J Appl Phycol (2007) 19:207–213

DOI 10.1007/s10811-006-9125-8

Increased activity of the non-regulated enzymes fructose-1,

6-bisphosphate aldolase and triosephosphate isomerase
in Anabaena sp. strain PCC 7120 increases
photosynthetic yield
Weimin Ma & Lanzhen Wei & Quanxi Wang &
Dingji Shi & Haibao Chen

Received: 14 June 2006 / Revised and Accepted: 26 August 2006 / Published online: 29 November 2006
# Springer Science + Business Media B.V. 2006

Abstract Non-regulated enzymes in the Calvin cycle
are generally presumed to be less important for the
regulation of photosynthetic yield. Here, to investigate
the relationship between the activity of non-regulated
enzymes and photosynthetic yield, two non-regulated
enzymes in the Calvin cycle—a rice cytosolic fructose-
1,6-bisphosphate aldolase (FBA) and a spinach chlo-
W. Ma and L. Wei contributed equally to this work.
W. Ma : L. Wei : Q. Wang : D. Shi (*)
College of Life and Environment Sciences,
Shanghai Normal University,
Shanghai 200234, People’s Republic of China
e-mail: cyanoshi@163.com
W. Ma
e-mail: cyanoma@hotmail.com
W. Ma : D. Shi
Laboratory of Photosynthesis, Institute of Botany,
Chinese Academy of Science,
Beijing 100093, People’s Republic of China
W. Ma
National Laboratory of Plant Molecular Genetics,
Institute of Plant Physiology and Ecology,
Shanghai Institutes for Biological Sciences,
Graduate School of the Chinese Academy of Sciences,
300 Fenglin Road, Shanghai 200032,
People’s Republic of China
H. Chen
State Key Laboratory of Bio-organic and Natural Products
Chemistry, Institute of Organic Chemistry,
Chinese Academy of Science,
Shanghai 200032, People’s Republic of China
roplast triosephosphate isomerase (TPI)—were cloned
and co-expressed in cells of the cyanobacterium
Anabaena sp. strain PCC 7120. The activity of FBA
and TPI and the photosynthetic yield reflected by
photosynthetic O2 evolution and cell dry weight were
measured and compared between wild-type and trans-
genic cells. Our results demonstrated that the activity of
FBA and TPI were increased in transgenic cells relative
to wild-type cells, and that activity was further increased
in a transgenic strain harboring two sets of FBA-TPI
tandem genes relative to cells containing one copy of the
FBA-TPI tandem gene. The increased activity of FBA
and TPI in Anabaena sp. strain PCC 7120 increased
photosynthetic yield, with increased activity levels
correlating closely with the degree of changes in
photosynthetic yield. This implies that the photosyn-
thetic yield is limited by the activity of the non-regulated
enzymes FBA and TPI, and that the endogenous activity
of non-regulated enzymes is not sufficient to increase
photosynthetic yield. We discuss the various roles of
FBA and TPI, and regulated and non-regulated
enzymes, in modulating photosynthetic yield.
Key words Anabaena sp. strain PCC 7120 . enzyme
activity . fructose-1,6-bisphosphate aldolase .
photosynthetic yield . triosephosphate isomerase
Abbreviations
CS control strain harboring pRL489
DHAP dihydroxyacetone phosphate
FBA fructose-1,6-bisphosphate aldolase
208
FBP fructose-1,6-bisphosphate
FBPase fructose-1,6-bisphosphatase
G-3-P D-glyceraldehyde-3-phosphate
RuBP ribulose-1,5-bisphosphate
SBPase sedoheptulose-1,7-bisphosphatase
TPI triosephosphate isomerase
TS1 transgenic strain harboring pRLFT1
TS2 transgenic strain harboring pRLFT2
WT wild-type
Introduction
The ability to improve photosynthetic carbon fixation
in higher plants and algae is a primary goal in
agricultural and environmental research. Many studies
have focused on the regulation of the Calvin cycle, a
primary pathway for carbon fixation, in order to produce
plants with increased photosynthetic yield. It has been
widely assumed that the regulated enzymes that catalyze
irreversible reactions are the major limiting factors in the
Calvin cycle (Spreitzer 1993; Hartman and Harpel
1994), whereas the remaining non-regulated enzymes
that catalyse readily-reversible reactions are present in
excess and, consequently, are ultimately unimportant
for regulation of photosynthetic carbon fixation
(Newsholme and Start 1973; Stitt 1995, 1996). How-
ever, the emphasis of this research has now shifted, due
in part to the finding that manipulating the regulated
enzymes fails to produce plants with high photosyn-
thetic yield. In addition, studies using transgenic plants
with reduced (Haake et al. 1998, 1999) or increased
(Barry et al. 1998; Kang et al. 2005) enzyme levels
have demonstrated that the non-regulated enzymes,
such as fructose-1,6-bisphosphate aldolase (FBA),
might play a significant role in regulating carbon flux
throughout the cycle. However, little information is
available regarding the relationship between the activity
of non-regulated enzymes and photosynthetic yield.
Triosephosphate isomerase (EC 5.3.1.1, TPI) and
fructose-1,6-bisphosphate aldolase (EC 4.1.2.13, FBA)
continuously catalyze the rapid and reversible ketose-
aldose isomerization of dihydroxyacetone phosphate
(DHAP) and D-glyceraldehyde-3-phosphate (G-3-P),
followed by the reversible aldol condensation of
DHAP and G-3-P to fructose-1,6-bisphosphate (FBP).
The metabolic process branches after the TPI and FBA
reactions, and the products either leave the Calvin
cycle and contribute to starch biosynthesis, or enter the
J Appl Phycol (2007) 19:207–213
ribulose-1,5-bisphosphate (RuBP) regeneration cycle.
It is believed that the rate of turnover in the Calvin
cycle is determined largely by the substrates RuBP,
G-3-P and fructose-6-bisphosphate (Fridlyand and
Scheibe 1999). Thus, it seems likely that FBA and TPI
are strategically positioned to determine the pathway
and rate of the metabolic flux in the Calvin cycle.
The aim of the present study was to investigate the
relationship between the activity of non-regulated
enzymes and the photosynthetic yield. FBA and TPI
were selected as the target enzymes because of their
important positions within the Calvin cycle. The
activity of FBA and TPI as well as the photosynthetic
yield were analyzed in the wild-type cyanobacterium
Anabaena sp. strain PCC 7120 as well as in trans-
genic strains. The results demonstrate the important
role of non-regulated enzymes in modulating photo-
synthetic yield.
Materials and methods
Culture conditions
Wild-type Anabaena 7120 (WT), transgenic Anabaena
7120 harboring pRL489 (control strain, CS), pRLFT1
(transgenic strain, TS1) and pRLFT2 (transgenic
strain, TS2) cells were cultured in BG-11 medium
(Allen 1968) buffered with Tris-HCl (5 mM, pH 8.0)
and bubbled with 2% (v/v) CO2 in air. For growth on
plates, the medium was supplemented with 15 g L−1
agar. All cultures were grown at 30°C with continuous
illumination by fluorescent lamps (60 μmol photons
m−2s−1). Transgenic strains were supplemented with
100 μg mL−1 neomycin sulfate (neo).
Construction of the shuttle expression plasmid
The pDCFAT plasmid harboring the fructose-1,6-
bisphophatase (FBPase), FBA and TPI genes and the
Ptrc promoter (Tang et al. 2001) was digested with
BamHI and ligated into the shuttle plasmid pRL489.
Standard general methods and protocols were used in
molecular cloning (Sambrook et al. 1989).
Triparental conjugative transfer
Triparental conjugative transfer was performed as
described by Elhai and Wolk (1988) with slight
modifications (Liu et al. 1999).
J Appl Phycol (2007) 19:207–213
Figure 1 Schematic de-
scribing the construction of
the shuttle expression plas-
mids pRLFT1 and pRLFT2.
PCR analysis
Total DNA was extracted from the cells of WT, CS, TS1
and TS2 according to the method of Cai and Wolk
(1990), and FBA-TPI tandem genes were PCR
amplified from total DNA of WT, CS, TS1 and TS2
using forward primer (5′–3′): (a) ATGTCTGCC
TATTGTGGTAAGTAC and reverse primer (5′–3′):
(b) TCAAGCAGCAACTTTCTTTGCTG and the fol-
lowing cycling conditions: 94°C for 5 min, then 30
cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 2 min,
and a final extension at 72°C for 10 min.
Isolation of whole cell extracts
WT and transgenic cells harboring pRL489, pRLFT1 or
pRLFT2 (A730 = 0.4 – 0.6) were harvested by centrifu-
gation at 10,000 × g for 5 min, then suspended in
209
medium A [10 mM HEPES-NaOH, 5 mM sodium
phosphate (pH 7.5), 10 mM MgCl2 and 10 mM NaCl],
supplemented with 25% glycerol. Cells were disrupted
by five 20 s pulses with a Bead-beater (Biospec, Japan)
followed by a 3 min incubation on ice. The homogenate
was centrifuged at 10,000 × g for 5 min at 4°C to
remove unbroken cells and debris. The supernatant was
immediately subjected to measurement of enzyme
activity.
Determination of enzyme activity
Enzyme activity was determined using standard
methods (Rol et al. 1949; Richards and Rutter
1961). Briefly, 1 mL reaction solution containing
100 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 μg
BSA, 8 mM DHAP and 20 μg Anabaena 7120
supernatant protein was incubated at 25°C for 10 min,
and the reaction was stopped by adding 875 μL 30%
210
Figure 2 Identification of the fructose-1,6-bisphosphate aldol-
ase–triosephosphate isomerase (FBA–TPI) tandem genes on a
1.2% agarose gel. Lanes: 1 DL2000 molecular weight marker, 2
Anabaena 7120 harboring pRL489, 3 Anabaena 7120 harbor-
ing pRLFT1, 4 Anabaena 7120 harboring pRLFT2, 5 Wild-
type Anabaena 7120, 6 negative control.
HCl and 125 μL of resorcinol thiourea reagents (0.1%
resorcinol and 0.25% thiourea in glacial acetic acid).
The mixture remained at 80°C for 10 min and was
then air-cooled to room temperature. The optical
density at 520 nm was measured for FBP formation
catalyzed by FBA and TPI with a non-incubated
control as a blank, and the reading was related to FBP
standards. Protein content was measured using the
Lowry method (Markwell et al. 1978). One unit of
activity was defined as the formation of 1 μmol FBP
per minute catalyzed by 1 mg protein.
Photosynthetic oxygen evolution
Oxygen evolution by photosynthesis was measured at
25°C with a Clark-type oxygen electrode (Hansatech,
UK), according to the method of Ma and colleagues
(2005). Cells were suspended in BG-11 medium with
a chlorophyll a concentration of 20 μg mL−1. The
NaHCO3 (10 mM final concentration) was added to
the 2 mL cell suspension 2 min prior to measurement.
The intensity of actinic light used for the measure-
ment of photosynthetic O2 evolution was 600 μmol
photons m−2s−1.
J Appl Phycol (2007) 19:207–213
Measurement of dry weight
The dry weight of WT, CS, TS1 and TS2 cells was
measured according to the method of Vonshak (1985).
Results
Cloning of a rice cytosolic FBA and a spinach
chloroplast TPI in Anabaena 7120
To clone the two non-regulated enzymes—a rice
cytosolic FBA and a spinach chloroplast TPI—in
cyanobacterium Anabaena 7120, the plasmid
pDCFAT (Tang et al. 2001) was digested with
BamHI. A ∼2 kb fragment containing the FBA and
TPI coding region was inserted into the pRL489
plasmid downstream of the strong PpsbA promoter to
generate shuttle expression plasmids pRLFT1 and
pRLFT2, which contained one set and two sets of the
FBA–TPI tandem genes, respectively (Figure 1).
Constructs were confirmed by agarose gel electro-
phoresis and direct sequencing (data not shown).
The shuttle expression plasmids pRLFT1 and
pRLFT2 were then transferred into the filamentous
heterocystous cyanobacterium Anabaena 7120 by tri-
parental conjugation transfer. Cells harboring pRLFT1
or pRLFT2 were screened by growth on neomycin-
containing medium plates (data not shown), and then
picked and cultivated in BG-11 liquid medium supple-
mented with 100 μg mL−1 neomycin.
PCR amplification of wild-type and transgenic
Anabaena 7120 cells with primers (a) and (b) (see
Materials and methods) revealed no band in WT and
CS cells, whereas the transgenic cells TS1 and TS2
each displayed a ∼2.0 kb band (Figure 2). This result
indicated that one set and two sets of tandem rice
cytosolic FBA and spinach chloroplast TPI genes
were successfully transferred into Anabaena 7120.
Effect of co-expression of tandem FBA–TPI genes
in Anabaena 7120 on enzyme activity
and photosynthetic yield
Enzyme activity
The activity of the two non-regulated enzymes, rice
cytosolic FBA and spinach chloroplast TPI, was
increased in TS1 and TS2 cells to approximately177%
J Appl Phycol (2007) 19:207–213 211

(TS1) and 259% (TS2) of the levels in WT cells

(Figure 3). In contrast, the enzyme activity in CS cells
was only slightly altered as compared with WT cells
(Figure 3). These results indicated that the one and
two set(s) of tandem rice cytosolic FBA and spinach
chloroplast TPI genes were successfully co-expressed
in transgenic Anabaena 7120, and were associated
with increased enzyme activity, with a greater
increase in TS2 than in TS1 cells.

Photosynthetic yield

O2 evolution and cell dry weight were elevated in

TS1 and TS2 cells by approximately 130% (O2
evolution of TS1), 198% (O2 evolution of TS2),
122% (dry weight of TS1) and 171% (dry weight of
TS2) of the corresponding levels in WT cells
(Figure 4a, b). By contrast, changes in the photosyn-
thetic O2 evolution and dry weight of CS cells were
much less robust relative to WT cells (Figure 4a, b).
Therefore, the photosynthetic yield reflected by
photosynthetic oxygen evolution and cell dry weight
was increased in transgenic cells compared to WT
cells, with a greater increase in the TS2 than in the Figure 4 Photosynthetic yield reflected by photosynthetic
TS1 strain. oxygen evolution (a) and dry weight of cells (b) in transgenic
Anabaena 7120 harboring pRL489 (CS), pRLFT1 (TS1) and
pRLFT2 (TS2) and wild-type Anabaena 7120 (WT). Experi-
ments were repeated at least five times and standard errors were
calculated.

The relationship between the increased activity

of the non-regulated enzymes FBA and TPI
and the elevated photosynthetic yield
in Anabaena 7120

To determine whether the elevated photosynthetic yield

Figure 3 Activity of the non-regulated enzymes FBA and TPI
in transgenic Anabaena 7120 harboring pRL489 (CS), pRLFT1
(TS1) and pRLFT2 (TS2), and wild-type Anabaena 7120 (WT).
One unit of activity (1 U) was defined as the formation of
1 μmol fructose-1,6-bisphosphate (FBP) per minute catalyzed
by 1 mg protein. Vertical bars indicate standard errors
calculated from at least five independent experiments.
in transgenic Anabaena 7120 cells was due to the
increased activity of the non-regulated enzymes FBA
and TPI, we investigated the relationship between the
increased activity levels of the non-regulated enzymes
FBA and TPI and the degree of changes to photosyn-
thetic yield in Anabaena 7120 (Figure 5). The black
and white circles depicting photosynthetic O2 activity
and cell dry weight, respectively, at various enzyme
activities (Figure 5) of the wild-type and transgenic
Anabaena 7120 strains were close to, or on, a line with
a slope of 1. These results suggest that the photosyn-
thetic yield of transgenic cells, as reflected by both O2
212
Figure 5 The relationship between the activity of the non-
regulated enzymes FBA and TPI and the elevated photosyn-
thetic yield. The line has a slope of 1 and intercepts the axes at
0%.
evolution and dry weight, is limited by the activity of
FBA and TPI present in the WT and transgenic cells.
Discussion
The Calvin cycle is the primary pathway of photosyn-
thetic carbon fixation. A major goal of photosynthesis
research is to identify the limiting steps within the cycle
in order to increase photosynthetic yield while decreas-
ing greenhouse gas emissions. Current efforts to
improve photosynthetic yield have focused largely on
regulating the catalytic enzymes of the Calvin cycle by
genetic engineering (Leegood et al. 2000), and the
emphasis of this research has concentrated primarily
on various regulated enzymes in the Calvin cycle
(Miyagawa et al. 2001; Lefebvre et al. 2005; Ma et al.
2005). However, decreased plastid FBA levels in
antisense transgenic potato lead to a dramatic decrease
in RuBP, as well as an inhibition of ambient photo-
synthesis and growth (Haake et al. 1998, 1999). In
contrast, the increased exogenous rice cytosolic FBA
and spinach chloroplast TPI activity in transgenic
Anabaena 7120 induces a significant increase in
photosynthetic yield (Figures 3, 4, and 5). Thus, current
results supported the view that the non-regulated
enzymes, catalyzing a freely reversible reaction, exert
a significant amount of control over photosynthetic
carbon flux and RuBP regeneration (Barry et al. 1998;
Haake et al. 1998, 1999; Kang et al. 2005), and also
J Appl Phycol (2007) 19:207–213
suggest that the endogenous activity of the non-
regulated enzymes, at least that of FBA and TPI, is
not sufficient to support increased photosynthetic yield.
The rice cytosolic FBA and spinach chloroplast
TPI were also individually cloned and expressed in
Anabaena 7120 cells. The activities of FBA and TPI
and the photosynthetic yield measured in a transgenic
strains harboring individual genes were much less
robust than those measured in transgenic strains
harboring the FBA–TPI tandem genes (Feng et al.,
unpublished data). This implies that the co-expression
of FBA and TPI in transgenic cells increases the activity
of both enzymes as well as the resultant photosynthetic
yield. On the other hand, we compared the individual
activity of FBA and TPI and photosynthetic yield in
transgenic Anabaena 7120 harboring the genes indi-
vidually and found that the increased activity of FBA
and resultant photosynthetic yield were much more
robust than the increased activity of TPI and resultant
photosynthetic yield (Feng et al., unpublished data). It
may be that FBA exhibits activities of both FBA and
sedoheptulose-1,7-bisphosphatase (SBPase) and thus is
more able to modulate photosynthetic yield than TPI.
Similarly, it is possible that co-expression of the FBA–
TPI tandem genes in Anabaena 7120 causes increased
activities of the regulated enzyme(s) since FBA
exhibits SBPase activity. However, the effect of co-
expression of the two non-regulated enzymes on the
activities of the regulated enzyme(s) is worthy of further
investigation.
Recent studies indicate that the increased activity
of SBPase, a regulated enzyme in the Calvin cycle, in
transgenic tobacco is not directly proportional to the
change in photosynthetic yield (Lefebvre et al. 2005).
By contrast, the current results not only demonstrate
that the increased activity of the non-regulated enzymes
FBA and TPI in the cyanobacterium Anabaena 7120
induces elevated photosynthetic yield (Figure 4a, b),
but also that the increased activity levels correlate
closely with the degree of the changes in photosyn-
thetic yield (Figure 5). On the other hand, our previous
results showed that increased activity of wheat chloro-
plastic FBPase, a regulated enzyme, in Anabaena 7120
enhanced photosynthetic yield in transgenic cells (Ma
et al. 2005). However, in that study, the increase in
photosynthetic yield was much less robust than the
increase in photosynthetic yield induced by the non-
regulated enzymes FBA and TPI in the present study
(Figure 4a, b). Taken together, the differing influences
J Appl Phycol (2007) 19:207–213
of the activity of the regulated and non-regulated
enzymes on photosynthetic yield suggest that they may
be modulated by different mechanisms.
In conclusion, the results from the present study
indicate that the increases in activity of the exogenous
non-regulated enzymes FBA and TPI in Anabaena
7120 increase the resultant photosynthetic yield and,
furthermore, the increased activity levels correlate
closely with the degree of changes in photosynthetic
yield. Taken together, these findings suggest that the
endogenous activity of non-regulated enzymes is not
sufficient to induce higher levels of photosynthetic
yield. The individual activities of FBA and TPI, and the
regulated and non-regulated enzymes from the Calvin
cycle may play different roles in regulating photosyn-
thetic yield.
Acknowledgements The authors are deeply grateful to Prof.
G.L. Tang (Institute of Organic Chemistry, Chinese Academy
of Sciences) for providing the pDCFAT plasmid and for fruitful
discussion. The authors also thank Prof. C.P. Wolk (Michigan
State University) for providing the pRL489, RP4 and pRL623
plasmids.
References
Allen MM (1968) Simple conditions for growth of unicellular
blue-green algae on plates. J Phycol 4:1–4
Barry GF, Cheikh N, Kishore GM (1998) Expression of fructose-
1, 6-bisphosphate aldolase in transgenic plants for im-
proved crops with better solids uniformity by improving
carbon availability. PCT Int Appl WO 9858069 Al 23 Dec
pp77
Cai Y, Wolk CP (1990) Use of a conditionally lethal gene in
Anabaena sp. strain PCC 7120 to select for double
recombinants and to entrap insertion sequences. J
Bacteriol 172:3138–3145
Elhai J, Wolk CP (1988) Conjugal transfer of DNA to
cyanobacteria. Methods Enzymol 167:747–754
Fridlyand LE, Scheibe R (1999) Regulation of the Calvin cycle
for CO2 fixation as an example for general control
mechanisms in metabolic cycles. Biosystems 51:79–93
Haake V, Zrenner R, Sonnerwald U, Stitt M (1998) A moderate
decrease of plastid aldolase activity inhibits photosynthe-
sis, alters the levels of sugars and starch, and inhibits
growth of potato plants. Plant J 14:147–157
Haake V, Geiger M, Walch-Liu P, Engels C, Zrenner R, Stitt M
(1999) Changes in aldolase activity in wild-type potato
plants are important for acclimation to growth irradiance
and carbon dioxide concentration, because plastid aldolase
exerts control over the ambient rate of photosynthesis
across a range of growth condition. Plant J 17:479–489
Hartman FC, Harpel MR (1994) Structure, function, regulation
and assembly of D-ribulose-1,5-bisphosphate carboxylase
oxygenase. Annu Rev Biochem 63:197–234
213
Kang R, Shi D, Cong W, Ma W, Cai Z, Ouyang F (2005)
Effects of co-expression of two higher plants genes ALD
and TPI in Anabaena sp. PCC7120 on photosynthetic CO2
fixation. Enzyme Microb Technol 36:600–604
Leegood RC, Sharkey TD, von Caemmerer S (2000) Photo-
synthesis: physiology and metabolism. Kluwer, Dordrecht,
pp 1–8
Lefebvre S, Lawson T, Fryer M, Zakhleniuk OV, Lloyd
JC, Raines CA (2005) Increased sedoheptulose-1,7-
bisphosphatase activity in transgenic tobacco plants
stimulates photosynthesis and growth from an early stage
in development. Plant Physiol 138:451–460
Liu F, Zhang H, Shi D, Shang Z, Lin C, Shao N, Peng G,
Zhang X, Zhang H, Wu J, Wang J, Xu X, Jiang Y,
Zhong Z, Zhao S, Wu M, Zeng C (1999) Construction of
shuttle expression vector of human tumor necrosis factor
alpha (hTNF-α) gene and its expression in a cyanobac-
terium, Anabaena sp. PCC 7120. Sci China (Ser C)
42:25–33
Ma W, Shi D, Wang Q, Wei L, Chen H (2005) Exogenous
expression of the wheat chloroplastic fructose-1,6-
bisphosphatase gene enhances photosynthesis in the
transgenic cyanobacterium, Anabaena PCC 7120. J Appl
Phycol 17:273–280
Markwell MAK, Haas SM, Bieber LL, Tolbert NE (1978) A
modification of the Lowry procedure to simplify protein
determination in membrane and lipoprotein samples. Anal
Biochem 87:206–210
Miyagawa Y, Tamoi M, Shigeoka S (2001) Overexpression
of a cyanobacterial fructose-1,6-/sedoheptulose-1,7-
bisphosphatase in tobacco enhances photosynthesis and
growth. Nat Biotechnol 19:965–969
Newsholme EA, Start C (1973) Regulation in metabolism.
Wiley, London
Richards OC, Rutter WJ (1961) Preparation and properties of
yeast aldolase. J Biol Chem 236:3177–3184
Rol JH, Epstein JH, Goldstein NP (1949) A photometric
method for the determination of insulin in plasma and
urine. J Biol Chem 178:839–845
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning:
a laboratory manual, 2nd ed. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY
Spreitzer (1993) Genetic dissection of Rubisco structure and
function. Annu Rev Plant Phys Plant Mol Biol 44:
411–434
Stitt M (1995) The use of transgenic plants to study the
regulation of plant carbohydrate metabolism. Aust J Plant
Physiol 22:635–646
Stitt M (1996) Metabolic regulation of photosynthesis. In:
Baker N (ed) Advances in photosynthesis, vol 3, environ-
mental stress and photosynthesis. Kluwer, Dordrecht,
pp 151–190
Tang G, Yang C, Bao J, Wang Y, Chen H, Shi D, Liu F (2001)
Co-expression of triosephosphate isomerase, fructose-1,
6-bisphosphate aldolase and fructose-1, 6-bisphosphatase
in E.coli. Acta Biochim Biophys Sinica 33:131–136
Vonshak A (1985) Culture methods and biomass produce of
algae. In: Coombs J, Hall DO, Long SP, Scurlock JMO
(eds) Techniques in bioproductivity and photosynthesis,
2nd edn, vol 15. Pergamon, Oxford, pp 196–211