Send Orders for Reprints to reprints@benthamscience.

net 281

Current Alzheimer Research, 2019, 16, 281-292

RESEARCH ARTICLE
ISSN: 1567-2050
eISSN: 1875-5828

The Role of MAPK's Signaling in Mediating ApoE4-Driven Pathology Impact

Factor
Current: 3.289
5-Year: 3.595

In Vivo
BENTHAM
SCIENCE

Shiran Salomon-Zimria, Amit Korena, Ariel Angelb, Tali Ben-Zurb, Daniel Offenb and
Daniel M. Michaelsona,*
a
Department of Neurobiology, Sagol School of Neuroscience, The George S. Wise Faculty of Life Sciences, Tel Aviv
University, Tel Aviv, Israel; bSackler School of Medicine, Sagol School of Neuroscience, Tel-Aviv University, Tel Aviv,
Israel

Abstract: Background: Alzheimer's Disease (AD) is associated with impairments in key brain Mito-
gen-Activated Protein Kinase (MAPK) signaling cascades including the p38, c-Jun N-terminal kinase
(JNK), ERK and Akt pathways. Apolipoprotein E4 (ApoE4) is the most prevalent genetic risk factor of
AD.
Objectives: To investigate the extent to which the MAPK signaling pathway plays a role in mediating
the pathological effects of apoE4 and can be reversed by experimental manipulations.
Methods: Measurements of total level and activation of MAPK signaling pathway factors, obtained util-
Current Alzheimer Research

ARTICLE HISTORY
Received: October 09, 2018
Revised: December 18, 2018
Accepted: February 04, 2019
DOI:
10.2174/1567205016666190228120254
izing immunoblot assay of hippocampal tissues from naïve and viral-treated apoE3 and apoE4 targeted
replacement mice.
Results: ApoE4 mice showed robust activation of the stress related p38 and JNK pathways and a corre-
sponding decrease in Akt activity, which is coupled to activation of GSK3β and tau hyper-
phosphorylation. There was no effect on the ERK pathway. We have previously shown that the apoE4-
related pathology, namely; accumulation of Aβ, hyper-phosphorylated tau, synaptic impairments and
decreased VEGF levels can be reversed by up-regulation of VEGF level utilizing a VEGF-expressing
adeno-associated virus. Utilizing this approach, we assessed the extent to which the AD-hallmark and
synaptic pathologies of apoE4 are related to the corresponding MAPK signaling effects. This revealed
that the reversal of the apoE4-driven pathology via VEGF treatment was associated with a reversal of
the p38 and Akt related effects.
Conclusion: Taken together, these results suggest that the p38 and Akt pathways play a role in mediat-
ing the AD-related pathological effects of apoE4 in the hippocampus.

Keywords: Alzheimer's disease (AD), apolipoprotein E4 (apoE4), VEGF, MAPK, signaling, adeno-associated virus, hippo-
campus, targeted replacement mice.

1. INTRODUCTION apoE2 (Cys-112, Cys-158), apoE3 (Cys-112, Arg-158), and

Alzheimer’s Disease (AD) is the most common cause of
dementia. AD brain pathology is characterized by the occur-
rence of brain senile plaques and Neuro-Fibrillary Tangles
(NFTs), as well as synaptic and neuronal loss and increased
neuro-inflammation [1-4]. Genetic studies revealed allelic
segregation of the apolipoprotein E gene in families and in-
dividuals with a higher risk of late onset and sporadic Alz-
heimer’s disease [5-7].
Apolipoprotein E (APOE for gene, apoE for protein) ex-
pressed in the brain as three common isoforms: apoE2,
apoE3, and apoE4, corresponding to the three APOE alleles:
APOEε2, APOEε3, APOEε4, which differ from one another
by one amino acid substitutions at positions 112 and 158:
*Address correspondence to this author at the Department of Neurobiology,
Sagol School of Neuroscience, The George S. Wise Faculty of Life Sci-
ences, Tel Aviv University, Ramat Aviv 6997801, Tel Aviv, Israel;
Tel: 972-3-6409624; Fax: 972-6406356; E-mail: dmichael@post.tau.ac.il
apoE4 (Arg-112, Arg-158) of which APOEε4 is the most
prevalent genetic risk factor for AD [5, 6]. About half of the
AD patients express APOEε4, whereas only about a quarter
of the population expresses this isoform. ApoE4 increases
the risk for AD by ~3- and 15-fold for apoE4 heterozygotes
and homozygotes, respectively, compared with ApoE3. In-
terestingly, ApoE2, which is the least prevalent allele, is as-
sociated with decreased AD risk [5-8]. ApoE4 is associated
with distinct brain pathologies, including increased neurode-
generation [9], impaired neurite outgrowth, impaired synap-
togenesis [10], and impaired neuronal remodeling [11].
ApoE4 is also associated with increased vascular pathology
[12] and increased brain inflammation [13]. The prevalence
of AD in apoE4 carriers is higher in females than in males
[14], Additionally, apoE4-driven pathologies are exacerbated
in the presence of additional risk factors or stressors, such as
old age, environmental factors, female sex and other genetic
modulation. Moreover, Recent findings from our lab suggest

1875-5828/19 $58.00+.00 © 2019 Bentham Science Publishers

282 Current Alzheimer Research, 2019, Vol. 16, No. 4
that female mice have a more pronounced apoE4-induced
pathological phenotype than the corresponding male mice
[15].
Because of the critical role of the Mitogen-Activated Pro-
tein Kinase (MAPK) pathways in regulating cellular func-
tion, the importance of MAPKs in AD pathogenesis is being
increasingly recognized. The MAPK signaling pathways,
which include the Extracellular Signal-Regulated Kinase
(ERK), c-Jun N-terminal kinase (JNK), and p38 pathways,
are activated by various types of cellular stress such as oxi-
dative, genotoxic, mitochondrial dysfunction, and osmotic
stress as well as pro-inflammatory cytokines [16, 17]. All of
these MAPK pathways are activated in vulnerable neurons in
patients with AD, suggesting that MAPK pathways are in-
volved in the pathophysiology and pathogenesis of AD [18].
Specifically, p38, which enables cells to respond to stress-
related stimuli from the extracellular environment, has in-
creased activity in human AD brains [19, 20], and mediates
β-amyloid-driven microglial activation [21] and tau hyper-
phosphorylation [16]. Specifically, p38 plays more than one
role in AD pathophysiology; in microglial p38 MAPK con-
tributes to the inflammation of the AD brains, in astrocytes
the p38 MAPK cascade expands the inflammatory response
and modulates the excitotoxicity, while the neuronal p38
MAPK signaling contributes to tau phosphorylation, NFT
formation and depression of synaptic plasticity [19]. JNK is
activated in response to cellular stress, and regulates various
processes such as brain development and repair, as well as
neuro-inflammation, cell proliferation, and cell death [22].
JNK also mediates the neurotoxic signals driven via Aβ and
contributes to cell death and various processes in AD pathol-
ogy [23, 24]. Activated JNK and p38 are associated with
cells that contain filamentous tau, suggesting that they may
also contribute to the hyper-phosphorylation of tau and the
formation of paired helical filament and involved in abnor-
mal processes, ranging from tau phosphorylation to neuronal
death [19, 21, 24]. The PI3K/Akt pathway promotes survival
and growth in response to extracellular signals. In normal
brains, the P13K/Akt pathway inactivates GSK3, and pre-
vents apoptosis of confluent cells. In AD, as well as in
ischemia and oxidative stress, Akt is inhibited. This leads to
GSK3β activation and subsequently to tau hyper-
phosphorylation and the formation of PHF-tau [25, 26].
GSK3β is a pleiotropic enzyme involved in a variety of cell
activities, and has been postulated as a therapeutic target for
AD due to its multiple connections to the pathology of the
disease [27]. The Extracellular signal–Regulated Kinase
(ERK) pathway is activated by many different stimuli, in-
cluding growth factors, cytokines, and transforming agents.
The ERK cascade is involved in a wide range of processes,
such as metabolism, motility, inflammation, cell death, and
survival [28]. In AD and corresponding transgenic mouse
models, ERK signaling plays a role in mediating the patho-
logical effects of oligomeric Aβ42, in the activation of GSK-
3 [29], and in impaired mitochondrial fission/fusion events
[30].
Accumulating evidence suggests that apoE4 is associated
with increased cellular stress, specifically oxidative stress,
endoplasmic reticulum stress, as well as with impaired im-
mune function [31]. In some in-vitro studies, this was shown
to be associated with altered MAPK signaling. For example,
Salomon-Zimri et al.
ERK is activated and JNK is inhibited by apoE4 in primary
neurons [23], p38 is activated in primary apoE4 microglial
cultures [32], and apoE4 inhibits the PI3K/Akt pathway in
endothelial cells [33]. ApoE4-driven MAPK signaling was
also observed in vivo, where fasting of apoE4- targeted re-
placement mice was found to be associated with decreased
Akt activities, whereas p38 activity increased during aging
[34]. A key unresolved issue is the extent to which the effect
of apoE4 on MAPK signaling plays a role in mediating the
pathological effects of apoE4. One way to address this issue
is to determine whether experimental manipulations that
have been found to reverse apoE4 pathological effect, such
as up-regulation of VEGF, can also reverse apoE4- driven
MAPK signaling pathologies. Utilizing apoE4 and apoE3 TR
mice we have recently shown that apoE4 is associated cogni-
tive decline [35] and with marked synaptic and neuronal
effects in the hippocampus (e.g., reduced levels of synapto-
physin, the presynaptic transporters VGluT and VGaT, and
the apoE receptor apoER2) and that apoE4 is associated with
elevated levels of brain Aβ and hyper-phosphorylated Tau
[15, 36, 37], as well as with reduced levels of VEGF [38].
Furthermore, reversal of the apoE4-driven reduction in hip-
pocampal VEGF levels by intra-hippocampal injection of
VEGF-expressing-lentivirus reversed the apoE4-driven cog-
nitive deficits and synaptic pathologies [38]. This experi-
mental manipulation is used for investigating the possible
relationship between apoE4-driven brain pathology and the
MAPK signaling pathway. Accordingly, the present study
investigated the effects of apoE4 on MAPK signaling, and
the extent to which VEGF is involved in these signal trans-
duction pathways. This was pursued by measuring the levels
and activation of p38, JNK/c-Jun, ERK, and Akt/GSK-3β in
the hippocampus of apoE4 mice, in which it was shown to
particularly be affected by apoE4. An additional aim was to
investigate the extent to which hippocampal-specific injec-
tion of a VEGF-expressing virus reverses the apoE4-driven
MAPK signaling.
2. MATERIALS AND METHODS
2.1. Mice
ApoE-TR mice, in which the endogenous mouse apoE
was replaced by either human apoE3 or apoE4, were created
by gene targeting, as previously described [34]. These mice
were purchased from Taconic (Germantown, NY). In order
to minimize possible genetic drift between the apoE4 and
apoE3 mice, which were offspring of apoE4 and apoE3 ho-
mozygous mouse colonies generated by Taconic around
2001, the mice were back-crossed by us with Harlan
C57Bl/6JOlaHsd mice for 10 generations. The present ex-
periments were performed with apoE3 and apoE4 homozy-
gous mice on an α synuclein -/- background in which the
apoE4-driven synaptic and AD-related phenotype are more
pronounced [32]. These mice are referred to in the text as
apoE3 and apoE4 mice, respectively. The apoE genotype of
the mice was confirmed by PCR analysis [35-37]. All ex-
periments were performed on 4-month-old male and female
mice, and were approved by the Tel Aviv University Animal
Care Committee. Following the indicated treatments, the
mice were anesthetized with ketamine and xylazine and were
perfused transcardially with phosphate buffered saline
(PBS). Their brains were then removed and halved, and each
The Role of MAPK's Signaling in Mediating ApoE4-Driven
hemisphere was further processed for either biochemical or
histological analysis, as outlined below. In the current study,
we chose to focus on female mice. This is driven by the lit-
erature based findings that females are more susceptible to
AD than males, and that the apoE4 related pathology is more
pronounced in females than in the corresponding males. Fur-
thermore, recent findings from our lab showed that apoE4-
TR female mice have a more pronounced pathological phe-
notype than the corresponding male mice. Specifically, the
AD-related pathology (e.g. Aβ and tau phosphorylation),
synaptic deficits (e.g. VGluT1,VGaT and SYP), vascular
pathology (collagen IV) and cognitive impairments were
more robust in female mice compared to male mice [15]. The
results presented correspond to 4 female cohorts. The first 2
female cohorts were used to characterize the effects of apoE4
and apoE3 on MAPK signaling and contained only naïve
non-treated mice (10-12 mice/cohort), whereas the other 2
female cohorts were used to assess the effects of the VEGF-
expressing adeno-associated-virus (AAV-VEGF) treatment
on apoE4 pathology and MAPK signaling. These experi-
ments contain 6 groups: 2 genotypes (apoE3 or apoE4) x 3
treatments (naïve mice, mice treated either with a sham GFP-
labeled virus or mice treated with the VEGF-expressing vi-
rus). These groups are referred to as naïve, sham-treated, and
VEGF-treated mice. Each group consisted of 5-7
mice/cohort. A control assay with corresponding apoE3 and
apoE4 male mice conduct was conducted for both the naïve
and AAV-VEGF experiments.
2.2. Adeno-associated Virus Preparation
Human VEGF and GFP coding sequences were cloned
into the PAAV2-GFAP-OPTOAI-P2A-EYFP backbone,
kindly provided by the Diesseroth lab [39]. The human
VEGF was amplified from pBluescript plasmid (purchased
from Harvard Institute of Proteomics, Boston, USA) by PCR
using restriction enzymes at the ends (VEGF-AGEI-FOR 5'
TAGACCGGTATGAACTTTCTGCTGTCTTGG3' VEGF-
ECORI-REV 5'TCAAGAATTCCAACCGCCTCGGCTTGT
CACAT3'). Both PAAV2-GFAP-OPTOAI-P2A-EYFP and
PLL3.7-GFAP-EGFP plasmids were cut with AGEI and
ECORI. OPTOAI-P2A-EYFP sequence replaced with the
GFP sequence or the VEGF sequence in order to obtain the
final expression constructs. As we described in Salomon-
Zimri et al, 2016, Concentrated AAV2/1 mosaic particles
were produced by the Tel Aviv University’s vector core fa-
cility. Briefly, HEK293 cells were transfected with the
AAV2-GFAP-GFP/VEGF-WPRE vector plasmid along with
AdenoHelper, Rep-Cap1 and Rep-Cap2 plasmids. Seventy-
two hours post transfection the cells were harvested, lysed
using three freeze-thaw cycles and incubated with Benzonase
for 90 min. The lysate was purified using a heparin-agarose
binding column and subsequently concentrated and desali-
nated using an Amicon filter.
2.3. Intracerebral Administration of Viral Vectors
Four-month-old apoE3 and apoE4-TR mice were anes-
thetized with a ketamine-xylazine mixture and placed in a
stereotactic apparatus (model 940; David Kopf). Subse-
quently, 1 μL of the viral preparation was injected bilaterally
into the CA3 region of the hippocampus using the following
Current Alzheimer Research, 2019, Vol. 16, No. 4 283
coordinates: ±2.3 mm medial/lateral, −2.1 mm ante-
rior/posterior, and −2.2 mm dorsal/ventral from the bregma.
The preparation was injected with a speed of 0.5 μL/min
over a period of 2 min utilizing a Hamilton 10-μL syringe
and a 26-gage needle. The needle was kept in place for ~3
min in order to prevent backflow. The mice were then
stitched and returned to their cages.
2.4. Immunoblot Analysis
Immunoblot analysis was performed as previously de-
scribed [38, 39]. The following Abs were used: rabbit anti-
VEGF (1:1000; Calbiochem), rabbit anti-p38 (1:1000, cell
signaling), rabbit anti-pp38 (1:1000, cell signaling), rabbit
anti-Akt (1:1000, cell signaling), rabbit anti-pAkt
(1:1000,cell signaling), rabbit anti-ERK1/2 (1:5000, Santa
Cruz), mouse anti-pERK1/2 (1:10000, Sigma), rabbit anti-
JNK (1:1000, cell signaling), rabbit anti-pJNK (1:1000, cell
signaling), mouse anti-GSK3β (1:1000, Santa Cruz), mouse
anti-pGSK3β (1:1000, Santa Cruz), and mouse anti-tubulin
(1:1000, Sigma). Membranes were scanned utilizing the
ChemiDoc Touch imaging system (Bio-Rad) and the blot
intensity was then quantified using Image Lab Software
(Bio-Rad). All results were normalized to the naïve-apoE3
group and utilized beta-tubulin as gel-loading control.
2.5. Quantification and Statistical Analysis
The results of the naïve mice, which consisted of non-
treated apoE3 and apoE4 mice of each cohort, were normal-
ized relative to apoE3 mice, after which they were analyzed
utilizing Student's t-test. The experimental design of the viral
construct-treated mice consisted of 2 genotypes (apoE3 and
apoE4, and 3 treatments (naïve, VEGF-expressing virus, and
sham GFP-labelled virus; n= 5-7 mice /group in each co-
hort). Each MAPK-related molecule was assessed utilizing a
general phosphorylation-independent antibody whose im-
munoreactivity corresponded to the total level of the mole-
cule and by the indicated phosphorylation-dependent mole-
cule whose immunoreactivity relative to the total level was
used as a measure of the kinase activity. The results of each
cohort were normalized relative to apoE3 mice, after which
they were analyzed utilizing 2-way ANOVA using STATIS-
TICA software (Version 8.0 StatSoft, Inc., Tulsa, OK, USA).
Further examination of the specific effect of treatment utiliz-
ing 1-way ANOVA, followed by post-hoc Bonferroni correc-
tion, was performed to test the specific effect of VEGF
treatment on the apoE4 mouse group. Beta-tubulin whose
levels were similar in the different groups was used as load-
ing controls and all the results were normalized relative to
the apoE3 naïve group standard. All graphs were prepared
and double analyzed via GraphPed prism 5.3 software.
3. RESULTS
The effects of the apoE genotype on the p38 MAPK
pathway were assessed by measuring the effects of apoE4
and apoE3 on the levels of p38 and phospho/activated p38 in
the hippocampus of the corresponding targeted replacement
mice. As can be seen in Fig. (1), the levels of p38 were the
same in apoE3 and apoE4 mice, whereas the extent of activa-
tion of p38, as measured by the ratio of phospho-p38 to total
p38, was significantly higher in the apoE4 than in the apoE3
284 Current Alzheimer Research, 2019, Vol. 16, No. 4 Salomon-Zimri et al.

Fig. (1). The effects of apoE4 on p38 levels and activation. Representative immunoblots of the effects of apoE4 and apoE3 on the total levels
of p38 in the hippocampus and on the corresponding levels of phosphorylated p38. . Hippocampi of 4-month-old female apoE3 and apoE4
TR mice were excised, homogenized, and subjected to p-38 and phosphorylated p-38 immunoblotting , as described in Materials and Meth-
ods. Quantitation of the total hippocampal p38 levels and of activated p38, as presented by the ratio of the phosphorylated p38 to its levels,
are presented in the in the central and right panels. ApoE3 mice are depicted in the white bar and the corresponding apoE4 mice are depicted
in the black bars. Beta-tubulin was used as a loading reference and the results presented (2.3 +/- 0.35 and 1+\- 0.08 for the ratio of apoE4 and
apoE3 mice, respectively; n=10-12 per group) are normalized relative to the apoE3 mice ***p<0.001 by Student’s t-test. Similar results were
obtained with a second cohort of mice.

mice (2.3 +/- 0.35 and 1+\- 0.08 ; ***p<0.0001, respec-
tively). The corresponding effects of the apoE genotype on
the JNK MAPK pathway were next examined. As can be
seen in Fig. (2), the total levels of both JNK and c-Jun in the
hippocampus of female apoE3 and apoE4 mice were similar,
whereas the ratios of phosphorylated/activated JNK were
significantly higher in the apoE4 mice (1.6 +\-0.18 vs. 1 +\-
0.09; *p<0.01, respectively) as were those of the activated c-
Jun (1.4 +/- 0.15 vs. 0.9+\- 0.1; **P<0.01, respectively).
We next focused on the effects of apoE4 on the growth
factor-related MAPK pathways utilizing ERK, Akt, and
GSK3β as markers. As shown in Fig. (3), and unlike the re-
sults that were obtained with the p38 and JNK pathways,
apoE4 did not affect either the levels of ERK or the extent of
its activation (1.2 +\- 0.2 relative to 0.938 +/-0.16; respec-
tively). Measurements of the Akt-GSK3β pathway, in which
GSK3β is to be a well-established substrate of Akt and
whose levels of activation correlate inversely with those of
Akt [40, 41], revealed that apoE4 down-regulates the activa-
tion of Akt relative to the corresponding apoE3 mice (0.6 +\-
0.1 relative to 0.93 +/-0.11; **p<0.01, respectively) and in
turn up-regulated GSK3β levels of activation (1.8+\- 0.2
relative to 1 +/-0/03; ***<0.001, respectively) without af-
fecting the total levels of both Akt and GSK3β (Fig. 4; A and
B, respectively). Tau phosphorylation is highly dependent on
GSK3β activity [41], and these results are in accordance with
previous observations that tau is hyper-phosphorylated in
apoE4 mice [15, 36] in a manner similar to that observed in
AD patients.
The possible association of apoE4-driven MAPK signal-
ing with the synaptic and AD pathological effects of apoE4
was examined next. This was performed by intra-
hippocampal injection of VEGF-expressing virus (AAV-
VEGF), which was previously shown to elevate the levels of
VEGF and reverse the synaptic and AD-related phenotype of
apoE4 [38]. The extent to which these protective effects are
associated with reversal of the apoE4-driven effects on
MAPK signaling was examined. Accordingly, the effects of
this treatment on the total levels and activation of the p38,
JNK, ERK, and Akt pathways were measured. The resulting
effects on p38 activation are depicted in Fig. (5). As can be
seen, the AAV-VEGF treatment abolished the apoE4-related
p38 activation and rendered it similar to that of apoE3 mice,
which was not affected by this treatment. Quantification of
these results by 2-way ANOVA, revealed significant effects
for group, ***p<0.0001 and *p<0.05 for group and treat-
ment, respectively. Further Bonferroni post-hoc analysis
revealed *p<0.05 for the specific effect of VEGF treatment
on apoE4 mice. In contrast, the total levels of p38, which
were similar in the two control mouse groups (Fig. 1), were
not affected by the VEGF treatment (not shown). Measuring
the effects of the AAV-VEGF treatment on c-Jun and JNK
phosphorylation revealed that they were higher in naïve
apoE4 mice than in the corresponding apoE3 mice and were
not affected by the sham treatment (Fig. 6). However, this
effect was reduced to non-significant levels by the AAV-
VEGF treatment (Fig. 6). Quantification of these results re-
vealed significant effects for the group. **p<0.01 and treat-
ment *p<0.05 for JNK activation measurements, and
*p<0.05 for the effect of the group for c-Jun activation by 2-
way ANOVA. The total levels of c-Jun and JNK, which were
the same in the naïve apoE4 and apoE3 mice (Fig. 2), were
also not affected by either the AAV-VEGF or sham treat-
ments. Further examination of the ERK pathway, which was
not affected by the apoE genotype under basal conditions
(Fig. 2), revealed that it was also unaffected by neither the
sham control nor the AAV-VEGF treatment (Fig. 7)
The effects of apoE4 on Akt and GSK3β activations were
also reversed by the AAV-VEGF treatment. Accordingly,
the AAV-VEGF treatment abolished the related apoE4-
driven decrease in Akt, as depicted in Fig. (4), and rendered
it similar to that of the corresponding apoE3 mice, which
were not affected by this treatment (Fig. 7). Quantification of
these results revealed significant effects for the group,
*p<0.05, by 2-way ANOVA. A complementary effect was
observed in GSK3β activation, in which the elevated acti-
vated GSK3β levels of the naïve apoE4 mice (Fig. 4) were
The Role of MAPK's Signaling in Mediating ApoE4-Driven Current Alzheimer Research, 2019, Vol. 16, No. 4 285

Fig. (2). The effects of apoE4 on JNK and Cc-Jun levels and activation. Hippocampi of 4-month-old female apoE3 and apoE4 TR mice were
excised, homogenized, and subjected to phosphorylated and total JNK(A) and c-Jun (B) immunoblotting , as described in Materials and
Methods. (A) Representative immunoblots of the effects of apoE4 and apoE3 on the total levels and phosphorylation of JNK in the hippo-
campus are presented in the left panel. Quantification of the total hippocampal JNK levels in these mice and of activated JNK levels, as pre-
sented by the ratio of phosphorylated JNK to its total level, are presented in in the central and right panels (1.6 +/-0.17 and 1+\- 0.09 for the
ratio of apoE4 and apoE3 mice, respectively; n=10-12 per group). (B) Representative immunoblots of the effects of apoE4 and apoE3 on the
total levels and phosphorylation of c-Jun in the hippocampus, as presented by the ratio of phosphorylated c-Jun to its total level, are presented
in the panel on the left. Quantitation of the total hippocampal Cc-Jun levels in these mice and of the ratio of the activated c-Jun to the total c-
Jun levels are presented in the central and right panels (1.5+/-0.15 and 1+\- 0.1 for the ratio of apoE4 and apoE3 mice, respectively). ApoE3
mice are depicted in the white bar and the corresponding apoE4 mice are depicted in the black bars. Beta-tubulin was used as a loading refer-
ence and the results presented are normalized relative to the apoE3 **p<0.01 and ***p<0.001 by Student’s t-test. Similar results were ob-
tained with another cohort of such mice.

Fig. (3). The effects of apoE4 on ERK levels and activation. Hippocampi of 4-month-old female apoE3 and apoE4 TR mice were excised,
homogenized, and subjected to phosphorylated and total ERK immunoblotting , as described in Materials and Methods. Representative im-
munoblots of the effects of apoE4 and apoE3 on the total and on the phosphorylation levels of ERK in the hippocampus are presented in the
panel on the left. Quantification of the total hippocampal ERK levels and activation, as presented by the ratio of phosphorylated JNK to its
total level, are presented in the central and right panels. 0.978 +/-0.16 and 1.2+\- 0.18 for the ratio of apoE4 and apoE3 mice, respectively;
n=10-12 per group). ApoE3 mice are depicted in the white bar and the corresponding apoE4 mice are depicted in the black bars. Beta-tubulin
was used as a loading reference and results presented are normalized relative to the apoE3. Similar results were obtained with another cohort
of such mice.
286 Current Alzheimer Research, 2019, Vol. 16, No. 4 Salomon-Zimri et al.

Fig. (4). The effects of apoE4 on the Akt and GSK levels and activation. Hippocampi of 4-month-old female apoE3 and apoE4 TR mice were
excised, homogenized, and subjected to phosphorylated and total Akt (A) and GSK-3β(B) immunoblotting , as described in Materials and
Methods. (A) Representative immunoblots of the effects of apoE4 and apoE3 on the total levels and phosphorylation of Akt in the hippocam-
pus are presented in the left panel. Quantification of the total hippocampal Akt levels in these mice and of the activated Akt levels, as pre-
sented by the ratio of phosphorylated Akt to its total level, are presented in the central and right panels (0.6 +/-0.1 and 0.93+\- 0.11 for the
ratio of apoE4 and apoE3 mice, respectively). (B) Representative immunoblots of the effects of apoE4 and apoE3 on the total levels and
phosphorylation of GSK3β in the hippocampus, as presented by the ratio of phosphorylated GSK3β to its total level, are presented in the
panel on the left. Quantitation of the total hippocampal c-Jun levels in these mice and of the activated GSK3β to the total GSK3β levels are
presented in in the central and right panels (1.8 +/-0.2 and 1+\- 0.03 for the ratio of apoE4 and apoE3 mice, respectively). ApoE3 mice are
depicted in the white bar and the corresponding apoE4 mice are depicted in the black bars. Beta-tubulin was used as a loading reference and
the results presented are normalized relative to the apoE3 **p<0.01 and ***p<0.001 by student’s t-test. Similar results were obtained with
another cohort of such mice.

Fig. (5). The effects of AAV-VEGF treatment on the p38 activation of apoE4 and apoE3 mice. Hippocampi of 4-month-old naïve, sham, and
AAV-VEGF-treated female apoE3 and apoE4 TR mice were excised, homogenized, and subjected to phosphorylated and total p-38 im-
munoblotting , as described in Materials and Methods . Representative immunoblots of total p38 and the corresponding phosphorylated p38
of naïve, sham, and AAV-VEGF-treated apoE4 and apoE3 mice, as presented by the ratio of phosphorylated p38 to its total level, are pre-
sented in the panel on the left. Quantitation of the activated p38 levels is presented in the right panels. ApoE3 mice are depicted in the white
bar and the corresponding apoE4 mice are depicted in the black bars. Beta-tubulin was used as a loading reference and the results presented
are normalized relative to apoE3 and are presented on the left. Quantification of these results revealed significant effects for the group,
***p<0.0001, and *p<0.05 for group x treatment, by 2-way ANOVA; Further Bonnferoni post-hoc analysis showed #p<0.05 for the specific
effect of VEGF treatment on apoE4 mice. n= 5-7 per group.
The Role of MAPK's Signaling in Mediating ApoE4-Driven Current Alzheimer Research, 2019, Vol. 16, No. 4 287

Fig. (6). The effects of AAV-VEGF treatment on JNK and c-Jun activation of apoE4 and apoE3 mice. Hippocampi of 4-month-old naïve,
sham, and AAV-VEGF-treated female apoE3 and apoE4 TR mice were excised, homogenized, and subjected to phosphorylated and total
JNK (A) and (B) c-Jun immunoblotting , as described in Materials and Methods . (A) Representative immunoblots of total JNK and the corre-
sponding phosphorylated JNK of naïve, sham, and AAV-VEGF-treated apoE4 and apoE3 mice in the hippocampus, as presented by the ratio
of phosphorylated JNK to its total level, are presented in the panel on the left. Quantification of these results revealed significant effects for
the group, **p<0.01, and *p<0.05 for treatment, by 2-way ANOVA. (B) Representative hippocampal immunoblots of total c-Jun and the cor-
responding phosphorylated c-Jun of naïve, sham, and AAV-VEGF-treated apoE4 and apoE3 mice in the hippocampus, as presented by the
ratio of phosphorylated c-Jun to its total level, are presented in the panel on the left. Quantification of these results revealed significant effects
for the group, *p<0.05 by 2-way ANOVA. ApoE3 mice are depicted in the white bar and the corresponding apoE4 mice are depicted in the
black bars. Beta-tubulin was used as a loading reference and the results presented are normalized relative to the apoE3 and are presented on
the left. n= 5-7 per group.

Fig. (7). The effects of AAV-VEGF treatment on ERK activation of apoE4 and apoE3 mice. Hippocampi of 4-month-old naïve, sham, and
AAV-VEGF-treated female apoE3 and apoE4 TR mice were excised, homogenized, and subjected to phosphorylated and total ERK im-
munoblotting , as described in Materials and Methods .Representative hippocampal immunoblots of total ERK and the corresponding phos-
phorylated ERK of naïve, sham, and AAV-VEGF-treated apoE4 and apoE3 mice in the hippocampus, as presented by the ratio of phosphory-
lated c-Jun to its total level, are presented in the panel on the left. Quantification of these results showed no significant effect by 2-way
ANOVA. n= 5-7 per group.
288 Current Alzheimer Research, 2019, Vol. 16, No. 4 Salomon-Zimri et al.

reduced following AAV-VEGF treatment and became non-
significant (Fig. 8). Quantification of these results revealed
significant effects for the group, *p<0.05, by 2-way ANOVA.
In conclusion, the present results show that apoE4 is as-
sociated with specific activation of the p38 and JNK MAPK
pathways with the corresponding suppression of Akt signal-
ing pathway, and suggest that the p38 and Akt pathways are
associated with the apoE4-driven synaptic pathologies as
well as with the Aβ and tau-related pathological effects in
vivo.
4. DISCUSSION
This study investigated the effects of apoE4 on the acti-
vation patterns of different MAPK pathways, and the possi-
ble role of these pathways in mediating the pathological ef-
fects of apoE4 in vivo. This was pursued by measuring the
total levels and extent of activation of distinct MAPK-related
kinases in the hippocampus of apoE4 and the corresponding
apoE3 TR mice. This revealed significant apoE4-driven acti-
vation and enhanced phosphorylation of p38 in the hippo-
campus of the apoE4 mice. A similar activation pattern was
seen in JNK and its transcription factor c-Jun. These effects
were accompanied by decreased activation of Akt, followed
by hyperphosphorylation of GSK3β and tau. In contrast, the
ERK pathway was not affected by apoE4. We have previ-
ously shown that apoE4 is associated with reduced levels of
hippocampal VEGF, and that reversal of this effect by intra-
hippocampal injection of an AAV-VEGF virus reverses the
synaptic and AD-related pathological effects of apoE4 [38].
Applying this therapeutic assay to the apoE4-driven effects
on MAPK activities revealed that apoE4-driven activation of
p38 and inhibition of Akt were reversed by AAV-VEGF
treatment. The mechanism by which apoE4 induces the
down-regulation of VEGF is not directly addressed in this
study. However, it should be noted that apoE4 down-
regulates the levels of numerous different receptors includ-
ing the NMDA receptor [42], the apoER2 receptor [37], and
the Insulin receptor [43], and targets them for degradation
[43-45]. It is thus possible that the apoE4-related reduction
in VEGF levels is driven by the reduced levels of VEGF
receptors [38]. Additionally, the apoE4 induced effect on the
JNK pathway became non-significant following the AAV-
VEGF manipulation, and the ERK signaling, which was not
affected by apoE4, was also not affected by the AAV-VEGF
treatment. A schematic summary of these effects is presented

Fig. (8). The effects of AAV-VEGF treatment on Akt and GSK3β activation of apoE4 and apoE3 mice. Hippocampi of 4-month-old naïve,
sham, and AAV-VEGF-treated female apoE3 and apoE4 TR mice were excised, homogenized, and subjected to phosphorylated and total (A)
Akt and (B) GSK-3β immunoblotting , as described in Materials and Methods . (A) Representativeimmunoblots of total Akt and the corre-
sponding phosphorylated Akt of naïve, sham, and AAV-VEGF-treated apoE4 and apoE3 mice in the hippocampus, as presented by the ratio
of phosphorylated Akt to its total level, are presented in the panel on the left. Quantification of these results revealed significant effects for
the group, *p<0.05 by 2-way ANOVA. (B) Representative immunoblots of total GSK3β and the corresponding phosphorylated GSK3β of
naïve, sham, and AAV-VEGF-treated apoE4 and apoE3 mice in the hippocampus, as presented by the ratio of phosphorylated GSK3β to its
total level, are presented in the panel on the left. Quantification of these results revealed significant effects for the group, *p<0.05 by 2-way
ANOVA. ApoE3 mice are depicted in the white bar and the corresponding apoE4 mice are depicted in the black bars. Beta-tubulin was used
as a loading reference and the results presented are normalized relative to the apoE3 and are presented on the left. n= 5-7 per group.
The Role of MAPK's Signaling in Mediating ApoE4-Driven
in (Fig. 9). Similar results were obtained with the
corresponding control experiment using male mice (not
shown). The present findings that apoE4 is associated with
decreased activation of Akt and increased activation of c-Jun
and JNK is in accordance with previous findings obtained
with apoE4 x APP double transgenic mice and with apoE-
expressing cells [46].
The specific role of the kinases in the apoE4-related pa-
thology is remained to be determined. Though, it has been
shown that p38 MAPK, could play more than one role in AD
pathophysiology, in microglia p38 MAPK contributes to
brain inflammation in AD, in astrocytes the p38 MAPK cas-
cade also modulates the excitotoxicity, whereas the neuronal
p38 MAPK signaling contributes to tau phosphorylation,
NFT formation and depression of synaptic plasticity [19, 47].
Nevertheless, the specific effects of the apoE genotype on
p38 signaling have not yet been reported. In vitro studies
utilizing primary neurons [48] and astrocytic apoE3 and
apoE4 embryonic stem cells [49] revealed that unlike the
present in vivo findings (Fig. 3), ERK signaling is activated
by apoE4. This may be due to the experimental differences
between the in vivo and in vitro systems.
The mechanisms underlying the present findings will be
addressed by focusing on three questions. Namely, which
mechanisms underlie the effects of apoE4 on MAPK signal-
Fig. (9). Summary of the effects of apoE4 on key MAPK signaling pathways. Schematic presentation of the effect of ApoE4 on MAPK and
may play a role in mediating the downstream pathological effects. The figure depicts the four MAPK pathways in which the kinases exam-
ined depicted in a filled elliptic cycle. Arrows indicate the proteins whose activation is modulated by apoE4; up for activation and down for
inhibition, whereas an asterisk denotes the signaling molecules that may play a role in mediating the apoE4-driven pathology. This summary
is based on the results shown in Figs. (1-8).
Current Alzheimer Research, 2019, Vol. 16, No. 4 289
ing, what is the process through which VEGF counteracts the
effects of apoE4 on MAPK signaling, and how do the
apoE4-driven effects on the MAPK system lead to the down-
stream apoE4-driven pathology? The Akt MAPK pathway is
regulated and triggered by growth factors [50, 51]. Accord-
ingly, it is possible that the presently observed down-
regulation of this pathway in apoE4 brains is driven by the
corresponding reduced levels of brain VEGF [38] or includ-
ing osmotic shock, inflammatory cytokines, LPS, UV, endo-
plasmic reticulum stress, mitochondrial dysfunction, and
impaired immune function [16, 17, 46, 52, 53]. Since apoE4
induces numerous pathways of cellular stress including oxi-
dative and endoplasmic reticulum stress [52], it is possible
that the effects of apoE4 on JNK and p38 are indirect and
result from the apoE4-induced stress.
With regard to the second question, the mechanisms by
which VEGF counteracts the effects of apoE4 on MAPK
pathway and the specific cell type involved in the pathology
are not yet known. However, based on the results, we can
hypothesize that VEGF alters apoE4 related signaling by two
mechanisms; a direct mechanism by which the effect of
VEGF is driven by the down-regulation of the downstream
signaling cascade, and an indirect mechanism by which
apoE4 and the decreased levels of VEGF induce cellular
stress that results in activation of p38 and JNK pathways.
Examination of the direct pathway shows that lower levels of
290 Current Alzheimer Research, 2019, Vol. 16, No. 4
VEGF are associated with lower Akt phosphorylation, lead-
ing to hyper-phosphorylation of GSK-3β which may also
lead in turn to tau phosphorylation. Furthermore, upregu-
lation of this pathway by elevating VEGF levels alters all
detected downstream phenotypes, which leads to reversal of
tau pathology (as observed in Salomon-Zimri et al. 2016)
[36]. The indirect pathway, on the other hand, shows hyper-
activation of the stress related markers, namely p-38 and
JNK/c-Jun in apoE4 mice, may be driven by various types of
apoE4-induced cellular stress such as oxidative, genotoxic,
mitochondrial dysfunction and osmotic stress, as well as pro-
inflammatory cytokines and extracellular environment stress
[54]. Up-regulation of VEGF by the AAV-VEGF treatment
which reverses the p38 related pathology and reduces the
apoE4 related effect on the JNK/c-Jun pathway possibly by
the contribution of the up-regulation of VEGF to reduce the
stress related processing. A schematic summary of the di-
rect/indirect hypothesis is presented in (Fig. 10).
The processes through which apoE4 reduces Akt levels
and increases p38 activity, mediating the synaptic and AD-
related pathological effects of apoE, are not fully understood.
The finding that the apoE4-driven inhibition of Akt is asso-
ciated with increased activation of GSKβ (Fig. 8) and tau
hyperphosphorylation, as obtained previously by Salomon-
Zimri et al. [38], is in accordance with findings obtained
with young AD apoE4 carriers at lower Braak stages [55].
These findings suggest that the cytoskeletal and tau pathol-
ogy observed in the apoE4 mice [36] may be driven via the
inhibition of Akt. Since Akt signaling has been implicated in
numerous other cellular activities such as growth, survival,
and migration [56], it is also possible that the Akt-related
pathological effects of apoE4 are mediated by these systems.
Fig. (10). The direct/indirect hypothesis. A model of the direct/indirect mechanisms underling the role of VEGF in mediating the patho-
logical effects of apoE4.
Salomon-Zimri et al.
Increased p38 activation has been reported in human AD
brain tissue, as well as in AD-relevant animal models and the
corresponding cell culture systems [18, 19, 47, 57]. Further-
more, p38 activation has been linked to increased production
of pro-inflammatory cytokines by glia activated with human
amyloid-beta (Aβ), as well as other diverse AD-related
events such as neurotoxicity and synaptic dysfunction [19,
58]. It is thus possible that the apoE4-driven increase in p38
plays a role in the apoE4-driven synaptic impairments and in
the accumulation of intra-neuronal Aβ as well as astrocytic
activation [15, 36]. The finding that the apoE4-driven activa-
tion of JNK pathway is not reversed by VEGF treatment,
whereas the synaptic and AD-related pathological effects of
apoE4 are, suggest that this signaling pathway does not play
a major role in the apoE4 phenotypes identified to date. The
extent to which JNK mediates yet to be identified pathologi-
cal effects of apoE4 remains to be determined.
Overall, the present study suggests a possible role of
MAPK's related signaling in mediating the apoE4 pathology.
The fact that diverse treatments such as ABCA1 agonist,
AAV-VEGF virus, and an anti-apoE4 Ab, all reversed both
the cognitive impairments and synaptic loss, suggest that
there may be correlation between the two [38, 59, 60]. This
observation, together with previous in-vitro studies, in which
a causal effect of apoE4 and synapse function has been
shown, suggest that the pathological effect of apoE4 on cog-
nitive impairment may be related to synaptic loss [61, 62].
Since the MAPK pathways were shown to be involved in the
pathophysiology and pathogenesis of AD [18, 19, 24] and
specifically in synaptic dysfunction [27], we have strong
reason to assume that the MAPKs are involve in the apoE4-
related AD-like pathology.
The Role of MAPK's Signaling in Mediating ApoE4-Driven
CONCLUSION
The present study shows that apoE4 is associated with
the specific activation of the stress-related p38 and JNK
MAPK pathways, and the inhibition of the corresponding
growth factor-related Akt pathways in the hippocampus. The
synaptic and AD-related pathological effects of apoE4 are
counteracted by reversal of the p38 and Akt-related signaling
effects of apoE4, suggesting that these MAPK pathways
could serve as possible apoE4-related therapeutic targets.
The mechanism underlying the observed effect of apoE4
on these growth factors is unknown, although it is interesting
to note that apoE4 has important effects on numerous recep-
tors such as VEGF-R2, ApoER2, and NMDA of which
apoE4 is a down-regulator, presumably by directing them to
lysosomal degradation. Accordingly, it is possible that the
effects of apoE4 on these growth factor-related pathways are
driven by the effect of apoE4 on the receptors, which in turn,
results in decreased growth factor.
ETHICS APPROVAL AND CONSENT TO PARTICI-
PATE
These experiments were conducted under the approval of
the institutional Tel-Aviv University Animal Care Commit-
tee (approval number: 04-14-022), and all animal rights were
strictly kept by ethical guidelines, Israel.
HUMAN AND ANIMAL RIGHTS
No humans were used in this study. All animal proce-
dures were followed in accordance with F16-00009 (A5010-
01) approval by Office of the Laboratory Animal Welfare
(OLAW) and the American National Research Council,
USA.
CONSENT FOR PUBLICATION
Not applicable.
CONFLICT OF INTEREST
The authors declare no conflict of interest, financial or
otherwise.
ACKNOWLEDGEMENTS
We thank Alex Smolar for his technical assistance and
Dr. Ori Liraz for his scientific counseling. This research was
supported in part by grants from the Israel Science Founda-
tion (grant No. 794/17), from the Joseph K. and Inez
Eichenbaum Foundation, from the Harold and Eleanore
Foonberg Foundation, and from the Joseph Sagol fellowship
program for brain research.
REFERENCES
[1] Masters CL, Simms G, Weinman NA, Multhaup G, McDonald BL,
Beyreuther K. Amyloid plaque core protein in Alzheimer disease
and Down syndrome. Proc Nat Acad Sci USA 82(12): 4245-9
(1985).
[2] Alzheimer A, Stelzmann RA, Schnitzlein HN, Murtagh FR. An
English translation of Alzheimer's 1907 paper, "Uber eine
eigenartige Erkankung der Hirnrinde". Clin Anat 8(6): 429-31
(1995).
Current Alzheimer Research, 2019, Vol. 16, No. 4 291
[3] Masliah E, Crews L, Hansen L. Synaptic remodeling during aging
and in Alzheimer's disease. J Alzheimer's Dis 9(3 Suppl): 91-9
(2006).
[4] Schwartz M, Deczkowska A. Neurological disease as a failure of
brain-immune crosstalk: the multiple faces of neuroinflammation.
Trends Immunol 37(10): 668-79 (2016).
[5] Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell
PC, Small GW, et al. Gene dose of apolipoprotein E type 4 allele
and the risk of Alzheimer's disease in late onset families. Science
(New York, NY 261(5123): 921-3 (1993).
[6] Roses AD. Apolipoprotein E alleles as risk factors in Alzheimer's
disease. Ann Rev Med 47: 387-400 (1996).
[7] Saunders AM, Strittmatter WJ, Schmechel D, George-Hyslop PH,
Pericak-Vance MA, Joo SH, et al. Association of apolipoprotein E
allele epsilon 4 with late-onset familial and sporadic Alzheimer's
disease. Neurology 43(8): 1467-72 (1993).
[8] Liu DS, Pan XD, Zhang J, Shen H, Collins NC, Cole AM, et al.
APOE4 enhances age-dependent decline in cognitive function by
down-regulating an NMDA receptor pathway in EFAD-Tg mice.
Mol Neurodegen 10: 7 (2015).
[9] Schindler S, Gratia P, Mullenberger G, Arendt J. Adenosarcoma
and other uterine sarcomas. Bulletin de la Societe des sciences
medicales du Grand-Duche de Luxembourg 134(2): 27-30 (1997).
[10] Mahley RW, Huang Y. Apolipoprotein e sets the stage: response to
injury triggers neuropathology. Neuron 76(5): 871-85 (2012).
[11] Kutner KC, Erlanger DM, Tsai J, Jordan B, Relkin NR. Lower
cognitive performance of older football players possessing
apolipoprotein E epsilon4. Neurosurgery 47(3): 651-7, 57-8 (2000).
[12] Peila R, Rodriguez BL, Launer LJ, Honolulu-Asia Aging S. Type 2
diabetes, APOE gene, and the risk for dementia and related
pathologies: the Honolulu-Asia aging study. Diabetes 51(4): 1256-
62 (2002).
[13] Michaelson DM. APOE epsilon4: the most prevalent yet
understudied risk factor for Alzheimer's disease. Alzheimer's
Dementia: J Alzheimer's Assoc 10(6): 861-8 (2014).
[14] Ungar L, Altmann A, Greicius MD. Apolipoprotein E, gender, and
Alzheimer's disease: an overlooked, but potent and promising
interaction. Brain Imaging Behav 8(2): 262-73 (2014).
[15] Bar R, Boehm-Cagan A, Luz I, Kleper-Wall Y, Michaelson DM.
The effects of apolipoprotein E genotype, alpha-synuclein
deficiency, and sex on brain synaptic and Alzheimer's disease-
related pathology. Alzheimers Dement (Amst) 10: 1-11 (2018).
[16] Kim EK, Choi EJ. Compromised MAPK signaling in human
diseases: an update. Arch Toxicol 89(6): 867-82 (2015).
[17] Yu Q, Du F, Douglas JT, Yu H, Yan SS, Yan SF. Mitochondrial
dysfunction triggers synaptic deficits via activation of p38 map
kinase signaling in differentiated Alzheimer's disease trans-
mitochondrial cybrid cells. J Alzheimer's Dis 59(1): 223-39 (2017).
[18] Zhu X, Lee HG, Raina AK, Perry G, Smith MA. The role of
mitogen-activated protein kinase pathways in Alzheimer's disease.
Neuro-Signals 11(5): 270-81 (2002).
[19] Munoz L, Ammit AJ. Targeting p38 MAPK pathway for the
treatment of Alzheimer's disease. Neuropharmacology 58(3): 561-8
(2010).
[20] Hensley K, Floyd RA, Zheng NY, Nael R, Robinson KA, Nguyen
X, et al. p38 kinase is activated in the Alzheimer's disease brain. J
Neurochem 72(5): 2053-58 (1999).
[21] Cuenda A, Rousseau S. p38 MAP-kinases pathway regulation,
function and role in human diseases. Biochimica et Biophysica
Acta 1773(8): 1358-75 (2007).
[22] Mehan S, Meena H, Sharma D, Sankhla R. JNK: a stress-activated
protein kinase therapeutic strategies and involvement in
Alzheimer's and various neurodegenerative abnormalities. J Mol
Neurosci 43(3): 376-90 (2011).
[23] Hoe HS, Harris DC, Rebeck GW. Multiple pathways of
apolipoprotein E signaling in primary neurons. J Neurochem 93(1):
145-55 (2005).
[24] Okazawa H, Estus S. The JNK/c-Jun cascade and Alzheimer's
disease. Am J Alzheimer's Dis Other Demen 17(2): 79-88 (2002).
[25] Takashima A. GSK-3 is essential in the pathogenesis of
Alzheimer's disease. J Alzheimer's Dis 9(3 Suppl): 309-17 (2006).
[26] Zhang Y, Huang NQ, Yan F, Jin H, Zhou SY, Shi JS, et al.
Diabetes mellitus and Alzheimer's disease: GSK-3beta as a
potential link. Behav Brain Res 339: 57-65 (2018).
[27] Morroni F, Sita G, Tarozzi A, Rimondini R, Hrelia P. Early effects
of Abeta1-42 oligomers injection in mice: involvement of
292 Current Alzheimer Research, 2019, Vol. 16, No. 4
PI3K/Akt/GSK3 and MAPK/ERK1/2 pathways. Behav Brain Res
314: 106-15 (2016).
[28] Sun J, Nan G. The extracellular signal-regulated kinase 1/2
pathway in neurological diseases: a potential therapeutic target
(Review). Intern J Mol Med 39(6): 1338-46 (2017).
[29] Kirouac L, Rajic AJ, Cribbs DH, Padmanabhan J. Activation of
Ras-ERK signaling and GSK-3 by amyloid precursor protein and
amyloid beta facilitates neurodegeneration in Alzheimer's disease.
eNeuro 4(2): (2017).
[30] Gan X, Wu L, Huang S, Zhong C, Shi H, Li G, et al. Oxidative
stress-mediated activation of extracellular signal-regulated kinase
contributes to mild cognitive impairment-related mitochondrial
dysfunction. Free Rad Biol Med 75: 230-40 (2014).
[31] Lau D, Bengtson CP, Buchthal B, Bading H. BDNF reduces toxic
extrasynaptic nmda receptor signaling via synaptic NMDA
receptors and nuclear-calcium-induced transcription of
inhba/activin A. Cell reports 12(8): 1353-66 (2015).
[32] Maezawa I, Maeda N, Montine TJ, Montine KS. Apolipoprotein E-
specific innate immune response in astrocytes from targeted
replacement mice. J Neuroinflammation 3: 10 (2006).
[33] DeKroon R, Robinette JB, Hjelmeland AB, Wiggins E, Blackwell
M, Mihovilovic M, et al. APOE4-VLDL inhibits the HDL-
activated phosphatidylinositol 3-kinase/Akt Pathway via the
phosphoinositol phosphatase SHIP2. Circ Res 99(8): 829-36
(2006).
[34] Ong QR, Chan ES, Lim ML, Cole GM, Wong BS. Reduced
phosphorylation of brain insulin receptor substrate and Akt proteins
in apolipoprotein-E4 targeted replacement mice. Sci Rep 4: 3754
(2014).
[35] Salomon-Zimri S, Boehm-Cagan A, Liraz O, Michaelson DM.
Hippocampus-related cognitive impairments in young apoE4
targeted replacement mice. Neuro-degenerative Dis 13(2-3): 86-92
(2014).
[36] Liraz O, Boehm-Cagan A, Michaelson DM. ApoE4 induces
Abeta42, tau, and neuronal pathology in the hippocampus of young
targeted replacement apoE4 mice. Mol Neurodegen 8: 16 (2013).
[37] Gilat-Frenkel M, Boehm-Cagan A, Liraz O, Xian X, Herz J,
Michaelson DM. Involvement of the Apoer2 and Lrp1 receptors in
mediating the pathological effects of ApoE4 in vivo. Curr
Alzheimer Res 11(6): 549-57 (2014).
[38] Salomon-Zimri S, Glat MJ, Barhum Y, Luz I, Boehm-Cagan A,
Liraz O, et al. Reversal of ApoE4-driven brain pathology by
vascular endothelial growth factor treatment. J Alzheimer's Dis
53(4): 1443-58 (2016).
[39] Liu Y, Deisseroth A. Tumor vascular targeting therapy with viral
vectors. Blood 107(8): 3027-33 (2006).
[40] Hermida MA, Dinesh Kumar J, Leslie NR. GSK3 and its
interactions with the PI3K/AKT/mTOR signalling network. Adv
Biol Regul 65: 5-15 (2017).
[41] Hooper C, Killick R, Lovestone S. The GSK3 hypothesis of
Alzheimer's disease. J Neurochem 104(6): 1433-9 (2008).
[42] Lane-Donovan C, Herz J. ApoE, ApoE receptors, and the synapse
in Alzheimer's disease. Trends Endocrinol Metabol 28(4): 273-84
(2017).
[43] Zhao N, Liu CC, Van Ingelgom AJ, Martens YA, Linares C,
Knight JA, et al. Apolipoprotein E4 impairs neuronal insulin
signaling by trapping insulin receptor in the endosomes. Neuron
96(1): 115-29 e5 (2017).
[44] Zhao N, Liu CC, Qiao W, Bu G. Apolipoprotein E, receptors, and
modulation of Alzheimer's disease. Biol Psychiat 83(4): 347-57
(2018).
Salomon-Zimri et al.
[45] Chen Y, Durakoglugil MS, Xian X, Herz J. ApoE4 reduces
glutamate receptor function and synaptic plasticity by selectively
impairing ApoE receptor recycling. Proc Nat Acad Sci USA
107(26): 12011-6 (2010).
[46] Cash JG, Kuhel DG, Basford JE, Jaeschke A, Chatterjee TK,
Weintraub NL, et al. Apolipoprotein E4 impairs macrophage
efferocytosis and potentiates apoptosis by accelerating endoplasmic
reticulum stress. J Biol Chem 287(33): 27876-84 (2012).
[47] Pei JJ, Braak E, Braak H, Grundke-Iqbal I, Iqbal K, Winblad B, et
al. Localization of active forms of C-jun kinase (JNK) and p38
kinase in Alzheimer's disease brains at different stages of
neurofibrillary degeneration. J Alzheimer's Dis 3(1): 41-48 (2001).
[48] Hoe HS, Pocivavsek A, Dai H, Chakraborty G, Harris DC, Rebeck
GW. Effects of apoE on neuronal signaling and APP processing in
rodent brain. Brain Res 1112(1): 70-9 (2006).
[49] Lee KI, Su CC, Yang CY, Hung DZ, Lin CT, Lu TH, et al.
Etoposide induces pancreatic beta-cells cytotoxicity via the
JNK/ERK/GSK-3 signaling-mediated mitochondria-dependent
apoptosis pathway. Toxicol In vitro: an international journal
published in association with BIBRA 36: 142-52 (2016).
[50] Song G, Ouyang G, Bao S. The activation of Akt/PKB signaling
pathway and cell survival. J Cell Mol Med 9(1): 59-71 (2005).
[51] Steen E, Terry BM, Rivera EJ, Cannon JL, Neely TR, Tavares R, et
al. Impaired insulin and insulin-like growth factor expression and
signaling mechanisms in Alzheimer's disease--is this type 3
diabetes? J Alzheimer's Dis 7(1): 63-80 (2005).
[52] Dose J, Huebbe P, Nebel A, Rimbach G. APOE genotype and
stress response - a mini review. Lipids Health Dis 15: 121 (2016).
[53] Dorey E, Bamji-Mirza M, Najem D, Li Y, Liu H, Callaghan D, et
al. Apolipoprotein E isoforms differentially regulate alzheimer's
disease and amyloid-beta-induced inflammatory response in vivo
and in vitro. J Alzheimer's Dis 57(4): 1265-79 (2017).
[54] Kusaka G, Ishikawa M, Nanda A, Granger DN, Zhang JH.
Signaling pathways for early brain injury after subarachnoid
hemorrhage. J Cerebral Blood Flow Metabol 24(8): 916-25 (2004).
[55] Simpson JE, Ince PG, Shaw PJ, Heath PR, Raman R, Garwood CJ,
et al. Microarray analysis of the astrocyte transcriptome in the
aging brain: relationship to Alzheimer's pathology and APOE
genotype. Neurobiol Aging 32(10): 1795-807 (2011).
[56] Majewska E, Szeliga M. AKT/GSK3beta Signaling in
Glioblastoma. Neurochem Res 42(3): 918-24 (2017).
[57] Sun A, Liu M, Nguyen XV, Bing G. P38 MAP kinase is activated
at early stages in Alzheimer's disease brain. Exp Neurol 183(2):
394-405 (2003).
[58] Lee JK, Kim NJ. Recent advances in the inhibition of p38 MAPK
as a potential strategy for the treatment of Alzheimer's disease.
Molecules 22(8): (2017).
[59] Boehm-Cagan A, Bar R, Liraz O, Bielicki JK, Johansson JO,
Michaelson DM. ABCA1 Agonist reverses the ApoE4-driven
cognitive and brain pathologies. J Alzheimer's Dis 54(3): 1219-33
(2016).
[60] Luz I, Liraz O, Michaelson DM. An Anti-apoE4 specific
monoclonal antibody counteracts the pathological effects of apoE4
in vivo. Curr Alzheimer Res 13(8): 918-29 (2016).
[61] Kim J, Basak JM, Holtzman DM. The role of apolipoprotein E in
Alzheimer's disease. Neuron 63(3): 287-303 (2009).
[62] Sun GZ, He YC, Ma XK, Li ST, Chen DJ, Gao M, et al.
Hippocampal synaptic and neural network deficits in young mice
carrying the human APOE4 gene. CNS Neurosci Therap 23(9):
748-58 (2017).