Bmi2601 3 2018-Study-Guide PDF

BMI2601/001/4/2018
Contents
Learning unit 0: Welcome and Introduction
Learning unit 1: Water, pH and amino acids
Learning unit 2: Protein structure
Learning unit 3: Purifying and analysing proteins
Learning unit 4: Enzymes
Learning unit 5: Protein expression
Learning unit 6: Carbohydrates and lipids of physiological significance
Learning unit 7: Introduction to metabolism
Learning unit 8: Nutrition
Discussion forums and topics in BMI2601
Announcements
Open Rubric
BMI2601/001/4/2018
Learning unit 0
0.1 Welcome and introduction
Welcome to Clinical Biochemistry II (BMI2601). This module is offered by Unisa’s Department of Life and
Consumer Sciences.
This is an online module, which means that you will find everything you need to complete the module on this site.
Check this site regularly for updates, posted announcements and additional resources uploaded throughout the
semester.
The university’s online platform, myUnisa, allows you to:
• submit assignments (I recommend that you submit your assignment online, as this will ensure that you
receive rapid feedback and comments),
• access your official study material,
• access the Unisa Library functions,
• chat to your lecturer or to fellow students and participate in online discussion forums, and
• access a variety of learning resources.

Please take some time to familiarise yourself with the site so that you get to know where the different tools and
resources are. I will give you more information about this later in this learning unit.
Although I really encourage you study this module online, I realise that some of you do not have online access at
all, while others may have online access only from time to time. For this reason, Unisa has also supplied a
printed study pack for this module.
Your study material for this module consists of
• your prescribed textbook
• these learning units
• Tutorial Letter 101
• any other tutorial letters you may receive through the year
Details of your prescribed book are given in the “Prescribed books” menu option, which you can access on the
left-hand side of this screen, and also in Tutorial Letter 101.
Tutorial letter 101 will be posted to you, but you can also access it on this site. Do this by clicking on “Official
Study Material” in the menu on the left. Once there, select Tutorial Letter 101.
Tutorial Letter 101 is just one of the tutorial letters you will be receiving during the semester. Please read it
carefully. You will also receive further tutorial letters shortly after the due dates for submission of the
assignments; these will contain suggested solutions to the assignments.
In this learning unit, I will give you an overview of and some general information about this module. I will also tell
you more about possible study strategies, how to use myUnisa, and about the assessment in the module.
2
BMI2601/001/4/2018
Click on “Next” below to go to the next screen, where you will find more information about contact details.
0.2 Lecturer and contact details
In this section I will give you my own contact details, as well as details of the Department of Life and Consumer
Sciences at Unisa, which is the academic department that offers this module. I will also give you the university’s
contact details, as well as some information about the student support services at Unisa that you are welcome to
make use of.
Whenever you contact the university, whether in writing or telephonically, always provide the module code and
your student number.
If you write to Unisa, you may enclose more than one letter in an envelope, but do not direct enquiries to different
departments (e.g. Despatch and Library Services) in the same letter, as this will cause a delay in the replies to
your enquiries. Please write a separate letter to each department and mark each letter clearly for the attention of
that department. You may not include letters to lecturers together with assignments.
0.2.1 Lecturer and department
Lecturer:
Mr M H Mkhombo
Telephone number: +27 11 471 2237 (during office hours 8:00–16:00)
E-mail address: mkhommf@unisa.ac.za
Postal address:
The Lecturer (BMI2601)
Department of Life and Consumer Sciences
Private Bag X6
Florida
1710
The department offering this module is the Department of Life and Consumer Sciences.
Telephone number (Departmental Secretary): +27 11 471 2230
Fax number: +27 11 471 2796
0.2.2 University
If you need to contact the university about matters not related to the content of this module, consult my Studies
@ Unisa, which you received with your study pack. This brochure contains information on how to contact the
university (e.g. to whom you can write for different queries, important telephone and fax numbers, addresses and
details of the opening and closing times of particular facilities).
3
BMI2601/001/4/2018
You can also make use of the following contact routes:
• Unisa website: http://www.unisa.ac.za & http://mobi.unisa.ac.za

• E-mail (general enquiries): info@unisa.ac.za
International students are urged to make use of the e-mail address info@unisa.ac.za
• study-info@unisa.ac.za for enquiries related to application and registration
• assign@unisa.ac.za for assignment enquiries
• exams@unisa.ac.za for examination enquiries
• despatch@unisa.ac.za for study material enquiries
• finan@unisa.ac.za for student account enquiries
• myUnisaHelp@unisa.ac.za for assistance with myUnisa
• myLifeHelp@unisa.ac.za for assistance with myLife e-mail accounts
• SMS 32695 – South Africa only
You will receive an auto response SMS with the various SMS options. The cost per SMS is R1,00.
• Fax 012 429 4150
0.2.3 Student support services
For information about the various student support systems and services available at Unisa (e.g. student
counselling, tutorial classes, language support), consult my Studies @ Unisa.
• Fellow students
It is always a good idea to have contact with fellow students. You can do this using the Discussion menu option
on myUnisa. You can also use the Discussion forum to find out whether there are students in your area who
would like to form study groups.
• Library
my Studies @ Unisa lists all the services offered by the Unisa Library.
To log in to the library web site, you need to provide your login details, i.e. your student number and your
myUnisa password, in order to access the library’s online resources and services. This will enable you to:
o request library material

o view and renew your library material
o use the library’s e-resources
• Unisa Directorate for Counselling and Career Development (DCCD)

DCCD supports prospective and registered students before, during and after their Unisa studies. There are
resources on their website (http://www.unisa.ac.za/Default.asp?Cmd=ViewContent&ContentID=15974), and also
printed booklets available to assist you with
o career advice and how to develop your employability skills

o study skills
o academic literacy (reading, writing and quantitative skills)
o assignment submission
4
BMI2601/001/4/2018
o exam preparation
• The Advocacy and Resource Centre for Students with Disabilities (ARCSWiD) You will find more
information about this centre on its web page at
http://www.unisa.ac.za/default.asp?Cmd=ViewContent&ContentID=19553. You can also contact Ms Vukati
Ndlovu on 012 441 5470.
0.3 Purpose and outcomes of this module
Biochemistry is the study of the structure, composition, chemical processes and reactions of substances in living
systems. The aim of this module is to introduce you to the chemistry of living organisms.
The purpose of the module is to enable you to identify and describe the structures and functions of some
important macromolecules found in the body, ranging from nucleic acids to proteins, carbohydrates and lipids,
and to explain, in basic terms, the processes involved in the digestion and metabolism of these biomolecules.
More specifically, after completing the module, you should be able to:
• describe the structures of amino acids and proteins
• describe basic laboratory techniques used to purify and analyse the structure of proteins
• explain how enzymes catalyse reactions
• explain how the genetic code is transcribed and translated into proteins
• identify and describe the structures and functions of some biologically important carbohydrates and
lipids
• describe how ingested molecules are digested and absorbed by the body, and the metabolic pathways
involved in their metabolism
• identify and explain the effects of a deficiency in certain nutrients and the contribution of nutrient
deficiencies to disease
The next section will give you a better idea of how the content of the module is structured and how the various
ideas expressed in the learning outcomes are related.
0.4 How the content of this module is structured
This module is an introductory course, and deals with the fundamentals of medical biochemistry. Essentially, in
this module, you will learn about how the various molecules that make up our bodies are formed and degraded,
and how energy is generated in our bodies to allow us to live and move. You will also gain an understanding of
how diseases or other abnormal conditions can result when these processes go wrong. In learning about this,
you will not only be acquiring knowledge that may be helpful in your career, but you will also come to understand
how your own body functions and what is required to maintain health.
We will start out in learning unit 1 by refreshing your memory regarding some basic chemistry principles relating
to the structure of water, pH of solutions, and buffers. These aspects all play a role in the formation and
degradation of biomolecules, and so you need to understand these fundamental concepts in order to grasp the
rest of the module content. Learning unit 1 will also introduce you to the structure of amino acids. Amino acids
5
BMI2601/001/4/2018
are the building blocks of proteins, and you need to investigate their structure before exploring the structure of
proteins.
Learning units 2, 3 and 4 will focus on proteins – their structure, analysis and functions. Proteins are found in
all forms of life, from viruses to humans. Proteins such as enzymes are responsible for many of the basic
chemical reactions that occur in our bodies, and their correct functioning is essential for health. They also play a
structural role in the body and are important components of many tissues. This makes an understanding of
protein structure and function central to the study of biochemistry.
Proteins are among the most complex organic molecules, and are synthesised on the basis of genetic
instructions. In learning unit 5, we look more deeply into these fundamental processes by examining how amino
acids and proteins are produced within cells from genetic material such as DNA and RNA.
In addition to proteins, carbohydrates and lipids are the most important sources of energy for the body. In
learning units 6 and 7, we will consider some carbohydrates and lipids that are physiologically important, and
how they are metabolised within the body.
Finally, in learning unit 8, we will focus on how the body digests and absorbs all three major energy sources –
proteins, carbohydrates and lipids. Here, we will also see what the effects are of deficiencies in essential
nutrients.
You will find the title and structure of each of the learning units in the table of contents. As you will have gathered
from what I have just explained, this module aims to give you an overall picture of the most important
biomolecules and chemical reactions within the body which, when they function in the proper balances, are
responsible for health, and which may cause disease when they malfunction.
Now that you have a better idea of how the module is structured, let’s look at what your studies will involve.
0.5 Learning resources
Your main learning resources for this module will be your prescribed textbook and these learning units. These
resources will be supported by tutorial letters.
The prescribed textbook to be used in conjunction with the online material is:
Murray R.K., Bender D.A., Botham K.M., Kennelly P.J., Rodwell V.W. and Weil P.A. (2009) Harper’s Illustrated
Biochemistry, 29th edition. McGraw-Hill, USA. (ISBN: 978-0-07-176576-3).
You will find more details about the textbook in the menu option “Prescribed books” to the left of this screen, and
also in Tutorial Letter 101. If you purchase the latest edition of the textbook, you may find that the pages in the
study guide do not directly correlate to the pages in this latest edition of the textbook. However, I am sure that
you will find it easy to locate the relevant section, rather than the specific pages, in the newer textbook.
The textbook is a comprehensive guide to biochemistry. You are not required to learn everything in the textbook,
so please follow the guidelines I will be giving you in terms of what to study there. Also use the online learning
material to guide you in terms of what you need to learn. You will need to study the chapters listed at the
6
BMI2601/001/4/2018
beginning of each learning unit and any recommended reading sections. If you find a topic particularly interesting,
you are very welcome to do further reading about it.
For the sake of convenience, in the learning units we will refer to the textbook as “Murray”.
0.6 Study plan

Consult my Studies @ Unisa for suggestions about general time management and planning skills.
This is a semester module offered over 15 weeks, and requires at least 120 hours of study time. This means that
you will have to study at least 8 hours per week for this module.
Here is a suggested schedule that you could use as a guideline for studying this module.
ACTIVITY HOURS
Reading and re-reading Tutorial Letter 101 and learning unit 0 3
Skimming learning units and textbook, forming a thorough general 5
impression of the whole
First reading of learning units 1–8 and textbook (2 hours per 16
learning unit)
In-depth study of learning units 1–8: making mind maps and 64
summaries, and doing learning activities (8 hours per learning unit)
Completing 2 assignments (Note: Assignment 01 should take less 14
time than Assignment 02)
Examination revision 16
Writing the examination 2
Total 120
0.7 How should you go about studying this module?
Distance studies are unique, with particular requirements for success that you should not underestimate. Once
you have received your study material, please plan how you will approach and complete this module. You can
use the study plan in the previous section as a guideline to draw up a reasonable study schedule to guide you
through the module. Remember to take into consideration the due dates for the assignments, which I supplied in
Tutorial Letter 101 for this module.
A crucial phase in the process of understanding and learning the basics of Clinical Biochemistry is to articulate
your ideas about the principles you are learning, both orally and in writing. Only when you have tried this process
for yourself will you understand the full value of this exercise.
The assignments in this module will take the form of written work, and they should give you an idea of how well
you are progressing in terms of achieving the learning outcomes.
Work through the learning units, making use of the learning strategies explained in the sections that follow. In
each case:
• Skim through the unit and draw your own basic mind map of the content. Then expand this map as your
knowledge and understanding of the unit increases.
7
BMI2601/001/4/2018
• Make your own summary of every unit.

• Do a reflection exercise at the end of every unit. (I explain this in more detail in a later section.)
As you work through the units, build up your own study and exam preparation portfolio. This portfolio will not be
assessed, but it will be an extremely valuable tool as you complete your assignments and revise for the
examination.
What is a portfolio? A portfolio is a folder/file in which you gather and compile additional and/or summarised
information during the year as you work through the learning material.
Your portfolio should comprise:

• answers to each activity in each learning unit
• a mind map/summary of each learning unit
• your marked assignments (or a copy you made prior to submitting your assignment)
• your reflections on each learning unit
• extra reading material taken from the internet, additional books, and medical and/or scientific journals
• a new vocabulary of words or glossary of new terms in your own words
In order to ensure that you achieve the learning outcomes for this module, you can use the learning strategies
explained in the following section. After explaining these, I will also say more about managing your study time,
finding articles for further reading, and avoiding plagiarism.
0.7.1 Learning strategies you can apply: the SSS method
There are a number of strategies that can help you study, one of which is the SSS strategy. The three techniques
in the SSS strategy are
• skimming,
• scanning and outlining, and
• study-reading and active learning.
In order to help you understand what these steps involve, I will give you more details in the sections that follow.
0.7.1.1 Skimming
Skimming involves moving your eyes quickly over a piece of text in order to get a general overview of what the
text is about.
1. Page through and explore. First, read the section quickly, forming a rough idea of what it is about.
Concentrate on headings and subheadings, any words or phrases that are in bold or italic type, text in boxes,
tables and illustrations, and – in the case of a chapter or learning unit – introductions and summaries. The
outcomes for a learning unit are important. (Think of how you would page through a magazine. When starting a
new learning unit, scan it and concentrate on the concepts that catch your eye.)
2. Make a cursory survey. As you read, ask yourself: What key terms occur in this learning unit or chapter?
Stop when you identify a key term, and carefully read what is said about it. Mark it in the book or in your printed
study text. What you are trying to do is help yourself to remember the location of important information so that
you can draw on it later. The key question is: Where is it?
8
BMI2601/001/4/2018
0.7.1.2 Scanning and outlining
Scanning also involves moving your eyes quickly over a text, but in this case you are doing so to find specific key
words or specific items of information.
1. Using the key concepts you identified during skimming, scan the chapter, learning unit or section.
If you have internet access, you can find more information on skimming and scanning here:
https://www.aacc.edu/tutoring/file/skimming.pdf
2. Outline the section by starting a mind map (for the whole learning unit or chapter or for parts of it, as in starting
a summary). You are looking for items and concepts while reading the information in the section or chapter in a
more evaluative way. Reflect on relationships between concepts. The question now is: What is the main topic of
this section/unit? What are the key concepts, and how do they relate to the topic?
If you have access to the internet, you can find a great deal of information about drawing mind maps, and also
see examples. Some good sites to start with are:
• http://www.wikihow.com/Make-a-Mind-Map
• http://www.mind-mapping.co.uk/make-mind-map.htm
3. Extend your outline. Start by giving your mind map a structure. As you work through the prescribed activities
of the section or chapter, keep returning to the mind map to fill in the detail. Think about the value and meaning of
categories, concepts, and key terms.
0.7.1.3 Study-reading and active learning
1. Study-reading and completing activities. This follows directly from what you have done so far, and you
need to be careful, thorough and thoughtful. You have to make connections between the key terms and concepts
you have identified, and here the mind map and summaries are important. (Remember to include your detailed
mind map in your portfolio.) Pause while reading, consolidate what you remember, and consider how new
information fits in with the information you already have. This will give you a good representation of the whole.
Your learning will be enhanced if you are active throughout this process. Whenever you get to an activity in your
study guide, complete it in full on loose pages which you then insert in your portfolio, grouped together according
to section and learning unit. Supplement this with your own notes from your portfolio. (You do not need to submit
activities or the portfolio to your lecturer, but these are essential for exam preparation).
Further, take time to understand what you read. Note new vocabulary words. Consult a dictionary to understand
the meaning of new words, or use Google to find definitions. You could compile a page of new words and terms
and their definitions for each learning unit, and add it to your portfolio.
2. Communicate. If you have access to the internet, use the Discussions tool to raise any issues you find
difficult, or even just interesting. If you cannot find help from your fellow students, feel free to contact your
lecturer. Also respond to other students’ postings by means of the Discussions tool. Communicating with others
about what you are learning is an important part of the learning process.
9
BMI2601/001/4/2018
3. Reflect. At the end of every learning unit, reflect on what you have learnt. This involves asking yourself
questions such as:
• What are the main new insights I gained in this learning unit? (Write down two or three.)
• What did I already know and find quite easy?
• What did I find difficult? Why might I have found this difficult? What can I do to resolve these
difficulties?
• Has the new knowledge I gained perhaps changed my thinking about issues such as how the body
functions; how my own health is or should be maintained; and what the uses of biochemical knowledge might be
in my life or career? (Either write down your thoughts on this, or share them with fellow students by means of the
Discussions tool.)
Reflection has enormous potential to enhance your learning by making you aware of your individual learning
strategies and progress, of the wider context in which you can apply your learning, and also of the impact of your
learning process on yourself and your circumstances.
0.7.2 Managing your self-paced study time
As I mentioned in an earlier section, to achieve the outcomes for this module you need to devote at least 120
hours to your studies (although some of you may need a bit more time, and some slightly less). As you will have
around 15 weeks to complete a semester module, you should plan to devote at least 8 study hours per week to a
module.
Remember that if you have registered for more than one module, you need to plan time for each module.
I recommend that you draw up a study schedule or keep a diary so that you have a clear idea of the time you
have available for study. This will help you to manage your studies within the time you have available and
balance your studies with work and family life.
In Tutorial Letter 101 and on myUnisa you will find a list of due dates for various assignments. Record these in
your diary. Divide the large assignments into a series of smaller, manageable tasks, and then complete these
one at a time.
0.7.3 Finding research/scientific articles
One of the easiest ways to find scientific and scholarly articles is to use the site Google Scholar, which you can
access at http://scholar.google.com.
On this site, you will see that there is a down arrow within the search bar where you are to enter your search
terms. If you click on this arrow, you will get a menu, “Advanced Search”, which will allow you to make your
search much more specific. When you have entered your search terms and clicked on “search” (or on the icon
representing this, which is a magnifying glass), a number of web sites relating to your query will appear. The
advantage of using this portal is that you can access most journal references in this way.
Certain journals, such as Science Direct, however, can only be accessed through a tertiary academic institution
such as Unisa. To access this journal, you need to do the following:
10
BMI2601/001/4/2018
1. Go to Unisa online at http://www.unisa.ac.za/
2. Click on “Library” at the top of the page.
3. In the menu on the left-hand side of the screen, click on “Search for information resources”.
4. Follow the guidelines if you are a first-time user.
5. Click on the option “Find e-resources”.
6. Now click on “A–Z list of electronic resources”.
7. Various links for databases will now be on your screen. Click on any database to do a search. For
biochemistry we recommend clicking on Science Direct, Nature or Springer Link. (Remember, if you
choose Science Direct, you need to select S at the top, and if you choose Nature you need to select N.)
8. When you have entered one of these databases, you can search for scientific articles by typing in the
relevant keywords in the “search” box. Be very specific in terms of the keywords you use. If you type in
just one very general word, this will usually result in too much information that does not relate to the
specific topic you are looking for.
9. You will need to do some independent searches yourself, as part of your portfolio, assignments and
exam preparation. This is especially true because this is a distance education course, which needs to be
supplemented with information from internet sources.
Contact the Unisa Library if you have any difficulties or for assistance: +27 12 429 3206, or see the library
website for the local branch library's telephone number.
0.7.4 Avoiding plagiarism
Please do not try to pass off other people's work (or our learning units and study material) as your own. If you
want to incorporate other people's words and ideas or our notes in your own answers, enclose these in quotation
marks if you are quoting directly, and always acknowledge your source. Use the Harvard referencing method.
You can search for more information on this method online; a good source is
http://www.staffs.ac.uk/assets/harvard_quick_guide_tcm44-47797.pdf If you are unsure about the correct way to
acknowledge sources, contact Unisa's Library Information Desk.
Students who do not acknowledge quotations, or who plagiarise from lecture notes and outside sources, or who
copy someone else's answers may be refused permission to write the examination, or be penalised in the
assignment.
0.8 Using myUnisa
I explained the advantages of online learning in section 0.1 of this learning unit. In the sections that follow, I will
give you an orientation to using myUnisa. You will see how the Unisa menu options work, and I will draw your
11
BMI2601/001/4/2018
attention to the “rules” or “etiquette” of online communications. Finally, you will have the opportunity to try using
one of the most important tools on myUnisa, the Discussions tool.
0.8.1 The myUnisa menu options
You need to be able to use the various menu options on this course site, as they will enable you to participate
actively in the learning process.
Click on the links below to see where the various options are located.
• Learning Units: The learning units are your main learning resource in this module. They contain the
content and learning activities that you need to work through to achieve the module outcomes.
• Official Study Material. A copy of the learning units, as well as Tutorial Letter 101, will be stored as
printable pdf versions under this option.
• Announcements: From time to time I will use this facility to give you important information about this
module. You should receive e-mail notification of new announcements posted on myUnisa.
• Schedule: This tool gives you access to important dates and details about events, such as examination
dates and deadlines for your assignments. You will need this information to help you manage your time
and plan your own schedule.
• Course Contact: If you want to send me e-mails in connection with this module, use this tool to
communicate with me.
• Additional Resources: This tool allows you to access any additional learning support material that might
help you in your studies for this module. I will send an e-mail alert or announcement to inform you if I
add anything to this folder.
• Discussions: This tool allows us to hold discussions as if we were in a contact setting, and I hope that
this will give you clarity on many of the issues that students tend to struggle with. I will set up a number
of discussion forums that you can visit to discuss specific topics. There will also be a forum for students,
where you can discuss issues among yourselves, or just support one another.
• Assignments: This tool allows you to submit your assignments electronically, and to monitor your
results. If you can, please submit your assignments via myUnisa. If you do not know how to do this,
consult Tutorial Letter 101.
0.8.2 myUnisa etiquette
myUnisa is the university's online platform, where lectures and students meet, interact and participate in an
ongoing process of learning and teaching. In interacting online, always remember to be mindful of and respectful
towards your fellow students and your lecturers. The rules of polite behaviour on the internet are referred to as
netiquette – a term that means “online manners”.
12
BMI2601/001/4/2018
You can access the web sites below to learn more about netiquette.
• http://networketiquette.net/
• http://www.studygs.net/netiquette.htm
• http://www.carnegiecyberacademy.com/facultyPages/communication/netiquette.html
Please observe the rules of netiquette during your normal, everyday online communications with colleagues,
lecturers, and friends. In particular, remember to be courteous to your fellow students when using the
Discussions tool.
0.8.3 Activity 0.1: Introduce yourself
At this point, I would like you to do an activity called an ice breaker.
What is an ice breaker?
The ice breaker serves a number of purposes:
• It will help you to get to know the myUnisa online environment

• It will help you to get to know and connect with your fellow students
To do the activity, click on the “Discussions” option in the menu on the left-hand side of the screen. From here,
click on the forum “Module-related discussions”, and then on the topic “Introducing yourself”.
Once inside the topic, post a short entry in which you:
• tell us who you are and where you live;

• share what biochemistry means to you, and why you chose to study it.
Also respond to at least one posting by one of your fellow students.
0.9 Assessment in this module
Your work in this module will be assessed by the following:
• Two written assignments, which will be used to calculate a year mark that will count 30% towards your
final mark
• One written examination of 2 hours, which will count 70% towards your final mark
Please consult Tutorial Letter 101 for details about the assessment in this module. Be sure to read the following
information in the tutorial letter:
• How your assignment and exam marks will be calculated

• The due dates for and unique numbers of your assignments
• How to submit your assignments
• Examination periods, admission and marks
Tutorial Letter 101 also contains the actual assignment questions.
13
BMI2601/001/4/2018
Remember that although Tutorial Letter 101 will be sentto you, you can also access an electronic version by
using the link on this page, or else going to "Official Study Material".
I wish you well in your studies. Enjoy the course!
14
BMI2601/001/4/2018
Learning unit 1: Water, pH and amino acids
1.1 Introduction
Biochemistry is the study of biological processes within and involving living organisms. The main aim of
biochemistry is to understand all the chemical processes within cells and how they interrelate. Water is the main
chemical component in living organisms, and it plays an important role in determining the chemical environment
in which the molecules of the cell find themselves. All biologically relevant reactions occur in aqueous
environments, and so in order to understand biological processes, we need to know about the chemical and
physical properties of water. The pH of the environment is also significant, and influences the chemical properties
of biological molecules. For this reason, biological systems are buffered to maintain a constant pH.
In this learning unit we will review some basic chemistry concepts relating to the properties of water, pH and
buffers. We will also discuss the properties of the monomeric units of proteins, the amino acids.
To complete the learning unit, you will need to refer to chapters 1 to 3 in Murray.
In the text, I have included the links to some internet sources that you may find interesting and helpful.
1.2 Learning outcomes

When you have completed this learning unit, you should be able to:
 describe the properties of water

 describe the different types of bonds that are important in stabilising biomolecules
 explain the connection between pH and the acidity or alkalinity of a solution
 discuss how buffers are involved in maintaining constant pH in biological systems
 recognise the structures of the 20 amino acids, and be able to group them as polar charged, polar
uncharged and nonpolar
 describe the formation of a peptide bond
1.3 Water
Recommended reading: chapter 2, pages 7–11 in Murray.
Water has the chemical formula H2O. The water molecule has a bent geometry, with the oxygen atom in the
middle and two hydrogen atoms attached to it, with a 105 angle between the hydrogen atoms (have a look at
figure 2-1 in Murray).
Figure 1.1: The structure of water (http://en.wikipedia.org/wiki/File:Water-3D-balls.png)
15
BMI2601/001/4/2018
The oxygen atom is highly electronegative, and attracts the electrons away from the hydrogen nuclei. This results
in a net positive charge on the hydrogen atoms, and a net negative charge on the oxygen atom. Because of the
asymmetrical distribution of charge, the water molecule has a dipole moment, and is a polar molecule.
Because of its strong dipole moment, it has a high dielectric constant.
Water molecules associate with one another through hydrogen bonds. Hydrogen bonds form between a
hydrogen atom covalently bound to a highly electronegative atom, such as nitrogen, oxygen or fluorine and an
unshared electron pair on another nitrogen, oxygen or fluorine atom (you will see this illustrated in figure 1.2).
The hydrogen bond is a strong dipole–dipole attraction between two molecules, and is not a covalent bond. A
water molecule can form up to four hydrogen bonds, since it can accept two and donate two hydrogen atoms
(see figure 1.3 for an illustration). In liquid form, each water molecule forms on average 3.5 hydrogen bonds with
its neighbours.
Figure 1.2: Hydrogen bond between two water molecules (δ+ and δ- indicate a partial positive and partial
negative charge respectively) (http://commons.wikimedia.org/wiki/File:Hydrogen-bonding-in-water-2D.png)
Figure 1.3: Model showing a water molecule forming four hydrogen bonds with other water molecules
(http://commons.wikimedia.org/wiki/File:3D_model_hydrogen_bonds_in_water.svg)
Hydrogen bonding influences the properties of water and explains why its viscosity, boiling point and surface
tension are high. As the water molecule is a polar molecule, it is an ideal biological solvent, and is able to
dissolve many different types of molecules. Because of its polar nature, it is an excellent solvent for polar and
ionic substances. We say that these substances are hydrophilic – this word means “water loving”. Nonpolar
substances are insoluble in water, and we describe them as hydrophobic – this word means “water fearing”.
16
BMI2601/001/4/2018
The energy of a hydrogen bond is small compared with the energy of a covalent bond, but most biological
macromolecules, for example DNA and proteins, form numerous hydrogen bonds, and they are very important in
determining the three-dimensional structures of these macromolecules.
1.3.1 Activity 1.1

Do the following activity and add it to your portfolio.
Remember, this could serve as part of your summary to use in preparing for the exam!
Refer to your textbook, and answer the following questions.
a) Water has a high dielectric constant. What does this mean? How does this influence the ability of water
to dissolve salts?
b) Water is able to dissolve many organic molecules that are able to form hydrogen bonds. Give the names
of and draw two organic molecules that are able to form hydrogen bonds with water.
c) Why is water a polar molecule?
1.3.2 Feedback on activity 1.1
When discussing the dielectric constant of water you should have referred to the fact that water has a partial
positive charge on the hydrogens and a partial negative charge on its oxygen, and is therefore a dipole. Because
of its dipole nature, it is able to interact with charged molecules.
Your list of organic molecules able to form hydrogen bonds with water could have included alcohols, aldehydes,
ketones and amides. Molecules in this category have hydrogen covalently bound to a highly electronegative
atom, such as nitrogen, oxygen or fluorine or an unshared electron pair on another nitrogen, oxygen or fluorine
atom. This will allow them to form hydrogen bonds.
1.4 Types of bonds

A covalent bond is a chemical bond that involves the sharing of electron pairs between atoms. This is the
strongest type of bond that holds molecules together.
Noncovalent forces are weaker, but are still important in determining the structure, stability and function of
biomolecules.
There are four types of noncovalent interaction that are important in stabilising biomolecules. They are:
 hydrophobic interactions
 electrostatic interactions
 hydrogen bonding
 van der Waals forces
An example of a molecule that is held together by covalent and non-covalent interactions is the DNA double
helix. Each individual strand of DNA is held together by covalent bonds, and the two strands of the double helix
are held together by hydrogen bonds and van der Waals interactions.
17
BMI2601/001/4/2018
1.4.1 Activity 1.2

Refer to your textbook and answer the following questions.
a) Explain the difference between a covalent and a noncovalent bond.

b) Write a brief description of the four different types of noncovalent interactions.
The difference between covalent and noncovalent bonds and the different types of noncovalent bonds are
discussed in chapter 2, pages 8 and 9 of the textbook. Ensure that you described
 hydrophobic interactions
 electrostatic interactions
 hydrogen bonding
1.5 Acids and bases

Acids are proton donors and bases are proton acceptors. Given that a hydrogen atom consists of a proton and
+
one electron, a H ion is a proton. Because of this, acids have a tendency to surrender their hydrogen atoms, and
bases have a tendency to accept hydrogen atoms.
The strength of an acid or base can be determined by the extent to which it dissociates in water. A strong acid is
one that completely dissociates in water. If an acid is represented by the general formula HA, then the following
equation applies for strong acids:
𝐻𝐴 → ��+ +
��−
Hydrochloric acid (HCl) is a strong acid, and completely dissociates into anions and protons in solution. You will
+ -
not find HCl molecules in solution; they will all be in the H and Cl form.
𝐻𝐶𝑙 → ��+ +
𝐶��−
A weak acid does not completely dissociate in water. If an acid is represented by the general formula HA, the
following equation applies for weak acids (note the two-way arrow), and significant amounts of undissociated acid
-
(HA) will remain in solution. The unprotonated species (A ) of a weak acid is referred to as its conjugate base.
𝐻𝐴 ↔ ��+ +
18
BMI2601/001/4/2018
��−
Similarly, a weak base will be in equilibrium with its conjugate acid.
Refer to page 12 of the textbook for some examples of weak acids and their conjugate bases.
pH is a dimensionless measure of the relative acidity of a solution, with values ranging from 0 to 14. pH = -
+
log[H ]; in other words, pH is the negative log of the hydrogen ion concentration, and so if there are high
+ +
concentrations of H the pH will be low, and if there are low concentrations of H the pH will be high. A solution
19
BMI2601/001/4/2018
with a pH of 7 is neutral, solutions with a pH less than 7 are acidic, and solutions with a pH greater than 7 are
alkaline.
pKa is the value used to express the relative strength of acids and bases. The relative strength of bases is
expressed in terms of the pKa of their conjugate acids. The pKa value of an acidic group is the pH at which the
protonated and unprotonated species are present at equal concentrations. It therefore follows that the lower the
pKa value, the stronger the acid.
Solutions of weak acids or bases with their conjugate base or acid respectively can act as buffers. A buffer is a
solution that resists change in pH when a strong acid or base is added. A substance will buffer most effectively at
a pH similar to its pKa. Many biomolecules are weak acids or bases or have functional groups that behave as
weak acids or bases, and can therefore act as buffers.
The following web page has further information on acids and bases. You do not have to read it, but you may find
the information useful: http://www.chemguide.co.uk/physical/acidbaseeqia/acids.html
1.6 pH in biological systems

Microorganisms can generally handle a wide pH range in their external environment, although each species has
a specific pH growth range. Cellular processes, on the other hand, are highly sensitive to pH changes, and the
pH within the cell cytoplasm and extracellular fluid of animals is carefully regulated.
Buffer solutions are used to maintain constant pH. A buffer solution consists of a mixture of a weak base and its
conjugate acid. This solution is able to resist changes in pH by neutralising small quantities of added acid or
base.
−
Carbonic acid (H2CO3) and hydrogen carbonate (HCO3 ) are two important components of blood that maintain
the blood pH at 7.4. If the pH drops below 7.4, a condition called acidosis develops, and if the pH goes higher
than normal, a condition called alkalosis develops. Acidosis and alkalosis can easily be tested for by checking the
pH of the blood.
Another important buffer system is the phosphate buffer system, which is involved in maintaining the pH of
intracellular fluid. This buffering system helps to ensure that the pH in the cell is maintained at a near constant
level, allowing the enzymes in the cell to function optimally.
Buffers are also used extensively for in vitro work where the pH of a solution needs to be controlled. Read the
sections entitled, “Functional groups that are weak acids have great physiological significance”, and “Solutions of
weak acids and their salts buffer changes in pH” on pages 12 and 13 in Murray.
1.6.1 Activity 1.3
a) Explain the difference between a strong acid and a weak acid.

b) Define pKa.
20
BMI2601/001/4/2018
c) In your own words, describe how biomolecules can act as weak acids or bases.
d) How do buffers resist changes in the pH of a solution?
e) Why are buffers important in biological systems?
When discussing why buffers are important in biological systems, you should have mentioned that they maintain
the pH in the blood and in the cells (intracellular pH) at a near constant value, which is necessary in order for the
enzymes of the body to function correctly. You could also have mentioned that changes in pH can change the
ionisation of functional groups in biological molecules, which can modify their activity.
1.7 Amino acids and peptides

Amino acids are the building blocks of proteins, and also fulfil other functions within biological systems. Here are
some examples.
 Nonprotein amino acids play significant roles as metabolic intermediates.

 Many amino acids are used to synthesise other molecules, such as the neurotransmitter serotonin,
porphyrins and nucleotides.
 Short chains of amino acids can act as hormones, neuromodulators and neurotransmitters in the
human body.
There are 20 common amino acids found in all proteins. They all have a carboxylic acid group (COOH), an amino
group (NH2) with a side chain (R group) linked to the α-carbon atom (you can see this in figure 1.4). Each side
chain has unique chemical properties that determine the properties of the amino acid.
Figure 1.4: General structure of an amino acid (http://en.wikipedia.org/wiki/File:AminoAcidball.svg)
There are three major types of amino acids:
 those with nonpolar R groups,

 those with uncharged polar R groups, and
 those with charged polar R groups.
20
B M12601/001/4/2017
Refer to the tabIe below and tabIe 3-1 in Murray for a Iist of the 20 comman amino acids. Each amino acid can be
represented by a one- or three-letter abbreviation.
Although there are only 20 different amino acids within proteins, these may be chemically modified, changing
their properties. An example would be the conversion of lysine into 5-hydroxylysine.
Table 1.1: Structures of the 20 amino acids found in proteins.
Nonpolar
.
H3N-c-c
.r //0
"•"-y-c.;_o· HsN-C-C
•
H3N-c-c
,f'
H3N-c -c
'o·
• ,f' • -'/0
'o· 6H ' o· I 'o· I
CH3
/' TH2 HJC-CH
CH,CHs
I
Cll
f"l
"
C:l-f3 CH3 CH3
Glycine (Giy) Alanine (Ala) Valine(Val) Leucine (Leu) Isoleucine (lie}
H3N-C-C
• ,f'
I 'o·
YHt
Hz
$
I
Methionine (Met) Tryptophan (Trp) Phenylalanine (Phe) Proline (Pro)
Polar
•
H3N-c -c
,;!> •v
N-C-C
,f'
I 'o· I 'o·
fH2 CH
OH "'
O H CH3
Serine (Ser) Threonine (Thr) Cyotcine (Cyo)
•r
H3N-c-c
.vo -r
H3H-c-c
,f' •
HJN- -c,;_
qO
_
I 'o· I 'o· 0
CHz fHz
Q /c
NHt 0
I
/c
fHz
OH NHz 0
Tyrosine (Tyr) Asparogirle (Asn) Glutamine (Oin)
Charged
.r-c,-f' •
H3N-y-c, .
,f' .r ,f'
• -c,0•
H3N-
1 0 0
fHz
H3N-
1
fHz jHz
fHz fHz /c
Hz ?Hz o- 0
NH
H2 I
NH3• ?= NHt•
NHz
Lysine (Lys} Arginine (Arg) Histidine (Hi$) Asp rtte Acid (Asp) Glutamic Acid (Oiu)
21
BMI2601/001/4/2017
1.8 Amino acid chirality

With the exception of glycine, the α-carbon of all the amino acids is chiral. This means that the amino acids are
asymmetric, and can form two different configurations that are non-superimposable. To understand what I mean
by that, think of a left and a right hand; they are similar, but you cannot superimpose them – in other words, you
cannot lay one exactly on the other (have a look at figure 1.5 for an illustration).
Molecules that are non-superimposable mirror images are called enantiomers or stereoisomers. The two
enantiomers of each amino acid can be classified as either L or D amino acids. All the amino acids derived from
proteins in humans are L amino acids. Some D amino acids occur naturally in the walls of bacteria, and can also
be found in some peptides and antibiotics that are produced by bacteria, fungi, reptiles and other non-mammalian
species.
Figure 1.5: Two enantiomers of a generic amino acid (http://en.wikipedia.org/wiki/File:Chirality_with_hands.svg)
1.9 Amino acid charge

Amino acids can have a positive, negative or zero net charge. The carboxylic acid group and amino group of the
amino acids are ionisable, and in solution they exist in equilibrium between their charged and uncharged forms.
R-COOH ⇄ R-COO- + H+
+ +
R-NH3 ⇆ R-NH2 + H
The pKa value of the α-carboxylic acid groups for all amino acids is near 2, and so at pH values above 3.5 the
-
carboxyl group is ionised (-COO ). The pK value of the α-amino groups is approximately 9; it is therefore in its
+
ammonium form (-NH3 ) at pH values below 8. This means that at around pH 7 (physiological pH), both groups
are completely ionised, resulting in a net charge of zero (have a look at figure 1.6). Consequently, amino acids in
blood and most tissues will have a neutral net charge if their R groups are uncharged.
Molecules that have equal numbers of ionisable groups of opposite charge are called zwitterions.
22
BMI2601/001/4/2017
The R groups of some amino acids can also be ionised and will have their own pKa values. Refer to figure 3-1 on
page 20 in Murray, which shows the effect of pH on the charged state of aspartic acid.
Figure 1.6: Zwitterion form of α-amino acid at physiological pH
Because of their ionic nature the amino acids are more soluble in polar solvents, such as water, than in nonpolar
solvents. The isoelectric pH, also called the pI, is the pH at which the amino acid has no net charge.
1.9.1 Activity 1.4
a) Draw the full structures of the following tripeptide in its predominant form at pH 7: Ile-Phe-Arg.
b) In your own words, define a zwitterion.
c) What is pI, and how is it calculated for an amino acid?
To draw the structure of the tripeptide, refer to the table showing the structures of the amino acids and the
section entitled “Peptide structures are easy to draw” on page 22 of the textbook. This information should help
you draw the basic peptide structure. Once you have done that, you need to look at the ionisable groups in the
peptide. The amino group and carboxyl groups on either end of the tripeptide will be ionised at pH 7, and your
diagram should reflect this. Now for the side chains: which of the side chains can be ionised? (Which are
classified as charged?) You then need to look at the pKa value for the side chain and determine whether it will be
ionised or not at pH 7.
1.10 The R groups determine the properties of the amino acids

Each R group or side chain of an amino acid determines the amino acid’s properties. Refer to the table of amino
acids on pages 18 and 19 in Murray for the structures of the side chains.
23
BMI2601/001/4/2017
Note the following:
 The hydrophobic R groups will generally occur at the centre of a protein molecule to minimise their
interaction with water.
 Glycine is the smallest amino acid, and gives polypeptides flexibility.
 The charged amino acids can interact via ionic interactions or salt bridges.
 The other amino acid side chains also have specific properties.
Read the section “The α-R groups determine the properties of amino acids” on pages 21 and 22 of Murray.
1.10.1 Activity 1.5
a) Which amino acids have hydrophobic side chains? In a protein molecule, where would you expect to
find these amino acids: on the surface or inside? Why is this the case?
b) Why does glycine give a polypeptide chain more flexibility?
c) Which amino acids in a polypeptide chain are able to form ionic interactions?
d) Discuss some of the properties of histidine.
e) What are the properties of serine and cysteine side chains?
You will find all the answers to the questions in this activity in the section “The α-R groups determine the
properties of amino acids” on pages 21 and 22 of Murray.
1.11 Peptide bond

Amino acids can polymerise through the formation of a peptide bond to form peptides (as you can see in figure
1.7). In the formation of a peptide bond the α-carboxyl and α-nitrogen atoms join, with the elimination of a water
molecule. The resultant peptide bond has a partial double bond character.
24
BMI2601/001/4/2017
Figure 1.7: Peptide bond formation: condensation of two amino acids to form a dipeptide
(http://en.wikipedia.org/wiki/File:Peptidformationball.svg)
When amino acids are joined together by peptide bonds to form a peptide, one end of the peptide will have a free
amino group (-NH2). This is referred to as the N-terminus or N-terminal end. The other end of the peptide will
have a free carboxyl group (-COOH). This is called the C-terminal end or C-terminus (these are shown in figure
1.8). The convention for writing peptide sequences is to start with the N-terminus and end with the C-terminus.
Figure 1.8: Structure of a tetrapeptide; the N-terminal end is shown in green, and the C-terminal end is shown in
blue (http://commons.wikimedia.org/wiki/File:Tetrapeptide_structural_formulae_v.1.png)
The peptide bond is uncharged at physiological pH. Peptides, however, are charged, because their terminal
amino acids end in either a carboxyl or an amino group, and if they contain acidic or basic side chains, these may
be charged. The charge on the peptide will depend on the pH of the surroundings and the pKa values of the
dissociating groups.
Polymers consisting of two, three and many amino acid residues are referred to as dipeptides, tripeptides and
polypeptides, respectively. Peptides with fewer than 20 amino acids may be referred to as oligopeptides.
25
BMI2601/001/4/2017
Polypeptides are linear molecules, and do not form branched chains. Proteins contain one or more polypeptide
chains ranging from as few as 50 to over 4000 amino acid residues. For each position in a polypeptide, there are
100
20 possible amino acids. For a polypeptide of 100 amino acid residues, there are 20 possible combinations of
130
amino acids, yielding over 1.27 x 10 potentially unique chains. This exceeds the number of estimated atoms in
the universe. Therefore, a vast number of different protein molecules can potentially exist.
1.11.1 Activity 1.6
a) In your own words, describe the formation of a peptide bond.

b) Explain why the peptide bond has a partial double bond character.
c) Draw a picture of a peptide showing which bonds have free rotation and which bonds do not have free
rotation. This has implications when peptides and proteins fold, which is something I will say more about
in the next learning unit.
1.12 Conclusion
In summary, water is a vital solvent in biological systems, as its properties make it a unique and effective solvent.
pH is an important measure of solvents, since it can influence the ionisation state of functional groups, and
therefore the activity of biological molecules. It is therefore important that a constant pH be maintained within
living systems. This is achieved through buffering.
Proteins are essential to life, and are made up of amino acids held together by peptide bonds. In this learning unit
you were introduced to the structures of the amino acids and how the chemical environment they are in can affect
their ionisation states.
26
BMI2601/001/4/2017
Learning unit 2: Protein structure
2.1 Introduction
A protein is a macromolecule, consisting of one or more chains of amino acid residues. Proteins perform a
number of important functions within the cell, and are essential in most biological processes. They are necessary
for
 catalysing chemical reactions

 transportation of molecules across membranes
 structural elements of cells
 regulatory molecules
 synthesis of DNA and RNA molecules
 immune system elements as part of the body’s defence system
Proteins fulfil a range of functions as a result of their unique structures, and knowing about these structures can
help us understand the role that proteins play in the body. Although we know the structures of a number of
proteins, there are many more proteins that are being studied at present to give us insight into different biological
systems and processes. For structures that are known, we can use molecular docking programmes to predict
which drugs may or may not interact with key sites on a protein molecule. All this shows you how important
knowledge of protein structure is, and that this information can be applied in medicine and other fields.
This learning unit will focus on the structure of protein molecules and a number of diseases that occur as a result
of the incorrect folding of certain proteins. Alzheimer’s disease is one such example. The underlying reasons for
the protein misfolding are currently being studied in the hope that this will help us develop a treatment for this
disease.
To complete the learning unit, you will need to refer to chapter 5 in Murray.

 describe the primary, secondary, tertiary and quaternary structure of proteins

 describe the main types of secondary structural elements that can be found in proteins
 explain what forces or bonds hold each order of protein structure together
 discuss protein folding and misfolding
 discuss three diseases, namely prion disease, Alzheimer’s disease and beta-thalassemia, that occur as
a result of protein misfolding
27
BMI2601/001/4/2017
2.3 Structure of proteins

The following article contains further information on protein structure. You do not have to read it, but you may find
the information helpful: http://www.nature.com/scitable/topicpage/protein-structure-14122136
Most proteins fold into a unique three-dimensional structure. A protein structure can be classified in terms of four
levels of organisation. These are illustrated in figure 2.1. They are:
 Primary structure – the amino acid sequence of the polypeptide chain or chains
 Secondary structure – local arrangement of the polypeptide backbone with the formation of alpha
helices, beta sheets and turns
 Tertiary structure – this refers to the overall three-dimensional shape of the entire polypeptide
 Quaternary structure – if there is more than one polypeptide chain, the quaternary structure consists of a
number of chains or their subunits that are associated or arranged in a particular way.
Figure 2.1: Levels of organisation of protein structure

(http://commons.wikimedia.org/wiki/File:Main_protein_structure_levels_en.svg)
28
BMI2601/001/4/2017
I will say more about these structures in the sections that follow.
2.3.1 Primary structure
Figure 2.2: Primary structure of a protein (http://commons.wikimedia.org/wiki/File:Protein-primary-structure.png)
The primary structure of a protein is the amino acid sequence of the polypeptide chain or chains that form the
protein molecule. The sequence of a protein is determined by the DNA sequence of the gene that encodes for
the protein, which, when expressed, results in the synthesis of a protein with a specific amino acid sequence.
Insulin, a polypeptide hormone, was the first protein to be completely sequenced – this was done by Fredrick
Sanger in 1953. Since then, the amino acid sequences of thousands of proteins have been determined.
Do you remember that in the previous unit I said that when we write the sequence of a protein, we write the order
of the amino acids from the N-terminal end (the end with the free α-amino group) to the C-terminal end (the end
with the free α-carboxyl group)?
Amino acid sequence analysis is important in clinical applications, as many inherited diseases are due to
mutations that result in amino acid changes in proteins.
Proteins can be directly sequenced by the Edman reaction. Today, because we know the genome sequence of
many organisms, it is often easy to determine numerous protein sequences from the genomic sequence.
2.3.1.1 Activity 2.1
Remember that your completed activities could serve as part of your summary to use in preparing for the
exam!
Read the section, “The Edman reaction enables peptides and proteins to be sequenced” on pages 29 and 30 in
Murray, and briefly discuss the sequencing of proteins by the Edman reaction.
29
BMI2601/001/4/2017
2.3.1.2 Feedback on activity 2.1
It is important for you to understand the Edman reaction, because it is widely used to directly determine the
primary structure of proteins.
You should have provided a concise explanation of the relevant section in your textbook, using figure 4-7 in
Murray to guide you. You should also have mentioned that only chains of 5 to 30 amino acids can be sequenced
at a time, and so, in most cases, the polypeptides (proteins) must first be cleaved into smaller peptides. Once the
sequences of these peptides have been determined, these sequences can be joined together to generate the
entire sequence of the polypeptide.
2.3.2 Secondary structure

The secondary structure of a protein refers to the local arrangement of the polypeptide backbone. Within proteins
there are a number of common structural elements that form alpha helices, beta sheets and turns.
The peptide bond has a ridged planar structure because it has a partial double bond character (I mentioned this
in learning unit 1). As a result, there is no free rotation about the bond that connects the carbonyl carbon and the
nitrogen of the peptide bond. The peptides can then assume two possible conformations across the peptide
bond, namely the cis and trans configurations.
Most peptides assume the trans configuration owing to steric hindrance of their side chains (to see this, have a
look at figure 2.3). However, proline residues in beta sheets often adopt the cis configuration, and glycine, which
only has a hydrogen for an R group, may adopt the cis configuration.
Free rotation is possible about the other two covalent bonds in the polypeptide backbone, although the possible
conformations will also be limited by steric hindrance.
Figure 2.3: Diagram showing the trans and cis conformations of a peptide. Note the close proximity of the R
groups in the cis conformation. The R groups will sterically interfere with each other, as they cannot occupy the
same space.
30
BMI2601/001/4/2017
Read the section, “Peptide bonds restrict possible secondary conformations” on page 36 in Murray and answer
the following questions.
a) What are the phi and psi angles? Why are only a limited number of phi and psi angles allowed in a
protein structure?
b) What does a Ramachandran plot show?
The Ramachandran plot is a way to visualise the phi and psi angles that are found in protein structures. Owing to
steric hindrance, not all combinations of phi and psi angles are possible. A Ramachandran plot can then be used
to show which conformations of the peptide backbone are possible.
2.3.2.3 Alpha helices

Recommended reading: The sections on the alpha helix, beta sheet and loops and bends, pages 37–38 in
Murray.
A secondary structure that is conformationally stable and has favourable hydrogen bonding patterns is the alpha
(α) helix. The stability of the α helix is due to the hydrogen bonds formed between the oxygen of the peptide
bond carbonyl and the hydrogen atom of the peptide bond nitrogen four residues down along the polypeptide
chain (have a look at the figure below and figure 5-4 in Murray). If an α helix has predominantly hydrophobic R
groups on one side down the helix and mostly hydrophilic ones on the other side, it can form the interface
between polar and nonpolar regions, for example the aqueous cytosol and the hydrophobic interior of the protein.
Figure 2.4: Alpha helix held together by hydrogen bonds (yellow)

(http://en.wikipedia.org/wiki/File:Alpha_helix.png)
31
BMI2601/001/4/2017
2.3.2.4 Beta sheets

The other easily recognisable structure is the beta (β) sheet. The peptide backbone of the β sheet is highly
extended, with the R groups of the amino acids in a β strand pointing alternately to one side or the other of the β
strand (you can see this in figure 2.5 below and figure 5-5 in Murray).
Like α helices, β sheets acquire much of their stability from hydrogen bonds between the carbonyl oxygens and
amide hydrogens of the peptide bonds. However, they differ from α helices in that the hydrogen bonds are
formed with neighbouring polypeptide chains rather than within the same section of polypeptide chain.
Beta sheets can be either parallel or antiparallel. Groups of β sheets form the core of many proteins, and
typically have a right-handed twist when viewed along the polypeptide strands (this is illustrated in figure 2.6).
Figure 2.5: Schematic diagram of hydrogen bonding in an antiparallel beta sheet

(http://commons.wikimedia.org/wiki/File:Beta_sheet_bonding_antiparallel-color.svg)
Figure 2.6: Cartoon representation of a domain of a protein showing twisted antiparallel beta sheets. Follow the
polypeptide chain and take note of how the alpha and beta strands are connected.
(http://en.wikipedia.org/wiki/File:PDZ_domain_2DC2.png)
32
BMI2601/001/4/2017
2.3.2.5 Irregular secondary structures

The regular secondary structures, α helices and β sheets generally make up only half of the protein structure.
The rest of the structure is typically composed of random coils, loops, bends or turns that don't have a universal
structure that is easy to describe.
 Turns and bends are short segments of amino acids that join two units of secondary structure.
 Loops tend to be longer, and many have important biological functions. While they cannot be described
by a universal structure, most adopt a specific conformation stabilised by hydrogen bonds, salt bridges
or hydrophobic interactions.
Because many loops and bends occur on the surfaces of proteins, they are involved in the recognition and
binding of antibodies.
a) Describe the structure of an alpha helix.

b) The amino acids glycine and proline tend to destabilise the α helix conformation. Why does this occur?
c) Explain the difference between an antiparallel and a parallel β sheet. You may find it helpful to draw an
image of each type of β sheet.
d) What are supersecondary structures?
When describing the structures of an α helix and a β sheet, be sure to discuss their shape and what type of
bonds hold the structures together.
Super-secondary structures are structural motifs made up of several adjacent elements of secondary structure
that can be found in a number of proteins. An example is the helix-loop-helix motif. They are smaller than protein
domains.
33
BMI2601/001/4/2017
2.3.3 Tertiary structure
Recommended reading: The section on tertiary and quaternary structure, pages 39–40 in Murray.
Figure 2.7: Three different ways of representing the three-dimensional structure of a monomer of the protein
triose phosphate isomerase. Left: an all-atom depiction coloured by atom type. Middle: a cartoon representation
showing the secondary structural elements. Right: a solvent-accessible model coloured by residue type (acidic
residues red, basic residues blue, polar residues green, nonpolar residues white).
(http://en.wikipedia.org/wiki/File:Proteinviews-1tim.png)
The tertiary structure of a protein refers to the entire three-dimensional conformation of a polypeptide. It
encompasses the conformation of the secondary structural elements, how they are arranged in relation to one
another, and the position of the amino acid side chains (you can see examples of tertiary structures in figure 2.7
above and figure 2.8 below).
Large polypeptides may form domains, which are structurally independent units that typically perform a particular
function. Smaller proteins often have only one domain (myoglobin is an example), whereas larger proteins may
be made up of a number of domains (figure 5-8 in Murray shows polypeptides with two domains). The domain
structure of a protein is not always clear, as the domains may make lots of contacts with one another, making the
protein look like a single entity.
Some proteins contain covalent disulphide bonds (S-S) that form between cysteine residues. The disulphide
bonds increase the stability of the folded conformation of the protein.
34
BMI2601/001/4/2017
Figure 2.8: The human retinol-binding protein bound to retinol (vitamin A), illustrating an eight-strand beta-barrel
structure (http://en.wikipedia.org/wiki/File:Rbp_1brp.png)
2.3.3.1 Determination of three-dimensional structure

The three-dimensional structure of a protein can be determined using X-ray crystallography or nuclear magnetic
resonance (NMR) spectroscopy.
 X-ray crystallography is used to determine the three-dimentional structure of proteins that have been
crystallised (for an illustration, see figure 2.9).
 NMR is used to determine the average structure of a protein in solution.
Figure 2.9: Steps in the determination of a protein structure using X-ray crystallography
(http://en.wikipedia.org/wiki/File:X_ray_diffraction.png)
35
BMI2601/001/4/2017
Molecular modelling can also be used to infer the structure of proteins for which X-ray crystallographic or NMR
structures are not yet available, where there are structures available with similar primary sequences. These
structures may not be accurate, and are just predictions of what the structure may be. For structures that are
known, molecular docking programmes can be used to predict which drugs may or may not interact with key sites
on a protein molecule.
2.3.4 Quaternary structure

Proteins can be made up of multiple polypeptide chains or subunits. Quaternary structure refers to the way in
which these chains associate with each other.
 Monomeric proteins contain a single polypeptide.

 Dimeric proteins contain two polypeptides, with homodimers being made up of two copies of the same
polypeptide and heterodimers containing two different polypeptide chains.
 Trimeric, tetrameric etc. structures contain increasing numbers of chains.
The figures below show examples of multi-subunit proteins.
Figure 2.10: Multi-subunit transporter protein spanning the plasma membrane (positioned between the blue and
red lines in the middle of the diagram). Each polypeptide chain is shown in a different colour.
(http://en.wikipedia.org/wiki/File:2onk.gif)
36
BMI2601/001/4/2017
Figure 2.11: The quaternary structure of a heptameric cleavage fragment (PA63) of the protective antigen
protein, produced by Bacillus anthracis. This protein fragment forms a pre-pore, which later forms a channel that
allows other toxins into the cytosol of the target cell, resulting in damage to the host.
(http://en.wikipedia.org/wiki/File:ANTHRA_1.JPG)
The main forces that stabilise a protein’s tertiary and quaternary structure are:
 hydrophobic forces
 electrostatic forces – salt bridges
 hydrogen bonds
 covalent disulphide bonds between the sulfhydryl groups of cysteine residues
Read the section on tertiary and quaternary structure in your textbook and answer the following questions.
a) What are protein domains?

b) Discuss which forces and bonds keep proteins in their specific conformation at each level of structure
(primary, secondary, tertiary and quaternary).
37
BMI2601/001/4/2017
2.4 Protein folding

Figure 2.12: A nascent polypeptide folds into its three-dimensional shape
Protein folding is the physical process in which a polypeptide folds into a functional three-dimensional structure.
When a protein is being synthesised, the new polypeptide chain does not yet have any specific conformation; the
different amino acid residues then interact with one another, forming the folded protein structure. This process
generally occurs spontaneously, and the final structure that forms is the active stable conformation.
2.4.1 Factors facilitating the folding of proteins
A number of factors can facilitate the folding of proteins to ensure that misfolding does not occur.
 Folding is modular: During synthesis, short segments of protein fold into secondary structural units.
The hydrophobic regions of these secondary structural units then come together and form the interior of
the protein, as they prefer not to interact with the solvent. The secondary structural elements then
rearrange until the final conformation is reached. In multimeric proteins the individual subunits will
generally fold before they associate with the other subunits that make up the final protein.
 Assistance by auxiliary proteins: Within cells, auxiliary proteins help to increase the speed of correct
protein folding.
 Chaperones: These are proteins that assist in the folding and assembly of macromolecular structures.
The hsp70 family of chaperones helps fold numerous protein molecules, and in that way prevents the
formation of insoluble aggregates.
 Protein disulphide isomerase: This assists in the formation of disulphide bonds that stabilise a
protein’s native conformation.
 Proline-cis, trans-isomerase: This enzyme catalyses the isomerisation of the X-Pro bonds of proteins
from the trans to cis configuration. The cis configuration is common in the proline residues in beta sheet
turns.
38
BMI2601/001/4/2017
2.4.2 Misfolding
Although most proteins fold correctly, misfolding sometimes occurs. Incorrect folding of proteins typically
produces inactive proteins; the cell then detects these and degrades them. In some instances, however, the
misfolded proteins may accumulate and aggregate. Several neurodegenerative and other diseases develop as a
result of this accumulation of misfolded proteins.
Protein misfolding can happen by chance, but a number of factors may increase the likelihood of misfolding. They
include:
 the presence of infectious prion proteins

 mutations that make the protein more unstable
 protein hyperphosphorylation
 pathological increases in the intracellular concentration of protein
 problems with the cellular machinery involved in the degradation of proteins
Three examples of illnesses caused by misfolded proteins are prion diseases, Alzheimer’s disease and beta-
thalassemia.
Prion diseases, or transmissible spongiform encephalopathies, are caused when insoluble protein aggregates
are deposited in neural cells. This affects brain tissue: holes develop in the tissue, which then looks like a
sponge. A variety of symptoms may occur, including visual deterioration, dementia, muscle paralysis and lack of
coordination.
Alzheimer’s disease typically occurs in elderly people, and is characterised by dementia. In Alzheimer’s disease
patients, there is an elevated level of the protein β-amyloid, which undergoes a conformational transformation
from a soluble α helix-rich state to a state rich in β sheets that are prone to self-aggregation.
Beta-thalasaemia is an inherited blood disorder caused by misfolding of one of the haemoglobin subunits. As a
consequence, defective haemoglobin is produced; individuals with β-thalassemia make less haemoglobin and
have fewer circulating red blood cells than normal.
The following article tells you more about the role of protein misfolding in certain diseases:
http://www.nature.com/scitable/topicpage/protein-misfolding-and-degenerative-diseases-14434929. Although you
do not have to read the article, I really encourage you to do so.
2.4.3. Activity 2.5
a) What is an insoluble aggregate?

b) How do chaperones help proteins fold?
c) What are prions and prion diseases? How do prion proteins cause disease?
d) Discuss how misfolding of proteins can result in Alzheimer’s disease and beta-thalassemia. Be sure to
include information on the cause, and which specific proteins are directly involved in each disease.
39
BMI2601/001/4/2017
Prion diseases, Alzheimer’s disease and beta-thalassemia are examples of diseases that illustrate the
importance of correct protein folding for health. Ensure that you understand how the change in the structures of
specific proteins causes disease. The three diseases are described in the section “Perturbation of protein
conformation may have pathologic consequences” on pages 44 and 45 in Murray.
2.5 Conclusion
Currently, it is not possible to determine a protein’s tertiary structure from its sequence. As tertiary structures can
shed light on the function of proteins and can be used to analyse which drugs or ligands will interact with
proteins, extensive research is being conducted to understand how proteins fold in the hope that one day it will
be possible to determine the structures of proteins directly from sequence data. Knowledge of how proteins fold
can also shed light on why some proteins misfold. As the misfolding of certain proteins can lead to disease,
information about misfolding can help us develop treatments for these conditions in the form of drugs with the
capacity to inhibit the incorrect folding of proteins.
40
BMI2601/001/4/2017
Learning unit 3: Purifying and analysing proteins
3.1 Introduction
Proteins perform essential roles in the body. We need to study proteins to understand how changes in the
structure, amount or activity of these substances relate to specific diseases or physiological states. To sequence
and fully characterise the structure of a protein, we first need to obtain it in pure form. The protein must also be in
pure form in order for us to confirm the biological activity (signalling capacity, enzymatic activity, etc.) of a protein
with complete certainty.
There are a number of industrial and pharmaceutical applications for purified proteins. An example is insulin,
which is synthesised in bacteria and then purified for use by diabetics. Many purified proteins are also utilised in
research; some examples are DNA polymerase, reverse transcriptase, ligase and restriction endonucleases,
which are all enzymes used in the laboratory to manipulate DNA.
In this learning unit we will discuss some practical methods that are used in the laboratory to isolate, characterise
and manipulate proteins. First, we will study different methods of purifying (isolating) proteins, namely
centrifugation and chromatography. Then we will see how proteins can be analysed by means of four different
methods. Finally, we will briefly refer to how recombinant DNA technology can add value to these processes.
You must not only learn the various techniques, but also understand when these techniques are used, and how
they can be used in combination with each other.
To complete the learning unit, you will need to refer to chapter 4 in Murray., which deals with the techniques used
to purify and analyse proteins.
 explain how proteins can be purified using centrifugation and chromatography

 explain how proteins can be analysed using the following methods:
 SDS-PAGE
 isoelectric focusing
 2D-PAGE
 mass spectroscopy
3.3 Protein purification
Experimental methods for characterising the structure and function of proteins generally require the protein being
studied to be pure. There are thousands of different proteins and other molecules within a cell, and so first of all
41
BMI2601/001/4/2017
the particular protein must be isolated or separated from the other cell contents. This is referred to as purification.
Purification consists of a number of steps, each of which results in the removal of contaminating macromolecules,
until in the final step only the protein of interest remains.
Before a protein of interest can be purified, the cells containing the protein need to be lysed (broken open),
releasing the cellular constituents and creating a homogenate. The resulting homogenate can then be centrifuged
to remove any insoluble material.
3.3.1 Centrifugation
In the sections that follow I will start by telling you how centrifugation works, and then discuss the uses of
centrifugation with you. Based on your knowledge of the terms “centrifuge” and “centrifugal force”, and the
photograph below, do you perhaps have an idea of how the process is performed?
Figure 3.1: Tabletop centrifuge (http://en.wikipedia.org/wiki/File:Tabletop_centrifuge.jpg)
3.3.1.1 How centrifugation works
A centrifuge is a piece of equipment that spins rapidly, subjecting a sample to centrifugal force. This causes the
heavier and denser particles to migrate away from the axis of rotation and the lighter ones to be situated closer to
the axis of rotation. To form an idea of this, imagine a tyre filled with air and mud. If the tyre is rotated fast, as a
result of centrifugal force the mud will coat the inside surface of the tyre.
During centrifugation, larger particles experience more force, and may sediment to form a pellet at the bottom of
the centrifuge tube. The velocity at which particles will pellet is dependent on
• their size and shape,

• the density difference between the particles and the liquid, and
• the viscosity of the solution.
The remaining solution containing all the unpelleted particles is called the supernatant. To separate the
supernatant from the pellet, a pipette can be used to remove the supernatant from the centrifugation vessel
easily. Depending on the speed at which the sample is centrifuged, particles of different sizes will pellet out of
solution (to see this illustrated, have a look at figure 3.2).
42
BMI2601/001/4/2017
Figure 3.2: Differential centrifugation of cellular components. In step 1 the cellular components are centrifuged at
a low speed; this pellets only the large green particles (e.g. nuclei and whole cells). If the resulting supernatant is
then centrifuged at a higher velocity, the next biggest particles (the red particles), will pellet out (these could be
larger organelles, such as mitochondria). After another round of centrifugation at an even higher velocity, small
vesicles will pellet out. In this way the different components of the cell can be separated out.
(http://en.wikipedia.org/wiki/File:Differentielle_zentrifugation.gif)
3.3.1.2 Uses of centrifugation
Most proteins are small and soluble, and are not pelleted during normal centrifugation. However, centrifugation is
often used to remove all the large cellular components, for example the organelles and membranes, in the first
step of purification. It is possible to change the conditions of the solution, temperature or pH, causing the proteins
to precipitate; in this way they may be pelleted during routine centrifugation.
Centrifugation is also generally used to separate the components of blood to produce plasma.
Figure 3.3: Diagram of a blood sample after centrifugation (http://commons.wikimedia.org/wiki/File:Blood-

centrifugation-scheme.png)
43
BMI2601/001/4/2017
Centrifugation is also used in industry. It is often used to remove fat from milk to produce skimmed milk, and it is
used in the manufacture of beverages such as fruit and vegetable juices. It may also be used to enrich uranium,
which is required for nuclear reactors.
Analytical ultracentrifugation is a special form of centrifugation that can be used to determine the properties of
macromolecules. Mixtures of particles are centrifuged together with a high-density solution, for example sucrose.
The particles will move through the centrifugation tube at varying speeds, depending on their physical properties
and the properties of the dense solution. The properties of the particles, such as shape and mass, can then be
inferred by analysing their movement through the solution.
3.3.2 Activity 3.1
a) Centrifugation is a very useful technique that is routinely used in the laboratory. Explain what
centrifugation is used for in the laboratory.
b) Can you think of something in your home (or somebody else’s) that uses centrifugal force?
Centrifugation is a useful technique that is most frequently used to separate insoluble material from soluble
material, resulting in a pellet of insoluble material and the liquid supernatant that contains all the soluble
molecules. It may also be used to separate molecules of different sizes.
A salad spinner, which is used to remove water from lettuce after you have washed it, uses centrifugal force.
A washing machine also uses centrifugal force during its spin cycle to remove as much water from the washing
as possible.
3.3.4 Chromatography
Figure 3.4: A simple column for chromatography (http://en.wikipedia.org/wiki/File:Simple_column_for_Ni2%2B-

affinity_chromatography.jpg)
44
BMI2601/001/4/2017
Proteins can be purified by column chromatography. Column purification can produce large quantities of a
specific protein that can then be analysed further.
During chromatography, the solution containing the desired protein and other molecules is passed through a
column containing a solid porous matrix of small beads. Have a look at figure 4-2 in Murray to see the
components of a typical liquid chromatography apparatus. The matrix can be modified, and depending on the
type of modification, the proteins that are passed through the column will be separated according to different
properties. Some of the properties used for separation are:
• size (size-exclusion chromatography)
• charge (ion-exchange chromatography)
• binding ability (affinity chromatography)
• hydrophobicity (hydrophobic chromatography)
Because there are large numbers of different proteins within a cell, many proteins may share the same properties
with the desired protein, and so it is usually necessary to do a succession of different columns to obtain a purified
protein.
3.3.4.1 Size-exclusion chromatography
Figure 3.5 below and figure 4-3 in Murray show the principle behind size-exclusion or gel filtration
chromatography. During size-exclusion chromatography, proteins of different sizes move through the column at
different rates, and are therefore separated according to size.
Figure 3.5: Diagram illustrating the theory behind size exclusion chromatography. (For those of you who are not
viewing this picture in colour: On the graph, the line that peaks first represents the larger particle.)
(http://en.wikipedia.org/wiki/File:SizeExChrom.png)
45
BMI2601/001/4/2017
3.3.4.2 Ion-exchange chromatography
The following web page has further information on ion-exchange chromatography:

http://ionexchangechromatography.net/ion-exchange-chromatography-elution/. (You do not have to read this
page, but you may find it interesting.)
In ion-exchange chromatography the proteins interact with the matrix, depending on their charge. The net charge
of the protein will depend on the pH of the buffer solution the proteins are dissolved in. Think back to learning unit
1, and how the pH of a solution can affect the charge of the amino acids:
• proteins with a net negative charge will bind to a positively charged matrix (anion exchanger); and
• proteins with a net positive charge will bind to a column containing a negatively charged matrix (cation
exchanger).
The other molecules and proteins that do not have the opposite charge to the matrix will not bind, and will pass
through the column. The bound proteins can then be eluted (removed from the column) by increasing the ionic
strength of the buffer solution being passed through the column. As the ionic strength increases, the charge–
charge interactions are weakened, and the protein will move off the column.
3.3.4.3 Affinity chromatography
An affinity column has specific ligands, or substrate molecules covalently bound to the matrix. A protein that
interacts with the ligand will become bound to the column. All the other proteins should not bind, and will pass
through the column. The bound protein can then be eluted in pure form.
Affinity chromatography is highly specific, and large quantities of pure protein can often be obtained using a
single column. For this reason fusion proteins, in which the protein of interest is fused to a tag that can bind an
affinity matrix, are often generated. The fused tags are generally removed after purification, before the protein is
analysed further.
An example of a common tag is the His-tag, which is able to bind a metal affinity matrix. A number of histidine
residues are added to the end of a protein by modifying the DNA encoding for the protein. This is illustrated in the
figure below. When the protein is expressed the additional nucleotides are attached, creating a new protein with
the tag joined to the protein. The modified protein can then be purified easily by affinity chromatography.
46
BMI2601/001/4/2017
Figure 3.6: Addition of a polyhistidine tag to a protein of interest. The His-tag, which in this illustration is situated
on the end of the vector, was added by inserting the DNA coding for the protein of interest into a vector that
contains the His-tag, so when the protein is expressed, it has the histidine tag attached.
(http://en.wikipedia.org/wiki/File:His-tag.png)
3.3.4.4 Hydrophobic chromatography
During hydrophobic chromatography proteins associate with hydrophobic groups, such as Phenyl Sepharose or
octyl Sephadex, which are attached to a stationary matrix. Although hydrophobic amino acids such as
phenylalanine, tyrosine and tryptophan are typically buried within a protein, some will be on the surface of the
protein and will be exposed. These hydrophobic amino acids can interact and bind to the hydrophobic groups on
a column. Proteins that are less hydrophobic will not bind to the column, and will be washed away. Typically,
buffers with high salt concentrations are used, as the high ionic strength will enhance the hydrophobic
interactions between the proteins and the matrix. The proteins can then be eluted from the column by gradually
decreasing the salt concentration of the mobile phase (the buffer being added to the column). The least
hydrophobic proteins will elute first, at higher salt concentrations than the more hydrophobic proteins.
3.3.5 Activity 3.2
a) When the pH of a solution changes, how does this affect the charge on a protein?
b) In your own words, explain how size-exclusion chromatography works.
c) Describe how proteins can be separated by hydrophobic interaction chromatography.
d) Describe how affinity chromatography works. Present your answer as a list of steps, and illustrate it with
a sketch.
47
BMI2601/001/4/2017
When discussing the effect of pH on the charge of a protein, did you mention the pKa of the exposed side
chains? If the pH drops, what will the charge be on the acidic and basic side chains? Likewise, if the pH
increases, what charge would you expect the acidic and basic side chains to have?
Here is some information to help you. As the pH of a solution increases, the acidic and basic groups on proteins
will become deprotonated. Therefore, carboxyl groups become carboxylate anions (R-COOH to R-COO-), and
ammonium groups are converted to amino groups (R-NH3+ to R-NH2).
Both the learning guide and the textbook explain the different forms of chromatography clearly. If you are still
having trouble understanding the techniques, do an online search for more information, or refer to other texts.
3.4 Protein analysis
You have a purified protein – so what now?
There are a number of techniques for studying proteins. Each technique will yield different information about the
protein.
In the sections that follow we will examine:

• SDS polyacrylamide gel electrophoresis (SDS PAGE)
• isoelectric focusing
• two-dimensional polyacrylamide gel electrophoresis
• mass spectroscopy
3.4.1 SDS polyacrylamide gel electrophoresis (SDS-PAGE)
SDS polyacrylamide gel electrophoresis (SDS-PAGE) is the most common method used to separate proteins for
non-preparative purposes. It can also be used to determine the purity and relative molecular mass of a protein.
In the sections that follow, I will start by explaining the working principle of this method, and then tell you about
the process involved in applying it.
3.4.1.1 Principle of SDS-PAGE
The principle behind electrophoresis is that a charged particle moves in an electric field. During gel
electrophoresis, particles are subjected to an electric field to move them through a gel matrix. During SDS-
PAGE, proteins are subjected to an electric field in a gel matrix in the presence of the detergent sodium dodecyl
sulphate (SDS). SDS is a powerful detergent that binds to proteins and causes them to denature or unfold.
In addition to SDS, a reducing agent such as 2-mercaptoethanol is often added. This breaks any disulphide
linkages within the proteins, ensuring that all forms of tertiary and quaternary structures are disrupted. These two
48
BMI2601/001/4/2017
compounds ensure the proteins are all in an extended conformation and are not associated with one another or
any other molecules.
As SDS is negatively charged, numerous SDS molecules bind to each polypeptide chain. They, therefore, mask
the intrinsic charge of the proteins, and all the proteins will migrate to the positive electrode when an electric field
is applied. Because all the proteins have the same shape (denatured) and the same charge to mass ratio, they
will separate according to their relative molecular mass. The smaller molecules can move through the pores in
the gel more easily than the larger molecules, which experience more physical resistance. They, thus, separate
during their passage through the gel with the smaller molecules moving ahead of the larger molecules.
3.4.1.2 The process involved in SDS-PAGE
To perform SDS-PAGE, a polyacrylamide gel is cast (made) and placed in a buffer tank (you can see this in figure
3.7). The proteins are then loaded onto the polyacrylamide gel using a Hamilton syringe, and an electric field is
applied. After a set length of time, the gel is removed and stained with Coomassie blue, which binds to the
proteins but not the gel, allowing the proteins to be visualised. Figure 4-5 in Murray and figure 3.8 below show
gels that have been used to analyse proteins. The smaller molecules will have travelled farther down the gel,
while the larger ones will be at the top of the gel, closer to the point at which they entered it.
If proteins of known molecular mass (molecular markers) are run on the gel with a protein of interest, the position
of the protein of interest can be compared with the proteins of known molecular mass to determine its estimated
size.
Figure 3.7: SDS polyacrylamide gel electrophoresis (SDS-PAGE). A gel is placed in a tank in the presence of
buffers. The protein samples are loaded into precast wells in the gel and the gel is subjected to an electric field.
This results in the separation of the proteins. (http://commons.wikimedia.org/wiki/File:SDS-
PAGE_Electrophoresis.png)
49
BMI2601/001/4/2017
Figure 3.8: Picture of an SDS polyacrylamide gel used to analyse proteins

(http://commons.wikimedia.org/wiki/File:SDS-PAGE.jpg)
Specific proteins can be identified by Western blotting. This procedure involves transferring the proteins in the gel
onto a nitrocellulose paper or nylon membrane by placing the membrane and gel into a strong electric field. Once
the proteins have been transferred to the membrane, the membrane can be exposed to antibodies (specific for
the protein of interest) coupled to radioactive isotopes, a detectable enzyme or a fluorescent dye. The antibodies
will bind to the protein of interest, and it will be possible to see the position of the protein on the membrane.
a) Explain why proteins separate during SDS-PAGE.

b) Why are SDS and 2-mercaptoethanol added to the proteins when performing SDS-PAGE?
c) After electrophoresis the gel can be stained with Coomassie blue. What is the function of the stain?
3.4.2 Isoelectric focusing
Isoelectric focusing (IEF) is a technique for separating molecules by differences in their isoelectric point (pI). It is
usually performed on proteins in a gel with a pH gradient. In learning unit 1 we discussed the fact that the overall
charge on the protein is a function of the pH of its surroundings. When an electric field is applied, proteins will
move through the gel, depending on their charge. If they have a positive charge they will move to the negative
electrode (cathode), and if they have a net negative charge they will move to the positive electrode (anode).
When they reach a point where their isoelectric point (pI) is the same as the pH of the gel they will have a net
charge of 0, and will stop moving. Therefore, proteins will migrate through the gel until they reach the region
where the pH matches their pI. You can see this in figure 3.9. (This figure needs to be viewed in colour, so if you
are studying on paper, please go online to view it if you can.)
50
BMI2601/001/4/2017
Figure 3.9: Isoelectric focusing. In (A) the proteins are charged and move towards either the positive or the
negative electrodes, depending on their charge. In (B) the molecules have moved to their isoelectric point; they
therefore have a net charge of 0 and will no longer move through the gel.
(http://en.wikipedia.org/wiki/File:Isoelectric_focusing_contribute2.jpg)
3.4.3 Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE)
Another useful technique to analyse proteins is two-dimensional polyacrylamide gel electrophoresis (2D-PAGE).
This technique gets its name from the fact that mixtures of proteins are separated in two dimensions using two
distinct properties. Molecules are separated more effectively in 2-D electrophoresis than in 1-D electrophoresis
(SDS-PAGE), as it is less likely that two molecules will be similar in both properties. Generally, the proteins are
separated based on their pI in one dimension and then separated according to their molecular mass in the
second dimension (figure 3.10 shows this).
2D-PAGE is a very effective way of separating complex mixtures of proteins. It can be used to compare the
patterns of proteins expressed within an organism under different conditions.
51
BMI2601/001/4/2017
Figure 3.10: Diagram depicting two-dimensional gel electrophoresis. The proteins are initially separated
according to pI, and are then separated by SDS-PAGE (http://id.wikipedia.org/wiki/Berkas:2D_electrophoresis.gif)
Figure 3.11: Two-dimensional polyacrylamide gel showing the separation of protein in two dimensions
(http://commons.wikimedia.org/wiki/File:2D-Gel.jpg)
3.4.4 Mass spectroscopy
Mass spectroscopy can be used to accurately identify proteins, and requires only small amounts of material.
There are a number of different types of mass spectroscopy. Matrix-assisted laser desorption ionisation-time-of-
flight (MALDI-TOF) spectroscopy is often used to identify proteins. The protein of interest is cleaved into
peptides, and the precise mass of the peptides in the sample is determined by means of the mass spectroscope.
52
BMI2601/001/4/2017
This information is then used to search a genomic database in which all the predicted peptide fragments of the
proteins of an organism have been determined using the genetic codes. Once a match is found, the sequence of
the protein is identified.
Read the section on mass spectroscopy on pages 31 and 32 in Murray.
3.4.5 Activity 3.4
a) You are given a mix of proteins, and you want to determine their pIs. What technique could you use?
Explain the principles behind the technique.
b) In your own words, describe 2D-PAGE.
c) Discuss how mass spectroscopy can be used to analyse and identify proteins.
For question a), did you describe isoelectric focusing?
When discussing 2D-PAGE, did you discuss the fact that the proteins are first separated based on their pI, and
then separated according to their molecular mass?
The use of mass spectroscopy for identifying proteins is described on pages 31 and 32 of the textbook, in the
section, “Peptides can be volatized for analysis by electrospray ionization or matrix-assisted laser desorption”.
3.5 Recombinant DNA technology
It is generally difficult to isolate a specific protein in large enough amounts from tissue samples. It is therefore
often preferable to clone the gene that encodes for the specific protein into a vector that can then be placed in
Escherichia coli or yeast to produce large quantities of its encoded protein. The protein of interest can then be
purified from the bacterial or yeast cells, and analysed using the techniques we have spoken about this learning
unit. Not all animal proteins can be expressed in active form in microbial cells or yeasts. In this situation the
genes may need to be expressed in cultured animal cell systems.
3.6 Conclusion
In this learning unit I described some common methods used to purify and analyse proteins. This was just an
introduction to some of the methods that may be used to study proteins; there are many more protein procedures
that are used routinely in laboratories. In addition, there are also a number of different techniques that require
highly specialised equipment found only in specialised laboratories.
53
BMI2601/001/4/2017
Learning unit 4: Enzymes
4.1 Introduction
Many thousands of biochemical reactions occur within living organisms. Enzymes are the molecules that catalyse
these chemical reactions, which bring about specific biochemical changes. Enzymes within the body fulfil a
variety of functions, including the breakdown of nutrients to supply energy, and the manufacture of proteins,
lipids, carbohydrates and other molecules. Studying enzymes helps us understand biochemical processes in
living organisms.
Genetic mutations can result in changes in the activity of an enzyme, which may cause disease. Many inherited
diseases are due to flaws in enzymes. Hundreds of different metabolic disorders occur as a result of genetic
mutations, and their symptoms, treatment, and prognoses vary widely. Understanding how enzymes function can
help us develop specific treatments for these disorders.
In this learning unit we will first explore the role of enzymes as catalysts; this will involve looking at their
classification and their association with cofactors, coenzymes and prosthetic groups. We will then study the
various mechanisms of enzyme catalysis in more detail. After briefly examining the role of enzymes in medicine,
we will investigate in detail how the activity of enzymes is regulated.
In this unit I will tell you about enzymes, how they catalyse reactions, and how their activity can be regulated.
To complete the learning unit, you will need to refer to chapters 7 and 9 in Murray.
In the text, I have also given you the links to some internet sources that you may find interesting and helpful.
• explain why an enzyme can be classified as a catalyst

• discuss the different types of reactions enzymes catalyse and how enzymes can be classified based on
the type of reactions they catalyse
• distinguish between cofactors, prosthetic groups and coenzymes, and explain how they aid catalysis or
substrate binding
• describe the four mechanisms by which enzymes catalyse reactions
• explain how monitoring certain enzymes in the blood can help us diagnose certain diseases, specifically
myocardial infarction
• explain what a zymogen is and why enzymes are produced in this form
• describe the ways in which the activity of enzymes can be regulated
54
BMI2601/001/4/2017
4.3 Enzymes are catalysts
Enzymes are generally proteins, although some RNA molecules also have catalytic activity; these are called
RNA-enzymes, or ribozymes. A catalyst is a substance that brings about or accelerates (speeds up) a chemical
reaction without itself undergoing any permanent chemical change.
The catalytic activity of an enzyme is determined by its amino acid sequence and three-dimensional structure.
The molecules that bind and are acted upon by enzymes are called substrates, and the molecules formed are
called products.
Usually only a small portion of the residues that make up an enzyme come into contact with the substrate. Of
these residues only a few (two to three on average) are directly involved in catalysis. The region that binds the
substrate and contains the catalytic residues is known as the active site.
Enzymes may also require cofactors for catalysis. Because they are catalysts, they are not destroyed or
permanently modified while they convert substrates into products, and they can therefore catalyse numerous
reactions.
Figure 4.1: An enzyme catalysed reaction in which a substrate binds to an enzyme, forming the enzyme–
substrate complex. The substrate is then converted to two products in a reaction catalysed by the enzyme.
(http://commons.wikimedia.org/wiki/File:Allosteric_competitive_inhibition_3.svg)
Enzymes differ from ordinary catalysts in a number of respects.
• They have very high reaction rates; the rates of enzymatically catalysed reactions may be as much as
106 to 1012 times faster than the uncatalysed reactions.
o
• Reactions occur under mild conditions: temperatures below 100 C, moderate atmospheric pressure and
neutral pH.
• They have a high degree of reaction specificity, and typically only catalyse the conversion of one or two
compounds (substrates) into one or more other compounds (products).
• Their activity can be regulated by a number of methods.
55
BMI2601/001/4/2017
Most enzymes are extremely selective catalysts, and will only catalyse a precise reaction for a particular
substrate or a small set of closely related substrates. A limited number of enzymes, on the other hand, have
broad specificity and will act on a range of substrates.
The binding of substrates is determined by complementary shape and the charge or hydrophobic characteristics
of the substrate and enzyme. Enzymes show stereospecificity, and they are able to distinguish and catalyse
reactions of only one stereoisomer of a given compound. Refer to figure 7-1 in Murray.
Two enzymes that are different but catalyse the same reaction are called isozymes.
4.3.1 Enzyme classification
Recommended reading: chapter 7, page 58 in Murray.
Enzymes are commonly named by adding the suffix –ase to the name of the enzyme’s substrate or to a word that
describes the enzyme’s catalytic function. For example, alcohol dehydrogenase removes hydrogens from
alcohols, and proteases hydrolyse proteins.
To standardise the naming of newly discovered enzymes, the International Union of Biochemistry and Molecular
Biology (IUBMB) proposed an unambiguous system of enzyme nomenclature in which each enzyme has a
unique code number (EC number) and name that distinguishes the type of reaction catalysed and the substrates
involved. The EC number is a sequence of four numbers, the first of which broadly classifies the enzyme based
on its mechanism. An example would be hexokinase, which has the official name of ATP:D-hexose 6-
phosphotransferase, E.C. 2.7.1.1.
There are six main classes of reactions that enzymes catalyse. I have summarised these for you in the table
below.
Table 4.1: Enzyme classification according to reaction type
Classification Type of reaction catalysed
Oxidoreductases Catalyse oxidation and reduction reactions
Transferases Catalyse transfer of functional groups such as methyl or phosphate groups
Hydrolases Catalyse the hydrolysis of bonds (hydrolytic cleavage of C-C, C-O, C-N, and other
bonds)
Lyases Cleave various bonds by means other than hydrolysis, generating double bonds
(atom elimination)
Isomerases Catalyse geometric or structural changes within a molecule (reactions involving

isomerisation)
Ligases Catalyse the joining of two molecules coupled to the hydrolysis of ATP
56
BMI2601/001/4/2017
4.3.2 Activity 4.1
Remember, these activities serve as part of your exam preparation!
a) What is a catalyst? Why are enzymes classified as catalysts?

b) Enzymes are stereospecific catalysts, and may only catalyse reactions of one stereoisomer of a
compound. Explain this statement. Be sure to state what a stereoisomer is.
c) What is an isozyme?
d) Look at table 4.1 in this learning unit and discuss how enzymes can be classified based on the type of
reactions they catalyse.
e) Into what group would you classify the enzyme that joins two pieces of DNA?
We discussed stereoisomers in learning unit 1 in section 1.8, “Amino acid chirality”. Reviewing this section
should help you to answer the question. Note that the enzyme that joins two pieces of DNA is a ligase.
4.3.4 Cofactors, coenzymes and prosthetic groups
Some enzymes require additional prosthetic groups, cofactors or coenzymes to aid substrate binding or catalysis.
Prosthetic groups
Prosthetic groups are molecules or atoms that are incorporated into the structure of an enzyme, and are bound
by covalent or noncovalent forces. The Greek word “prosthesis” means “addition” or “attachment”, and the
prosthetic groups are essentially additional molecules that the enzymes require to function correctly. They may
help to bind and orient substrates, or they may be directly involved in the reaction being catalysed. Examples of
prosthetic groups include heme, thiamine pyrophosphate, biotin and metal ions. Metals are the most common
prosthetic group; enzymes containing metals are called metalloenzymes.
Cofactors
Cofactors associate transiently with the enzyme, and do not remain permanently bound to it. They are released
from the enzyme's active site after the reaction has been catalysed. Metal ions can also act as cofactors.
Coenzymes
Coenzymes transport chemical groups from one point in a cell to another, generally between two different
enzymes. Vitamins such as thiamine, riboflavin and folic acid act as coenzymes. The body cannot synthesise
them, and so they must be obtained from the diet. NAD and NADP+ are examples of coenzymes that stabilise
57
BMI2601/001/4/2017
and carry hydride ions. Other groups that are transported by coenzymes include the acetyl group, carried by
coenzyme A, and the methyl group, carried by folic acid.
4.3.5 Activity 4.2
a) Discuss the difference between prosthetic groups, cofactors and coenzymes.

b) Many prosthetic groups, cofactors and coenzymes are generated from B vitamins. Refer to the textbook,
and briefly discuss this statement.
I will be discussing vitamins in learning unit 8. If you were unsure of what the B vitamins are, did you consult the
textbook?
The B vitamins include:

• thiamine (vitamin B1)
• riboflavin (vitamin B2)
• niacin or niacinamide (sometimes called vitamin B3)
• pantothenic acid (vitamin B5)
• pyridoxine, pyridoxal, or pyridoxamine (vitamin B6)
• cobalamin (vitamin B12)
In the section, “Many coenzymes, cofactors and prosthetic groups are derivatives of B vitamins” on page 59 in
Murray, you will see that many different enzymes contain the B vitamins.
4.4 Mechanisms of enzyme catalysis
For a reaction to be catalysed by an enzyme, the enzyme and substrate need to interact in a particular way. The
specificity of the interaction is determined by the complementary geometric shapes of the enzyme and the
substrate.
The site on the surface of the enzyme where the substrate binds is called the active site. It is more than just a
recognition site. It provides a three-dimensional environment that aligns the substrate, bringing it into contact with
cofactors, prosthetic groups and the amino acid side chains that are required for catalysis. The active site also
shields the substrate(s) from the solvent, thus generating the optimal environment for catalysis.
To enhance the rates of chemical reactions, enzymes use various combinations of four general mechanisms of
action:
• catalysis by proximity and orientation
• catalysis by strain
58
BMI2601/001/4/2017
• catalysis involving proton donors or acceptors (acid–base catalysis)

• covalent catalysis
Most enzymes will use more than one mechanism of catalysis.
4.4.1 Catalysis by proximity, orientation and strain
Catalysis by proximity and orientation
For molecules to react with each other, they need to be close together. When an enzyme binds substrate
molecules at its active site, it brings the bound molecules within bond-forming distance of each other, and orients
the molecules in the correct position so that they will react. This increased proximity will increase the rate of a
reaction.
Catalysis by strain
Enzymes that catalyse the breakdown of molecules may bind the substrate so that the bond that is to be broken
is placed under strain. This weakens the bond, making it more susceptible to cleavage. Refer to figure 7-5 in
Murray for an illustration of this. The conformation that the substrate is forced to adopt is similar to the transition
state intermediate, a transient species that is formed half way through the conversion of substrates to products.
For this reason, this mechanism is also referred to as transition state stabilisation.
4.4.2 Catalysis involving proton donors or acceptors (acid-base catalysis)
During acid–base catalysis the ionisable functional groups are involved in catalysis by acting as acids or bases –
in other words, they either donate or accept protons. Let me use HIV protease as an example to illustrate acid–
base catalysis.
HIV protease
The aspartic protease family of enzymes share a common catalytic mechanism. This family of enzymes includes
the digestive enzyme pepsin and HIV protease, which is the protease produced by human immunodeficiency
virus (HIV). HIV protease cleaves newly synthesised viral proteins into the mature protein components of the
virus, and without it, infection does not occur. It is a homodimer, with two active site aspartates, which act as
acid–base catalysts (you will find these illustrated in figure 4.2 below).
Also refer to figure 7-6, which shows the mechanism of catalysis of HIV protease, and read the section entitled
“HIV protease illustrates acid-base catalysis” on page 61 in Murray.
59
BMI2601/001/4/2017
Figure 4.2: The structure of HIV protease (green and cyan) complexed with a polypeptide substrate (magenta).
The active site Asp-25 residues are coloured red. (http://en.wikipedia.org/wiki/File:HIV_protease_1KJF.png)
HIV protease activity is essential for HIV replication and infection, and so if its activity is inhibited, this will affect
the ability of HIV to infect additional cells. HIV protease is consequently a prime target for drug therapy. Inhibitors
work by binding to the active site, preventing the substrate from binding.
Figure 4.3 below shows an inhibitor bound to HIV protease. A number of different protease inhibitors are used in
the treatment of HIV.
Figure 4.3: The HIV protease (blue and green) with an inhibitor (grey) bound to the active site
(http://en.wikipedia.org/wiki/File:HIV_protease_1EBY.png)
4.4.3 Activity 4.3
a) Discuss how proximity, orientation and strain can facilitate catalysis by enzymes.
b) Describe the mechanism of action of HIV protease. In your answer, be sure to refer to the two aspartic
acid residues and their role in catalysis.
60
BMI2601/001/4/2017
Did you understand the description of the mechanism of catalysis of HIV protease in the textbook, or did you just
copy from the textbook without actually understanding what it meant?
For a better understanding of how HIV protease catalyses the hydrolysis of the peptide bond, study figure 7-6 in
the textbook, and read the figure description and the description in the text.
The textbook reads, “In the first stage of the reaction, an aspartate functioning as a general base extracts a proton
from a water molecule, making it more nucleophilic.” What does this mean? In learning unit 1 I explained that
acids are proton donors and bases are proton acceptors. So, if aspartate functions as a general base, it is going
to accept a proton. This means that the aspartate extracts a proton from a water molecule. What then happens to
the water molecule? It has lost a proton, and therefore has excess electrons and is more nucleophilic. As a result,
it wants to react with an electrophilic group. Because of the close proximity of the peptide that is bound to the HIV
protease, the carbonyl carbon of the peptide bond is the closest electrophilic group. The activated water then
reacts with this group, forming a chemical bond. This is the formation of the transient tetrahedral intermediate.
This structure is not stable, and because there is another aspartate residue in close proximity, it then acts as an
acid (acids are proton donors), donating a proton to the intermediate that is in the active site. This process results
in the cleavage of the peptide bond. The two fragments of protein can then be released.
I hope after this explanation you understand the process, and that it seems less complex than it did initially!
4.4.5 Covalent catalysis
Covalent catalysis
During covalent catalysis, the substrate forms a transient covalent bond with residues in the active site or with a
coenzyme. The formation of the covalent bond is transient, and after completion of the reaction the enzyme is
reverted to its original state, and so remains a catalyst. This type of catalysis is particularly common among
enzymes that catalyse group transfer reactions.
Covalent catalysis typically takes place by means of a “ping-pong” mechanism, where the first substrate is bound
and its product is released prior to the binding of the second substrate (refer to figure 7-4 in Murray and the figure
below).
61
BMI2601/001/4/2017
Figure 4.4: Covalent catalysis by a “ping-pong” mechanism

(http://commons.wikimedia.org/wiki/File:Ping_Pong_Mechanism_1.jpg)
Chymotrypsin
Chymotrypsin is a digestive enzyme that breaks down proteins and polypeptides in the intestines. It is a serine
protease, and preferentially cleaves peptide bonds following a large hydrophobic amino acid (e.g. tyrosine,
tryptophan, or phenylalanine). This is because the large residues fit snugly into a large hydrophobic pocket near
the active site. It will also cleave peptide bonds following leucine and methionine, although at a slower rate.
Chymotrypsin is synthesised in the pancreas in an enzymatically inactive form called chymotrypsinogen, and is
activated by the enzyme trypsin. The active site of chymotrypsin contains three important catalytic residues:
serine 195, histidine 57 and aspartate 102 (you can see this in figure 4.5). Although the three residues are far
apart in the primary structure, residues 57, 102 and 195, they are close together in the three-dimensional
structure.
Chymotrypsin cleaves peptide bonds in a substrate by attacking the carbonyl carbon of the peptide bond with a
powerful nucleophile, the serine 195 residue. The serine 195 becomes covalently bonded to the substrate,
forming an enzyme–substrate intermediate (refer to figure 7-7 in Murray). Histidine 57 and aspartate 102 then
work together to activate a water molecule, forming a hydroxide ion. The resulting hydroxide ion then attacks the
carbonyl carbon of the serine-bound acyl group, releasing the carboxyl terminal peptide, which returns the
enzyme to its original state.
62
BMI2601/001/4/2017
Figure 4.5: Structure of chymotrypsin showing the catalytic residues (red)

(http://en.wikipedia.org/wiki/File:Triad_Divergence.png)
The following article also contains further information about enzyme catalysis by serine proteases:
http://www.nature.com/scitable/topicpage/enzyme-catalysis-the-serine-proteases-nbsp-14398894. Although you
do not have to read this article, you may find it interesting.
4.4.6 Activity 4.4
a) Which amino acid residues generally participate in covalent catalysis?

b) Describe a “ping-pong” mechanism, and illustrate it by means of a sketch.
c) Describe the mechanism of action of chymotrypsin. What role does each of the three catalytic residues
play?
The amino acid residues that generally participate in covalent catalysis are mentioned in the section, “Covalent
catalysis” on page 60 of Murray.
If you are having problems describing a “ping-pong” mechanism, look in the index of the textbook for the section
describing this type of mechanism.
Did you describe the mechanism of action of chymotrypsin in the way I described the mechanism of action of HIV
protease in the feedback on activity 4.3? Read through the textbook and the learning guide; also consider figure
7-7 and describe what is happening during the catalytic process.
63
BMI2601/001/4/2017
4.5 Enzymes in medicine
Enzymes are the main molecules targeted by therapeutic agents (that is, substances such as drugs that are used
for therapy). Most antibiotics inhibit enzymes that are essential to microbial pathogens, in that way either killing
them or stopping them from growing. High throughput screening can be used to analyse the effects of thousands
of molecules on the activity of a given enzyme. This can be used to detect inhibitory compounds that can
potentially be used as drugs.
Appropriate enzyme function is essential if the various biochemical pathways in the body are to function correctly.
Any malfunction (mutation, overproduction, underproduction or deletion) of a single critical enzyme can lead to
illness. We can see how important enzymes are from the fact that the malfunction of just one type of enzyme out
of the thousands of types present in our bodies can result in lethal illness.
The analysis of enzymes in the body can be used to diagnose a number of diseases or to follow the progress of a
disease. Although many enzymes exist naturally in the blood (clotting factors are an example), most enzymes are
found within the cells of the body. When there is tissue damage or in the case of certain diseases, some cellular
enzymes may be released into body fluids, such as the blood or urine. These enzyme levels can be easily
monitored and used in the diagnosis of various diseases. For example, myocardial infarction is often diagnosed
by monitoring the levels of certain enzymes in the blood. The presence of troponin in the blood plasma is also
used as an indication of damage to heart muscle.
A number of enzymes used in clinical diagnosis of disease are listed in table 7-2 in Murray. Detection of catalytic
activity is not absolutely specific for a particular illness, as sometimes a number of different illnesses may result in
changes in a specific enzyme activity. This means that enzyme data is just a clue, and we should use it in
conjunction with other clinical data.
4.5.1 Activity 4.5
a) Explain why it is important to study the structure and functions of enzymes.

b) Discuss the use of enzymes in the diagnosis of myocardial infarction.
c) What is troponin? If a technician detects increased serum troponin levels, what is the most likely cause?
4.6 Regulation of activity
Organisms have the ability to maintain a constant intracellular environment regardless of changes in the external
environment. This is referred to as homeostasis. Enzymes are crucial for catalysing chemical and physical
changes within cells, and so the regulation of enzyme activity is important for maintaining homeostasis.
64
BMI2601/001/4/2017
Many diseases are due to problems with the regulation of particular enzymes. Regulatory dysfunctions resulting
from pathogenic agents or genetic mutations are known to play a role in the initiation or progression of many
forms of cancer and some forms of diabetes, and have also been implicated in cystic fibrosis and Alzheimer’s
disease. This makes understanding how enzymes are regulated essential for understanding the molecular basis
of disease.
Regulation of an enzyme pathway does not mean that every enzyme in that pathway must be regulated; rather, a
few key enzymes can be controlled. In an enzyme pathway, the product of one step becomes the substrate for
the next step, and so forth. This means that the whole pathway can be regulated by managing the first enzyme in
the pathway.
Metabolite flow and the maintenance of homeostasis can be controlled either passively or actively. Changes in
substrate level represent a passive method for controlling metabolic pathways, because if there is limited
substrate, the production of metabolites will be reduced. However, regulation through control of substrate levels
is inadequate, and other mechanisms are used to actively regulate enzymatic activity.
It is more efficient to regulate metabolic pathways by controlling key enzymes that are involved in rate-limiting
steps. This can be done by:
• changing the quantity of enzyme present; or by
• altering the intrinsic catalysis efficiency of the enzyme molecules themselves.
There are five main ways that enzyme activity is controlled in the cell. These are
• compartmentalisation
• enzyme production and degradation
• irreversible or reversible covalent modification
• allosteric control (regulated by inhibitor or activator binding)
• activation owing to environmental change
4.6.1 Compartmentalisation
In eukaryotes, different metabolic pathways occur in different cellular compartments. There is a differential
distribution of enzymes and metabolites in separate cell structures or organelles. For example, fatty acid
biosynthesis takes place in the cytosol, and fatty acid oxidation takes place within mitochondria. If we are able to
control the metabolites in the different compartments, we are able to influence the rates of the enzyme catalysed
reactions.
4.6.2 Enzyme production and degradation
Enzymes are proteins. They are continuously being synthesised and degraded within a cell, in a process called
protein turnover. Therefore, to maintain a constant amount of enzyme, the rate of synthesis needs to match the
rate of degradation.
65
BMI2601/001/4/2017
The synthesis of an enzyme can be influenced by controlling transcription and translation of the enzyme genes.
Transcription of the genes that encode for enzymes can be enhanced by the presence of inducers and
suppressed in the presence of repressor molecules. The repressor and inducer molecules are generated in
response to changes in the environment. This will change the amount of enzyme available.
The rate at which enzymes are degraded can also be controlled, changing the concentration of enzyme within the
cell. In animals the ubiquitin protease pathway is responsible for the degradation of defective protein molecules
and for controlling the degradation of certain selected cellular proteins.
4.6.3 Covalent modification
Covalent modifications that regulate enzyme activity may be either reversible or irreversible. Phosphorylation and
partial proteolysis are two common methods used to control the catalytic activity of enzymes
• Phosphorylation is an example of a reversible covalent modification, as the enzyme can be restored to
its original state.
• Proteolysis is classified as an irreversible covalent modification, as the two sections of protein cannot be
re-joined.
Irreversible covalent modification
A number of proteins are synthesised as inactive precursor enzymes (proenzymes) or zymogens that are
irreversibly transformed into active enzymes by selective proteolysis.
• Some digestive enzymes are secreted as zymogens, and later converted to active enzymes.
• Chymotrypsinogen is produced in the pancreas in inactive form, and converted in the small intestine to
the active form chymotrypsin by trypsin.
• Coagulation factors are often synthesised as inactive proteins; blood clotting requires a series of
proteolytic activations involving several proteins.
Reversible covalent modification
Of the covalent modifications that regulate protein function, phosphorylation is the most common. Proteins are
phosphorylated by protein kinases, and dephosphorylated by protein phosphatases. Many enzymes of
intermediary metabolism are affected by phosphorylation. Phosphorylation can either increase an enzyme’s
catalytic efficiency, converting it to its active form, or convert an enzyme to its ineffective form (refer to table 9-1
in Murray). Read the section, “Protein phosphorylation is extremely versatile” on page 91 in Murray.
4.6.4 Activity 4.6
66
BMI2601/001/4/2017
a) In your own words, explain how proenzymes or zymogens facilitate the rapid mobilisation of activity in
response to a physiological demand. Specifically mention blood clotting.
b) Discuss the activation of prochymotrypsin (chymotrypsinogen) by selective proteolysis. Be sure to
mention any conformational changes that occur.
c) Describe how protein kinases phosphorylate proteins (you will find figure 9-7 and the associated text in
Murray a great help). Which amino acid residues do they typically phosphorylate?
d) Cells often regulate enzyme activity by means of phosphorylation. Why is this the case? Be sure to
discuss the ease of interconversion and how the chemical properties of the phosphoryl group can affect
the enzyme.
Did you read the section, “Proteases may be secreted as catalytically inactive proenzymes” on page 89 in
Murray? You would have found the answers to questions a) and b) there.
Phosphorylation is discussed in the next section in the textbook.
4.6.6 Allosteric control
Allosteric effectors bind to parts of enzymes other than the active site reversibly by noncovalent forces. This
binding changes the conformation of the enzyme in such a way that its activity is either inhibited (typically
because the substrate(s) can no longer bind the active site) or activated (the active site can now accommodate
the substrate(s)). Refer to the figures below showing inhibition of enzyme activity by an allosteric effector and a
non-allosteric inhibitor.
Figure 4.6: A diagram showing inhibition by an allosteric effector. Binding of the inhibitor at an allosteric site
induces a conformational change in the active site. (Image modified from
http://commons.wikimedia.org/wiki/File:Allosteric_competitive_inhibition_3.svg)
67
BMI2601/001/4/2017
Figure 4.7: Diagram showing non-allosteric inhibition, where an inhibitor binds the active site, inhibiting activity
(http://commons.wikimedia.org/wiki/File:Competitive_inhibition.svg)
Allosteric effectors work by altering the substrate-binding properties of the catalytic site, with positive effectors
enhancing substrate binding, and negative effectors reducing substrate binding.
Feedback inhibition
Feedback inhibition occurs when a product of a multistep biosynthetic pathway binds to an enzyme that catalyses
one of the early steps in the pathway (refer to figure 4.8 below). Feedback inhibitors usually have no structural
similarities to the substrates of the enzymes they inhibit. They therefore bind to sites other than the active site,
and are allosteric inhibitors. Enzymes that are allosterically inhibited are often the first enzymes in a long
metabolic pathway, so energy is not wasted making products that will not be used.
(http://commons.wikimedia.org/wiki/File:Feedback_inhibition.svg)
Allosteric sites may be used as drug targets. If a drug can be manufactured that binds an allosteric site that
inhibits the activity of an enzyme, then this molecule can be used to reduce the activity of that enzyme without
having to bind directly to the active site.
68
BMI2601/001/4/2017
4.6.7 Activity 4.7

a) Define the term “allosteric site”.
b) In your own words, explain feedback inhibition.
c) Read the section, “Feedback regulation is not synonymous with feedback inhibition” on page 88 in
Murray, and explain the difference between feedback inhibition and feedback regulation.
4.6.8 Activation due to environmental change
Some enzymes become activated or deactivated when they enter a different environment, such as when they
move from high pH to low pH. For example, the enzymes in the lysosome are active only at low pHs, and if they
leave the lysosome and enter the cytoplasm, they become inactive.
4.6.9 Activity 4.8
This is a discussion activity that you must answer in the Discussions tool on the module web site. To do this,
click on the forum “Module-related discussions”, and then on the topic “Activity 4.8: Enzymes in industry”. If you
do not have internet access, you can do the activity in writing and add it to your portfolio.
Do an internet search, or consult other relevant resources, and identify at least one product that you use in your
daily life that contains enzymes or requires purified enzymes for its manufacture. Do not select a product
manufactured with the use of microorganisms, but one that uses purified proteins or enzymes. Which enzymes
are used, and how do they contribute to the manufacture of the product?
Post a summary of your findings in the Discussion space.
Also read the postings by other students, and respond to at least one of these. Mention anything you found
particularly interesting about the other posting, or ask for clarification or more details of any aspect if you wish.
4.7 Conclusion
There are thousands of enzymes in the human body, all interacting to generate the molecules required for life.
Now that you have completed this learning unit you should have a greater understanding of how enzymes work
and how they catalyse reactions to bring about specific biochemical changes. You should also realise that if a
person has an enzyme deficiency or if an enzyme is functioning incorrectly, this can result in defects in metabolic
pathways and may cause disease. If we understand how specific enzymes function, this can also help us design
drugs that could be used to modulate the activity of various enzymes.
69
BMI2601/001/4/2017
Learning unit 5: Protein expression
5.1 Introduction
For an organism to survive, the information in the DNA needs to be converted into a functional form – in other
words, the genes need to be expressed. All cellular organisms use the same basic mechanism of gene
expression:
• When a particular gene is expressed, the relevant region of DNA is unwound and copied into an RNA
molecule. This process is called transcription.
• If the gene encodes for a protein, mRNA is produced. The mRNA is then read by a ribosome to form a
protein in a process called translation.
Therefore, protein coding regions of DNA are not converted directly into proteins, but are first converted into an
intermediary mRNA molecule.
In this learning unit I will start by discussing the structure of DNA and RNA and the process of transcription,
during which RNA is synthesised. I will then talk about how proteins are synthesised from mRNA during
translation. Finally we will briefly look at the regulation of gene expression. To complete the learning unit, you will
need to refer to chapters 34, 36 and 37 in Murray. In the text, I have also given you some internet sources that
you may find interesting and helpful.
• describe and draw the different nucleotides found in DNA

• describe the structure of DNA
• distinguish between and describe the functions of a number of different types of RNA that are produced
in cells
• explain how RNA is synthesised using DNA as a template (transcription)
• discuss RNA processing, including splicing of mRNA
• explain how the codons of mRNA determine the amino acid sequence of a protein, and ensure that you
can use a codon usage table to determine the protein sequence from an RNA sequence
• explain how tRNAs act as adaptor molecules during translation
• explain how RNA is translated to form proteins
• distinguish between point mutations and frameshift mutations in DNA and explain how these mutations
can result in silent mutations, missense mutations and nonsense mutations in protein sequences
5.3 Structure of DNA
All living organisms grow and develop according to the information in their genetic material. The genetic material
is DNA, and it can be divided into short segments of DNA called genes, which encode for all proteins and
70
BMI2601/001/4/2017
functional RNA chains. Genes contain the information needed to construct and sustain an organism's cells and
determine the characteristics of the organism.
All organisms have a mixture of biological traits. Some of these are clearly visible, such as number of fingers or
hair colour, and some are not, such as blood type or increased risk for specific diseases. These traits are
encoded for by the genes and are passed on from one generation to the next through the hereditary molecule,
DNA.
Read the sections, “DNA contains four deoxynucleotides”, “The denaturation of DNA is used to analyse its
structure” and “Renaturation of DNA requires base pair matching”, in chapter 34, pages 343–346 in Murray.
Ensure that you are able to:

• recognise and describe the structure of DNA
• draw the structures of the nucleotides that are present in DNA
• describe DNA base pairing and draw structures showing the hydrogen bonds that form between base
pairs
• describe the forces that hold the double helix together
• discuss the denaturation and renaturation of DNA and the conditions in which denaturation and
renaturation occur
Figure 5.1: Structure of RNA and DNA and the nitrogenous bases they contain
(http://commons.wikimedia.org/wiki/File:Difference_DNA_RNA-EN.svg)
71
BMI2601/001/4/2017
5.4 Structure of RNA
The chemical nature of RNA differs from that of DNA, in that RNA
• contains ribose rather than deoxyribose sugars
• typically contains the ribonucleotide uracil instead of thymine
• generally exists as a single strand, but is capable of folding to form different structures
• can be hydrolysed by alkali to 2’,3’ cyclic diesters
Cells produce four major classes of RNA (refer to table 36-1 in Murray). These are:
• messenger RNA (mRNA), which is the message for protein synthesis
• transfer RNA (tRNA), which carries the amino acids during protein synthesis
• ribosomal RNA (rRNA), which forms important parts of the ribosome
• small RNAs, which include the small nuclear RNAs (snRNAs), involved in rRNA and mRNA processing,
and micro-RNAs (miRNAs) and the small interfering RNAs (siRNAs), which are both involved in
regulating gene expression
Read the section, “Nearly all the several species of stable, abundant RNAs are involved in some aspect of
protein synthesis” and the sections on each type of RNA molecule on pages 348 to 352 in Murray.
5.4.1 Activity 5.1
Remember, this could serve as part of the summary you could use in preparing for the exam!
a) Describe the structure of DNA.

b) Draw structures showing the base pairing that occurs between the nucleotides found in DNA.
c) In what respects does RNA differ from DNA? Discuss differences in the sugar group, the nucleotides
and the double and single stranded nature of the two molecules.
d) Describe each of the different types of RNA that are produced in cells.
Did you mention the following factors when describing the structure of DNA?
• what nucleotides can be found in DNA
72
BMI2601/001/4/2017
• complementary base pairing

• the role of hydrogen bonding, and van der Waals and hydrophobic interactions in maintaining the
structure of DNA
• antiparallel, template, noncoding and coding strands
• phosphodiester bonds
The structures you drew showing the base pairing that occurs between the nucleotides found in DNA should be
similar to figure 34-3 in Murray.
When describing the different types of RNA that are produced in cells (messenger RNA, transfer RNA, ribosomal
RNA and small RNAs), did you describe the structures, functions and abundance of each type of RNA molecule?
5.5 RNA synthesis (transcription)
Figure 5.2: Diagram showing the synthesis of RNA from DNA

(http://commons.wikimedia.org/wiki/File:Transcription_both_strands.png)
Transcription is the process of converting a portion of DNA into an RNA copy. It involves the unwinding of a
section of the DNA helix while RNA polymerase catalyses the formation of a RNA chain complementary to the
DNA. The reaction that is catalysed by the RNA polymerase occurs in the 5’-3’ direction. If mRNA is produced, it
is read by a ribosome to form a protein in a process called translation.
Transcription in bacteria is simpler than in eukaryotes, so that is the topic I will start with. RNA polymerase, or
DNA-dependent RNA polymerase, is an enzyme that catalyses the formation of RNA using DNA as a template
(you will see this in figure 36-2 in Murray). The bacterial RNA polymerase enzyme is made up of the core enzyme
and the σ factor. The σ factor is not involved in catalysis, but it helps the enzyme recognise the promoter region
(this is the sequence of nucleotides that indicates where RNA synthesis must begin).
When the σ factor and core enzyme are joined together, the result is referred to as the RNA polymerase
holoenzyme. The holoenzyme is required to start transcription, but only the core enzyme is required to continue
synthesis of the RNA.
73
BMI2601/001/4/2017
5.5.1 The transcription process
The transcription process can be divided into three stages. These are:
• initiation (binding of the holoenzyme, opening of the helix, addition of first nucleotides)
• elongation (the length of the RNA chain is extended)
• termination (signals indicate the end of transcription and the RNA is released)
I will say more about each of these in the sections that follow.
5.5.1.1 Initiation
When the RNA polymerase holoenzyme comes into contact with a promoter, it binds tightly to the DNA. The σ
factor helps the RNA polymerase recognise the promoter region.
Different σ factors will recognise different promoters. This differential recognition helps to control which genes are
transcribed.
The RNA polymerase holoenzyme then unwinds and opens a region of the DNA. This is referred to as the
preinitiation complex. One of the exposed DNA strands then acts as the template for the start of transcription.
After the synthesis of approximately 10 nucleotides of RNA in the 5’ to 3’ direction, the σ factor dissociates. The
initiation step is important as a regulatory step; if transcription is not initiated, then the gene will not be expressed.
Bacterial promoter sequences are described in the section, “Bacterial promoters are relatively simple” on page
382 in Murray.
5.5.1.2 Elongation
After initiation the RNA polymerase shifts to elongation mode, where consecutive ribonucleotides are added to
the growing chain in the 5’ to 3’ direction in the order specified by the template strand. In bacteria, chain
elongation continues at a rate of approximately 50 nt/sec (nucleotides per second).
Figure 5.3: Elongation of RNA transcript. RNAP is the RNA polymerase.

(http://commons.wikimedia.org/wiki/File:Simple_transcription_elongation1.svg)
74
BMI2601/001/4/2017
5.5.1.3 Termination
The final step is termination, which is directed by a termination sequence in the DNA. During termination the RNA
polymerase stalls, and the DNA and RNA chains are released. In some instances a factor called the rho factor is
required for termination. The RNA polymerase can then bind a new σ factor, and the process is repeated with the
same or a different gene.
Figure 5.4: Termination of transcription

(http://commons.wikimedia.org/wiki/File:Simple_transcription_termination1.svg)
a) Define the terms “downstream” and “upstream” in the context of DNA sequences.
b) Read the section, “RNA synthesis is a cyclical process and involves RNA chain initiation, elongation and
termination” on page 381 in Murray and describe transcription in bacteria.
c) Describe the structure and catalytic activity of DNA-dependent RNA polymerase.
d) What is the role of the σ factor in transcription?
e) Describe bacterial promoters.
In your discussion of the structure and catalytic activity of DNA-dependent RNA polymerase, did you mention that
it is a multi-subunit enzyme and requires a σ factor to form the holoenzyme? With regard to its function, did you
mention that it catalyses the polymerisation of ribonucleotides into a sequence that is complementary to a DNA
sequence? The role of the σ factor in transcription is discussed in the section, “Bacterial DNA-dependent RNA
polymerase is a multisubunit enzyme” on pages 379 and 380 in Murray.
Bacterial promoter sequences are described in the section, “Bacterial promoters are relatively simple” on page
382 in Murray. When describing bacterial promoters, did you mention the consensus sequence and TATA box,
and the function of the AT rich region?
75
BMI2601/001/4/2017
5.5.2 Transcription in eukaryotes
We will not ask you to describe transcription in eukaryotes in more detail than I supply in this learning unit, and
you do not need to refer to the textbook for this section.
Transcription in eukaryotes is more complex than in bacteria, and is performed by three different RNA
polymerases.
The three major RNA polymerases in eukaryotes are:
• RNA polymerase I, which transcribes genes encoding tRNAs, rRNAs and other small RNAs
• RNA polymerase II, which transcribes most genes, including protein encoding genes
• RNA polymerase III, which transcribes genes encoding tRNAs, rRNAs and other small RNAs
RNA polymerase II, which transcribes most genes, requires a number of general transcription factors to initiate
transcription. This makes it different from the bacterial RNA polymerase, which requires just the σ factor. Once
the RNA polymerase has started transcription, most of the general transcription factors are released.
RNA polymerase II also requires activator, mediator and chromatin modifying proteins when transcribing DNA in
eukaryotic cells.
• The transcription activator proteins bind sequences in the DNA to help sequester the RNA polymerase
to the start of transcription.
• The Mediator protein helps the RNA polymerase II to interact with the activator proteins and general
transcription factors.
• The chromatin modifying proteins help the RNA polymerase II manage the complex packaging of the
DNA. They alter the histones, and therefore change the chromatin structure that influences gene
transcription.
These proteins are all important in the regulation of gene expression.
The link http://www.youtube.com/watch?v=SMtWvDbfHLo will take you to an amazing video showing the
transcription process in eukaryotes. It is well worth watching.
5.5.2.1 mRNA processing
mRNA produced by eukaryotes undergoes a number of processing steps within the nucleus. The mRNA is
modified by the addition of a 5’ cap and a 3’ poly-A tail, and the introns are removed in a process called RNA
splicing.
The 5’ end of the mRNA molecule is modified by the addition of a methylated guanine cap. The 5’ cap helps the
cell to distinguish the mRNAs from the other RNAs that are produced in the cell, as only the mRNAs are capped.
76
BMI2601/001/4/2017
The 3’ end is polyadenylated, which results in the addition of a number of adenine residues, known as the poly-A
tail.
The modification of the 5’ and 3’ ends of the mRNA also protect the mRNA from nuclease attack.
In the following sections we look in more detail at RNA splicing and RNA editing.
5.5.2.1.1 RNA splicing
In eukaryotes the RNA molecules transcribed contain both coding (exon) and noncoding (intron) sequences. So,
before the RNA can be translated into a protein, the introns need to be removed in a process termed splicing
(you can see this in figure 5.5).
Figure 5.5: RNA splicing (http://commons.wikimedia.org/wiki/File:Eukaryotic_Transcription_.svg)
There are a number of mechanisms for splicing immature RNA. The most common method used in eukaryotic
cells involves a multicomponent complex called the spliceosome. The spliceosome contains five snRNA
molecules and over 60 different proteins. We think that the function of the snRNAs is to position the RNA
molecule for splicing.
• Splicing is initiated with a cut at the junction between the 5’ exon and intron (refer to figure 36-13 in
Murray and figure 5.6 below). This occurs when a specific nucleotide within the intron performs a
nucleophilic attack on the 5’ splice site.
• The free 5’ end then forms a loop called the lariat structure.
• The 3'OH of the released 5' exon then performs a nucleophilic attack at the 3' splice site.
77
BMI2601/001/4/2017
• The exons are joined, resulting in a continuous sequence with the intron removed.
In genes containing multiple introns, the process is repeated until all the introns have been removed.
Figure 5.6: Diagram illustrating the steps of RNA splicing resulting in the formation of spliced mRNA and the
intron lariat (http://en.wikipedia.org/wiki/File:RNA_splicing_reaction.svg)
mRNA can undergo alternative splicing. Alternative splicing results in the formation of different mature mRNA
molecules. When these are translated, they will produce different proteins (refer to figure 36-15 in Murray).
Defects in splicing can result in disease. For example, β-thalassemia is a disease in which not enough β-globin
protein is synthesised. This could result in anaemia. Some forms of β-thalassemia are caused by defects in the
splicing of the gene that encodes for the β-globin protein. As a consequence, the normal translation reading
frame of the mRNA is disrupted, and the β-globin protein is not produced in a functional form.
The following YouTube video shows the RNA splicing process:

https://www.youtube.com/watch?v=aVgwr0QpYNE.
5.5.2.1.2 RNA editing
RNA editing is a process where the sequence of an mRNA molecule is changed after it has been transcribed,
and the resultant RNA molecule will have a sequence that is different from the original transcribed RNA
sequence. Refer to the section, “RNA editing changes mRNA after transcription” on page 393 in Murray.
The genes in bacteria do not contain introns, and transcription and translation are often coupled. In that case,
translation of the mRNA begins before transcription is complete. In eukaryotes the mRNA is first modified and
transported from the nucleus to the cytoplasm, and so translation starts only after transcription is complete.
78
BMI2601/001/4/2017
a) Briefly describe how eukaryotic mRNAs are modified.

b) Describe how mRNA is spliced in eukaryotes.
c) Explain how alternative RNA splicing can result in the formation of different mRNA molecules.
d) Describe how the apolipoprotein B (apoB) gene undergoes mRNA editing in the intestine to produce a
smaller protein.
When explaining splicing, did you mention introns, exons, the spliceosome and the formation of the lariat
structure?
Alternative RNA splicing is described in the section, “Alternative splicing provides for different mRNAs” and is
clearly illustrated in figure 36-15 on page 391 in Murray.
The mRNA editing of the apolipoprotein B (apoB) gene is described in the section, “RNA editing changes mRNA
after transcription”.
5.5.3 Processing of rRNA and tRNA
Recommended reading: the section entitled, “Both ribosomal RNAs and most transfer RNAs are processed
from larger precursors”, chapter 36, pages 391–392 in Murray.
Ribosomal RNAs and most tRNAs are processed from large precursor molecules. In humans the three rRNA
molecules (28S, 18S and 5.8S) are transcribed as a single large precursor molecule. This is then processed to
produce the three separate rRNA molecules.
Many tRNAs are also synthesised as large precursor RNA molecules that are then processed to produce the
mature tRNA molecules.
5.6 Translation
Many genes in a cell encode for mRNAs that serve as templates for the production of proteins. In biology,
translation is the process where the information in the mRNA sequence, which contains four different subunits, is
converted into an amino acid sequence containing 20 different subunits. The resulting polypeptide chain then
folds into a three-dimensional structure forming the active protein.
Read the section, “Genetic information flows from DNA to RNA to protein”, on page 395 in Murray.
79
BMI2601/001/4/2017
In the sections that follow, I discuss important aspects of the translation process with you.
5.6.1 The mRNA sequence is decoded in sets of three nucleotides
Because DNA and RNA are similar, the DNA can act as a direct template for the synthesis of RNA by
complementary base pairing. This is not the case when RNA is translated to form proteins. During translation the
mRNA sequence is decoded using sets of three nucleotides called codons (this is illustrated for you in figure 5.7).
There are 64 possible codons. Of these, 61 code for a specific amino acid, while the other 3 do not code for any
amino acid, and are referred to as nonsense codons. The nonsense codons signal a stop to translation.
Figure 5.7: Diagram showing the codons specified by an mRNA molecule (http://en.wikipedia.org/wiki/File:RNA-
codons.png)
The codons do not bind directly to the amino acids; instead, tRNAs act as adaptor molecules that recognise both
the codon, in the RNA, and the amino acid. tRNAs are about 80 nucleotides in length (you can see these in figure
5.8) and have an acceptor stem, which binds to a specific amino acid, and an anticodon loop, which binds to a
specific codon on the mRNA . Enzymes called aminoacyl-tRNA synthetases couple each amino acid to the
correct tRNA molecule.
80
BMI2601/001/4/2017
Figure 5.8: Structure of a tRNA molecule (http://commons.wikimedia.org/wiki/File:TRNA-Phe_yeast_en.svg)
The anticodon of the tRNA is the region that binds to the codon of the mRNA. Which codon sequence
corresponds to which amino acid is referred to as the genetic code. It is a code because if you know which codon
sequences encodes for which amino acid, then you can determine the protein sequence from the DNA or RNA
sequence.
We use a codon usage table to predict the amino acid sequence of a protein from the DNA sequence of a gene.
Table 37-1 in Murray and table 5.1 in this learning unit are codon usage tables. Refer to the tables and see
whether you can determine which codons code for each amino acid. For example, if you have the RNA sequence
AUGCUUCAUAGAUGA, this will encode for the peptide with the sequence Met, Leu, His, Arg. The last codon is
a stop codon, and does not encode for an amino acid.
Table 5.1: Codon usage table (http://openwetware.org/wiki/CH391L/S12/TranslationRBSandCodons)
81
BMI2601/001/4/2017
Each type of tRNA molecule can be bound to only one specific amino acid, although some tRNAs can recognise
more than one codon. Because some tRNAs can base pair with more than one codon, it is possible to match 20
amino acids to 61 different codons (there are 64 possible codons, but 3 are stop codons) with only 31 different
tRNAs. The actual number of tRNAs present is different in every organism.
5.6.2 Reading frame
The genetic code is non-overlapping with no punctuation, and once reading is started at a specific codon the
sequence is read in a continuing sequence of nucleotide triplets. Therefore, there are three possible reading
frames in an mRNA sequence. Figure 5.9 shows this.
Figure 5.9: There are three possible reading frames in an mRNA sequence. (1)
AGG•TGA•CAC•CGC•AAG•CCT•TAT•ATT•AGC, (2) A•GGT•GAC•ACC•GCA•AGC•CTT•ATA•TTA•GC and (3)
AG•GTG•ACA•CCG•CAA•GCC•TTA•TAT•TAG•C. Each will encode for a different protein sequence. Which
reading frame is read will depend on where translation begins.
(http://en.wikipedia.org/wiki/File:Reading_Frame.png)
5.6.3 Activity 5.4
a) The genetic code is said to be degenerate, unambiguous, non-overlapping, without punctuation and
universal. Explain each aspect of this statement.
b) What is the sequence of the polypeptide translated from the mRNA with the following sequence:
AUGGCUCGAAUUGCUUCUUAA?
c) Explain the difference between a codon and an anticodon.
d) What is meant by reading frame? Draw a diagram showing the three reading frames for the sequence in
question a).
e) What is the function of a tRNA molecule?
f) The genetic code is said to be universal except for a few exceptions. Where in humans is the genetic
code different?
82
BMI2601/001/4/2017
The answer to the first question can be found on page 396 of the textbook. Did you define each of the terms with
regard to the genetic code?
Were you able to easily read the codon usage table to translate the mRNA sequence? Ensure that you
understand how to use a codon usage table.
After reading the section on the genetic code in the textbook, you should have found that the genetic code may
be different in the mitochondria of human cells. The mitochondria contain their own separate and distinct
translation machinery which reads four codons differently from the way they are read in the nucleus.
5.6.5 Mutation
When the DNA sequence is changed in some way, this process is called a mutation. When the DNA is
transcribed into RNA, the RNA molecule will also contain the mutation.
A point mutation is a single base change, and may have a number of effects when an mRNA molecule is
translated into a protein. Point mutations may be silent mutations, missense mutations or nonsense mutations.
Sections of DNA can also be inserted or deleted, resulting in mutations. Depending on how many nucleotides are
inserted or deleted, a frameshift mutation could result (refer to figure 37-5 in Murray).
5.6.6 Activity 5.5
a) Describe what silent mutations, missense mutations and nonsense mutations are, and state the effects
of each type of mutation.
b) Discuss the difference between acceptable, partially acceptable and unacceptable missense mutations.
c) Discuss deletion and insertion mutations. Be sure to mention frame shifts and the insertion or generation
of a nonsense codon. Refer to figure 37-5 in Murray to help you.
5.6.7 The translation process
We know that amino acids are joined to tRNA molecules that can also bind mRNA, but how are the amino acids
joined together to form proteins?
83
BMI2601/001/4/2017
During protein synthesis, each amino acid is joined by a peptide bond. This reaction is catalysed by the
ribosome, a complex macromolecular machine made from ribosomal RNAs (rRNAs) and more than 50 different
proteins. Ribosomes are made up of two subunits, one small and one large.
Figure 5.10: Structure of a ribosome showing its two subunits, the large (red) and small (blue)
(http://en.wikipedia.org/wiki/File:Ribosome_shape.png)
Like transcription, translation can be divided into three stages. These are:
• chain initiation
• chain elongation
• chain termination
The link http://www.youtube.com/watch?v=TfYf_rPWUdY is to a video showing the translation process. Although

it is not essential that you watch the video, I really would encourage you to do so.
The sections that follow describe the various steps in the translation process.
5.6.7.1 Initiation
Initiation at the correct nucleotide is important, because if initiation is shifted over by a nucleotide, the translation
will no longer be in frame.
Translation always begins at the codon AUG, and a specific tRNA, the initiator tRNA, is required to start
translation. The initiator tRNA carries the amino acid methionine. (In bacteria it is modified to formylmethionine.)
Although methionine is the first amino acid in any new protein, the methionine residue may be removed after
translation, and so there is a possibility that it may not be present in the mature protein.
During initiation, initiation factor proteins bind to the small subunit of the ribosome forming the preinitiation
complex. This complex and the methionine-carrying tRNA then bind to the mRNA, forming the initiation complex.
After the initiation complex is formed, the large ribosomal subunit binds to the complex and the initiation factors
are released. The large ribosomal subunit has three sites where tRNAs can bind. They are the aminoacyl site (A
site), the peptidyl site (P site) and the exit site (E site). At this stage, the met-tRNA will occupy the P site.
84
BMI2601/001/4/2017
5.6.7.2 Elongation
During elongation, a charged tRNA enters the A site of the ribosome. To see this, have a look at figure 37-9 in
Murray. If the tRNA is the correct one, and the anticodon of the tRNA is complementary to the codon in the A site,
peptidyl transferase will catalyse the formation of a peptide bond between the amino acid in the A site and the
amino acid in the P site.
The ribosome then moves one codon down, in a process called translocation, so the tRNA that was in the A site
moves to the P site, and the tRNA that was in the P site moves to the E site. The E site is the site where the
tRNA that has given up its amino acid remains before it is released back into the cytoplasm. The A site is now
empty, and is ready to receive the next charged tRNA.
This process is repeated, and new amino acids are added to the polypeptide chain until all the codons in the
mRNA have been read. The elongation process is aided by a number of elongation factors.
5.6.7.3 Termination
Once the polypeptide has been fully translated, it needs to be released from the ribosome.
There are three termination codons, namely UAG, UAA and UGA. They do not have matching tRNAs, and signal
the ribosome to stop translating. Release factors, a type of protein, bind to the ribosome with a stop codon in the
A site, causing the polypeptide and mRNA to be released from the ribosome (have a look at figure 37-10 in
Murray). The inactive ribosome complex then dissociates into its two subunits, which are ready for another round
of translation.
Multiple ribosomes can bind to the same RNA molecule to form what is called a polyribosome.
The translation process in both prokaryotes and eukaryotes is similar, although the initiation, elongation and
termination factors are different.
5.6.7.4 Post-translational processing
In eukaryotes, proteins destined for export to specific parts of the cell or from the cell have leader sequences at
their N-terminal ends. These leader sequences are recognised and direct the proteins to their proper destination.
They are eventually removed by specific proteases.
Other proteins are synthesised as precursor molecules that need to be modified to become active proteins.
a) In your own words, describe the translation process. Discuss chain initiation, elongation and termination.
85
BMI2601/001/4/2017
b) What is the specific function of initiation, elongation and termination factors in the translation process?
c) Read the section, “Posttranslational processing affects the activity of many proteins”, on pages 408 and
409 in Murray, and describe the posttranslational modification of insulin and collagen.
d) Have you ever taken antibiotics? Have you ever wondered why the antibiotics kill the bacteria causing
illness, but do not harm the person taking them? There are many different types of antibiotics with
different modes of action. Certain antibiotics function by selectively killing bacteria by inhibiting protein
synthesis. Discuss how tetracycline and chloramphenicol inhibit protein synthesis in bacteria, and why
they do not affect protein synthesis in eukaryotic cells. Refer to page 409 in Murray.
5.7 Regulation of gene expression
Gene expression in living cells has an enormous influence on the properties of cells, including their structure and
functions. To avoid wasting resources, cells control the expression of their genes, as not all gene products are
required at all times. This regulation of gene expression is required for the development, differentiation and
adaption of cells.
Cells can control the expression of genes at a transcriptional level or through other mechanisms such as gene
amplification, gene rearrangement, posttranscriptional modification, RNA stabilisation, translational control,
protein modification and protein stabilisation. All of these influence the levels of active protein in the cell.
5.8 Conclusion
In summary, transcription is catalysed by DNA-dependent RNA polymerase, resulting in the formation of an

mRNA molecule. In eukaryotes, these mRNA molecules are modified to produce mature mRNA. The mRNA is
then translated by an RNA-protein complex called a ribosome. Translation requires the adapter molecule tRNA,
and results in the formation of a polypeptide chain or protein.
86
BMI2601/001/4/2017
Learning unit 6: Carbohydrates and lipids of physiological significance
6.1 Introduction
Carbohydrates are essential constituents in many biological processes. Health disorders resulting from problems
relating to carbohydrate metabolism include diabetes mellitus, galactosaemia, glycogen storage diseases and
lactose intolerance. Lipids are important in the human body because they provide energy, they are the main
component of cell membranes, and they act as electrical insulators of nerves. Fats in natural foods also contain
fat-soluble vitamins, which are essential for health.
In this learning unit we will explore the structures and functions of a number of biologically important
carbohydrates and lipids. Following a general introduction to carbohydrates, I will speak in more detail about
monosaccharides, the basic units of carbohydrates, and in particular glucose, the most important
monosaccharide. I will also tell you about disaccharides and polysaccharides, as well as glycosaminoglycans
and glycoproteins.
The second part of the learning unit is concerned with lipids. We will start with a general overview, after which we
will examine a number of different types of lipids and their biologically important derivatives, namely the fatty
acids, triacylglycerols, phospholipids, glycolipids and steroids. I will end by briefly referring to amphipathic lipids.
To complete the learning unit, you will need to refer to chapters 14 and 15 in Murray.
• explain what monosaccharides, disaccharides, oligosaccharides and polysaccharides are

• explain why monosaccharides are physiologically important
• discuss the role of polysaccharides in the human body
• distinguish between saturated and unsaturated fatty acids, and explain how the degree of saturation
influences their melting points
• describe and draw the structures of a triacylglycerol, a glycerophospholipid and sphingolipid, and
describe the function of these molecules in the body
• discuss the structure of cholesterol and its importance in the body
6.3 Carbohydrates of physiological significance
Carbohydrates are essential components in all living organisms. They have important structural and metabolic
roles. Most organic carbon on our planet is stored in the form of starch and cellulose, which are both polymers of
glucose. Glucose is produced during photosynthesis in plants, where it is stored as starch or used to synthesise
cellulose.
87
BMI2601/001/4/2017
Most carbohydrates in animals are derived from the degradation of plant materials. However, humans are able to
synthesise carbohydrates from amino acids. Glucose is the major metabolic fuel of mammals (except ruminants),
and it supplies the energy used to power most biological processes. It is the precursor molecule used for the
synthesis of all other carbohydrates in the body. These include glycogen for storage, the ribose and deoxyribose
sugars in nucleic acids and galactose in lactose in milk.
Carbohydrates are also often associated with proteins and lipids to form glycoproteins and glycolipids,
respectively.
6.3.1 Monosaccharides
The basic units of carbohydrates are known as monosaccharides. When monosaccharides are covalently linked
together, they are called disaccharides, oligosaccharides or polysaccharides.
Polysaccharides are classified according to the number of C atoms they contain, the chemical nature of their
carbonyl group and their chiral handedness. If they have an aldehyde group they are referred to as aldoses, and
if they have a ketone group they are called ketoses (refer to table 14-1 in Murray).
Monosaccharides with three carbon atoms are called trioses, those with four are tetroses, those with five are
pentoses, those with six are hexoses, and so on. According to this classification, glucose is an aldohexose (a six-
carbon aldehyde), fructose is a ketohexose (a six-carbon ketone) and ribose is an aldopentose (a five-carbon
aldehyde).
A number of the carbon atoms in a monosaccharide are chiral and asymmetric, with two possible configurations
each. As a result of this asymmetry, a variety of isomers for any given monosaccharide exist. Read the section,
“Sugars exhibit various forms of isomerization” on pages 133 and 134 in Murray, which describes the isomers of
monosaccharides.
6.3.2 Glucose
Glucose is the most common and the most biomedically important monosaccharide. It is a hexose (in other
words, it has six carbons). The structure of glucose can be presented in different ways (refer to figure 14-1 in
Murray).
The cyclic form of glucose, formed by a reaction between the aldehyde group and a hydroxyl group, is the most
thermodynamically stable form (you can see this in figure 6.1). It is the most common form found in aqueous
solution. Glucose has 4 asymmetric carbon atoms, and can form 16 different isomers.
88
BMI2601/001/4/2017
Figure 6.1: Example of a cyclic form of glucose (http://commons.wikimedia.org/wiki/File:Glucose_Haworth.png)
A variety of pentoses and hexoses are important in the body. Look at tables 14-2 and 14-3 in Murray, which show
a number of physiologically important pentoses and hexoses.
6.3.3 Disaccharides
Disaccharides form when two monosaccharides are joined by a glycoside bond. Maltose, sucrose and lactose
are three physiologically important disaccharides (refer to figure 14-11 in Murray). Table 14-4 in Murray shows
other important disaccharides, along with their clinical significance.
If people are deficient in certain enzymes, they may be unable to digest certain disaccharides. For example,
people develop lactose intolerance if they are deficient in lactase, the enzyme that catalyses hydrolysis of lactose
into glucose and galactose. As lactose is found in milk, and to a lesser extent in other dairy products, people who
are lactose intolerant may feel uncomfortable after consuming dairy products. They may experience abdominal
bloating, cramps, flatulence, diarrhoea and nausea.
Galactosaemia is a rare genetic metabolic disorder that affects an individual’s ability to metabolise the
monosaccharide galactose properly. This happens because the enzymes needed to metabolise galactose are
either severely diminished, or missing entirely. Depending on which enzymes in the metabolic pathway have
been affected, possible symptoms are liver damage, renal failure, cataracts and brain damage. Treatment
involves avoiding all foods containing galactose.
6.3.4 Activity 6.1
Remember, these activities serve as part of your preparation for the exam!
a) Draw the structures of an aldehyde and ketone group.

b) Draw a Haworth projection of an isomer of glucose.
c) How many carbon atoms do trioses, tetroses, pentoses, hexoses and heptoses have?
89
BMI2601/001/4/2017
6.3.5 Polysaccharides
Polysaccharides are usually composed of just a few types of monosaccharide components. A polysaccharide that
consists of only one type of monosaccharide is a homopolysaccharide, and a polymer that consists of more than
one type of monosaccharide is a heteropolysaccharide.
Starch is a homopolymer of glucose, and it is the main form of stored carbohydrate in plants. In the human diet it
is found in cereals, legumes, potatoes and other vegetables. Starch is made up of a mixture of two constituents:
amylose and amylopectin.
• Amylose is a linear polymer containing several thousand glucose units linked by α(1→4) bonds. It forms
a helix as a result of the bond angles between the glucose units.
• Amylopectin contains mainly α(1→4) linked glucose residues. However, it is different from amylose in
that it is highly branched, with α(1→6) branch points every 24 to 30 glucose residues.
Refer to figure 14-12 in Murray to see the structures of amylose and amylopectin. Amylopectin molecules may
contain up to two million glucose units, which makes them the largest molecules occurring in nature. Figure 6.2
shows amyloplasts, containing starch, in potato cells.
The structure of starch will determine how easy to digest (digestible) it is. The glycaemic index is a measure of
the digestibility of a starch.
Figure 6.2: Amyloplasts containing potato starch within plant cells

(http://commons.wikimedia.org/wiki/File:Potato_starch.jpg)
In the sections that follow I discuss two types of polysaccharides, namely glycogen and cellulose.
6.3.5.1 Glycogen
Glycogen is the storage polysaccharide in animals. When an animal cannot use glucose immediately for energy,
the glucose is stored as glycogen or is converted to fat. Glycogen is found predominantly in skeletal muscle and
90
BMI2601/001/4/2017
the liver, where it occurs as cytoplasmic granules. Glycogen is a polymer of glucose similar to amylopectin, but it
is more highly branched, with branching points occurring every 8 to 13 glucose residues (refer to figure 14-13 in
Murray). Muscle glycogen granules are spherical, and can contain up to 60 000 glucose residues. Glycogen is
easily converted back to glucose to provide energy to cells.
A person who has problems relating to one of the enzymes involved in glycogen synthesis or breakdown will have
glycogen storage disease, an inherited metabolic disorder. There are a number of different types of this disease,
depending on which enzymes are affected and whether the problems occur with glycogen processing in only the
liver or muscles, or both. Some types of glycogen storage disease cause few symptoms, but other forms may be
life threatening.
6.3.5.2 Cellulose
Cellulose is another homopolymer of glucose, made up of β(1→4) linked D-glucose units. It is the main
constituent of plant cell walls. Mammals lack the enzymes needed to digest cellulose, because they do not have
the enzymes required to cleave the β(1→4) bonds. Cellulose is therefore the main component of dietary fibre.
Bacteria found in the ruminant gut are able to digest cellulose, producing short-chain fatty acids. Because these
bacteria occur in the ruminant gut, cows can obtain nutrients from the cellulose found in grass.
In summary, starch and glycogen are polysaccharides that have α-glycosidic linkages and store glucose in plants
and animals. Cellulose is a polysaccharide of glucose with β-glycosidic linkages, and is a structural material of
plants.
6.3.6 Glycosaminoglycans and glycoproteins
Carbohydrates can also contain amino sugars or uronic acids to form glycosaminoglycans. If these are then
attached to proteins, they form proteoglycans. Proteoglycans are an important component of the animal
extracellular matrix that exists between cells in an organism.
Glycoproteins are proteins that contain branched or unbranched oligosaccharide chains. Serum albumin is an
example of a glycoprotein. Glycoproteins also occur in cell membranes. Glycoporin is an important glycoprotein
found in human erythrocytes. Glycoporins are rich in sialic acid, which prevents the red blood cells from adhering
to the vessel walls or other cells.
6.3.7 Activity 6.2
Remember, these activities serve as part of your preparation for the exam!
a) You have learnt a great many new terms in this unit. Skim through the sections you have covered so
far, and identify all the terms that were new to you. Then draw up your own glossary table, with the term
91
BMI2601/001/4/2017
in one column and its meaning in the second column. This will help you both when you revise these
sections, and when you answer the questions below.
b) Explain what monosaccharides, disaccharides, oligosaccharides and polysaccharides are.
c) What is meant by the glycaemic index of starchy food?
d) What is a glycoprotein?
e) Why can cows live on a diet of grass, while humans can’t? Explain your answer with reference to the
presence of α- and β-glycosidic linkages in the carbohydrates contained in plant matter.
The glycaemic index of starchy food is a measure of its digestibility. It is determined based on how much a
specific starch will raise blood glucose levels. If a starch is completely hydrolysed (broken down) into glucose, it
will have a glycaemic index of 1. If it is not digested at all, and therefore no glucose enters the blood stream, it will
have a glycaemic index of 0. Most starches have a glycaemic index somewhere between 0 and 1.
Grass contains cellulose, which contains β(1→4) linked D-glucose units. Mammals lack the enzymes necessary
to cleave the β(1→4) bonds, and so they are unable to digest cellulose. Cows are ruminants. In their gut there
are bacteria that are able to digest cellulose, producing short-chain fatty acids. Cows are then able to use these
short-chain fatty acids as a nutritional source.
6.4 Lipids of physiologic significance
Recommended reading: chapter 15, pages 140–149, in Murray.
Lipids are a structurally heterogeneous class of biological molecules that are soluble in organic (nonpolar)
solvents such as chloroform, but are only sparingly soluble, if at all, in water. Fats, oils, waxes, some vitamins
and hormones and most nonprotein membrane components are lipids.
Lipids store energy, act as a thermal insulator, function as structural components of cell membranes, and act as
important signalling molecules. These are all biological functions, and the fact that lipids fulfil them means that
they are essential for good health.
Lipids can be classified as simple, complex or derived.
 Simple lipids: Contain only esters of fatty acids with various alcohols. Examples are
o fats and oils, which are esters of fatty acids with glycerol
o waxes, which are esters of fatty acids with higher molecular weight monohydric alcohols
 Complex (or compound) lipids: Contain esters of fatty acids with groups that are not an alcohol and a
fatty acid. Examples are
o phospholipids, which are lipids containing a phosphoric acid residue
o glycolipids, which are lipids containing a fatty acid, sphingosine, and carbohydrate group
 Derived and precursor lipids: These include fatty acids, glycerol, other alcohols, steroids, fatty
aldehydes, ketone bodies, hydrocarbons, lipid-soluble vitamins and hormones
92
BMI2601/001/4/2017
In this learning unit we are going to examine a number of different types of lipids and their derivatives that are
important from a biological point of view. These are the fatty acids, triacylglycerols, phospholipids, glycolipids and
steroids.
Figure 6.3: Four common lipid molecules (http://hif.wikipedia.org/wiki/file:Common_lipids_lmaps.png)
6.4.1 Fatty acids
Recommended reading: chapter 15, pages 141–143, the section on fatty acids, in Murray.
A fatty acid is a carboxylic acid with a long aliphatic tail. The aliphatic tail may be either saturated (containing no
double bonds) or unsaturated (containing one or more double bonds) (to see this, have a look at figure 6.4 below
and figure 15-1 in Murray). Mono-unsaturated acids contain one double bond, and polyunsaturated acids contain
two or more double bonds.
Natural fatty acids in animals usually have an even number of carbon atoms – typically between 14 and 20. You
will see some examples of common fatty acids in tables 15-1 and 15-2 in Murray.
93
BMI2601/001/4/2017
Figure 6.4: Diagram showing a saturated and an unsaturated fatty acid

(https://www.flickr.com/photos/ajc1/6082438756/sizes/m/in/photostream/)
Most naturally occurring unsaturated fatty acids have cis double bonds, and not trans double bonds (refer to
figure 6.5 below and figure 15-6 in Murray). In the cis configuration there is a bend in the hydrocarbon chain,
which interferes with their packing. This reduces the number of van der Waals interactions, causing the fatty acid
melting point to decrease.
A diet containing trans fatty acids is unhealthy, and is linked to the development of diseases such as
cardiovascular disease and diabetes mellitus. Saturated fats can raise total blood cholesterol levels, and have
also been associated with increased risk of cardiovascular disease. As a result, it is best if most of the fat
consumed in the diet is in the form of unsaturated fats.
Figure 6.5: Structures of trans and cis-oleic acid (http://en.wikipedia.org/wiki/File:Isomers_of_oleic_acid.png)
94
BMI2601/001/4/2017
6.4.2 Activity 6.3
a) Explain the difference between a saturated and an unsaturated fatty acid.

b) Explain what an ester is.
c) Discuss the difference between a trans and cis double bond.
d) Study the information label on a tub of margarine and write down what percentage of the fats are trans
fatty acids. Why is it important that this value should be low?
e) Explain how the length and degree of unsaturation of fatty acids can influence their physical and
physiological properties.
You may have had to remember some of your chemistry to explain what an ester is. Esters are derived from
carboxylic acids, which contain the group -COOH. In an ester the hydrogen of the carboxylic acid is replaced by a
hydrocarbon group. This could be an alkyl group such as a methyl or ethyl, or a ring structure such as phenyl.
Esters are frequently created from carboxylic acids and alcohols. Many biological fats and oils are the fatty acid
esters of glycerol (e.g. triacylglycerols).
The length and degree of unsaturation of fatty acids influences their melting points. Did you mention van der
Waals interactions, and whether increased length and saturation decreases or increases the melting point?
Did you also mention that the fatty acids found in membranes need to be fluid (not a solid or a liquid, but
something in between) at environmental temperatures, and that it is possible to control this by controlling the
degree of saturation of the fatty acids found in membranes? Lipids that are used for storage in the body are more
saturated than membrane lipids (think of the fat on meat). Remember that animals do not have a body
fridge. If they are to have the same solidity, lipids in the extremities of the body, where the temperature may be
lower, need to be more unsaturated than lipids in the centre of the body.
6.4.4 Triacylglycerol (triglyceride)
Recommended reading: chapter 15, page 144, the section on triacylglycerols, in Murray.
The triacylglycerols are the principal storage fats in humans. They are the most abundant class of lipids in the
body. Fats yield more energy when they are oxidised than carbohydrates or proteins. The breakdown of fats
yields about six times more energy than the breakdown of hydrated glycogen of equal mass.
In animals, triacylglycerols are stored in fat cells, or adipocytes. The fat content of a healthy human typically
varies between 20 and 26%, and enables a person to survive without food for two to three months. Glycogen
functions as a short-term energy store, and the body’s glycogen stores can supply enough energy for just a
single day. The fat in the body also provides thermal insulation, which is especially important for animals that are
repeatedly exposed to low temperatures.
95
BMI2601/001/4/2017
The triacylglycerols are esters of the alcohol glycerol and three fatty acids (this is illustrated in figure 6.6). Mono-
and diacylglycerols also occur, where only one or two fatty acids are esterified with glycerol. These are typically
produced during the synthesis and hydrolysis of the triacylglycerols. The carbon 1 and 3 of glycerol are not
identical when the molecule is viewed three dimensionally, and so enzymes are able to distinguish between
them. For example, gastric lipases attack the sn-3 ester bond of a triacylglycerol, forming 1, 2-diacylglycerol and
a free fatty acid, but will not cleave the carbon 1 ester.
Figure 6.6: An example of an unsaturated triacylglycerol (chemical formula: C55H98O6). On the left is the
glycerol portion, and on the right, from top to bottom, are palmitic acid, oleic acid and alpha-linolenic acid.
(http://en.wikipedia.org/wiki/File:Fat_triglyceride_shorthand_formula.PNG)
6.4.5 Phospholipids
Recommended reading: chapter 15, pages 144–145, the section on phospholipids, in Murray.
Glycerophospholipids are the main constituents of biological membranes. They are made up of two fatty acids
that are linked to a glycerol molecule at the C-1 and C-2 positions and a highly polar head group, which is
attached to the C-3 position of the glycerol by a phosphodiester bond (to see this illustrated, study figure 6.7).
All the glycerophospholipids are derivatives of phosphatidic acid (diacylglycerol and phosphate group), and are
named according to the polar head group that is attached. If the polar head group is an ethanolamine or choline
(refer to figure 15-10 in Murray), then they are referred to as phosphatidylethanolamine or phosphatidylcholine,
respectively. The fatty acids found in the glycerophospholipids are generally 16 or 18 carbons long. The fatty acid
at the C-1 position is normally saturated, and the fatty acid at the C-2 position is unsaturated. There are many
exceptions, however.
96
BMI2601/001/4/2017
Figure 6.7: Diagram of a phospholipid showing the hydrophobic tails and hydrophilic head. The R at the top of
the image signifies the polar head group. Image from OpenStax College, Anatomy & Physiology
(http://cnx.org/content/m46021/latest/?collection=col11496/1.6)
The glycerophospholipids are amphipathic molecules, because they contain nonpolar (hydrophobic) and polar
(hydrophilic) regions. The phosphate group at pH 7 is negatively charged, and the head group may also be
charged at pH 7. The aliphatic tails are nonpolar and the heads are polar.
Phosphatidylcholine and phosphatidylethanolamine are found in the cell membrane. Phosphatidylcholine is the
most abundant phospholipid, and it is a storage molecule for choline. Choline is used to synthesise acetylcholine,
which is an important neurotransmitter in the body.
Other significant biologically important lipids in this class are phosphatidylserine (which plays a role in apoptosis),
phosphatidylinositol (which is a precursor of messengers), and diphosphatidylglycerol (used to synthesise
cardiolipin, which is found in the mitochondrial membrane and is essential for mitochondrial function).
6.4.6 Sphingolipids
Sphingolipids are also important lipids of membranes. Like the glycerophospholipids, they have a polar head and
two nonpolar tails (although only one fatty acid). However, they are different in that they do not contain glycerol.
Instead, they contain a long-chain amino alcohol called sphingosine (to see what this looks like, see figure 6.8).
They are therefore made up of a sphingosine or one of its derivatives, a fatty acid, and a polar head group which
may or may not be linked by a phosphodiester bond (which would require a phosphoric acid). If there is a
phosphoric acid present, then it is a phospholipid. Not all sphingolipids are phospholipids.
97
BMI2601/001/4/2017
Figure 6.8: The structure of a sphingolipid. The R group is the polar head group.
(http://commons.wikimedia.org/wiki/File:Sphingolipid.png)
As in figure 6.8, when the fatty acid is attached to the -NH2 of the sphingosine molecule, the resulting group
without the head group is called a ceramide (this is indicated by the shaded regions in figure 6.8). The ceramide
is a structural unit that is common to all sphingolipids – in other words, it occurs in all sphingolipids.
There are three main types of sphingolipid. They are
• the sphingomyelins,
• glycosphingolipids and
• gangliosides
The sphingomyelins (illustrated in figure 15-13 in Murray) are found in the membranes of brain and nerve tissue,
especially in the myelin sheath of myelinated neurons. We think that they play a role in insulating nerve fibres and
in signal transduction.
In Niemann-Pick Disease, which is a rare hereditary disease, sphingomyelin accumulates in various organs, and
causes irreversible neurological damage.
The glycosphingolipids and gangliosides do not contain phosphate. They have one or more sugar groups in their
head groups, which is why they are classified as glycolipids. I will say more about them in the next section.
6.4.7 Activity 6.4
a) Phosphatidic acid is an important intermediate in the synthesis of triacylglycerols. Draw the structure of
phosphatidic acid and a triacylglycerol. How does the phosphatidic acid structure differ from the
structure of a triacylglycerol?
b) Describe the structure of a glycerophospholipid. Explain why it is classified as an amphipathic molecule.
c) What is the function of phosphatidylcholine?
98
BMI2601/001/4/2017
d) What type of molecule is cardiolipin, and where is it found?

e) What is a ceramide group? Draw its structure.
f) Describe the structure of a sphingolipid.
Did you find the structures of a phosphatidic acid and a triacylglycerol on page 144 in Murray?
You should have been able to find the answers to all the questions in the learning guide or on pages 144 to 147
in Murray.
6.4.9 Glycolipids
Recommended reading: chapter 15, pages 145–146, the section on glycolipids, in Murray.
Glycolipids are essentially lipid molecules with a carbohydrate attached (for an illustration, see figure 6.9). They
provide energy and serve as markers for cellular recognition. There are a number of different types of glycolipids.
Examples are glyceroglycolipids and glycosphingolipids.
Figure 6.9: Chemical structures of glycolipids (http://en.wikipedia.org/wiki/File:Glycolipids.svg)
The glycosphingolipids generally have one to six carbohydrate units attached to a ceramide by an O-glycosidic
bond. They are found on the outer surface of plasma membranes, and comprise between 5% and 20% of the
lipid molecules of plasma membranes in human cells. Some glycosphingolipids function in cell–cell recognition,
and others may be involved in regulating signal transduction (transmission of signals across the plasma
membrane). As cellular recognition molecules, they act as markers in tissue and organ specificity. For example,
the sugar head groups of certain glycosphingolipids are involved in determining the different human blood groups
(A, B, AB and O).
99
BMI2601/001/4/2017
If a single sugar molecule is linked to the ceramide, it is called a cerebroside (shown in figure 6.10).
Galactosylceramide is an important glycosphingolipid found in the plasma membranes of neural tissue.
Glucosylceramide is found in the plasma membranes of non-neural tissue.
Figure 6.10: Chemical structure of galactoceramide

(http://commons.wikimedia.org/wiki/File:Galactoceramide.png)
Gangliosides are complex glycosphingolipids, and have large polar heads containing several sugar units. They
also contain N-acetylneuraminic acid or sialic acid. They are present in the membranes of most non-neural
tissues, and are found in higher concentrations in nervous tissue.
6.4.10 Steroids
Recommended reading: chapter 15, pages 146–147, the section entitled, “Steroids play many physiologically
important roles”, in Murray.
A steroid is an organic compound derived from cyclopentanoperhydrophenanthrene, which consists of three

fused cyclohexane rings (A-C) joined to a cyclopentane ring (D) (refer to figure 15-16 in Murray). Cholesterol, bile
acids, adrenocortical hormones and the sex hormones estradiol and testosterone are examples of steroids.
Cholesterol is found in all cells of the body. It is the metabolic precursor of the steroid hormones, which regulate a
number of physiological functions, including sexual development and carbohydrate metabolism. Cholesterol is
also widespread in biological membranes, where it regulates membrane fluidity and permeability.
The only hydrophilic group in the cholesterol structure is the single hydroxyl group (refer to figure 6.11 below or
figure 15-19 in Murray for the structure of cholesterol). Consequently, the molecule is highly hydrophobic.
Although cholesterol is essential, an excess of cholesterol in the blood is associated with atherosclerosis. This is
a condition in which lipid deposits block the blood vessels, which leads to heart disease.
100
BMI2601/001/4/2017
Figure 6.11: Cholesterol (http://hif.wikipedia.org/wiki/file:Common_lipids_lmaps.png)
Ergosterol occurs in plants and yeasts. It is an important steroid precursor of vitamin D.
6.4.11 Activity 6.5
a) Explain what a glycolipid is.

b) Describe the biological role of glycosphingolipids.
c) Why is cholesterol classified as a sterol?
d) Describe the role of cholesterol in the human body.
.4.12 Amphipathic lipids
Recommended reading: chapter 15, pages 148–149, the section on amphipathic lipids, in Murray.
Lipids are generally insoluble in water because they are predominantly nonpolar. However, amphipathic lipids
have a hydrophobic portion and a hydrophilic portion. An example of an amphipathic lipid is a phospholipid.
Amphipathic lipids bury their hydrophobic tails, avoiding exposure to water, while keeping their hydrophilic head
groups in contact with water. They do this by forming lipid bilayers, micelles, liposomes and emulsions (refer to
figure 15-24 in Murray). You will have studied the structure of cell membranes in other courses, and should know
the importance of amphipathic lipids in the formation of cellular membranes.
Liposomes can be used clinically as drug carriers for the delivery of pharmaceutical drugs in the body. If they are
joined to tissue-specific antibodies, they can be targeted to specific cells, reducing toxicity to other cells in the
body. Certain anticancer drugs, such as doxorubicin (Doxil), are administered using liposomes.
6.4.13 Activity 6.6
101
BMI2601/001/4/2017
a) Discuss the difference between a lipid bilayer, a micelle and a liposome.

b) What role do micelles play in the body?
c) What is an emulsion?
d) Extend the glossary that you started to compile in an earlier activity by adding new terms from the
sections above.
e) Draw a mind map that shows all the main sections and ideas in this learning unit, and that you can use
for your own exam revision.
Did you manage to explain the difference between lipid bilayers, micelles and liposomes? You should have
noticed that both the lipid bilayers and liposomes have a double amphipathic lipid layer, which means that they
can have polar molecules on either side of the lipid layer (look at the location of the polar heads in figure 15-24 in
Murray). This makes them different from micelles, which are circular and have the nonpolar tails on the inside.
Micelles often enclose nonpolar fluids. Liposomes are smaller circular structures, whereas lipid bilayers are much
larger structures. Both can enclose an aqueous medium (an aqueous medium is made of or contains water, and
is therefore a polar medium).
Did you find it easy or difficult to draw a mind map? You may have found it quite difficult, as we deal with a
number of complex concepts in this learning unit. Remember that when you compile a mind map, you usually
position the title in the middle of the page. You then enter the main topics on “branches” extending outwards
from the title and arranged in a clockwise sequence. You would have two main topics or branches for this unit,
namely carbohydrates and lipids, and secondary points under each of these. Remember that you can add small
sketches to your mind map to help you grasp and recall key concepts better.
6.5 Conclusion
Glucose is the most biomedically important monosaccharide. The body uses glucose as an energy source.
Glycogen is the storage polysaccharide in animals. When the body cannot use glucose immediately for energy,
the body stores it as glycogen or converts it to fat. The triacylglycerols are uncharged storage lipids. They are the
principal fat storage molecule in humans. The glycophospholipids and sphingolipids are the main constituents of
cellular membranes, and are often involved in cellular recognition. Both the carbohydrates and lipids are
essential for many biological processes.
102
BMI2601/001/4/2017
Learning unit 7: Introduction to metabolism
7.1 Introduction
Metabolism is all the chemical processes occurring within a living organism that are required to sustain life. In
humans, normal metabolism includes the day-to-day functioning of the body (growth, production of energy,
elimination of waste etc.) and adaption to different situations such as starvation and pregnancy. It is the process
by which living organisms obtain and utilise free energy required for life. An enzyme or nutritional deficiency,
anomalous secretion of hormones or the presence of drugs or toxins that affect the usual metabolic processes
can give rise to abnormal metabolism.
We need to understand metabolism in order to recognise the abnormalities that bring about many diseases. In
this learning unit we will look at the metabolism of carbohydrates, lipids and amino acids, and where in the body
these reactions typically take place. We will also briefly discuss the regulation of metabolic pathways and how
metabolism differs between the fed and fasting states.
To complete the learning unit, you will need to refer to chapter 16 in Murray. In the text, I have also given you the
links to some internet sources that you may find interesting and helpful.
• explain the role of ATP in the body

• explain the difference between anabolic and catabolic pathways
• discuss the metabolism of carbohydrates, lipids and proteins
• briefly describe the regulation of metabolic pathways
• discuss the difference in metabolism between the fed and fasting states
• discuss diabetes and how it affects metabolism
7.3 Energy generation and ATP synthesis
ATP is the main chemical energy carrier in cells. When it is broken down into ADP and inorganic phosphate (Pi) it
yields energy, which can be used to drive other cellular processes.
ATP is synthesised by two main methods:
 oxidative phosphorylation in the mitochondria.

 substrate level phosphorylation, which takes place during the tricarboxylic acid cycle in the
mitochondrion and during glycolysis in the cytoplasm
Oxidative phosphorylation is the main mechanism of ATP synthesis in most human cells. During oxidative
phosphorylation, fuel molecules are oxidised and electron acceptor coenzymes, for example nicotinamide
adenine dinucleotide (NAD+) and flavin adenine dinucleotide (FAD), are reduced to form NADH and FADH2,
103
BMI2601/001/4/2017
respectively. The electrons are then transferred from NADH or FADH2 to O2 through the electron transfer
system. This process results in the generation of ATP.
7.4 Metabolic pathways
The following article contains further information about human metabolism:
Da Poian, A.T., El-Bacha, T. & Luz, M.R.M.P. (2010) Nutrient Utilization in Humans: Metabolism Pathways.
Nature Education 3(9):11 (http://www.nature.com/scitable/topicpage/nutrient-utilization-in-humans-metabolism-
pathways-14234029). Although you do not have to read it, I really encourage you to do so.
A metabolic pathway is a series of successive enzymatic reactions that produce specific products. The reactants,
intermediates and products are called metabolites. Within an organism there are many different interconnected
metabolic pathways. There are three categories of metabolic pathways:
• anabolic pathways – involve biosynthesis of molecules
• catabolic pathways – complex metabolites are broken down into simpler products
• amphibolic pathways – act as links between the anabolic and catabolic pathways
When complex metabolites are broken down in catabolic pathways, free energy is released. This free energy is
conserved by the synthesis of ATP from ADP and inorganic phosphate or by the reduction of coenzymes (NAD+
and FAD), which can be used to generate additional ATP. The ATP molecules can then be converted back to
ADP and phosphate, releasing energy. This energy is then used to drive the anabolic pathways, which require
free energy.
Carbohydrates, lipids and proteins are the main components of foods, and the body digests and absorbs them to
supply energy. All three nutrient types are important as sources of energy. The type of food consumed
determines which metabolic pathways are active. When carbohydrates, lipids and proteins are degraded through
their different catabolic pathways, they are converted to a common intermediate, acetyl-coenzyme A (acetyl-CoA)
(refer to figure 16-1 in Murray). The acetyl group of the acetyl-CoA is then oxidised in the citric acid cycle (this is
also known as the tricarboxylic acid cycle) to CO2, with the simultaneous reduction of the coenzymes NADH and
FADH2. The NADH and FADH2 can then be utilised by the electron transport system to generate ATP.
Many citric acid cycle intermediates can be used as precursors for different anabolic or biosynthetic pathways.
7.4.1 Activity 7.1
104
BMI2601/001/4/2017
a) In your own words, define metabolism.

b) What is the difference between an anabolic and a catabolic pathway? Which types of pathways require
energy, and which generate energy?
c) Although the citric acid cycle does not directly utilise oxygen, it can only function under aerobic
conditions. Why is this?
7.4.2 Carbohydrate metabolism
Glucose is converted to pyruvate by the glycolytic pathway. This results in the synthesis of ATP during substrate-
level phosphorylation. The pyruvate is transported to the mitochondria, and under aerobic conditions pyruvate is
converted to acetyl-CoA. Acetyl-CoA enters the citric acid cycle, and further ATP is synthesised. Under anaerobic
conditions, lactate is formed.
Glucose and its metabolites are also associated with:
• glycogen synthesis
• the pentose phosphate pathway, source of ribose
• triose phosphates for triacylglycerol
• pyruvate and citric acid cycle intermediates; these are precursors for the synthesis of nonessential
amino acids, fatty acids and cholesterol
7.4.3 Lipid metabolism
Fatty acids can be oxidised to acetyl-CoA in a process called β-oxidation. The resultant acetyl-CoA can:
• enter the citric acid cycle to generate energy
• be converted to cholesterol or other steroids
• be used to form ketone bodies
Fatty acids obtained from the diet and synthesised from acetyl-CoA can also be esterified with glycerol to form
triacylglycerol, which is stored as fat.
7.4.4 Amino acid metabolism
Organisms need amino acids in order to synthesise protein. However, they may also use amino acids as fuel to
generate energy or as precursors to produce other molecules.
There are two main types of reactions that involve amino acids, namely transamination and deamination. During
transamination the amino group is moved from the amino acid to a keto acid. The amino acid becomes a keto
acid, and the keto acid becomes an amino acid. This allows the nonessential amino acids to be synthesised from
105
BMI2601/001/4/2017
metabolic intermediates. During deamination the amino group (nitrogen-containing group) is removed from an
amino acid, and is ultimately excreted in the urine as urea. The carbon skeletons that remain can
• enter the citric acid cycle to generate energy
• be used to synthesise glucose
• be used to form ketone bodies or other molecules
7.4.5 Activity 7.2
a) Discuss the metabolism of glucose. Refer to figure 16-2 and the associated text on pages 152 and 153
in Murray.
b) Discuss the metabolism of fatty acids and cholesterol. Refer to figure 16-3 and the associated text on
pages 152 and 153 in Murray.
c) Discuss the metabolism of amino acids. Refer to figure 16-4 and the associated text on pages 153 and
154 in Murray.
7.5 Location of metabolic pathways
The following article contains further information on nutrient utilisation:
El Bacha, T., Luz, M. & Da Poian, A. (2010) Dynamic Adaptation of Nutrient Utilization in Humans. Nature
Education 3(9):8 (http://www.nature.com/scitable/topicpage/dynamic-adaptation-of-nutrient-utilization-in-humans-
14232807).
Although you do not have to read it, I really encourage you to do so.
Metabolic pathways in humans occur in specific tissues and organs, and within different compartments or
organelles within the cells of those tissues. Let me tell you a bit more about the metabolites entering and leaving
the various tissues and organs. The blood is the main medium used to transport metabolites around the body.
Amino acids and glucose from digestion are carried by the blood, and enter the liver. The liver then regulates the
concentration of these substances within the blood (refer to figure 16-5 in Murray).
The maintenance of the correct levels of glucose within the blood is very important. If there is excess glucose, it is
converted to glycogen (this process is called glycogenesis) or fatty acids (this process is called lipogenesis) within
the liver. If the concentration of glucose in the blood is too low, then the body produces more glucose by breaking
down glycogen (this process is called glycogenolysis) or by converting lactate, glycerol and amino acids to
glucose (this process is called gluconeogenesis).
106
BMI2601/001/4/2017
Excess amino acids that enter the liver are deaminated, producing urea, which is transported to the kidney before
being excreted from the body. The liver also manufactures the major plasma proteins (proteins found in the
blood).
The skeletal muscles use glucose aerobically, as a result of which CO2 is formed, and anaerobically, as a result
of which lactate is created. The muscles store glycogen as a fuel source for muscle contraction, and muscle
proteins are synthesised from plasma proteins within the muscle tissue. During starvation, the muscle mass can
be broken down to supply amino acids for gluconeogenesis (metabolic pathway involved in the generation of
glucose from non-carbohydrate carbon substrates).
Lipids that are ingested are hydrolysed into monoacylglycerols and fatty acids in the gut. They are re-esterified
and packaged with protein, and enter the blood as chylomicrons. Chylomicrons are lipoprotein particles that
permit dietary lipids and cholesterol to move from the intestines to other areas of the body within the water-based
bloodstream. They contain triacylglycerol, phospholipids, cholesterol, and proteins. The chylomicrons are
transported to tissues that contain lipoprotein lipase (e.g. adipose, cardiac, and skeletal muscle tissue), which
hydrolyses the triacylglycerol, freeing the fatty acids. The fatty acids can then be oxidised as fuel or added to
tissue fat. The chylomicron remnants that are left over are taken up by the liver. Figure 16-6 in Murray shows
what happens to the major lipid metabolites within the body.
Triacylglycerols within adipose tissue are the main fuel reserves of the body. When triacylglycerols are
hydrolysed (undergo lipolysis) they form glycerol (substrate for gluconeogenesis) and free fatty acids.
Long-chain fatty acids can also be synthesised (lipogenesis) in the liver, and adipose tissue from carbohydrates.
The liver also produces ketone bodies (ketogenesis), which can be used by other tissues as a fuel during
extended fasting or starvation.
7.5.1 Activity 7.3
a) Compile a table in which you define the following terms in your own words: glycogenesis, lipogenesis,
glycogenolysis, ketogenesis, lipolysis and gluconeogenesis. From your definitions, can you deduce the
meaning of the word parts “genesis” and “lysis”?
b) Draw your own, simple diagram to show the relationship between glycogenesis, lipogenesis,
glycogenolysis and gluconeogenesis.
c) What is deamination of amino acids?
d) Basing yourself on figure 16-6 in Murray, explain the fate of lipid substrates and metabolites in your own
words.
107
BMI2601/001/4/2017
7.6 Regulation of metabolic pathways
To ensure that the right quantity of products of a metabolic pathway are produced, the flux of metabolites through
the metabolic pathway needs to be controlled. This is done by controlling the activity of one or more enzymes
that catalyse crucial reactions in the pathway. Although metabolic pathways are irreversible, many of their
component reactions are often at equilibrium, with only one or two reactions of a pathway being irreversible. The
first committed step or irreversible reaction is generally the rate-limiting step. Most metabolic pathways are
controlled by regulating the enzymes that catalyse these reactions. It is also beneficial to control the pathway
early on, as this prevents the unnecessary synthesis of metabolites when they are not required.
7.6.1 Activity 7.4
a) What is the difference between a reversible reaction, a reaction at equilibrium and an irreversible
reaction?
b) Read the section entitled, “Allosteric and hormonal mechanisms are important in the metabolic control of
enzyme-catalysed reactions” and refer to figure 16-8 on pages 157 and 158 in Murray. Describe how
the metabolites A and D in figure 16-8 can influence the flux through the pathway depicted in the figure.
A reversible reaction is one in which the reactants can convert to products, and the products formed can be
converted back to reactants. This means that the reaction occurs in both directions. Irreversible reactions go in
just one direction, and result in the formation of products. Once the products are formed, they are not converted
back into reactants, as the pathway does not occur in the reverse direction. Only reversible reactions can reach
equilibrium.
In a reaction that is at equilibrium, the rate of the forward and reverse reactions is the same. This means that the
concentration of the reactants and products will remain constant if the conditions are not changed. If the
concentration of the reactants or products is changed in some way, then there will be flux through the pathway
until a new equilibrium is established, with different concentrations of reactants and products. Under steady state
conditions there will be a constant supply of reactants and removal of products, resulting in a net flux. Equilibrium
will not be reached, even though the reaction may be reversible.
In figure 16-8, the presence of metabolite A will enhance the activity of the enzyme, Enz2, and this will result in B
being removed through the action of Enz2 (Enz2 converts B to C), driving the reaction in the forward direction.
The final product D can allosterically bind to Enz2, inhibiting its activity, and stopping the formation of C. As C is
no longer being produced, the formation of D will also be reduced. This is one way to ensure that if there is too
much D present in the cell, then no more D will be produced.
108
BMI2601/001/4/2017
7.7 Metabolism during fed and fasting states
Glucose is essential for the central nervous system and erythrocytes. Erythrocytes do not have mitochondria, and
so they rely entirely on glucose for energy. They cannot make energy from other substances.
The brain derives about 80% of its energy from the utilisation of glucose. It derives the other 20% of its energy
from the metabolism of ketone bodies.
During fasting between meals and starvation, the body needs to maintain blood glucose levels for the
erythrocytes and brain. A number of metabolic changes occur within the cells to maintain glucose levels and to
provide other metabolic fuels for the rest of the tissues.
7.7.1 Activity 7.5
Then go to the discussion forum and complete the discussion activity.
Refer to Murray pages 158–161 and answer the following questions.
a) What is a ketone body?

b) Describe in detail how the supply of metabolic fuel differs when the body is in the fed and fasting states.
c) Describe the changes that occur in the levels of plasma insulin, plasma glucagon, plasma free fatty
acids, blood glucose, liver glycogen and blood ketone bodies as the body enters the fasting state.
The following question is a discussion activity.
Post your answer to the question below in the online Discussions page. To do this, click on the forum “Module-
related discussions”, and then on the topic “Activity 7.5d: Fed and fasting states”. Also respond to at least one
other posting by a fellow student. If you do not have internet access, you can write down your answers to this
activity and add it to your portfolio, as you have done before.
d) Describe how the body maintains blood glucose levels in both the fed and fasting states. Also, discuss
at what point you think the body enters the fasting state. Will it always be the same length of time after
a meal has been consumed? What factors do you think may affect the length of time it takes the body to
enter a fasting state?
When comparing the fed and fasting states, did you include and discuss the following points?
Fed state
• Glucose is always required, and so glucose levels need to be maintained (and why glucose is required)
• After digestion, a large quantity of metabolic fuel
• Insulin is secreted by in response to
109
BMI2601/001/4/2017
• Excess glucose is converted to glycogen (increase in glycogen synthetase, decreased glycogen

phosphorylase) or used for lipogenesis
• Excess lipids from digestion ….
• Protein synthesis increased
Fasting state
• Blood glucose drops slightly

• Free fatty acids increase in plasma
• After a while, the concentration of ketone bodies increases
• Increased glucagon secretion
• Gluconeogenesis in liver
• Inhibition of lipogenesis
I will supply feedback on the discussion activity in the online Discussion page, or send it to you at a later stage.
7.8 Diabetes
Diabetes mellitus is a metabolic disease causing a person to have high blood sugar levels. Increased blood sugar
levels cause increased thirst, frequent urination and increased hunger. It may occur either because the pancreas
does not produce enough insulin, or because the cells of the body do not respond to the insulin produced.
Insulin plays a fundamental role in regulating blood glucose concentration. The β cells in the islets of Langerhans
in the pancreas release insulin into the blood in response to increased blood glucose concentration
(hyperglycaemia). The insulin stimulates the adipose and muscle tissue to absorb the excess glucose from the
blood and either to use it as fuel or store it. Insulin also signals the muscle and liver cells to convert glucose to
glycogen. When glucose levels are low, insulin is not released from the pancreas, and glycogen is converted to
glucose. This is predominantly controlled by the hormone glucagon, which has the opposite effect from insulin.
In diabetics, who do not produce enough insulin or whose cells do not respond to the insulin effectively, the
body’s cells do not absorb glucose, and the liver and muscle tissue do not store it properly. This results in high
concentrations of glucose in the blood. The lack of insulin also affects other metabolic pathways in the body. In
the absence of insulin there is increased gluconeogenesis from amino acids in the liver and increased lipolysis in
adipose tissue, supplying excess free fatty acids to the liver for ketogenesis.
The ketone bodies acetoacetate and beta-hydroxybutyrate are acidic. If the tissues cannot utilise them all
effectively, the increased levels in the blood will result in acidosis.
110
BMI2601/001/4/2017
7.8.1 Activity 7.6
a) Discuss the role of insulin in the body.

b) Draw two flow diagrams, one showing how glucose is metabolised in people who do not have diabetes,
and the other showing what happens to glucose in individuals who have diabetes.
7.9 Conclusion
The digestion of food provides the tissues of the body with the molecules they need for the biosynthesis of
complex macromolecules. The breakdown of these molecules supplies energy for metabolic processes. Nearly
all the products of digestion (sugars, lipids and amino acids) can be metabolised to a common metabolite, acetyl-
CoA. Acetyl-CoA can be used to synthesise a number of other molecules (e.g. long-chain fatty acids and
steroids), or else it can be oxidised to yield energy. The metabolic pathways in the body are highly regulated,
controlling the levels of various metabolites. For example, glucose levels in the blood are maintained during the
fasting and fed states through the manipulation of various metabolic processes.
111
BMI2601/001/4/2017
Learning unit 8: Nutrition
8.1 Introduction
To be healthy, an individual needs to eat a balanced diet that includes a number of essential molecules. The
essential chemicals include vitamins, amino acids, fatty acids, minerals and water. To understand which nutrients
are important, we need to understand the biochemistry of the body.
In this learning unit we are going to examine the digestion and absorption of carbohydrates, lipids, proteins,
vitamins and minerals. We will then look at diseases that can occur as a result of nutritional deficiency,
specifically deficiencies in certain vitamins. To complete the learning unit, you will need to refer to chapters 43
and 44 in Murray.
• describe the digestion and absorption of carbohydrates, lipids, proteins, vitamins and minerals
• describe the consequences of undernutrition
• distinguish between different vitamins, describe their functions in the body and identify diseases that
occur as a result of deficiencies in those vitamins
8.3 Nutrition, digestion and absorption
Nutritional diseases occur when there is a lack of essential nutrients in the body. Seven groups of substances are
essential in the diet. These are
• water
• carbohydrates
• proteins
• fat
• vitamins
• minerals
• fibre
In this learning unit we are going to examine the importance of carbohydrates, fats, proteins and vitamins in the
diet. Before reading the sections that follow, jot down what you know about the different groups of substances
that are essential in the diet.
112
BMI2601/001/4/2017
8.3.1 Digestion and absorption of carbohydrates
Recommended reading: chapter 43, page 518, in Murray.
All carbohydrates need to be hydrolysed to monosaccharides before they can be absorbed in the small intestine.
The hydrolysis of starch begins with the action of salivary amylases and continues with the action of pancreatic
amylases. Amylases hydrolyse starch to dextrins, a mixture of short polymers of D-glucose units. These are
further hydrolysed to form glucose, maltose and maltotriose.
Any disaccharides that are consumed and undergo starch hydrolysis are hydrolysed to form monosaccharides by
a number of enzymes (maltase, sucrose-isomaltase, trehalase and lactase) that are present in the brush border
of the small intestine. The monosaccharides are then absorbed by the intestinal cells.
Glucose and galactose are actively pumped out of the intestine, but they compete with each other for intestinal
absorption, as they use the same sodium-dependent transport protein (refer to figure 43-1 in Murray). The other
monosaccharides, including glucose and galactose, can be absorbed by a sodium-independent facilitative
transporter down their concentration gradients. This means they can only move into the cell if the concentration
of the monosaccharide within the cell is lower than the concentration outside the cell.
8.3.2 Digestion and absorption of lipids
Fats are important dietary components because they contain the fat-soluble vitamins and the essential fatty
acids. The main dietary lipids are triacylglycerols and phospholipids. Because they are hydrophobic, they need to
be emulsified before they can be absorbed. Lingual and gastric lipases hydrolyse triacylglycerols, forming 1,2-
diacylglycerols and free fatty acids, which act as emulsifying agents. Pancreatic lipases produce 2-
monoacylglycerols and free fatty acids. Pancreatic esterase hydrolyses a portion of the monoacylglycerols to
form fatty acids and glycerol. The complete digestion of one molecule of triacylglycerol results in three fatty acid
molecules and one glycerol molecule.
8.3.3 Digestion and absorption of proteins
Ingested proteins need to be broken down into small oligopeptides, tripeptides, dipeptides and amino acids so
that they can be absorbed by the intestines. During human digestion the proteins in food are broken down by
proteolytic digestive enzymes or proteases. The digestion of the proteins by the proteases is enhanced if the
proteins are first denatured through cooking or exposure to gastric acids.
There are two main groups of protease enzymes, namely the endopeptidases and the exopeptidases. The
endopeptidases cleave protein molecules into smaller peptides by hydrolysing the peptide bond between specific
amino acids. The different enzymes have different specificity for where they cleave within a protein molecule. For
example, trypsin will only cleave the peptide bond after a positively charged arginine or lysine residue.
Chymotrypsin cleaves bonds after aromatic residues (phenylalanine, tyrosine and tryptophan), and elastase
113
BMI2601/001/4/2017
cleaves the peptide bond following small non-polar residues. The exopeptidases remove amino acids one at a
time from the ends of the peptides, and cannot cleave the peptide in the middle of the molecule.
To prevent the digestive enzymes accidently digesting molecules inside and outside the cells that should not be
digested, they are secreted as inactive zymogens. The zymogens are then activated when they are in the correct
environment – for example, pepsinogen is activated to pepsin by gastric acid, and will therefore only become
active once it is in the stomach.
8.3.4 Activity 8.1
a) Start by drawing a mind map showing the digestion of each type of nutrient (proteins, carbohydrates and
lipids).
b) Why is it better to eat carbohydrates with a low glycaemic index?
c) Discuss the digestion of the disaccharide lactose and lactose intolerance in humans.
d) Define the word “emulsified”.
e) Discuss the digestion and absorption of lipids. Refer to bile salts, fat-soluble vitamins, monoacylglycerol
pathway, glycerol, chylomicrons and cholesterol.
f) Pepsin, trypsin and chymotrypsin are secreted into the small intestine. What is their function?
g) What is the difference between an aminopeptidase and a carboxypeptidase?
h) What are dipeptidases and tripeptidases?
i) Describe the activation of zymogens within the digestive tract. How and where is the zymogen
trypsinogen activated?
j) Briefly discuss the absorption of amino acids and peptides by the intestine.
Did you find the answers to the questions about carbohydrates? If not, use the index in the textbook.
We first spoke about emulsions in connection with amphipathic lipids. Review the section on amphipathic lipids in
learning unit 6.
Did you mention that pepsin, trypsin and chymotrypsin are all involved in the digestion of proteins, and that each
cleaves a peptide bond next to a particular amino acid?
114
BMI2601/001/4/2017
8.3.6 Energy balance
The body needs food as a source of energy. If the energy gained from food is greater than the energy that the
body needs, then the extra calories are stored, and the individual gains weight. If an organism ingests fewer
calories than it is using to live, then emaciation and wasting may result. Both obesity and undernutrition are
unhealthy, and are associated with increased mortality.
There are two extreme forms of undernutrition, namely kwashiorkor and marasmus. These usually only arise in
situations of famine or inadequate food supply. Patients who have advanced cancer and AIDS are often
undernourished, and have a condition called cachexia.
Proteins are required to maintain the nitrogen balance in the body. In a healthy adult who is not building or losing
muscle mass, the body excretes roughly the same amount of nitrogen as it absorbs. However, if the body needs
more nitrogen, then it will excrete less nitrogen than what it absorbs.
Some amino acids cannot be synthesised in the body, and so they must be supplied through the diet. These are
referred to as essential amino acids. They include histidine, isoleucine, leucine, lysine, methionine,
phenylalanine, threonine, tryptophan and valine. The other amino acids are considered nonessential, as they can
be synthesised from the other amino acids in the body.
8.3.7 Activity 8.2
Read the sections, “Energy balance: over and undernutrition” and “Protein and amino acid requirements”, and
answer the following questions.
a) What is marasmus? What effects does marasmus have on the body?

b) Discuss the reasons for cachexia in severely ill patients.
c) Discuss the symptoms and causes of kwashiorkor.
d) Discuss nitrogen balance and the conditions that may result in a negative or positive nitrogen balance.
e) Why are the essential amino acids required by the body?
f) Discuss how the amounts of the nonessential and essential amino acids that an organism consumes
can affect the nitrogen balance in the body.
8.4 The importance of vitamins and minerals in the body
Vitamins are organic molecules that the body needs in small amounts for a number of biochemical functions. All
of them except vitamin D and nicacin must be obtained from the diet, as they generally cannot be synthesised by
the body.
• The lipid-soluble vitamins are hydrophobic. They include vitamin A, vitamin D, vitamin E and vitamin K.
115
BMI2601/001/4/2017
• The water-soluble vitamins include vitamin C and the B-complex vitamins.
Refer to table 44-5 in Murray for the functions of the vitamins and the illnesses that result from deficiencies in
specific vitamins.
In the case of any nutrient, insufficient uptake results in a deficiency disease, and excessive uptake greater than
the body’s ability to metabolise it may result in toxicity. Although individuals have different nutrient requirements,
average reference levels of nutrient intake have been calculated. You can see these in tables 44-1, 44-2, 44-3
and 44-4 in Murray.
8.4.1 Digestion and absorption of vitamins and minerals
Recommended reading: chapter 43, page 521, in Murray.
Vitamins and minerals are found in food, and the body absorbs them during digestion. The ability of the body to
absorb vitamins and minerals depends on the type of food, and the presence of other chelating compounds
(compounds that bind vitamins). Fat-soluble vitamins are absorbed along with fats in the lipid micelles. The
water-soluble vitamins and mineral salts are absorbed from the intestine by active transport across the cell
membrane or by carrier-mediated diffusion.
The absorption of a number of vitamins and minerals is reliant on the presence of other factors. For example, the
absorption of calcium in the intestine is dependent on vitamin D, and the absorption of vitamin B12 requires a
specific transport protein. The absorption of iron is tightly controlled; however, vitamin C enhances the
absorption of iron, and calcium reduces its absorption.
8.4.2 The fat-soluble vitamins
Table 8.1: The fat-soluble vitamins
Vitamin Function in the body Deficiency syndrome
A Maintenance of vision, gene expression and cell Night blindness and xerophthalmia
differentiation
D Maintenance of calcium balance, gene Rickets in children and osteomalacia in adults

expression and cell differentiation
E Antioxidant and cell signalling Neurologic disorders, haemolytic anaemia in

newborns
K Blood clotting Impaired blood clotting and haemorrhagic

disease
We will now examine two of the fat-soluble vitamins in greater detail, namely vitamin A and vitamin D.
116
BMI2601/001/4/2017
8.4.2.1 Vitamin A
Recommended reading: chapter 44, pages 526–528, the section on vitamin A, in Murray.
Vitamin A is a group of compounds that includes retinol, retinaldehyde, retinoic acid, and some provitamin A
carotenoids (refer to figure 44-1 in Murray). Vitamin A can be found in two main forms in foods. These are retinol,
the form of vitamin A absorbed from animal food sources, and the carotenes, which are absorbed from plant
material.
Vitamin A has several functions, and is essential for the maintenance of good vision. Vitamin A in the form of
retinaldehyde is required by the retina of the eye, where it combines with opsin proteins to form rhodopsin and
iodopsin. These molecules absorb light, and are needed for both night and colour vision. Vitamin A also plays a
part in growth, development and tissue differentiation. Retinoic acid binds to receptors regulating the transcription
of a number of specific genes.
Vitamin A is toxic if too much is consumed, as the body can metabolise only a limited amount at any given time.
Figure 8.1: The different forms of vitamin A (http://commons.wikimedia.org/wiki/File:Vitamin-A-Synthese.png)
8.4.2.2 Vitamin D
Recommended reading: chapter 44, pages 529–531, the section on vitamin D, in Murray.
Vitamin D is a hormone that is involved in the regulation of calcium absorption and homeostasis. There are a
number of different forms of vitamin D. Of these, the most important dietary forms are vitamin D3 (cholecalciferol)
and vitamin D2 (ergocalciferol). Both forms can be obtained from the diet, and cholecalciferol can be synthesised
117
BMI2601/001/4/2017
non-enzymatically in the skin from cholesterol through exposure to ultra-violet wavelengths of sunlight (refer to
figure 44-3 in Murray). Sunscreen absorbs ultraviolet light and prevents it from reaching the skin, and therefore
reduces the ability of the body to synthesis vitamin D.
The active metabolic forms of vitamin D are calcitriol and ercalcitriol, produced from cholecalciferol and
ergocalciferol, respectively. The conversion to the active metabolites takes place in the liver and kidneys. Refer to
figure 44-4 in Murray, which shows the conversion of cholecalciferol into the metabolically active form, calcitriol.
Vitamin D typically acts like a steroid hormone, enhancing gene expression. The main function of vitamin D is to
maintain the calcium concentration in plasma. It does this in three ways:
• It increases intestinal absorption of calcium
• It reduces excretion of calcium
• It mobilises bone mineral
Calcitriol is also involved in insulin secretion and the synthesis and secretion of the parathyroid and thyroid
hormones, and it is involved in immunological functions. Supplementation of vitamin D may be beneficial, but it is
toxic if too much is consumed.
Figure 8.2: Structure of cholecalciferol (http://en.wikipedia.org/wiki/File:Cholecalciferol-3d.png)
118
BMI2601/001/4/2017
a) How is β-carotene converted to vitamin A?

b) In your own words, discuss the function of vitamin A in the body.
c) Describe the symptoms of vitamin A deficiency.
d) Describe the symptoms of excessive intake of vitamin A.
e) Discuss the synthesis of vitamin D in the skin. Does this synthesis occur uniformly all year round?
f) What is the function of vitamin D binding globulin?
g) How does vitamin D reduce the excretion of calcium?
h) Describe the symptoms of vitamin D deficiency in adults and children.
i) Describe the symptoms of excessive intake of vitamin D.
j) If somebody goes on a fat free diet, which vitamins are they most likely to be deficient in? (There are
four vitamins.)
k) A 19-year-old male was admitted to hospital with a leg fracture from a minor fall. When a history was
taken, it was shown that this person was spending all day inside playing computer games, and was
eating a very poor diet consisting mostly of cereal. What deficiency may have caused the patient to have
brittle bones? Explain your reasoning.
l) A 6-year-old girl was brought to a hospital suffering from a severe respiratory infection. While the girl
was being treated in hospital for the infection, a nurse noticed that the patient had problems seeing at
night. The nurse then suggested she take a supplement. What deficiency is the patient most probably
suffering from? Explain your reasoning.
Did you answer all the questions? You should have found the answers in the textbook in the section on lipid-
soluble vitamins.
You should have explained that the 19-year-old might have been suffering from a vitamin D deficiency, as he was
not eating a complete diet, and was therefore probably not getting sufficient nutrients from his diet. He also spent
all his time indoors and was not being exposed to sunlight, so was therefore probably suffering from a vitamin D
deficiency. Upon further examination it may have been found that he had additional deficiencies as a result of his
poor diet.
The young girl mentioned in question l) probably had a vitamin A deficiency, as night blindness is a common
symptom of vitamin A deficiency. Vitamin deficiency may also lead to increased susceptibility to infectious
diseases, and that may be why she became so ill that she needed to be hospitalised.
8.4.3 The water-soluble vitamins
B-complex vitamins
Many coenzymes, cofactors and prosthetic groups of enzymes are derivatives of the B vitamins. The B vitamins
include
• thiamine (vitamin B1)
119
BMI2601/001/4/2017
• riboflavin (vitamin B2)
• niacin or niacinamide (sometimes called vitamin B3)
• pantothenic acid (vitamin B5)
• pyridoxine, pyridoxal, or pyridoxamine (vitamin B6)
• cobalamin (vitamin B12)
Vitamin B1, or thiamine, plays an important role in the metabolism of carbohydrates and other molecules. A
deficiency in this vitamin can result in three different syndromes, namely beriberi, acute pernicious beriberi and
Wernicke encephalopathy.
Vitamin B2, or riboflavin, is involved in lipid and carbohydrate metabolism. It forms part of flavin mononucleotide
(FMN) and flavin adenine dinucleotide (FAD) (refer to figure 44-10 in Murray).
Two compounds, nicotinic acid and niacinamide, have the biological activity of niacin. In the body it can be
synthesised from the amino acid tryptophan (for this reason it is sometimes not classified as a vitamin), and
forms part of the coenzymes nicotinamide adenine dinucleotide (NAD+) and nicotinamide adenine dinucleotide
phosphate (NADP+). Deficiency results in pellagra, and excess niacin can be toxic.
Vitamin B6 can take several forms, including pyridoxine, pyridoxal, pyridoxamine and their 5’-phosphates (refer to
figure 44-12 in Murray). It is a coenzyme for a few enzymes involved in amino acid metabolism, and is important
in changing steroid hormone action.
Vitamin B12,or cobalamin, is found only in foods of animal origin. Deficiency causes pernicious anaemia.
Vitamin C
Vitamin C is an antioxidant that maintains vitamin E and some metal cofactors in the reduced state. It is also
used by copper containing hydroxylases and the a-ketoglutarate linked iron containing hydroxylases. Vitamin C
deficiency results in scurvy.
8.4.4 Activity 8.4
a) If a person is deficient in vitamin B1, lactic acidosis can result. Explain the biochemical reason for this.
b) Discuss riboflavin deficiency.
c) Describe the symptoms of pellagra. Why are some defects in tryptophan metabolism associated with the
development of pellagra?
d) Discuss the absorption of vitamin B12 in the body.
e) Discuss the biochemistry of how a vitamin B12 deficiency may result in pernicious anaemia.
f) Review the section on metabolism and oxidative phosphorylation. Which vitamins are essential for
oxidative phosphorylation?
g) What are the symptoms of scurvy?
120
BMI2601/001/4/2017
8.5 Conclusion
Digestion involves hydrolysing molecules into smaller fragments which can be absorbed through the gut
epithelium. The carbohydrates are absorbed as monosaccharides, the lipids as 2-monoacylglycerols and fatty
acids, and the proteins as amino acids and small peptides. Vitamins are also absorbed by the digestive system,
as they generally cannot be synthesised by the body, and are essential for certain metabolic functions.
I hope that now that you have completed this module, you have a greater understanding of a number of important
biochemical concepts. This module began with the revision of a number of basic chemistry principles, including
the structure of water, pH of solutions, buffers and the structure of amino acids. We then discussed proteins in
terms of their structure, analysis and function. We also covered the formation of proteins during transcription and
translation from the information in the genetic material.
You learnt about the structures and functions of a number of carbohydrates and lipids that occur in the body. We
ended the module with a discussion of how the body digests and absorbs proteins, carbohydrates and lipids, and
the effects on the body of deficiencies in certain essential nutrients.
121
BMI2601/001/4/2017
Forum 1: Student Lounge
Use this forum to discuss general matters among yourselves
Discussion 1: Introduce yourself
Use this space to get to know your fellow classmates.
Tell one another about your current work situation, professional background and something personal (± 250 words).
Discussion 2: Fellow student contact details
Use this space to share your contact details with your classmates and to form study groups.
Forum 2: Learning units
Use this forum to discuss specific topics you are trying to understand in the course
122
BMI2601/001/4/2017
Announcement 1: Welcome and getting started
Dear Student
Welcome to Clinical Biochemistry. You should have received a Getting Started letter in the mail explaining what
we expect of you as an online student.
But for now, we would like you to first go to the Discussion Forums link on the left side of your screen and
access Forum 1: Student Lounge. In Discussion 1 we want you to participate in your first online activity where
you need to introduce yourself to your fellow students. Please participate in this discussion during February /July.
We are looking forward to meeting you online!
Your lecturer
123

Bmi2601 3 2018-Study-Guide PDF

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Bmi2601 3 2018-Study-Guide PDF

Uploaded by

Copyright:

Available Formats

BMI2601/001/4/2018

Learning unit 0: Welcome and Introduction

Learning unit 1: Water, pH and amino acids

Learning unit 2: Protein structure

Learning unit 3: Purifying and analysing proteins

Learning unit 4: Enzymes

Learning unit 5: Protein expression

Learning unit 6: Carbohydrates and lipids of physiological significance

Learning unit 7: Introduction to metabolism

Learning unit 8: Nutrition

Discussion forums and topics in BMI2601

0.1 Welcome and introduction

The university’s online platform, myUnisa, allows you to:

• access your official study material,

• access the Unisa Library functions,

• access a variety of learning resources.

Your study material for this module consists of

• your prescribed textbook

• these learning units

• Tutorial Letter 101

0.2 Lecturer and contact details

0.2.1 Lecturer and department

You can also make use of the following contact routes:

• Unisa website: http://www.unisa.ac.za & http://mobi.unisa.ac.za

0.2.3 Student support services

o request library material

• Unisa Directorate for Counselling and Career Development (DCCD)

o career advice and how to develop your employability skills

0.3 Purpose and outcomes of this module

0.4 How the content of this module is structured

0.5 Learning resources

0.6 Study plan

0.7 How should you go about studying this module?

• Make your own summary of every unit.

Your portfolio should comprise:

0.7.1 Learning strategies you can apply: the SSS method

0.7.1.2 Scanning and outlining

0.7.1.3 Study-reading and active learning

0.7.2 Managing your self-paced study time

0.7.3 Finding research/scientific articles

1. Go to Unisa online at http://www.unisa.ac.za/

2. Click on “Library” at the top of the page.

4. Follow the guidelines if you are a first-time user.

5. Click on the option “Find e-resources”.

6. Now click on “A–Z list of electronic resources”.

0.7.4 Avoiding plagiarism

0.8 Using myUnisa

0.8.1 The myUnisa menu options

0.8.2 myUnisa etiquette

0.8.3 Activity 0.1: Introduce yourself

At this point, I would like you to do an activity called an ice breaker.

What is an ice breaker?

The ice breaker serves a number of purposes:

• It will help you to get to know the myUnisa online environment

Once inside the topic, post a short entry in which you:

• tell us who you are and where you live;

0.9 Assessment in this module

Your work in this module will be assessed by the following:

• How your assignment and exam marks will be calculated

I wish you well in your studies. Enjoy the course!

Learning unit 1: Water, pH and amino acids

1.2 Learning outcomes