Biol. Cell (2011) 103, 21–33 (Printed in Great Britain) doi:10.

1042/BC20100094
Research article

PMA up-regulates the transcription

of Axl by AP-1 transcription factor
binding to TRE sequences via the
MAPK cascade in leukaemia cells
Giridhar Mudduluru∗ , Jörg H. Leupold∗ , Philipp Stroebel† and Heike Allgayer∗1
∗ Department of Experimental Surgery Mannheim/Molecular Oncology of Solid Tumors, DKFZ and University of Heidelberg, Mannheim
www.biolcell.org

68167, Germany, and †Institute of Pathology, Medical Faculty Mannheim, University of Heidelberg, Mannheim 68167, Germany

Background. Axl is a receptor tyrosine kinase promoting anti-apoptosis, invasion and mitogenesis, and is highly
expressed in different solid cancers. Axl basal transcriptional activity is driven by Sp1/Sp3, and overexpression
of MZF-1 (myeloid zinc-finger 1) induces Axl transcription and gene expression. Furthermore, Axl expression is
epigenetically controlled by CpG hypermethylation; however, little is known about inducible Axl gene expression
and Axl regulation in haematopoetic malignancies.
Results. In the present study, we studied Axl transcriptional regulation under PMA-stimulated conditions in leuk-
aemia cells. Luciferase analysis with sequential 5 -deletion constructs revealed that the − 660/ − 580 region of
the Axl promoter is indispensable for induced promoter activity under PMA stimulation. This region includes AP-1
(activator protein 1)/CREB [CRE (cAMP-response-element)-binding protein] motifs, five times partially overlap-
ping TGCGTG repeats and multiple GT repeats. Mutational, supershift and ChIP (chromatin immunoprecipitation)
analysis determined that AP-1 family members bind to AP-1 motifs and to the 5 × TGCGTG overlapping re-
peats, thus transactivating Axl promoter activity. Furthermore, specific inhibitors of PKC (protein kinase C), ERK1/2
(extracellular-signal-regulated kinase 1/2) and p38 reduced Axl expression. Additionally, mithramycin treatment
abolished constitutive and PMA-induced Axl expression.
Conclusions. Taken together the results of the present study suggest that PMA-induced Axl gene expression in
Biology of the Cell

leukaemia cells is mediated by AP-1 motifs and 5 × TGCGTG repeats within the promoter region − 660/ − 580,
and through the PKC/ERK1/2/AP-1 or PKC/p-38/AP-1 signalling axis.

1 Towhom correspondence should be addressed (email
heike.allgayer@umm.de).
Key words: activator protein 1 (AP-1), Axl promoter, PMA, receptor tyrosine
kinase.
Abbreviations used: AP-1, activator protein 1; ATF, activating transcription
factor; ChIP, chromatin immunoprecipitation; CRE, cAMP-response element;
CREB, CRE-binding protein; EGF, epidermal growth factor; EMSA,
electrophoretic mobility-shift assay; ERK, extracellular-signal-regulated
kinase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; JDP,
J-domain-containing protein; JNK, c-Jun N-terminal kinase; MAPK,
mitogen-activated protein kinase; MMP, matrix metalloproteinase; MZF-1,
myeloid zinc finger 1; NF-κB, nuclear factor κB; PKC, protein kinase C; sAxl,
soluble Axl; TRE, PMA-response element; TTBS, Tris-buffered saline with
0.1% Tween; uPA, urokinase-type plasminogen activator; uPAR, uPA receptor.
Introduction
Axl receptor tyrosine kinase belongs to the Tyro3
family, originally identified as a transforming gene
in human leukaemias (Janssen et al., 1991; O’Bryan
et al., 1991). The human Axl protein has a molecular
mass of 140 kDa, and an approximately equal distri-
bution of amino acids on either side of the plasma
membrane with two immunoglobulin-like domains
and two fibronectin-type III domains in the extra-
cellular region, and a distinctive intracellular kinase
domain (O’Bryan et al., 1991; Graham et al., 1994;
Lai et al., 1994). Gas6 is a known ligand for Axl,
and the Gas6–Axl axis is known to transduce anti-
apoptotic signals (Demarchi et al., 2001). Axl is not

www.biolcell.org | Volume 103 (1) | Pages 21–33 21


only expressed as a transmembrane protein, but is also
cleaved at its extracellular domain to produce a sAxl
(soluble Axl) form of ∼65 kDa. In mouse cells, it
has been shown that sAxl generation is mediated by
ADAM10 (a disintegrin and metalloproteinase 10)
proteolysis, and high levels of sAxl were found as a
heterocomplex with the ligand Gas6 in serum (Costa
et al., 1996; Budagian et al., 2005a). Overexpression
of Axl can transform fibroblasts, even in the absence of
Gas6 (Burchert et al., 1998) and is associated with in-
vasiveness and metastasis in various cancer types. Axl
overexpression was also detected in peritoneal meta-
static nodules of colon cancers, prostate carcinoma,
gastric sarcoma, certain types of breast cancers, myel-
oid leukaemia and some other cancer types (Neubauer
et al., 1994; Weiner et al., 1994; Craven et al., 1995;
Jacob et al., 1999; Meric et al., 2002; Wu et al., 2002;
Sun et al., 2003).
Signals transmitted through PKC (protein kinase
C) can potentially activate the network of MAPK
(mitogen-activated protein kinase), which plays an
important role in regulating the response of cells to
various extracellular stimuli, such as PMA (Rubin-
feld and Seger, 2004; Kolch et al., 2005). The MAPK
signalling pathways are activated by sequential phos-
phorylation steps, through five pathways mediated by
JNK (c-Jun N-terminal kinase), ERK (extracellular-
signal-regulated kinase) 1/2, p38 MAPK, ERK5 and
ERK3/4. Activated MAPK kinase pathways activ-
ate AP-1 (activator protein 1), which is a heterodi-
meric complex of structurally and functionally re-
lated members of the Jun (c-Jun, JunB or JunD)
and Fos (c-Fos, FosB, Fra-1 or Fra-2) family. Ad-
ditionally, some members of the ATF (activating
transcription factor) (ATFa, ATF-2 and ATF-3) and
JDP (J-domain-containing protein) (JDP-1 and JDP-
2) subfamilies, which share structural similarities
and form heterodimeric complexes with AP-1 pro-
teins (predominantly with Jun proteins), can bind
to TRE (PMA-response element)-like sequences (5 -
TGAC/GTCA-3 ), as does AP-1. The net activity of
AP-1 can be regulated by changes in the transcrip-
tion of genes encoding AP-1 subunits, by controlling
the stability of their mRNAs, by post-translational
processing and turnover of pre-existing or newly syn-
thesized AP-1 subunits and by specific interactions
between AP-1 proteins and other transcription factors
and cofactors. The activation of AP-1 is involved in
cellular proliferation, apoptosis, differentiation and
22 
C The Authors Journal compilation 
C 2011 Portland Press Limited
G. Mudduluru and others
carcinogenesis (Angel and Karin, 1991; Shaulian and
Karin, 2002, Eferl and Wagner, 2003).
Our previous studies (Mudduluru and Allgayer,
2008; Mudduluru et al., 2010) have shown that con-
stitutive expression of Axl in solid cancer is driven by
Sp1/Sp3, and that overexpression of MZF-1 (myeloid
zinc finger 1) transactivates Axl transcription and
gene expression. Moreover, Axl and MZF-1 are co-
expressed in colorectal cancer tissues. Furthermore,
Axl expression is epigenetically controlled by CpG
hypermethylation. Still, the transcriptional regula-
tion of Axl in blood cells and under stimulated con-
ditions is not clearly known. Therefore, the present
study was performed with leukaemia cells as a model
system, and with PMA as an oncogenic stimulus
to investigate the essential promoter region of Axl,
its transcriptional regulation and inducing signalling
molecules under stimulated conditions.
Results
PMA (5 nM) induces Axl gene expression
in leukaemia cells
To determine the effect of PMA on Axl expression,
K562 and HL-60 cells were stimulated with PMA in
a dose-dependent manner for 24 h. Endogenous Axl
mRNA amounts were screened by quantitative-PCR
analysis. Both cell lines showed inducible Axl gene
expression in a dose-dependent manner (Figures 1a
and 1b). We determined that 5 nM PMA is suffi-
cient for stimulation of K562 and HL-60 cells, in
which a 2-fold (K562) and 10-fold (HL-60) increase
in Axl gene expression is shown (Figures 1a and 1b).
Furthermore, 5 nM PMA stimulation significantly
induced Axl protein amounts in both cell lines (Fig-
ures 1b and 1d). Therefore 5 nM PMA was used for
stimulation in all further experiments.
− 727/ − 556 bp of the Axl promoter region is
mandatory for PMA-induced promoter activity
To determine the minimal Axl promoter region
required for PMA stimulation, we transfected a
series of deletion luciferase constructs into K562
cells. The AxlP1 construct ( − 1276/+7) exhib-
ited a maximum luciferase activity in both stim-
ulated and unstimulated conditions as compared
with pGL3-Basic (Figure 2a). Further deletion con-
structs, AxlP2 ( − 1010/+7), AxlP3 ( − 727/+7),
AxlP4 ( − 556/+7) and AxlP5 ( − 478/+7) showed
MAPK pathways in Axl gene expression Research article
Figure 1 PMA induces Axl gene expression
(a and c) K562 and HL-60 cells were stimulated with different concentrations of PMA for 24 h along with DMSO controls, and Axl
mRNA expression was determined by real-time PCR. GAPDH served as an internal control. (b and d) Both of the cell lines were
treated with 5 nM PMA or DMSO, or neither of them, as indicated. Cell lysates were prepared and Axl was detected by Western
blot analysis. Untreated or DMSO-treated cells served as controls and β-actin served as an internal loading control. TPA, PMA.

a gradual decrease in luciferase activity in both
unstimulated as well as PMA-stimulated condi-
tions, and AxlP4 completely lost the ability to
be stimulated by PMA. AxlD1 ( − 2376/ − 556)
and AxlD2 ( − 2376/ − 770) lack the core promoter
and, additionally, AxlD2 lacks a region spanning
− 770/ − 556, this construct showing almost no luci-
ferase activity, comparable with the pGL3-Basic vec-
tor activity (Figure 2a) in both stimulated and un-
stimulated conditions. The − 2376/+7 reporter con-
struct did not show any further significant induction
in both conditions when compared with the AxlP1
( − 1276/+7) construct (results not shown), indicat-
ing that the main promoter activity for PMA stimula-
tion lies within the − 1276/+7 bp region, this being
comparable with the results seen for constitutive pro-
moter activity in Rko, HCT116 and HeLa cells (Mud-
duluru and Allgayer, 2008). From all of the deletion
experiments, we conclude that these data suggest that
the 5 -flanking region located between − 727 and
− 556 bp is required for PMA-stimulated Axl pro-
moter activity in leukaemia cells. Correspondingly,
a TRANSFAC database search and manual screen-
ing predicted AP-1/CREB [CRE (cAMP-response-
element)-binding protein]-binding motifs between
− 545 and − 530 bp, five overlapping TGCGTG
motifs between − 628 and − 606 bp, and a GT-
rich sequence ( − 610 to − 589) in this region of
the Axl promoter (Figure 2b). Apart from these,
one more AP-1 consensus sequence was predicted
at − 1030/ − 1024 bp of the Axl promoter.
AP-1 and 5 × TGCGTG repeats mediate
PMA-induced Axl promoter activity
To analyse the functional relevance of predicted
motifs in this important region of the pro-
moter ( − 727/ − 556 bp), AP-1 putative motifs
were mutated at four/five bases by site-directed

www.biolcell.org | Volume 103 (1) | Pages 21–33 23

 G. Mudduluru and others

Figure 2 Delineating the 5 -flanking region essential for PMA-induced promoter activity
(a) Schematic representation of a series of deletion constructs of Axl, and reporter assays showing Axl promoter activity. In
total, 500 ng of Axl–luciferase constructs or pGL3-basic vector together with 25 ng of Renilla luciferase plasmid were transiently
transfected with Effectene into K562 cells. The firefly luciferase activity was normalized with Renilla luciferase activity. (b) Schem-
atic presentation of the Axl promoter, important for PMA stimulation with putative binding sites. (c) Schematic representation of
site-directed mutagenesis performed for AP-1 family-binding motifs in the Axl promoter region. Wild-type/mutant Axl promoter
construct (2 μg) along with the Renilla luciferase plasmid were transfected with the Nucleofector Kit V into K562 and HL-60 cell
lines. The wild-type unstimulated activity of AxlP1 was set to 100% (first bar), and the activity of other constructs was calculated
and plotted as a percentage of this value. The statistical difference of the activity of the mutated constructs in all panels is shown
against stimulated AxlP1 wild-type activity. *P  0.05. WT, wild-type. (d) AP-1 binding motifs in the Axl promoter.

mutagenesis within the AxlP1 ( − 1276 to +7) re-
porter plasmid. Different mutated constructs were
generated, with mutations either in single regions
(AP-1 I, AP-1 II, AP-1 III and AP-1 IV) or all
of them (AP-1- I, II, III, IV) (Figures 2c and 2d).
From our previous results, it was shown that the
Axl core promoter is driven by Sp1 and Sp3 in
colorectal cancer cell lines (Mudduluru and Allgayer,
2008). Therefore, to study the additional relevance
of Sp family members under stimulated conditions,
we also used constructs mutated with Sp-binding do-
mains of the Axl promoter (Sp1 abcde) for the present
study (Mudduluru and Allgayer, 2008). Mutated and
wild-type constructs were transfected into the K562
and HL-60 cells and compared for reporter activity.
We observed that all mutants for single AP-1 mo-
tifs reduced the PMA-stimulated promoter activity
as compared with the wild-type AxlP1. Especially
the AP-1 II and AP-1 III mutant constructs signific-
antly reduced the PMA-stimulated promoter activity
(P < 0.05), whereas AP-1 IV showed the trend (P =
0.058) in K562 cells. In HL-60 cells, the AP-1 III
mutant construct showed significant reduction in the
promoter activity (P = 0.021), and others showed
reduction in the promoter activity. The construct
where there was mutation of the four AP-1 motifs
significantly reduced the PMA-stimulated promoter
activity in both of the cell lines (P = 0.0007 and P =
0.018 respectively). Unstimulated promoter activity
was not significantly altered with any of the AP-1

24 
C The Authors Journal compilation 
C 2011 Portland Press Limited
MAPK pathways in Axl gene expression
mutations (Figure 2c). This confirms that all four
AP-1 motifs mediate PMA stimulation of the pro-
moter, especially AP-1 II and III. However, they do
not affect basal promoter activity as compared with
the Sp family binding motifs (Sp1 abcde; Figure 2c).
In addition, the Sp1 abcde mutant construct did
not show any significant increased promoter activ-
ity upon PMA stimulation (Figure 2c). EMSA (elec-
trophoretic mobility-shift assay) and Western blot
analysis for Sp-binding motifs, and expression of
Sp1 and Sp3 after PMA stimulation did not show
an increase in binding efficiency and expression of
Sp1 and Sp3 (Supplementary Figures S1a and S1b
at http://www.biolcell.org/boc/103/boc1030021add
.htm). This clearly implicates that the Sp-binding
motifs are the essential mediators of basic promoter
activity, whereas the AP-1 motifs are mediators of
PMA-inducible promoter activity in leukaemia cells.
PMA increases the abundance
of AP-1 family members
Functional and mutagenesis studies revealed that AP-
1 motifs are important for PMA-stimulated Axl pro-
moter activity. To investigate whether this PMA-
induced promoter activity is due to an increase of ex-
pression or stabilization of AP-1 transcription factors,
sequential Western blot analysis was performed for
AP-1 and Axl proteins. Protein amounts of all AP-1
members were increased in a time-dependent man-
ner, among them c-Fos being the one with an increase
after 1 h of stimulation. Starting at 2 h, Fos B pro-
tein increased, with a maximum level at 4 h. After
30 min of stimulation, activated c-Jun was observed,
and this was constantly present for 24 h. In addition,
total protein levels of c-Jun were increased, starting
at 2 h. Axl protein levels were increased after 4 h of
treatment and were further increased at 24 h (Fig-
ure 3a). Most of the AP-1 family members’ gene ex-
pression was induced by PMA-stimulation in K562
cells. Activated c-Jun levels were stable from 8 to
24 h after stimulation, which was paralled by an in-
crease of Axl protein levels at 8 h and a further 4-fold
increase of Axl protein at 24 h. Taken together, these
data show that PMA activates c-Jun and stabilizes
the expression of all AP-1 family members, which
is followed by an increase of Axl protein expression
in K562 cells. Since we observed a higher activa-
tion/expression of AP-1 transcription factors at 8 h
post-stimulation with PMA, we used this time point
Research article
for EMSA and supershift analysis to show the bind-
ing of these transcription factors to the respective
cis-elements in the Axl promoter.
AP-1 family nuclear proteins bind
to the Axl promoter
To demonstrate that PMA-induced Axl gene ex-
pression is dependent on AP-1 family transcription
factors binding to the promoter, gel-shift and super-
shift analysis was performed using nuclear extracts
either with DMSO- or PMA-stimulated K562 cells.
EMSA and supershift analysis was performed with
oligonucleotides corresponding to the AP-1-binding
motifs (Figure 2d) and the GT-rich region. To de-
termine specific binding of AP-1 to these motifs, a
50-fold excess of unlabelled wild-type, or a 50-fold
excess of an oligonucleotide mutated for the respect-
ive AP-1-binding motif (Supplementary Figure S2
at http://www.biolcell.org/boc/103/boc1030021add
.htm) were used for cold (non-radioactive) competi-
tion. As shown in Supplementary Figure S2, the com-
petition with wild-type oligonucleotides completely
abolished specific binding of transcription factors,
whereas, with the mutated oligonucleotides as com-
petitors, the formation of specific complexes stayed
intact, demonstrating binding specificity for these
motifs.
To investigate the binding of specific AP-1 fam-
ily members to these motifs, a comparative super-
shift analysis with all AP-1 family members was per-
formed with nuclear extracts of K562 cells, with or
without PMA stimulation (Figure 2d). PMA stim-
ulation increased the abundance of specific com-
plexes to the AP-1 motifs. Incubation of AP-1
family antibodies identified phospho-c-Jun within
the AP-1 complexes at all four AP-1 motifs and
at the GT-rich region, under PMA-unstimulated
conditions (Figures 3b and 3c, and Supplement-
ary Figures S3a and S3b, top panel at http://www.
biolcell.org/boc/103/boc1030021add.htm). Follow-
ing PMA stimulation, Fos B and Fra 1 were iden-
tified to be increased within the AP-1 complexes at
all sites, and also at the GT-rich region (Figures 3b
and 3c, and Supplementary Figures S3a and S3b,
bottom panel). Additionally, Jun B was identified
within complexes bound to the AP-1 I and AP-1 IV
motif, and Jun B, Jun D and c-Fos within complexes
at the AP-1 II and AP-1 III motif (Figures 3b and
www.biolcell.org | Volume 103 (1) | Pages 21–33 25
 G. Mudduluru and others

Figure 3 AP-1 family members bind to the Axl promoter, and their abundance increases after PMA stimulation
(a and b) Supershift analysis was performed with (bottom panel) or without (top panel) PMA stimulation (for 8 h) and nuclear
extracts of K562, for AP-1 family members (c-Jun, Jun B, Jun D, c-Fos, Fos B, Fra 1 and Fra 2) using AP-1 I ( − 628/ − 606 bp)
and AP-1 II and III ( − 655/ − 640 bp) as radioactive probes. IgG served as the negative control. Specific supershifted complexes
are indicated with arrows. (c) K562 cells were stimulated with 5 nM PMA for the time points indicated, followed by preparation
of total cell lysates. Untreated cells were used as a control. Phospho-c-Jun, c-Jun, Jun B, Jun D, c-Fos, Fos B, Fra 1, Fra 2
and Axl protein levels were determined by Western blot analysis. β-Actin served as the internal control. The results shown are
representative of two similar experiments. (d) The in vivo association of phospho-c-Jun with the Axl promoter was evaluated with
a ChIP assay in K562 and HL-60 cells after 24 h of DMSO, PMA, Gö6983, or Gö6983 with PMA treatment. Immunoprecipitated
DNA with the specific antibody was amplified by real-time PCR (SYBR® Green) using specific primers. TPA, PMA.

3c, and Supplementary Figures S3a and S3b, bottom
panel).
The AP-1 II and AP-1 III motifs harbour CRE and
TRE consensus sequences, which could bind CREB
and AP-1 transcription factors respectively. To define
binding of phospho-CREB and phospho-c-Jun tran-
scription factors together at these motifs, supershift
analysis was performed. No significant differences in
band intensities were observed between unstimulated
and PMA-stimulated supershift bands for CREB and
phospho-CREB; however, an intense shifted band was
observed with phospho-c-Jun following PMA stim-
ulation (Supplementary Figure S4b at http://www.
biolcell.org/boc/103/boc1030021add.htm), even
though increased activated p-CREB levels were
observed within nuclear proteins (Supplementary
Figure S4a). These results suggest that AP-1 family
transcription factors are binding preferentially to the

26 
C The Authors Journal compilation 
C 2011 Portland Press Limited
MAPK pathways in Axl gene expression
specific AP-1 motifs in the Axl promoter, as opposed
to CREB transcription factors.
ChIP (chromatin immunoprecipitation) analysis
was performed to determine the in vivo relevance of
AP-1 transcription factor binding to the Axl pro-
moter, comparing DMSO treatment with PMA stim-
ulation, and, to get initial insights into putative
signalling mediators, with a PMA/PKC inhibitor
in K562 and HL-60 cells. A non-specific region of
the uPAR [uPA (urokinase-type plasminogen activ-
ator) receptor] promoter was used as a negative con-
trol (Mudduluru and Allgayer, 2008), which did not
show any specific changes after treatment (results
not shown). PMA stimulation increased the bind-
ing of phospho-c-Jun to the Axl promoter; also, 1 h
pre-treatment with Gö6983 decreased the binding
of phospho-c-Jun (Figure 3d). Similar results were
observed in Western blot analysis; Gö6983 inhibited
c-Jun activation (Figure 4b). These data support the
notion that, in vivo, AP-1 binds to the predicted AP-
1 consensus and GT-rich region of the Axl promoter
upon PMA-stimulation, and that the PKC pathway
might be one important mediator.
The PKC/MAPK signalling pathway mediates
PMA-induced Axl gene expression
To investigate signalling molecules mediating PMA-
induced Axl gene expression, luciferase assay, EMSA,
quantitative PCR and Western blot analysis were per-
formed following treatment of the cells with various
chemical inhibitors of the MAPK signalling pathway
prior to PMA stimulation. K562 and HL-60 cells
were transfected with AxlP1 reporter constructs and
treated with the specific inhibitors for 45 min and sti-
mulated with PMA for 24 h (Figure 5a). PKC and
ERK1/2 inhibitors significantly reduced the Axl pro-
moter activity, whereas a p38 inhibitor showed the
trend and a JNK inhibitor showed reduced promoter
activity. Similar results were observed with EMSA
analysis with inhibitor treatment (Figure 5b). PKC,
ERK1/2 and p38 inhibitors showed reduced PMA-
induced AP-1 binding to the Axl promoter. Addi-
tionally, K562 or HL-60 cells were untreated, treated
with DMSO or treated with PMA following 45 min
of pretreatment with PKC/JNK/ERK/p38 inhibit-
ors, or the GC-rich binding compound mithramy-
cin (Figure 4). No differences in the activation and
expression of PKC signalling molecules and in
Axl expression and protein amounts were observed
Research article
between untreated and DMSO-treated samples.
PMA-induced Axl gene expression was completely
abolished by the PKC inhibitor Gö6983 in paral-
lel with the downstream signalling molecules ERK,
p38, JNK and phospho-c-Jun, in both of the cell
lines (Figures 4a and 4b). Specific inhibitors of ERK
(U0216), p38 (SB202190) and JNK (SP600125) par-
tially abolished PMA-induced Axl gene expression
in K562 cells (Figure 4a). Both the ERK1/2 and
p38 inhibitors completely abolished Axl gene ex-
pression in the HL-60 cell line (Figure 4a). Further-
more, Western blot analysis showed similar results in
K562 cells (Figures 4c and 4d). Individual inhibitors
of JNK/ERK/p38 could not abolish the activation of
c-Jun completely, as indicated by Western blotting
for phosphorylated c-Jun (Figures 4c and 4d). This
could be due to the leakage of signalling through
other MAPK signalling molecules. This suggests that
PMA-induced signalling might be working mainly
through ERK and p38. However, the differences in
PMA-induced Axl gene expression through MAPK
signalling in these cell lines need to be further invest-
igated thoroughly. Apart from the findings presented,
post-transcriptional regulation of Axl cannot be ruled
out after PMA stimulation. Furthermore, to gain ad-
ditional information on the PMA-induced effect on
basal Axl gene expression, mithramycin, which has
already been shown to abolish Axl basal gene expres-
sion via the prevention of Sp binding in colorectal
cell lines (Mudduluru and Allgayer, 2008), was in-
cluded. PMA-activated MAPK could not induce Axl
gene expression after mithramycin treatment (Fig-
ure 4c), even though the MAPK signalling cascade
was active, suggesting that basal Axl gene expres-
sion via Sp factors is a prerequisite for inducible ex-
pression. Taken together, these results suggest that
PMA-induced Axl gene expression is mainly regu-
lated via PKC and MAPK/ERK1/2 and MAPK/p38
pathways, and it further reconfirms in leukaemia cells
that Sp family transcription factors are required for
constitutive Axl gene expression.
Discussion
Axl has been discussed as a transforming gene in
leukaemia (Janssen et al., 1991; O’Bryan et al.,
1991); however, mechanisms inducing its expres-
sion upon oncogenic stimuli in leukaemia are still
the subject of investigation. In the present study
www.biolcell.org | Volume 103 (1) | Pages 21–33 27
 G. Mudduluru and others

Figure 4 The MAPK pathway via different signalling molecules mediates PMA-induced Axl gene expression
(a) Real-time PCR analysis of K562 and HL-60 cells were performed with DMSO, PMA or with specific inhibitors in combination
with PMA, as indicated. Cells were pretreated with inhibitors for 45 min and further stimulated with 5 nM PMA for 24 h. (b) Western
blot analysis of K562 and HL-60 cells were performed with DMSO, PMA, Gö6983 or a combination of PMA and Gö6983. Cells
were pretreated with DMSO or Gö6983 in the respective wells for 45 min and stimulated for either 1 h or 24 h along with PMA.
Specific antibodies against the indicated molecules were used, together with anti-β-actin as a loading control. (c and d) Effect
of inhibitors on PMA-induced Axl protein expression. K562 cells were pretreated with ERK1/2 inhibitor U0216 (10 μM), p38
inhibitor SB202190 (10 μM), JNK inhibitor SP600125 (5 to 10 μM) and mithramycin (100 nM) 45 min before stimulation with
5 nM PMA and incubated for an additional 24 h along with inhibitors or as indicated. Untreated and DMSO-treated cells served
as experimental controls. Cell lysates were prepared, and phosphorylated (phospho-ERKs, phospho-p38, phospho-JNK and
phospho-c-Jun) and total (ERKs, p38, JNK, Axl) proteins were detected by Western blot analysis. β-Actin served as the internal
control. TPA, PMA.

we show that, in leukaemia cells, PMA-induced Axl
gene expression is mediated by AP-1 family tran-
scription factors bound to AP-1 cis-acting elements
within − 660 and − 580 bp of the promoter region.
This region is essential for PMA-induced Axl pro-
moter activity. PMA-stimulation activates AP-1 fam-
ily members and induces the expression/stabilization
of AP-1 family transcription factors that lead to
induced Axl gene expression in leukaemia cell
lines. Moreover, we found that PMA-stimulated Axl
gene expression is mediated through ERK/JNK/p38
signalling.

28 
C The Authors Journal compilation 
C 2011 Portland Press Limited
MAPK pathways in Axl gene expression Research article
Figure 5 The MAPK pathway inhibitors reduce Axl promoter activity and AP-1 binding to its promoter
(a) Luciferase analysis of AxlP1 either with or without pre-treatment of specific inhibitors in K562 and HL-60 cells. (b) EMSA
analysis was performed with AP-1 II and III ( − 655/ − 640 bp) motif with or without PMA stimulation (8 h) after 45 min of
pre-treatment with the specific inhibitors in K562 and HL-60 cells. TPA, PMA.

AP-1 consists of various dimers of the Fos (c-Fos,
FosB, Fra-1 and Fra-2), Jun (c-Jun, JunB and JunD),
and CREB/ATF protein families, as well as other bZip
proteins. In addition, associations have been observed
between Fos or Jun and the p65 subunit of NF-κB
(nuclear factor κB) (Stein et al., 1993) and ATF-2
and p50-NF-κB (Du et al., 1993). AP-1 transcrip-
tion factor heterodimers or homodimers bind to a
consensus cis-element in the promoters of a number
of genes (Adler et al., 1994). Evidence for the critical
importance of AP-1 activity in malignant transform-
ation induced by tumour promoters or by oncogenes
has been reported (Bernstein and Colburn, 1989;
Domann et al., 1994; Dong et al., 1994). The regula-
tion of AP-1 activity is complex and occurs at differ-
ent levels, including dimer composition, transcrip-
tional and post-translational events, and interaction
with ancillary proteins. AP-1 is induced by several
external stimuli that increase MAPK activity, indu-
cing activation of c-Fos and c-Jun. PMA, a tumour-
promoting agent, often serves as a model agent to
study the mechanism by which growth factors reg-
ulate growth and differentiation of the cells, and is
an endogenous activator of PKC and MAPK path-
ways (Jaken, 1996; Parekh et al., 2000). AP-1 ac-
tivation itself can be mediated by AP-1 binding to
TRE elements within the promoter, for example of
c-Jun and Fra-1, inducing their expression (Angel
et al., 1988; Bergers et al., 1995). The − 1276/+7
region of the Axl promoter showed maximum activ-
ity under PMA-stimulated conditions (Mudduluru
and Allgayer, 2008). A TRANSFAC database search,
5 delineation reporter analysis, site-directed muta-
genesis, EMSA and supershift analysis of the Axl pro-
moter identified two unique binding motifs of AP-1-
and TRE-consensus sequences, which are essential
for PMA-stimulated promoter activity (AP-1 II and
AP-1 III). Apart from these two, AP-1-binding mo-
tifs containing partially overlapping five TGCGTG
repeats, a − 607 to − 589 bp unique GT-rich
motif and a distant − 1010 to − 1022 bp AP-1 mo-
tif show specific binding complexes of AP-1 tran-
scription factors under PMA-stimulated conditions,
which are also required for stimulated Axl promoter
activity. Axl protein amounts could be detected at 4 h
and increased gradually up to 24 h, whereas activated
c-Jun was detected at 30 min and achieved maximum
activated levels at 12 h. Among AP-1 members, an
induction of c-Fos and c-Jun was detected as early
as 1 h and 2 h respectively, and achieved maximum

www.biolcell.org | Volume 103 (1) | Pages 21–33 29


levels 4–12 h after PMA treatment. These findings
suggest that c-Jun is being activated at early time
points upon PMA treatment and, indeed, transactiv-
ates/stabilizes the other AP-1 transcription factors.
Thus c-Jun or c-Fos might be playing a major role in
the earlier course and the rest of the AP-1 factors may
play a major role in the later course of the induction
of Axl gene transcription by PMA, a phenomenon
which has been described previously, e.g. for Fra1
and proenkephalin (Adiseshaiah et al., 2003; Won
et al., 1998). We can speculate that upon PMA stim-
ulation, AP-1 transcription factors are activated and
autoregulated or stabilized at their protein levels, and
then transactivate Axl gene expression.
c-Jun transcriptionally regulates EGFR [EGF
(epidermal growth factor) receptor] and HB-EGF
(heparin-binding EGF-like growth factor), thereby
controlling keratinocyte proliferation and skin tu-
mour formation (Zenz et al., 2003). Hu et al.
(1994) and Kustikova et al. (1998) reported that
AP-1 transcription factors stimulate the transcrip-
tion of MMP (matrix metalloproteinase) 9, MMP1,
uPA, uPAR, HMGI(Y) [high-mobility group I (Y)]
and E-cadherin, which are tumour progression- and
metastasis-associated genes. Since Axl overexpression
is associated with increased invasion, metastasis and
angiogenesis in various cancer cells, and also its over-
expression is reported in different cancers, such as
metastatic colon and prostate carcinoma, gastric, en-
dometrial, certain types of breast cancers and sarco-
mas (Neubauer et al., 1994; Weiner et al., 1994;
Craven et al., 1995; Jacob et al., 1999; Meric et al.,
2002; Wu et al., 2002; Sun et al., 2003; Budagian
et al., 2005b; Shieh et al., 2005; Vajkoczy et al.,
2006), the transactivation of Axl by AP-1 following
PMA stimulation adds to the list of essential AP-1
target genes in the context of carcinogenesis, inva-
sion, metastasis and angiogenesis.
Signals transmitted through PKC can potentially
activate the network of MAPK signal-transduction
pathways (ERK1/2, JNK, p38, ERK5 and ERK3/4),
which play an important role in regulating the re-
sponse of cells to various extracellular stimuli, such
as PMA (Kast et al., 2003; Rubinfeld and Seger,
2004; Kolch et al., 2005). The conventional posi-
tion of c-Jun/AP-1 in signal transduction cascades
has been downstream of MAPK pathways. Thus we
studied the effect of inhibitors of each MAPK path-
way on PMA-dependent Axl gene expression. PMA-
30 
C The Authors Journal compilation 
C 2011 Portland Press Limited
G. Mudduluru and others
activated MAPK, activated c-Jun and promoted Axl
promoter activity and gene expression (Figure 4),
indicating that activation of the MAPK cascade is
relevant for PMA-induced Axl gene expression (An-
gel and Karin, 1991; Minden and Karin, 1997; Kast
et al., 2003). Diverse inhibitors of different molecules
of MAPK-associated pathways [JNK (SP600125),
ERK1/2 (U0126), and p38 (SB202190)] repressed
c-Jun activation and reduced AP-1-binding com-
plexes to the Axl promoter, indicating three dif-
ferent lines of signalling in this particular situation
(Pulverer et al., 1991; Papavassiliou et al., 1995; Shin
et al., 2002; Kast et al., 2003). These findings sug-
gest that inhibition of PKC or downstream signalling
molecules of PKC (ERK1/2, JNK, p38) activity res-
ults in an inhibition of AP-1 transactivation, which is
an important mechanism for Axl transactivation and
gene expression under tumorigenic PMA stimula-
tion, suggesting therapeutic considerations for leuk-
aemia. Mithramycin treatment completely blocked
PMA-induced Axl gene expression, even though the
MAPK signalling cascade was active, which is a con-
firmation that, also in leukaemia, Sp1/Sp3 is essential
for the basal transcriptional activation of Axl gene
expression, which is a prerequisite for inducibility
(Mudduluru and Allgayer, 2008).
In summary, we have identified an AP-1 family
binding region − 660 to − 580 bp within the Axl
promoter that is indispensable for PMA-induced
Axl gene expression in leukaemia cells. Induction of
transcription factor AP-1 binding is mainly mediated
through the ERK1/2/p38 pathway, and phorbol es-
ters transactivate and/or stabilize the expression of all
AP-1 family transcription factors in leukaemia cells.
Materials and methods
Cell culture, reagents and treatments
K562 and HL-60 cells were obtained from the A.T.C.C. and
grown at 37◦ C in RPMI medium supplemented with 10%
FCS (fetal calf serum). Mock-treated control cells were handled
identically with PMA (Sigma)-stimulated cells with the excep-
tion that only medium was added. For inhibition studies, cells
were treated with or without the following inhibitors for 45
min: 5 μM Gö6983 (Calbiochem), 10 μM U0216 (Calbiochem),
10 μM SB202190 (Calbiochem), 100 nM mithramycin (Sigma)
and 5 or 10 μM SP600125 (Calbiochem) respectively.
Preparation of protein extracts and immunoblotting
Protein lysates were prepared as described previously by Mud-
duluru et al. (2008). Briefly, for immunoblotting, samples
(50 μg/lane) were boiled for 5 min, separated via SDS/PAGE,
MAPK pathways in Axl gene expression
and transferred on to PVDF membranes. After transfer, the mem-
branes were blocked with 5% non-fat skimmed milk containing
TTBS [TBS (Tris-buffered saline, 50 mM Tris/HCl and 150 mM
NaCl, pH 8.0) with 0.1% Tween] for 3 h at room temperature
(21◦ C) and then probed with primary antibodies against c-Jun
(Santa Cruz Biotechnology, sc-45x), phospho-c-Jun (Santa Cruz
Biotechnology, sc-822), Jun B (Santa Cruz Biotechnology, sc-
46x), Jun D (Santa Cruz Biotechnology, sc-74x), c-Fos (Santa
Cruz Biotechnology, sc-52x), Fos B (Santa Cruz Biotechno-
logy, sc-7203x), Fra1 (Santa Cruz Biotechnology, sc-22794x),
Fra2 (Santa Cruz Biotechnology, sc-604x), phospho-Jnk (Cell
Signaling Technology, cs-9251s), JNK (Cell Signaling Techno-
logy, cs 9252), phospho-ERK1/2 (Cell Signaling Technology, cs
9101s), ERK1/2 (Cell Signaling Technology, cs 9102), phospho-
p38 (Cell Signaling Technology, cs 9211s), p38 (Cell Signaling
Technology, cs-9212), Axl (Santa Cruz Biotechnology, sc-1096)
or β-actin (Santa Cruz Biotechnology, sc-1616) for 2 h at room
temperature. After three washes with TTBS, blots were incub-
ated with the appropriate secondary antibodies conjugated with
horseradish peroxidase. After final washes with TTBS, the mem-
branes were exposed to film after ECL (enhanced chemilumines-
cence; Amersham Biosciences).
RNA isolation and RT (reverse transcriptase)–PCR
Total RNA was extracted using the RNeasy Midi kit
(Qiagen) according to the manufacturer’s instructions. Total
RNA (1 μg) was reverse-transcribed by random hexamer
primers using SuperScript II reverse transcriptase (Invitro-
gen). The single-strand cDNA was amplified by SYBR® Green
quantitative PCR using specific primers as described previ-
ously (Mudduluru et al., 2010). GAPDH (glyceraldehyde-3-
phosphate dehydrogenase) was used as an internal control.
The sequences of the sense and antisense primers used for
either semi-quantitative, or SYBR® Green quantitative PCR
were: GAPDH (sense, 5 -GTCTTCACCACCATGGAGAA-3
and antisense, 5 -ATCCACAGTCTTCTGGGTGG-3 ) and Axl
(sense, 5 -GGTGGCTGTGAAGACGATGA-3 and antisense,
5 -CTCAGATACTCCATGCCACT-3 ).
Preparation of nuclear extract and EMSA
Cells were either pre-treated with the respective specific
inhibitor for 45 min and/or treated for 8 h with PMA
(5 nM), then cells were harvested into 50 ml Falcon tubes
and washed with ice-cold PBS. Nuclear extraction, protein
concentration estimation and EMSAs were essentially per-
formed as described previously (Mudduluru and Allgayer,
2008; Mudduluru et al., 2010). Briefly, 100 ng of annealed
double-stranded oligonucleotides, GT-rich ( − 609/ − 569),
AP-1 I (5 × TGCGTG repeats: − 635/ − 601), AP-1 II
and III ( − 672/ − 631), and AP-1 IV ( − 1036/ − 1008),
of the Axl promoter listed in Supplementary Table S1
(at http://www.biolcell.org/boc/103/boc1030021add.htm) were
end-labelled with [γ -33 P]dATP using T4 polynucleotide kinase
(NEB), and purified with Sephadex G-50 columns (Amersham
Bioscience). The DNA-binding reaction was conducted on ice for
20 min with 5 μg of K562 cell nuclear extract. For supershift as-
says, antibodies were incubated with the reaction mixture at 4◦ C
for an additional 60 min. Samples were analysed on a 5% poly-
Research article
acrylamide gel in 0.25 × Tris/borate/EDTA buffer at 10 V/cm
for 3.5 h. The gel was dried and analysed by autoradiography.
Generation of luciferase reporter constructs
Luciferase reporter constructs of the Axl promoter gener-
ated as described by Mudduluru et al. (2008). Two addi-
tional reporter constructs were generated (Mudduluru and
Allgayer, 2008), lacking the transcriptional start site
and the core promoter, using specific reverse primers. The
primer sequences are listed in Supplementary Table S2 (at
http://www.biolcell.org/boc/103/boc1030021add.htm). Mutant
constructs were generated using the QuikChange® XL site-
directed mutagenesis kit from Stratagene using AxlP1 ( − 1276
to +7) as a template. The sequences of the mutant oligonuc-
leotides are shown in Supplementary Table S1. Successful incor-
poration of the mutations was confirmed by automated sequen-
cing.
Transfection and luciferase assays
For luciferase assays, 0.5 × 106 K562 cells were plated in 24-well
plates at the time of transfection. Luciferase reporter plasmids
(0.5 μg of each) were transfected with the Effectene® transfection
reagent (Qiagen). For AP-1/Sp family binding motif mutation
and specific inhibitor-treated luciferase assay analysis, cells were
electroporated with the Amaxa Cell Line Nucleofector Kit V
(Lonza) according to the manufacturer’s protocol into 2 × 106
cells with 2 μg of respective reporter plasmid. For all luciferase
reporter assays, 25 ng of pRL-TK (Renilla luciferase-thymidine
kinase; Promega) was also co-transfected and measured to nor-
malize transfection efficiency. After 12 h of transfection, cells
were either pre-treated with specific inhibitors for 45 min and/or
stimulated with 5 nM of PMA. After 24 h, cells were washed
twice with PBS and lysed with 100 μl of passive lysis buffer
(Promega) for 20 min. Luciferase activity of 20 μl of cell lysate
was measured via the dual-luciferase reporter assay system (Pro-
mega) according to the manufacturer’s instructions. Assays for
all samples were performed in triplicate, and the results were
averaged.
ChIP assay
ChIP assays were performed as described previously (Leupold
et al., 2007; Mudduluru and Allgayer, 2008) using either
anti-phospho-c-Jun (Santa Cruz Biotechnology, sc-822 X) and
anti-IgG (as a control; Santa Cruz Biotechnology, sc-2338 X)
antibodies. K562 or HL-60 cells were either mock-treated with
DMSO or treated with Gö6983 (5 μM) in the respective samples
45 min prior to PMA (5 nM) stimulation. After 24 h, cells were
processed as described previously (Leupold et al., 2007; Muddu-
luru and Allgayer, 2008). Phospho-c-Jun-binding intensity to
the Axl promoter was measured using SYBR® Green PCR with
specific primers: sense 5 -AGTGTGTCTGTGGGCCAGTA-3
and antisense 5 -CCTTCATTCCCCCTCACTCT-3 .
Statistical analysis
Statistical analyses were performed using SPSS statistical soft-
ware. A Student’s t test was performed for data with normal
distribution, and the Wilcoxon test for all other analyses. P
values of 0.05 were considered as statistically significant.
www.biolcell.org | Volume 103 (1) | Pages 21–33 31

Author contribution
Concept and design of the research was by Girid-
har Mudduluru. The experiments were carried out
by Giridhar Mudduluru and Jörg Leupold; collec-
tion and/or assembly of data was by Giridhar Mud-
duluru; and data analysis and interpretation was by
Giridhar Mudduluru and Philipp Stroebel. The ma-
nuscript was written by Giridhar Mudduluru and
Heike Allgayer. Financial support for the study was
obtained by Heike Allgayer. All authors approved the
final manuscript.
Acknowledgements
This publication contains parts of the dissertation
(Dr. sc. hum.) of Giridhar Mudduluru at the Man-
nheim Faculty of Medicine, University of Heidelberg,
Mannheim, Germany. We thank Erika Hillerich and
Laura Nelson for excellent help and critical appraisal
of the manuscript prior to submission.
Funding
H.A. was supported by the Alfried Krupp von
Bohlen und Halbach Foundation (Award for Young
Full Professors), Essen; the Hella-Bühler-Foundation,
Heidelberg; the Dr Ingrid zu Solms Foundation,
Frankfurt/Main; the Hector Foundation, Weinheim,
Germany; the FRONTIER Excellence Initiative of
the University of Heidelberg; and the Walter Schulz
Foundation, Munich, Germany.
References
Adiseshaiah, P., Papaiahgari, S.R., Vuong, H., Kalvakolanu, D.V. and
Reddy, S.P. (2003) Multiple cis-elements mediate the
transcriptional activation of human fra-1 by
12-O-tetradecanoylphorbol-13-acetate in bronchial epithelial cells.
J. Biol. Chem. 278, 47423–47433
Adler, V., Unlap, T. and Kraft, A.S. (1994) A peptide encoding the
c-Jun delta domain inhibits the activity of a c-jun amino-terminal
protein kinase. J. Biol. Chem. 269, 11186–11191
Angel, P., Hattori, K., Smeal, T. and Karin, M. (1988) The jun
proto-oncogene is positively autoregulated by its product,
Jun/AP-1. Cell 55, 875–885
Angel, P. and Karin, M. (1991) The role of Jun, Fos and the AP-1
complex in cell-proliferation and transformation. Biochim. Biophys.
Acta 1072, 129–157
Bergers, G., Graninger, P., Braselmann, S., Wrighton, C. and
Busslinger, M. (1995) Transcriptional activation of the fra-1 gene by
AP-1 is mediated by regulatory sequences in the first intron. Mol.
Cell. Biol. 15, 3748–3758
Bernstein, L.R. and Colburn, N.H. (1989) AP1/jun function is
differentially induced in promotion-sensitive and resistant JB6
cells. Science 244, 566–569
32 
C The Authors Journal compilation 
C 2011 Portland Press Limited
G. Mudduluru and others
Budagian, V., Bulanova, E., Orinska, Z., Duitman, E., Brandt, K.,
Ludwig, A., Hartmann, D., Lemke, G., Saftig, P. and Bulfone-Paus,
S. (2005a) Soluble Axl is generated by ADAM10-dependent
cleavage and associates with Gas6 in mouse serum. Mol. Cell.
Biol. 25, 9324–9339
Budagian, V., Bulanova, E., Orinska, Z., Thon, L., Mamat, U.,
Bellosta, P., Basilico, C., Adam, D., Paus, R. and Bulfone-Paus, S.
Bulfone-Paus (2005b) A promiscuous liaison between IL-15
receptor and Axl receptor tyrosine kinase in cell death control.
EMBO J. 24, 4260–4270
Burchert, A., Attar, E.C., McCloskey, P., Fridell, Y.W. and Liu, E.T.
(1998) Determinants for transformation induced by the Axl receptor
tyrosine kinase. Oncogene 16, 3177–3187
Costa, M., Bellosta, P. and Basilico, C. (1996) Cleavage and release
of a soluble form of the receptor tyrosine kinase ARK in vitro and in
vivo. J. Cell Physiol. 168, 737–744
Craven, R.J., Xu, L.H., Weiner, T.M., Fridell, Y.W., Dent, G.A.,
Srivastava, S., Varnum, B., Liu, E.T. and Cance, W.G. (1995)
Receptor tyrosine kinases expressed in metastatic colon cancer.
Int. J. Cancer 60, 791–797
Demarchi, F., Verardo, R., Varnum, B., Brancolini, C. and Schneider,
C. (2001) Gas6 anti-apoptotic signaling requires NF-κB activation.
J. Biol. Chem. 276, 31738–31744
Domann, F.E., Levy, J.P., Birrer, M.J. and Bowden, G.T. (1994) Stable
expression of a c-JUN deletion mutant in two malignant mouse
epidermal cell lines blocks tumor formation in nude mice. Cell
Growth Differ. 5, 9–16
Dong, Z., Birrer, M.J., Watts, R.G., Matrisian, L.M. and Colburn, N.H.
(1994) Blocking of tumor promoter-induced AP-1 activity inhibits
induced transformation in JB6 mouse epidermal cells. Proc. Natl.
Acad. Sci. U.S.A. 91, 609–613
Du, W., Thanos, D. and Maniatis, T. (1993) Mechanisms of
transcriptional synergism between distinct virus-inducible
enhancer elements. Cell 74, 887–898
Eferl, R. and Wagner, E.F. (2003) AP-1: a double-edged sword in
tumorigenesis. Nat. Rev. Cancer 3, 859–868
Graham, D.K., Dawson, T.L., Mullaney, D.L., Snodgrass, H.R. and
Earp, H.S. (1994) Cloning and mRNA expression analysis of a
novel human protooncogene, c-mer. Cell Growth Differ. 5, 647–657
Hu, E., Mueller, E., Oliviero, S., Papaioannou, V.E., Johnson, R. and
Spiegelman, B.M. (1994) Targeted disruption of the c-fos gene
demonstrates c-fos-dependent and -independent pathways for
gene expression stimulated by growth factors or oncogenes.
EMBO J. 13, 3094–3103
Jacob, A.N., Kalapurakal, J., Davidson, W.R., Kandpal, G., Dunson,
N., Prashar, Y. and Kandpal, R.P. (1999) A receptor tyrosine kinase,
UFO/Axl, and other genes isolated by a modified differential
display PCR are overexpressed in metastatic prostatic carcinoma
cell line DU145. Cancer Detect Prev. 23, 325–332
Jaken, S. (1996) Protein kinase C isozymes and substrates. Curr.
Opin. Cell Biol. 8, 168–173
Janssen, J.W., Schulz, A.S., Steenvoorden, A.C., Schmidberger, M.,
Strehl, S., Ambros, P.F. and Bartram, C.R. (1991) A novel putative
tyrosine kinase receptor with oncogenic potential. Oncogene 6,
2113–2120
Kast, C., Wang, M. and Whiteway, M. (2003) The ERK/MAPK
pathway regulates the activity of the human tissue factor pathway
inhibitor-2 promoter. J. Biol. Chem. 278, 6787–6794
Kolch, W., Calder, M. and Gilbert, D. (2005) When kinases meet
mathematics: the systems biology of MAPK signalling. FEBS Lett.
579, 1891–1895
MAPK pathways in Axl gene expression
Kustikova, O., Kramerov, D., Grigorian, M., Berezin, V., Bock, E.,
Lukanidin, E. and Tulchinsky, E. (1998) Fra-1 induces
morphological transformation and increases in vitro invasiveness
and motility of epithelioid adenocarcinoma cells. Mol. Cell. Biol. 18,
7095–7105
Lai, C., Gore, M. and Lemke, G. (1994) Structure, expression, and
activity of Tyro 3, a neural adhesion-related receptor tyrosine
kinase. Oncogene 9, 2567–2578
Leupold, J.H., Asangani, I., Maurer, G.D., Lengyel, E., Post, S. and
Allgayer, H. (2007) Src induces urokinase receptor gene expression
and invasion/intravasation via activator protein-1/p-c-Jun in
colorectal cancer. Mol. Cancer Res. 5, 485–496
Meric, F., Lee, W.P., Sahin, A., Zhang, H., Kung, H.J. and Hung, M.C.
(2002) Expression profile of tyrosine kinases in breast cancer. Clin.
Cancer Res. 8, 361–367
Minden, A. and Karin, M. (1997) Regulation and function of the JNK
subgroup of MAP kinases. Biochim. Biophys. Acta 1333, F85–F104
Mudduluru, G. and Allgayer, H. (2008) The human receptor tyrosine
kinase Axl gene–promoter characterization and regulation of
constitutive expression by Sp1, Sp3 and CpG methylation. Biosci.
Rep. 28, 161–176
Mudduluru, G., Vajkoczy, P. and Allgayer, H. (2010) Myeloid zinc
finger 1 induces migration, invasion, and in vivo metastasis through
Axl gene expression in solid cancer. Mol. Cancer Res. 8, 159–169
Neubauer, A., Fiebeler, A., Graham, D.K., O’Bryan, J.P.,
Schmidt, C.A., Barckow, P., Serke, S., Siegert, W., Sndograss,
H.R., Huhn, D. et al. (1994) Expression of axl, a transforming
receptor tyrosine kinase, in normal and malignant hematopoiesis.
Blood 84, 1931–1941
O’Bryan, J.P., Frye, R.A., Cogswell, P.C., Neubauer, A., Kitch, B.,
Prokop, C., Espinosa, 3rd, R., Le Beau, M.M., Earp, H.S. and
Liu, E.T. (1991) Axl, a transforming gene isolated from primary
human myeloid leukemia cells, encodes a novel receptor tyrosine
kinase. Mol. Cell Biol. 11, 5016–5031
Papavassiliou, A.G., Treier, M. and Bohmann, D. (1995) Intramolecular
signal transduction in c-Jun. EMBO J. 14, 2014–2019
Parekh, D.B., Ziegler, W. and Parker, P.J. (2000) Multiple pathways
control protein kinase C phosphorylation. EMBO J. 19, 496–503
Pulverer, B.J., Kyriakis, J.M., Avruch, J., Nikolakaki, E. and Woodgett,
J.R. (1991) Phosphorylation of c-jun mediated by MAP kinases.
Nature 353, 670–674
Received 26 July 2010/11 October 2010; accepted 26 October 2010
Published as Immediate Publication 26 October 2010, doi:10.1042/BC20100094
Research article
Rubinfeld, H. and Seger, R. (2004) The ERK cascade as a prototype
of MAPK signaling pathways. Methods Mol. Biol. 250, 1–28
Shaulian, E. and Karin, M. (2002) AP-1 as a regulator of cell life and
death. Nat. Cell Biol. 4, E131–E136
Shieh, Y.S., Lai, C.Y., Kao, Y.R., Shiah, S.G., Chu, Y.W., Lee, H.S. and
Wu, C.W. (2005) Expression of axl in lung adenocarcinoma and
correlation with tumor progression. Neoplasia 7, 1058–1064
Shin, M., Yan, C. and Boyd, D. (2002) An inhibitor of c-jun amino
terminal kinase (SP600125) represses c-Jun activation,
DNA-binding and PMA-inducible 92-kDa type IV collagenase
expression. Biochim. Biophys. Acta 1589, 311–316
Stein, B., Baldwin, Jr, A.S., Ballard, D.W., Greene, W.C., Angel, P. and
Herrlich, P. (1993) Cross-coupling of the NF-κB p65 and Fos/Jun
transcription factors produces potentiated biological function.
EMBO J. 12, 3879–3891
Sun, W.S., Fujimoto, J. and Tamaya, T. (2003) Coexpression of
growth arrest-specific gene 6 and receptor tyrosine kinases Axl
and Sky in human uterine endometrial cancers. Ann. Oncol. 14,
898–906
Vajkoczy, P., Knyazev, P., Kunkel, A., Capelle, H.H., Behrndt, S., von
Tengg-Kobligk, H., Kiessling, F., Eichelsbacher, U., Essig, M.,
Read, T.A. et al. (2006) Dominant-negative inhibition of the Axl
receptor tyrosine kinase suppresses brain tumor cell growth and
invasion and prolongs survival. Proc. Natl. Acad. Sci. U.S.A. 103,
5799–5804
Weiner, T.M., Liu, E.T., Craven, R.J. and Cance, W.G. (1994)
Expression of growth factor receptors, the focal adhesion kinase,
and other tyrosine kinases in human soft tissue tumors. Ann. Surg.
Oncol. 1, 18–27
Won, J.S., Song, D.K., Kim, Y.H., Huh, S.O. and Suh, H.W. (1998) The
stimulation of rat astrocytes with phorbol-12-myristate-13-acetate
increases the proenkephalin mRNA: involvement of
proto-oncogenes. Brain Res. Mol. Brain Res. 54, 288–297
Wu, C.W., Li, A.F., Chi, C.W., Lai, C.H., Huang, C.L., Lo, S.S.,
Lui, W.Y. and Lin, W.C. (2002) Clinical significance of
AXL kinase family in gastric cancerAnticancer Res. 22,
1071–1078
Zenz, R., Scheuch, H., Martin, P., Frank, C., Eferl, R., Kenner, L.,
Sibilia, M. and Wagner, E.F. (2003) c-Jun regulates eyelid closure
and skin tumor development through EGFR signaling. Dev. Cell 4,
879–889
www.biolcell.org | Volume 103 (1) | Pages 21–33 33
Biol. Cell (2011) 103, 21–33 (Printed in Great Britain) doi:10.1042/BC20100094

Supplementary online data

PMA up-regulates the transcription of Axl by AP-1 transcription
factor binding to TRE sequences via the MAPK cascade in
leukaemia cells
Giridhar Mudduluru∗ , Jörg H. Leupold∗ , Philipp Stroebel† and Heike Allgayer∗1
∗ Department of Experimental Surgery Mannheim/Molecular Oncology of Solid Tumors, DKFZ and University of Heidelberg, Mannheim
68167, Germany, and †Institute of Pathology, Medical Faculty Mannheim, University of Heidelberg, Mannheim 68167, Germany

Figure S1 EMSA and Western blot for Sp family members

(a) EMSA analysis of 8 h PMA-stimulated or unstimulated nuclear extracts of K562 cells with Sp-binding motifs (Mudduluru
and Allgayer, 2008). (b) Sequential Western blot analysis for Sp1 and Sp3 was performed with PMA-stimulated K562 cells as
indicated. TPA, PMA.

1 Towhom correspondence should be addressed (email

heike.allgayer@umm.de).

www.biolcell.org | Volume 103 (1) | Pages 21–33

 G. Mudduluru and others

Figure S2 AP-1 transcription factors bind to putative binding sites of the Axl promoter
EMSA was performed with or without PMA-stimulated nuclear extract of K562 cells and a γ-33 P-labelled oligonucleotide probe
corresponding to the GT-rich, AP-1 I, AP-1 II and AP-1 III sites of the Axl promoter. For competition, a 50-fold excess of
unlabelled wild-type or mutant oligonucleotides was used. The GT-rich region ( − 590/ − 610 bp) mutated for T with A, was
unable to abolish the binding of PMA-induced complexes [left-hand panel (GT-rich)], yet no specific binding complexes were
observed under unstimulated conditions. It shows that under stimulated conditions, PMA-induced transcription factors bind
to this GT-rich motif. Gel-shift analysis with AP-1 showed higher binding of specific complexes with PMA-stimulated samples
which were not observed in unstimulated conditions. Moreover, base conversion of GC into TT in this AP-1 I (middle pannel)
site failed to abolish the PMA-induced binding complexes when used as mutant competitor oligonucleotides. These results
showed that the complexes bound to AP-1 I motifs are highly specific. Higher binding of specific complexes bound to AP-1
II and III (consisting of TRE and CRE elements in close proximity in the promoter) were observed under PMA-stimulated
conditions (right-hand panel). Individual competition with oligonucleotides containing mutations in TRE elements, as well as
CRE elements, partially abolished the binding complexes; however, oligonucleotides containing mutations on both TRE
and CRE elements failed to do so. TPA, PMA.


C The Authors Journal compilation 
C 2011 Portland Press Limited
MAPK pathways in Axl gene expression

Figure S3 Supershift analysis of AP-1 family members

(a and b) Supershift analysis was performed as described in the Materials and methods section of the main text, with (bottom
panel) and without (top panel) 8 h PMA-stimulated nuclear extracts of K562, for AP-1 (c-Jun, Jun B, Jun D, c-Fos, Fos B, Fra
1 and Fra 2) using a GT-rich motif ( − 590/ − 610 bp) and AP-1 IV ( − 1013/ − 1019 bp) as radioactive probes. IgG served as the
negative control. Specific supershifted complexes are indicated. (c) Schematic presentation of an important region taken for
CHIP analysis. For, forward; Rev, reverse.

www.biolcell.org | Volume 103 (1) | Pages 21–33

 G. Mudduluru and others

Figure S4 Western blot and supershift analysis for CREB

(a) Western blot analysis for phospho-CREB and total CREB was performed with nuclear extracts from 8 h PMA-stimulated
or unstimulated samples. DNA polymerase ε served as an internal control. (b) Supershift analysis of 8 h PMA-stimulated or
unstimulated nuclear extracts of K562 cells was performed by adding antibodies for phospho-CREB, CREB, and phospho-c-Jun
with AP-1 II and III motifs ( − 655/ − 640 bp) as the radioactive probe. IgG served as the negative control. Specific supershifted
complexes are indicated. TPA, PMA.


C The Authors Journal compilation 
C 2011 Portland Press Limited
MAPK pathways in Axl gene expression

Table S1 Primers used for EMSA and supershift analysis

The position is from the upstream translation start site. Lower-case letters represent the sequences used to mutate the respective
transcription-factor-binding motif. Letters in italics indicate the oligonucleotides used for EMSA analysis, apart from the respective
normal and mutated oligonucleotides.
Number Name Mutagenesis oligonucleotide sequences (5 →3 ) Position (bp)
1 Sp_a_For_N CAAAGGGGGAGCCAGGGGCGGAGAAAGGGTTGCCCAAG − 239 to − 202
2 Sp_a_For_M CAAAGGGGGAGCCAGGtttaGAGAAAGGGTTGCCCAAG
3 Sp_b_For_N GGCTCTGGCCCTGGTGGGCGGAGGCAAAGGGGGAGC − 263 to − 228
4 Sp_b_For_M GGCTCTGGCCCTGGTGGtttaAGGCAAAGGGGGAGC
5 Sp_c_For_N GGCTGGGGGTGGAGGCGGGGAGAGGGGCGTCACG − 524 to − 491
6 Sp_c_For_M GGCTGGGGGTGGAGtattGGAGAGGGGCGTCACG
7 Sp_d_For_N CCTGGCTGGGGCTGGGCTGGGGGTGGAGGCGGGGAGAGG − 538 to − 500
8 Sp_d_For_M CCTGGCTGGGGCTGGGtctttGGTGGAGGCGGGG AGAGG
9 Sp_e_For_N GGAGGCCTGGCTGGGGCTGGGCTGGGGGTGGAGGCG − 543 to − 508
10 Sp_e_For_M GGAGGCCTGGCTGGGtaTtaGCTGGGGGTGGAGGCG
11 Sp_cde_For_M CTGGCTGGGtattaGtctttGGTGGAGtattGGAGAGG − 537 to − 500
12 GT Rich_For_ N GTGTGTGTGTGTGTGTGTGTGTCCTTGTCCGAGGAGCCGA − 609 to − 569
13 GT Rich_For_M GAGAGAGAGAGAGAGAGAGAGACCTTGTCCGAGGAGCCGA
14 AP1 I_For_ N GTGTGTGTGCGTGCGTGCGTGCGTGCGTGTGTGT − 635 to − 601
15 AP1 I_For_ EM1 TTCTTTTTGCGTGCGTGCGTGCGTGCGTCTCTCT
16 AP1 I_For_ EM2 GTGTGTGTTTGTTTGTTTGTGCGTGCGTGTGTGT
17 AP1 I_For_ EM3 GTGTGTGTTTGTTTGTTTGTTTGTTTGTGTGTGT
18 AP1 I_For_ EM4 GTGTGTGTGCAAGCAAGCAAGCGTGCGTGTGTGT
19 AP1 I_For_ EM5 GTGTGTGTGCAAGCAAGCAAGCAAGCAAGTGTGT
20 AP1 I_For_ M1 CTAAGAGTGTGTGTGgaatCGTGCGTGCGTGCGTGTG − 641 to − 605
21 AP1 I_For_ M2 GTGTGTGgaatCGTGCGTGCaattGTGTGTGTGTGTGTGTGTGTG − 633 to − 589
22 AP1 I_For_ M3 CTAAGAGTGTGTGTGgaatCGattaaGCaattGTGTGTGTGTGTGTGTG − 641 to − 593
23 AP1 I II&III_For_ N GCTTGTCCTAGCCTGTGTGTGTCAGTGACGTCTAAGAGTGTG − 672 to − 631
24 AP1 I II_For_M CCTAGCCTGTGTGTGTCAGTttatTCTAAGAGTGTGTGTGCGTGCG − 666 to − 613
25 AP1 I III_For_M GCTTGTCCTAGCCTGTGcatacCAGTGACGTCTAAGAGTGTG − 672 to − 631
26 AP1 I II&III_For_M CCTAGCCTGTGcatacCAGTttatTCTAAGAGTGTGTGTGCGTGCG − 666 to − 613
27 AP1 IV_For_ N GTGCTGGGATTACAGGAGTGAGTTACTGTGCCCGGCCAAC − 1036 to − 1008
28 AP1 IV_For_ M GTGCTGGGATTACAGGAGTttcaTACTGTGCCCGGCCAAC

Table S2 Primers used for Axl promoter cloning

The position is from the upstream translation start site.
Number Name Oligonucleotide sequences (5 →3 ) Position (bp)
1 AxlB GAAGGTACCATGACAACCCAGGCAAAGTG − 2376
2 AxlP1 GAAGGTACCCAGTCCCACCAGAAGGAGAG − 1276
3 AxlP2 GAAGGTACCTGCCCGGCCAACAACTATTC − 1010
4 AxlP3 GAAGGTACCTGTCTGTGGGCCAGTAGC − 727
5 AxlP4 GAAGGTACCAATGAAGGGCCAAGGAGGC − 556
6 AxlP5 GAAGGTACCAGGGGAGTGGAGTTCTGG − 478
7 AxlP6 GAAGGTACCGGCAGGGGTGCTGAGAAG − 181
8 AxlD1 GAACTCGAGGCCTCCTTGGCCCTTCAT − 556
9 AxlD2 GAACTCGAGACCTCAGAGACAGGAGGACA − 770

www.biolcell.org | Volume 103 (1) | Pages 21–33

 G. Mudduluru and others

Reference
Mudduluru, G. and Allgayer, H. (2008) The human receptor tyrosine
kinase Axl gene – promoter characterization and regulation of
constitutive expression by Sp1, Sp3 and CpG methylation. Biosci.
Rep. 28, 161–176

Received 26 July 2010/11 October 2010; accepted 26 October 2010

Published as Immediate Publication 26 October 2010, doi:10.1042/BC20100094


C The Authors Journal compilation 
C 2011 Portland Press Limited