juglans regia L.) using SSR markers.
– Acta Hort. 861: 133–142.
Morgante, M. and Olivieri, A. M. 1993. PCR-amplified
microsatellites as markers in plant genetics. – Plant J. 3:
175–182.
Nybom, H. 2004. Comparison of different nuclear DNA markers
for estimating intraspecific genetic diversity in plants. – Mol.
Ecol. 13: 1143–1155.
Nybom, H. and Bartich, I. V. 2000. Effects of life history traits and
sampling strategies on genetic diversity estimates obtained with
RAPD markers in plants. – Perspect. Plant Ecol. Syst. 3: 93–114.
Peakall, R. and Smouse, P. E. 2006. Genalex 6: genetic analysis in
excel. population genetic software for teaching and research.
– Mol. Ecol. Notes 6: 288–295.
Pritchard, J. K. et al. 2000. Inference of population structure from
multilocus genotype data. – Genetics 155: 945–959.
Qiang, H.-P. et al. 2015. Molecular diversity and population struc-
ture of a worldwide collection of cultivated tetraploid alfalfa
(Medicago sativa subsp. sativa L.) germplasm as revealed by
microsatellite markers. –PloS One 10: e0124592.
Qiong, L. et al. 2017. Testing the effect of the Himalayan moun-
tains as a physical barrier to gene flow in Hippophae tibetana
Schlect. (Elaeagnaceae). – PloS One 12: e0172948.
Raymond, M. and Rousset, F. 1995. Genepop (ver. 1.2): popula-
tion genetics software for exact tests and ecumenicism. – J.
Hered. 86: 248–249.
Schaal, B. A.  et  al. 2010. Phylogeographic studies in plants:
problems and prospects. – Mol. Ecol. 7: 465–474.
Schuelke, M. 2000. An economic method for the fluorescent
labeling of PCR fragments. – Nature Biotechnol. 18: 233–234.
Slatkin, M. and Barton, N. H. 1989. A comparison of three indirect
methods for estimating average levels of gene flow. – Evolution
43: 1349–1368.
Sytsma, K. J. et al. 2002. Urticalean rosids: circumscription, rosid
ancestry, and phylogenetics based on rbcL, trnL-F, and ndhF
sequences. – Am. J. Bot. 89: 1531–1546.
Van Oosterhout, C.  et  al. 2004. Micro-checker: software for
identifying and correcting genotyping errors in microsatellite
data. – Mol. Ecol. Resour. 4: 535–538.
Wang, R.  et  al. 2011. Fragmentation can increase spatial genetic
structure without decreasing pollen-mediated gene flow in a
wind-pollinated tree. – Mol. Ecol. 20: 4421–4432.
Weyland and Hermann. 1937. Beiträge zur Kenntnis der rheinischen
Tertiärflora. II. Erste Ergänzungen und Berichtigungen zur Flora
der Blätterkohle und des Polierschiefers von Rott im Siebenge-
birge. – Palaeontographica, Abt. B, Paläophytol. 83: 67–122.
Wu, Q.-K. et al. 2015. Genetic relationship of stone-used Ginkgo
biloba cultivars based on AFLP markers. – Acta Hortic. Sinica
42: 961–968.
Zhang, L. et al. 2015. Polyploidy induction of Pteroceltis tatarinowii
Maxim. – Agri. Sci. Technol. 16: 1159–1161.
Zhao, X. et al. 2012. High genetic diversity and low differentiation
of Michelia coriacea (Magnoliaceae), a critically endangered
endemic in southeast Yunnan, China. – Int. J. Mol. Sci. 13:
4396–4411.