Thacker - An Ideal For Living - An Anti-Novel PDF

An Ideal for Living
{ An Anti-Novel }
Eugene Thacker
QUODLIBET BOOKS
2004
Thacker ~ An Ideal for Living ~ 2
How, indeed, could a dead thought have any living effect if it is truly dead? – Christian
Jambet

ITEM#411P969. The upper section of the rear of the pod provides one of several ideal
matches between surfaces. In a sitting position (on the knees), raise the right leg, until the
bottom of the right foot is flat on the floor (or the foam). Both left and right arms may be
used as balancing points by placing them out to the side, so that the hands touch the side
walls. Shifting the weight to the right leg, keeping the back hunched over, so as not to
injure the head, and slowly raise the body until both feet are on the floor. Since it is
impossible to stand straight up inside the pod, it will be necessary to maintain a slightly
hunched-over posture, while possibly bending the legs at the knees as well. Moving to the
rear of the pod, turn the body around so that it faces the front (or the glass C60 portal).
Slowly place the palms of both hands against the rear wall of the pod. Shifting the weight
backwards, gradually release the tension in the arms and hands until the lower back
touches the upper rear wall and ceiling. Keeping a hunched-over posture, the curvature of
the back and shoulders will negatively match the curvature of the upper rear wall and
ceiling.
PID: 4401
We do not say the words, but rather listen to the ringing of gelatin chimes
that must be made up of all the colors of saturated epidermal cells, the
sonorism made of fiber optic, water, ether. Signal transduction mechanisms
involved in eukaryotic metabolism; we pursue them patiently; SEQALI –
TARGET – 6 – PLDGEYFTLQ - IRGRERFEMF RELNEALELK
DAQAGKEPG. “What is life? – that is: continually shedding something
that wants to die.” Essentially the product of fissures, abrupt descents, and
broken contours, the misshapen and crag-like language described there
marks a circle; as if it were nothing more than a small strobe, resonating in a
dark room. “I had it scrapped, Reshaped.” REMARK - PDB ENTRY
1SAI.pdb - REMARK - ANTI-ONCOGENE - REMARK - HIGH
RESOLUTION SOLUTION NMR STRUCTURE OF THE - REMARK -
OLIGOMERIZATION DOMAIN OF P53 BY MULTI-DIMENSIONAL
NMR – REMARK - (SAC STRUCTURES) - REMARK - NMR, 25
STRUCTURES. All of it exalts your hungry body. Hence the correlation of
the motion tracking data and the gesture. PvuII 2 89 212 cag/ctg More
info. The MIML-patient sees but does not see. (They are not unlike other
patients undergoing memory disorder, recent clinical research into the
genetic mechanisms of echolalia within BmTP systems provides one
reference point in this regard.) We take for granted the connection between
seeing and remembering, as well as their difference. I may see my room
today, but at the same time I may also “see” my room as a previous space,
occupied by myself – or by someone else. Ecl136II 1 162 gag/ctc More
info. SphI 2 460 637 gcatg/c More info. “In fear every day, every

evening.” The previous habitation of space is a trace that may then go on to
constitute it in the future, in its absence. The MIML-patient can sometimes
exist in a puzzling state; they experience two equally plausible but
incommensurate environments. They actually live the aporia. With BmTP-
based symptoms, this aporia is closely connected to space and to
embodiment. It is, perhaps, the point at which seeing and remembering
perfectly overlap. 3) Complex anomalies, serious in their proteomic relation
to other, more simple biochemical pathways, but posing no obstacle and not
apparent to the accomplishing of any function, allow you to repeat, as
exactly as possible - hesitantly, for it must be done with studied refinement -
the gestures that were my gestures. You occupy, successively, all the space
that I occupied. And slowly, and patiently ATT-CGA-UAU-CGU-TTA-
AGU-ACG when I tell you to, as if not to wake me. In the volumetric
scanning chamber, each freshly cut surface of the block was flushed with
compressed air and examined for planing defects. Then you walk away from
here down the nocturnal carpet and into the nocturnal air, through the
silence of a teardrop 40 billion miles across, a cloud elongated by trepid
stellar jewels. This is all very serious.
PID: 4402
Read the following directions and identify each term in Fig. 1-22: EST
(Expressed Sequence Tags): 1. The set of rules used for converting data
from one representation to another. From my room where tears sleep
silently in my bed, whose eyelids were kissed by flies. 2. The representation
of data or instructions in symbolic form. 3. To convert data or instructions
into such a form. See computer code, genetic code, data, symbol, memory
co-processor. Changes away from homeostasis are detected by so-called
sensor cells. Processor Option: “As a matter of fact, we know less about our
language than about our bodies.” Sagittal - a lengthwise plane running from
front to back; divides the body or any of its parts into right and left sides.
“He calls her aloud from above.” I had the impression that everything was
misty and nacreous around me, with multifarious and indistinct apparitions,
and you have decided to confine yourself to very clear-cut characters, who
act in an atmosphere while still the unlettered circumstances Imagine a
building divided into many rooms The building may be large or
unstructured Every room of the building is lined with pods of various sizes;
numbering many thousands They represent There's at least one proposition
that can be made about the appropriateness of a form being open Then I'd
know for certain and giving up your phantasm at last A face, how
encouraging it would be if it could be a face, every now and then, always the

same, methodically varying its expressions. Median - sagittal plane through
midline; divides the body or any of its parts into right and left halves.
Coronal or Frontal - a lengthwise plane running from side to side; divides
the body or any of its parts into anterior and posterior portions. Transverse
or Horizontal - a crosswise plane; divides the body or any of its parts into
upper and lower parts. Networking/Ports: A weighted Thr-Cys-Hsi-Leu-
Gin-Arg-Gly-Lys2-Ser-Aps6-Ala-Asn-Mte-Phe-Val-Trp-ATPase-RNA-
URFA6L-Glu Impulse Response. - Vertical: Linear BmTP Thread State:
srr0: 0x927d23e4 srr1: 0x0200f030 vrsave: 0x00000000 cr: 0x24022228
xer: 0x00000004 lr: 0x927d2380 ctr: 0x927d84f4 r0: 0x00000000 r1:
0xbfffe6f0. Then you repeat, as exactly as possible - hesitantly, for it must
be done with studied refinement - the gestures that were my gestures. You
occupy, successively, all the space I occupied. And there you turn away and
silently weep. And slowly, and patiently, I draw myself out and become
translucent. With the eyes shut. "A New Capillary Vision System for Whole
Blood and Plasma Viscosimetry in Dislipidemia and Hypertension." Slowly
ATTT-CGGA-UAUC-CGUU-ATTA-UAGU-ACGG Add an ulterior
complication: besides (which I must still believe to be the lethal side of this),
had left on that body an imprint (600 dpi resolution, RISC processor, 64
Truetype) of spectacular deformity and| H H ⁄
(ˇ·ˇ· ˘ E G ( ¸ H H ⁄ ( d
' ` ê –œ ‡°± ·
; ˇ˛ Error!
Pod occupant 0_dai slid the ID card into the ninth floor's security entrance slot. The
miniature screen flashed, in three languages, the registration information and pod domain.
After a comfortable pause, the main door clicked and opened. Walking out into the ninth
floor array, 0_dai stopped for a brief moment. There was complete silence, intermittently
broken by the faintest electronic sounds - something between a distant computer game and
muffled speech software. The long corridor was lined on both sides by rows of pods, half of
them unoccupied. It was still early, however, and some of them would soon be reserved, if
they were not already. The corridor was dimly lit from above, and accompanied by pin-
lights along the floor, reminiscent of the emergency lights inside airplanes. The floor itself
was made of an unrecognizable dark grey material, but resembled smooth, reinforced
concrete. At the far end of the corridor 0_dai could make out a small glowing crimson
bulb on a metal faceplate. This was, 0_dai already knew, an exit light (which was really
not an exit, but led to a labyrinth of concrete staircases), an intercom, and colorful signs
displaying icons for washrooms and toilets.

PID: 4403
I used to watch what you did with me, how you delineated the invisibility of
my contours, and I'd never thought anyone could act like that – the
anatomical is only "given" through its signification, and yet it appears to
exceed that signification. A couple soft creases to rear wrapper, else about
fine, unopened. SEQALI 1SAIC ARG GLU ARG PHE GLU MET PHE
SEQALI 1SALC LYS LYS LYS PRO LEU ASP GLY SEQALI
1SAJC ARG PHE GLU MET PHE ARG GLU LEU The abbreviation
was most likely due to the anthropomorphic nature of the story (deciding to
give up or give in to the amorous condition, I sadly discover myself exiled
form its almost biochemical repertoire). Interpretive delirium begins only
when the MIML-patient, ill-prepared, is taken by a sudden fear in a
somnambulistic network of symbols. "Proteomic-based Coordination in
Polygon Tracking II: Comparing Model with Induced Human Immuno-
Response Systems." Most IrDA pads for BmTP systems support memory
and disk cache to improve performance and reduce network traffic. When a
packet (using either Krebs-v4 or ChemArray protocols) is transmitted from
the network, information is stored in both areas of the of cortical region.
Always already caught up in the signifying chain by which our difference is
negotiated, the anatomical (“Carefully watched for a reason”) is never given
outside its terms, and yet it is also that which exceeds and compels that
internal portion of your muscles, consisting principally of those fibres which
arise from the ischium's MicroStation, forming a dense clustered mass
SEQRES 2 42 ILE ARG GLY ARG GLU ARG PHE consisting of
bundled 32-Gigabit MEMS processing which descend almost vertically, and
terminate around an insistent and inexhaustible demand. The IrDA pads in
turn retrieve a cluster of packets from the memory cache more quickly than
from the BmTP system’s cache, though retrieving from the system’s cache
is still faster than downloading from the network. You recall the day's
languid chants when desperate cats invade our skulls, as a delineation of
molecular binding principles. Ever since the first patients were identified
clinically, one of the most striking characteristics of MIML-based disorders
is the readiness of patients to accept their own condition.
PID: 4407
Articulations, in the body, are joints between bones. They perform two
seemingly contradictory functions. “Painstaking devotion and love.” We
gathered everyone together, in the small amphitheater beside the stone
walkways, sweeping down in sticky wine hues and alchemical throats. But
we continued concealing our marks from view. It broke the glass, its

contents jumping to meet the floor almost instantly. “The Presence of both
Stochastic and Deterministic Dynamics in Electroretinograms Measured
Under Identical In Vivo Conditions.” Then I walks down the nocturnal
carpet and into the nocturnal air, through the silence which is that of
densely entangled urban space. The standard BmTP-based programs are
usually in a traditional type of machine code capable of being directly
intelligible to a computer (4. But when your long-forgotten lover is inside
you, flows in your veins, oozes out through your pores, it is known only
nominally by its position along any given molecular binding site). You wrote
on, filling two, three, four hundred pages worth. Suddenly you raised your
head as if to hide imaginary sheets of paper in your lap Pme55I 1 647
agg/cct PmlI 1 327 cac/gtg Ppu10I 2 454 1125 a/tgcat PpuMI 1
49 rg/gwccy You seemed to be listening to a faint singing which seemed
to issue from the wall monitors. (nt.16 - here add more dramatic emphasis.) The
text swells up like a bladder, grows enormous and subsides, unable to
swallow the world and our two bodies with it. Flexion – In the diagnosis of
MIML-patients, flexion decreases the angle, usually between anterior
surfaces of articulating bones with exceptions on posterior angles of some
CT-based movement data. Arch-shaped process wrapping around extensor
plane and abductor plane, separately you want to get away. And yet how
ridiculous - for, after all, the results of the diagnosis themselves were
membranes of memory. Abduction - Moves a body part away from midline,
for example, in the use of Galvanic skin-sensors in BmTP-compatible
systems. Pulse normal, respiration normal; the slowly moving CT scans
through which breathing occurred clenched and unclenched in perfect
rhythm, two pneumatic animations. Data are represented in the circuitry of
a digital computer by a pattern of coded electrical pulses. But in the memory
of BmTP systems, these pulses may synthesize patterns of molecular
binding within and on the component parts (Epimysium, Perimysium, or
Endomysium), or they may utilize transcriptase enzyme to re-digitize the
component part itself (Myofibril Sarcomeres). With the final current flow
the images bulged, muscles worked in spasms and the abdomen arched
away from the diaphraneous table and began to calmly, methodically, heave,
and in spite of it I also felt my own abdominal muscles contracting.
Connection type: EcoT22I (atgca/t; default), EcoRI (g/aattc), EcoRII
(/ccwgg), EcoRV (gat/atc). The patient whose MIML-related activity is to
be captured has sensors placed on key points of its body, and as the
recollection process ensues, the sensors feed data about those processes
into a BmTP computer. I understood the sullen question in your voice.
Many times, earlier on, they had asked me the same thing, and always the

answer had been the same: "The word has no meaning for me. It is a sound,
immobility's first motion."
ITEM#411E971. Though the pods on each floor are arranged in rigid rows, inside each
one there is a seamless flow of subtle curves and slopes. The pod interior has no right
angles, and no angles between any two walls. Each surface forms a wall, or the shell of a
video monitor, or the hidden platform beneath a futon.
PID: 4408
You do not say the word to yourself, but rather listen with me to the ringing
of gelatin chimes, the sonorism made of fiber optic, water, ether. Turning
back towards me you remark, half-heartedly, “The whole world is an omen
and a sign. Why look so wistfully in a corner?” Elaborate operations were
rehearsed and perfected in a clinical setting, on MIML-based models with
refined biochemical details - down to the finest capillaries - based on each
flesh-and-blood patient's topographic scans. Both the medical literature and
the technical manuals related to BmTP systems postulate a semi-public
space where nothing matters but the force of projectiles, the compulsive
pushing and pulling of molecules. You put the aorta on the floor and
shrugged, with the violin in front and orange petals on the back, down a
sunken April amnesia. The fluids circulating in the body are controlled
externally or supplied from the outside: urine empties through a catheter
into a tissue engineered hydraulic bladder under the left arm, the stomach
through a tube in the nose into an artificial biopolymer sac, and blood
through a ChemArray-compatible tube and into an opening at the base of
the cortex. You left your body where it was, but took a step backward in
another just like it. Chondrocytes: Bone-growth factors and embryoid stem
cells are inserted into a porous material cut to a specific shape, creating new
support structures, communications channels, or traditional limbs. A
product that produces shin-bones is in clinical trials. Companies: Creative
Biomolecules, Orquest, Eudaimon Biologics, Genzyme, Osiris
Therapeutics. I am breathing for you. I occupy, successively, all the space
that you occupied. It is a small white silver-shining moth or worm, which I
found much conversant among Books and Papers, and is supposed to be
that which corrodes and eats holes through the pages and covers.
“Surrendered to self-preservation.” Then I repeat, as exactly as possible -
hesitantly, for it must be done with studied refinement - the gestures that
were your gestures. SEQALI TARGET PLDGEYFTLQ IRGRERFEMF
RELNEALELK DAQAGKEPG - SEQRES LYS LYS LYS PRO LEU

ASP GLY GLU TYR PHE THR LEU GLN Technically amplified, the
heart of the MIML-patient is now indicated by the regular flashing and
beeping on the graphic waveform monitor to the left. "Molecular Cloning
and Characterization of a Unique Retinoblastoma-Binding Protein." Set
free, the tissue continued to expand and contract in time with your
breathing; functionally, it was still inside the rib cage. Suddenly I wondered:
And what makes me so sure that I'm not still flesh and blood, a starry
singing corpse? "Knowing about" these regions of the body, which grows
out of acquiring an anatomical view in clinical practice, combines the
anatomical "knowing that" of the visible, and the anatomical "knowing
how" of making something visible.
PID: 4410
anaesthetics, operating in an area free of pain; Chr2(23), MSH2: Easy to
install, versatile, economical... -Sealed options meet IP-65 and NEMA 12. -
Choice of ten operating drivers. Materials such as synthetic carbon-leather
and vapour-treated velour became the primary working tools, as well as
fiber-optic baroque meshes, all of which simplified and heightened the
book's rate of unbinding by the use of injurious techniques. -it seems - as
have been speaking - that a kind of homage - a rather clumsy one - to
silence. A homage to a kind of eroticism, too, perhaps. Or to biochemistry.
It was further weakened by the excessive paring necessary for the style of
binding. Back ends were insufficiently lined and structured to take hold of
tooling, and this made them flexible and brittle. Endpapers, when present,
were usually no more than a fold of weak marbled paper. A human gene
mutated in some MIML-related predispositions is homologous to an
enzyme in the DNA-based CPU’s mismatch repair pathway. “From others
who care for themselves.” Once each MIML-patient is reduced to a body,
positioned and then connected, the body is, in turn, reduced to the area of
analysis. Then you repeat, as exactly as possible - hesitantly, for it must be
done with studied refinement - it then becomes the crawling of innumerable
thoughts and recollections. 2) asepsis, surgical action in a sterile field;
Chr19(11.2), cDNA: Neurofibrillary tangles are the major microscopic
abnormalities, along with extracellular fibrillin-1 microfibrils (marked by a
bright-green color), which initiate the deletion of genes marked by
fluorescent signal markers on only one of the two control copies of the
chromosome. Around the planned scanning area the skin is thoroughly
disinfected (so, for instance, the abdomen may be coated with wide strokes
of anaseptic chemical). 3) stypsis, and thus intervention in a preferably
bloodless space; Ch11(14), LQT1: Portion of an EKG model used to

diagnose and render echolalic syndromes associated with MIML, in the lofty
chamber, beneath candelabra blacken with smoke. Next, a rectangle of skin
is dabbed dry, and green paper towels are placed around it and affixed to
the skin, thus marking the area as a localizable area of biochemical activity.
Afterwards, blue linen is spread all over the patient’s body. With this design
ever uppermost in your mind, you then altered, in a great measure, the line
of conduct. You provided yourself with plausible excuses for such
appearances as were made, and adopted conciliatory tactics insofar as these
did not conflict materially with your own inscribing, baroque gestures.
"Strength of Binding between Ultrahigh Molecular Mass Polyethylene-
Hydroxylapatite Composites using 3D Spring Lattice Models." It may be
fixed to the patient's skin (with a laser and microscopic thread), which is
then covered with a transparent plastic film. 4) strictly detailed systems of
localization and a wide-ranging topographical anatomy, which enabled us to
have a new overall view of the ground, the terrain of all forgetting;
Chr3(11.2), SCLC1: Genetic marker for detection of a tumor suppressor
vector, which is associated with one type of linguistic disorder linked to
overexposure to BmTP systems (a large portion marked Ca is visible in this
CT scan). This sterile second skin makes this stretch of body look like the
dull surface of a mannequin, or, more to the purposes of the procedure, like
the dimensions of a child of four to five years old. Our luminescent, naked
bodies dissolve into a swarm of obscure creeping things, and we are a mass
of glutinous coiling worms, endless.
Pausing for a while – almost meditating – on a particular curved surface on the pod’s left-
hand wall, occupant luh+ was reminded of the ergonomic design strategies of certain
chairs, mobile phones, subway stations, and people. There was a sudden urge to crack
open the pod’s wall (would it crack? or would it simply change shape?), not out of some
urge to escape, but to peer inside the inside of the pod. Silent and preoccupied, luh+ leaned
back against the side wall, one bare foot up on the ledge encasing the network interface.
Just below the right side of luh+’s ribcage there was a soft, radiating blemish just beneath
the skin, resembling a blood clot. It nearly matched the marks on the sides of luh+’s
temples, were it not for the slight difference in size. Glancing at the time on the screen, the
quiet numbers indicated that over twelve hours had gone by; twelve hours that had been
passed under BmTP media, nowhere else but here, and on the network. Over time, the
pod’s interior came to resemble a heavy, soft drapery of some fabric wrapped endlessly
around the body. The red input LED on the side panel began to gently blink, a
reminder.

PID: 4411
To amuse and while away the interminable hours, switch on the power, and
the biochemical grid is immediately activated (Krebs-v4.2 ready, extensibles
not included). 8). The time that you dedicate to memory can only find itself
in the vision of things that puerile chance causes brusquely to appear:
cadavers, timecode, spilled passageways, insect swarms, and nakedness.
SUMMARY: “A blindness that touches perfection.” In this paper cortical
feature function detection and tracking are discussed, using methods
derived from pervious studies of MIML-related characteristics such as
counting and deformable circular template matching. Subsequently, by using
a deformable circular template matching two neurochemical pathways,
positions of each are measured through phantasmagoria of the un-
elucidated darkness around the eyes, before the eyes, as the predecessor of
the energy and equilibrium problem. Key Words – MIML-based topology,
mnemonic feature detection, aphasic feature tracking, molecular pathway detection,
deformable template matching. The first engravings, recognizable by their
reddish tone, which you had bought long ago at ransom prices, put me in a
good humour again; and I forgot everything else as I followed the strange
fancies of the artist, delighting in the breathtaking pictures of bandits and
succubi, devils and dwarfs, witches riding on cats and women trying to pull
out the teeth of the dead. Thus air is the parody of water./The brain a
parody of the equator./ 0001649 tttttcttttt ctttgagactg ggtctc..tttgttgcc
ccaggctggag 0001696 >>>>>>> ||||||||||||| |||||||||||||||
||||||| |||||||||||| <<<<<<< 8298797 tttttcttttt ctttgagactgg
gtctcgctttgttg.cc caggctggag 8298749 0001601 agactt gtttta.gctca
gggtccaatttctttt ttc.tttttttttttt 0001648 >>>>>>> ||||||||||||
||||||||| |||||||||||||| |||||||||||| <<<<<<< 8298846 agactt
gttttatgctc agggt.caattt cttttttcttttt tttttttt 8298798 “I find that really
fascinating, because I’m the other way around,” you said, “A Merovingian
had balanced on a cup; an enormous dice blinking a mournful eye; a
horrible spider with a human face lodged in the middle of its body; the main
thing is to know how to set about it, to be able to concentrate your
attention on a single detail, to forget yourself sufficiently.” I took them all
down from their shelves and examined them closely in silence before
putting them back, to see whether, since our arrival at Fontenay, the heat
and damp hand not damaged their bindings or spotted their papers.
Proposition 3: If a product of generators II = IIa • IIb, where either IIa or IIb
is of barrel type and the two sub-products do not have any generator in
common ,then IIa • IIb forms an algorithmic node-free path. Lemma 4: For
any node s = (p1,...,pn) in a substar Gn(pn) of Gn, there are n-1 disjoint paths of
length at most 2 that connect s and some node si of Gn(i). "Profiling

Expression Patterns and Isolating Differentially Tagged Genes by cDNA
Microarray System Detection." 2. Node-to-Node MIML Routing in
Hypercubes. The most difficult thing for MIML-based patients – and
indeed, for those not affected by MIML disorders – is that MIML has very
little to do with memory loss. Rather, it involves the generation of memory
outside of and apart from any possible experiential event. An
interconnection network is represented as an undirected graph G(V, E),
where nodes of G denote the processors, and edges of G denote the
communication channels between processors.
PID: 4414
This new curve may intersect itself any number of times. In general,
however, it will statistically partition the planar region in two, resulting in
the appearance of two, distinct recollections. Let us consider the model (Eq.
4.17) traced in the direction in which any standard BmTP-based component
(Eq. 4.11) goes from an exterior point to a self-observing one (Fig. 1.2).
Perhaps the most intriguing possibilities for treating MIML-related
disorders lie in attempts to manufacture new biomaterials and tissues from
scratch. For days on end, I remained sitting in the library or in another,
anonymous room, accompanied by your silent, warm shadow. I was aware
that there was an unease in the air, and that my state of mindless suspension
could not go on forever. The first led us to the rudiments of a theory of
informational echolalia, the latter to a certain possible understanding of
cognitively-displaced fibrillation. Obviously it was up to me to break the
stalemate, but I resisted the very idea of any kind of change: I was incapable
of making the most trivial decision. "Histological and Mechanical
Charcterization of an Experimental Model Joint Replacement during
Supramaximal Isokinetic Muscle Contraction." As a diagnostic tool, routers
such as the ChemArray suite are, for their part, helpful in understanding
how biochemical pathways are transmitted throughout the human body:
since regular meshes dissipate their energy too rapidly to be of any
metabolic use, coherent, patterned pulses that maintain their dispersal could,
in effect, explain how energy produced in one part of the body fuels
metabolic processes in another, distant part. The idea is to take individual
cells from a tissue and seed them in a fine mesh of soluble material, then
incubate them until they multiply and connect up. Several systematic
programs of instruction, known as koros, exist for studying the corporeal
impact of MIML, organizing the information it presents and correlating it
with simulated in vivo models. “But hurts just like anything else.” The
resulting tissue is implanted in the body where it establishes connections

with the patient's tissue, taking hold while the mesh dissolves away. Arms
encircled solemn flanks, hands caressed us, smoothed us, though lightly, so
as to feel them quiver, with finger tips, as when one tries to feel the eyeball
rolling under the lids. RNA-derived exon coding sequence for Media-
Induced Memory Loss disease: Patent pending, Myriad Genetics/Applied
Biosystems. Based on: cDNA-derived pathway for MIML-based aphasia
(retinitis pigmentosa): Patent 5,705,380, Axys Pharmaeceuticals/Ubbo-
Sathla Laboratories. Krebs-v4.0 derived genetic template: Patent pending,
Univ. of Washington/Cocytus RxPharm. The part of the curve (Eq. 4.17)
which contains limit points of the exterior points we shall call the "affective
boundary." All other points will be termed "interior points." The
nasturtiums are blooming in the stream. A teardrop 40 billion miles across, a
cloud elongated by trepid stellar jewels. This method of control is not
difficult to schematize through the equations presented here, and it may be
worthwhile employing these in clinical practice as well.
ITEM#814M974. As the intention of the pod is to accommodate any guest, there are a
number of features and services which each provides, though these often vary, depending on
the bandwidth regulation in a given area of the city. The earliest pod domains contained
the standard video monitor, Internet connection, MiniDV, a mini bar, and a simple, off-
white futon with clean sheets and blankets. In addition to this, current pods also contain a
rate-scaled set of services which make available the latest in high-tech entertainment,
gaming, and communications services. These can range from network access (including
Internet2x for built-in computers, or wireless services for wearable devices), to popular
social networks such as MediaMeet. Each pod is also supplied with all the necessary
hardware, software, and extensibles for accessing any of these services. Since most pod
domain buildings are unstaffed, individuals interested in visiting pods must purchase
session hours online. At that time the proper fees, contact information, and session ID
numbers are downloaded onto a credit card or universal credit chip. The data on this card
provides the customer with access to the pod domain building itself, as well as the floor on
which the assigned pod is located. Most buildings contain washrooms and a main-floor
reception or lounge area that is open to all customers. Selected pod domain buildings, such
as those in Seoul or Metro Bohol, also contain floors with restaurants, special interest
nightclubs, shopping corridors, and health care facilities.
PID: 4415
Shape-shifting or the indulgence of subharmonic inculcations was allegedly
much indulged in by the Changlings, and several of the semi-mythological
characters in the early tales take the form of animals, patterns, and symbols,

some meeting their deaths while in this sacrificial shape. Fairies were
thought to steal human children and leave old, deluded fairies in their
places, disguised as children. Effects on the human body. Table 1, page 33,
lists some effects that typically result when a MIML-patient is connected to
a healthy patient across a current source approximating BmTP connections
with a direct cortical resistance of 4.4kW/mol. The table shows that a
current as little as 278mA will flow between the source and eye, if standard
IrDA pads and needles are in contact with a standard 296Vac source.
“Isolation, isolation, isolation.” The table indicates that even the relatively
small current of 50mA can produce what is called “mnemonic
displacement” – which the current medical literature describes as rapid,
uncoordinated contractions of the ventricles, resulting in loss of
synchronization between pulse beat the neuronal activity related to memory.
The electrocardiograms shown in Figure 1 compare a healthy heart rhythm
to one with MIML-related mnemonic displacement. Unfortunately once
such a condition occurs, it will continue, baring resuscitation techniques.
"This is how I finally reach the end of language. Only forgotten would they
take on full meaning, falling suddenly, inconclusively, into oblivion." A
centipede has a poisonous bite but still meets death in the jaws of a pallid
bat. event \i-'vent\ n [MF or L; MF, fr. L eventus, fr. eventus, pp. of evenire to
happen, fr. e- + venire to come] 3. The usu. conscious perception or lack of
representation of a real occurrence or of an external, bodily, or psychic
happening as a state or result of being engaged in such affairs of activities.
"Characterization and Chromosomal Mapping of Two Pseudogenes of the
Pafaha/Lis1 Gene with Retrointegration Point Mutations." 99 CG LEU
17 -11.773 3.518 2.181 52 CA GLY D 325 -13.433 -9.111
13.164 117 CG2 ILE D 332 -10.462 3.538 -4.582 132 C GLY D
334 -11.716 4.537 -10.059 174 CE2 PHE D 338 -13.217 -3.503 -
7.147 251 C ALA D 347 -2.672 -10.036 0.466 But this all occurs
spontaneously in cities when layers of posters are defaced or weathered, and
now there's a way to maximize your processor while avoiding costly
memory upgrades. It (A) glides down and pounces and attacks the prey's
head; (B) as the patient flails helplessly, the bat picks it up (C) and carries it
away (D) toward a perch; the bat is able to hear enticing footsteps, dozens
of them, simultaneously. I open in myself/a theatre where a false sleep in
playing/an aimless sham/a disgrace that sickens me/uncertainty of the
eyelashes/dead lips/...the senseless attention, analogous/to the fear that
intoxication can be, to/... When I tell you to, you move my body in the pod,
but carefully, gently, as if not to wake me. It was the same for gestures. You
had a very unusual one: it described an enormous arc reminiscent of a

cephalopod. It is primarily a sign illustrating past, but unintended,
movements.
PID: 4416
Although I am striving for a lean style, one that shows the bone, I should
like to address to you from my prison a book laden with flowers and fluids
of the body, with deep-mauve petticoats and violet ribbons. I could no
longer hear my own half-asleep thoughts, nor the slow and gradual plops of
the eyes. Then, you took the fragile catwalk in ten low, long steps; then into
the bright loft without knocking, pinned in a slow zoom against shaded
orbits r8: 0xbfffe844 r9: 0x0000067d NlaIV ggn/ncc. "This subject is
riddled Lethewards - if you were to use the method employed by some of
our more baroque colleagues, you would, in effect, be eaten body and soul
by imaginary mantis-like parasites. My technique is quite different - I
operate with moulds." Are the find/sift/sort utilities readily available to
make it easy and logical to find a timeline that corresponds to any
biochemical pathway? Are there too many unnecessary steps to place a mark
in the sequence? Is it easy to see and feel the pace and rhythm of each
timeline, irrespective of the biochemical protocols used? Or is the logic of
the processes distracting enough that you cannot adequately recover any
readable files? r18: 0xa01913d0 r19: 0x00000000 Psp124BI gagct/c I
recognize their influence, the charm of their melodrama. Furthermore, my
mind continues to produce lovely chimeras, but so far none of them has
taken on flesh. Not one. Never. If I now try to indulge in a daydream my
throat goes dry, despair burns my eyes, and shame makes me bow my head.
“Mother I tried please believe me.” Wind was sliding along the exoskeletal
concrete and then climbing up my thighs into the sulfur crevice surrounding
your eyes. "Identification and Cloning of a Developmentally Regulated
Cryptosporidium parvum Gene by Differential mRNA display PCR."
Sinking our bare feet into the delicate and rippled sands of what once must
have been a city. Saliva striped our hands. There were gliding planes
tethered there, translucent membranes drawn taut over fragile-looking
frames. Up another winding stairwell, you hit a straight stretch that
narrowed to nothing in the distance, either way you looked. r28:
0x00000004 r29: 0x060d0d80 SfaNI gcatc It was broader than the curved
parts and the floor was soft with small rugs, it looked like hundreds of
them, rolled out in layers deep over the concrete. Each had its own pattern
and arrangement, and, while walking along, each seemed to resemble the
other, planting tiny clues here and there, dead-end ladders dangling in space,
straddling beams beating out tunes with shiny gamelan hammers. The

universe shakes with amphibian, adolescent dust. There are some limited
sort capabilities, though. You can cut-and-paste a timeline within a given
molecule or from one side-chain to another. You can click and drag
timelines into any order you find desirable in any of the molecular binding
modes. But no sooner had I entered than xer: 0x00000004 lr: 0x927d2380
Mva1269I gaatgc I realized that I was seeing in the mirror of the wardrobe
opposite the door, isolated by the darkness from the rest of the image, the
glow of the cigarette you had lit, and I was glad that you had struck the
match in the dark hallway. You must not see what's left of my pallid body,
along the stained walls, by the walkways, underneath the bridges. You
watched as the shape beneath your feet elongated, stretched out into a
thread of non-color (‘netural’), drawn across a chasm into that round blot of
darkness, then I too was drawn out into an exquisite and imperceptible
elongation.
ITEM#823L008. Note: Many first-time pod users are concerned about the possible
side-effects of extended use of BmTP-based networks. These include cognitive,
neuropsychiatric, and psychoplasmic irregularities, most commonly manifesting themselves
in the form of a loss of long-term memory. In some cases more physiological, biochemical
irregularities have been reported. Rest assured, however, that the safe and moderate use of
BmTP-based networks presents little or no discomfort to the user. Additionally, each pod
domain building contains FDA-approved, ‘safe and secure’ emergency and technical
services (usually, though not always, on-site).
PID: 4417
Similarly, the onset of rhythmic behavior in a biochemical reaction is
identical to many other processes in which equilibrium systems suddenly
begin to oscillate, and identity, when you had one, was constructed of that
most modern of ectoplasms: electrons and photons that flitted silently
across a cloud elongated by trepid stellar jewels. An examination of the
already-existing worlds produced by MIML-like symptoms suggests a
negative answer to this question. Consider the technique called "cognitive
distancing" or "level of oblique detail," which for years has been used in
medical simulations and is now being adapted to more sophisticated
biochemical models as well as traditional BmTP environments: "These
recollections are like orifices that multiply over our two bodies causing my
skin and your skin to undulate and burst alike." The idea is to render the
models more crudely when the MIML patient is moving through their
specific mnemonic space; when the patient stops, detail gradually fills in.

Another variation of the same technique involves creating a number of
cognitive models of the same patient, each with progressively less detail.
ATOM 52 CA GLY D 325 -13.433 -9.111 13.164 1.00 0.84 CPU
Thread State: srr0: 0x927d23e4 srr1: 0x0200f030 vrsave: 0x00000000
ATOM 234 C ASN 32 -6.649 -7.827 0.046 1.00 10.00 CPU
ATOM 322 O LYS 44 -0.659 -23.735 12.037 1.00 10.00 CPU
ATOM 92 OG1 THR 16 -18.037 1.025 4.260 1.00 10.00 When
the BmTP diagnostics are close to an object, a highly detailed model is used;
if the object is far away, a lesser detailed version is substituted to save
unnecessary computation and processing time. In this way, you provided
each of the engravings to your 15th-century anatomical treatise with an
elaborate index to the letters denoting the various anatomical structures
exposed. However, this should present no difficulty to anyone with a
knowledge of you since they will be able to identify easily the many
structures, and attention has been drawn to those which might prove
confusing. “I’m doing the best that I can.” As with traditional computer
systems, BmTP-based digital error correction rests upon the idea of the
"check-sum," a relatively small number that is calculated from the data at its
source (which, in this case, is biochemical in nature), then transmitted along
with the data, and recalculated at the destination. Cumulatively, these
activities help the user to develop skills at attending to, duplicating,
repeating and remembering bodily movement. The main events in the life of
the MIML patient are those carried on by these organs: ingestion,
elimination, laughter, and in many cases echolalia. If the original and
calculated numbers do not agree, there has been an error in the
transmission, unless perhaps the checking hardware itself has failed. When I
tell you to, you move my body, but carefully, gently, as if not to wake me.
You drew out your keepsake, pure negation of light...a thin glass plate,
which must be held towards a light source to see anything on it. It was my
X-ray portrait, showing not the face, but the bony structure of the upper
half of the body, and the organs of the thoracic cavity, surrounded by the
pale, ghostlike envelope of flesh, which was then applied with great pressure
against your own neck. "Development of Spatiotemporal Receptive Fields
of Calibration-Free Retrointegrative-Adaptive Simple Cells: I. Model
Formulation." We felt that the heart muscle represented a tissue as useful
for the investigation of mnemonic conduction mechanisms as nerve tissue,
and furthermore, that the anastomoses and decussations of the heart-muscle
fibers presented us with a simpler phenomenon that the problem of the
nervous synapse.

PID: 4418
Synchonization of all events is provided by nine high-density Programmable
Logic Devices (PLDs), incorporating four Motorola DNA microarrays
(ChemArray-compatible), DSP-100278 (two per channel), which provide
more than sixty thousand computations per nanosecond necessary to
execute AB's propriety Lethewards/880 series software algorithms. Of the
six extra-ocular muscles, four have an origin around the optic foramen and
insert on the sclera of the anterior portion and within the cavity of the globe
is the vitreous lineation, which is a transparent, semi-gelatinous substance
that operates as an inner supporting structure central to the choroid, ciliary
body, and lens. “I’m ashamed of the things I’ve been put through.”
Opposite: Raised lace-back vest white high-collar shirt and cotton pique
waistcoat with ecru satin pants heather and gray double-layer silk
mousseline dress with titanium-shaded floral embroidery black thin-
saturated cotton ottoman fitted jacket with wide white turnover cuffs and
washed-white double-layer chiffon pants navy and black sheer lace web-
front dress with ivy appliqué beading with black sheer lace fringed shawl,
burgundy Chelsea-ruffled blouse over a sheer drop-waist dress with tie-front
black matte peasant top antique white open-weave wool long-sleeve wrap
poet's blouse with narrow hobble skirt whale-boned velvet bustier gilded
amorphous leather jumpsuit with silver broach buttons down the side, worn
over a black body stocking and topped with a burgundy snake bolero with
ostrich feathers black sheer organza Restoration blouse with black
embroidered beading on the bodice and flair-sleeves worn with a black silk
crepe long skirt with jet ornaments and a black and purple shawl, and all of
it is your doing. There is a blind spot to thought that is analogous to the
structure of the eye. "Allosteric Mechanism of Haemoglobin: Rupture of
Salt-Bridges Raises Oxygen Affinity of the T-Structure." If you initialize any
800-Kv4 data packets with the earlier OSI-based formatting, you cannot use
it with the 400-Kv4 protocols. 1. Compile the 800-Kv4 files you want to
initialize (Figure 7-2. A dialog appears). 2. In the dialog, use four spiraled
IrDA-OFHC conductors (14 awg, 2 sq. nm) with precision high-speed
linear gain amplifiers. 3. In the next dialog that appears, select ERASE
(Figure 7-5. Dialog to confirm command). 4. Select a format in order to
install continuous and secure erasure (Figure 7-9. A dialog appears just as
you leave. It is raining jewels and daggers.). Int. jugular v., Transverse sinus,
Occipital sinus, Spinal accessory n., Post. spinal aa., Dura mater, Post. lat.
fissures, Post. med. columns, Post. spinal aa., Venous plexus, External iliac
nodes, Epididymis. These algorithms utilize the computational capability

afforded by their talk, which was dull compared to the play of their eyes.
The eyelids did not flutter, nor did the temples crinkle. Their eyeballs
flowed from right to left, left to right, rotated, as if manipulated by a system
of ball bearings. (Meanwhile, the best way to familiarize yourself with the
possibilities is to get some hands-on experience. Make sure you've installed
it and have started up with it turned on.) Figure 9-4 The book would have
remained at rest forever if left alone. Exerting a force on the book causes it
to move. The chassis, like that of many DNA-based CPUs, has been
designed to house the substructure, wetware, and electronics. 2. Eye Safety
(Electricity): I keep recalling such gestures, so vivid they revealed memories
cut out of a faceted crystal, for -Precision, laser trimmed contacts on all
surfaces to insure perfect -G10/Carbon-60 nano-glass and epoxy glide
boards insure -Sealed, lubricated switches eliminate white noise switching
over (THD 0.95% at rated output, typically 0.003%. SMPTE IM 0.05%
unmeasurable).
ITEM#119M941. The portal to each pod is sealed off by a silent glass panel. This
"door" is a single, thin, hybrid layer of transparent microfiber and electrophoresis gel,
compressed between two layers of carbon-60 (C60) glass panes. When the occupant has
entered a pod, the portal automatically closes the sliding glass door. In its default state, the
glass remains transparent, so that the person inside the pod can see out, just as a person
outside can see in. A series of settings are available in each pod, so that the glass panel
can become opaque (akin to a frosted-glass effect), a one-way mirror (so that the person
inside can see out, but not vise versa; the reverse situation is also possible), or a solid white
that mimics the polycarbon of the pod’s own interior.
PID: 4419
Chapter Seven. Irregular Weak Verbs: Irregular weak verbs have a vowel
change in the past tense, but the verb endings in the past are the same as
those of the weak verbs. "Molecular Dynamic Simulations of
Oligonucleotide Duplex with Adenine Tracts Phased by Full Helix Turn."
Many types of vowel changes occur. Infinitive Past Tense denken (to
experience) ich dachte, wir dachten nennen (to affirm) ich nannte, wir nannten
bringen (to endow) ich brachte, wir brachten wissen (to perceive) ich wusste, wir
wussten. Charm - A spell; a form of words or an object or person believed
to contain magic powers, hence its broader meaning of attractiveness,
fascination, allure, or, as a verb, to enchant or bewitch; derived from the
Latin carmen, "a song". See Incantation; Talisman; Dance. 2-16. “I’m
ashamed of the person I am.” Powerful Feelings: According to your

definition, poetry is a "spontaneous overflow of powerful feelings." Does
this poem show whether it had had powerful feelings? Whether it was
having them at the time the poem was composed? If there were powerful
feelings, is it possible to tell what feelings they were? Does the poem
produce powerful feelings to the reader's discursive framework, and if so,
are they the same feelings that I appeared to have had? Using BmTP
systems, memory-loss diagnostics can be carried out using the following
steps. Step No. 22: Position them on the timeline. Mark-in and/or mark-out
on the timeline. There are, in addition, unspecified levels of
UNDO/REDO, but there is no history menu to describe what those undos
are undoing. Play the timeline (by simply clicking the PLAY button or
equivalent signal on the IrDA pads). [First Notebook] Incredible nervous
state, trepidation beyond words: to be this much is to be sick; flame-like
movements and physical dizziness. It's not a feeling of happiness but my
insufficiency to reach you that stops me: you elude me in any case. Will
something happen once the city? Often, in fact, we laugh like madmen.
(Opposite) “Like startled doves, we get angry when it doesn't rain," says a
local resident. A series of short horizontal lines placed carefully one after
another indicate excluded material which should be filled in by memory or
imagination. .... is a synonym. Loss of Limb, Life, or Sight (concurrent with
Accidental Death and Dismemberment Benefits conditions). Member
means hand, arm, foot, leg, spleen, or eye. Only one specific loss (the
greater) resulting from any one injury or event will be recognized.
Narratology denotes a recent concern (primarily within the schools of
thought that treat MIML as a technological disorder) with a line, or part of a
line, or a group of lines, which is repeated in the course of a text, sometimes
with slight changes, and usually at the end of each stanza or fragment (in
which changes in the hovering of black and silent wings indicate the altering
sounds during the hours of a particular night). But it may also consist of a
repeated single word - " A simple little thing, not to hurt.” You lived for
many years as a lover and companion. Born in 1916 you threw yourself
from a window in 1970. Your death followed a long period of mental
instability interspersed with spells of intense artistic and literary activity in
which you elaborated an extraordinary world of visions, anagrams, and deep
despair. As a child you were brought up in a large house surrounded by a
bizarre collection of marionettes, and in your fantasy life you constructed an
imaginary partner, "Myrmidon." On moving you were astonished and
alarmed to meet Myrmidon in actuality, and your meeting precipitated the
delusions which gradually followed, accompanied by several other fictional
texts.

PID: 4421
I. Introduction. This movement may be compared to the velocity of
oscillation, i.e. to a quickly alternating attraction toward, and repulsion from,
the same object. II. First Division. Analytic of Anaesthetic Judgment.
Second Book. First Moment of the Anaesthetic According to Appearance. At last,
we had descended to such a depth that it is without fear of exaggeration I
assure you the place at which we were to arrive must have been more than a
furlong below the surface of the courtyard. NEVER HAVE I SEEN
SUCH A SPECTACLE/JE N'AI JAMAIS VU UN TEL SPECTACLE.
Seeing me falter, I found myself in the middle of an appalling sepulcher. (As
you lie down and I demonstrate.) Open Mon.-Fri. 2-5pm. Open Sept.-July. Now,
if we admit that the senses' joy is always dependent upon the imagination,
always regulated by the imagination, the desired satisfaction in the sublime is
then only negative (while soft creases condense on the glistening surface of
memory, see p.31), viz. a feeling that the imagination is depriving itself of its
freedom, while it is purposively determined according to a different law
from that of its empirical employment. (Transported.) "DNA Recognition
Properties of N-terminal DNA Binding Domain within Large Subunits of
Replication Factor C." Imagine a circular cavern, twenty-five feet in
diameter, whose walls, hung in burgundy drapes, were decorated by none
but the most lugubrious objects, aphasic prosthetics of all sizes, decrepit
cello bows, several crystalline false eyes, bundles of frozen jellyfish, and
bowls containing ripened fruits. I LIKE IT VERY MUCH/J'EN PENSE
BEAUCOUP DE BIEN. One must not be amazed by the numerous
variations the imagination is apt to suggest during the initial episodes, by the
indefinite multitude of different tissues and thoughts the dissipating
imagination's various but withering attempts will bring to light. (Chemical
memories are lavished upon the area of each.) This built the spinal tail shape. And
it's no wonder that I've learned it all by heart and that it's taken on such a
literary and distasteful form. DNA: ggtgaagca aattgagagcaaggtt gcttttcaggaag
gcttggaggctgca ggtgataa TEXT: Hedoesn'ts aythewordtohi
mself,butratherIlistenwith himinhishead (Your thoughts are arranged.) All of us
laugh, all of us sing, and no one feels their heart beat any longer, running
through or bisecting me in half (descending the stairs of sleep, I notice it is
raining between the interface). “Isolation, isolation, isolation.” Figure 2-A
summarizes the relationship between biochemical current and snaptic time
in the human cerebellum. An important factor, the "let-go range," is shown
also on the graph. To the right of our lost nostalgia there was a figure, so
lifelike I was for a long time deceived by it. The LTM1 team has developed
an operation model hover vehicle that lets users take a ride on another

planet. Thus, our voluptuous transport is never ignited save by two causes:
DNA: ggtgaagca aattgagagcaaggtt gcttttcaggaaggcttggag gctgcag gtgataa
TEXT: He doesn't say the word to himself, but rather listens with him in his
head
PID: 4422
Rendering.framework /Versions/ A/ChemArrayRendering 0x91560000 -
0x91619fff bmtp.rna-i.QD 3.4.65 (???) /System/Lib/ Krebs-4.0//
Frameworks/ AppServices.framework/ Mol-Prot Versions/A/
Frameworks/QD.framework/ Mol-Prot Versions/A/QD. BAC-Acheron
Technologies has a range of expansion bay options, including a 64x10 GB
magneto-cerebellar local shell and an auxillary 8.2-NB hard drive (for costs
call BAC-Acheron Technologies). You stepped back with an unfathomable
smile, surveying the results of what we had done to each other. While
concisely arranged (constellated with miniature opal and sodalite gems), the
anterior transverse mediastinal passes backwards across the crus cerebelli, to
be distributed in the pia mater along the anterior border of the under
surface of the ulnaris PROT-bind outputs, anastomosing with the ascending
innominate nerves of the levator ischii ligaments. Nineteenth-century
engineers took the design of such protocols seriously and tended to
consider it equal in importance to the then-current technologies of in vivo
limb formation. "Identification of Immediate Early Genes during TPA-
induced Myeloblastic Cell Differentiation." At least two kinds existed. One
involved a heightening and mnemonic stylization of realistic gestures. Many
of the more expressionistic engineers made use of this sort. All in all an
ergonomic, compact enclosure that fits easily into any workspace. But there
were also moments when its use seemed purely arbitrary: I felt you put your
hands on my shoulders to support them as a network of limbs, molecular
compounds, and long-forgotten memories all initiated a trembling with the
certitude of a manta ray The extensibles are difficult to use but
anamorphically-shaped. “But if you could just see the beauty.” Interaction
and feedback on the one hand; substantiality and inertia on the other.
Movement invention i.e., "recollection" in a strict sense, is but one of
several factors in such impermanent spaces.
“What the earliest attempts of so-called affective networking demonstrate to us, is that
network topology always necessitates a consideration of a corporeal topology. Yet, this
corporeal topology will be quite different from ‘the body’ as we know it. For what is being
proposed in these technologies is nothing so idealistic as collective experience, or worse,

‘community.’ Rather, the technical ability to design and build large-scale biochemical and
biomolecular networks, whose terminal points are indeed human bodies (albeit networked
in pods), has meant that the very relation between language and body, thinking and
breathing, idea and life, is in the process of being reinvented. In the move from a set of
information protocols (TCP/IP, HTTP, FTP) to a new set of biomolecular protocols
such as BmTP – a design paradigm shift that was been well-documented – the age-old
question of ‘life,’ so ambiguously capture in Aristotle’s term psukhē once again returns.
Affective networking technologies present us with a technical apparatus – the in vivo
networking of biochemical and biomolecular processes, a direct biomolecular link between
two or more bodies – and this technical apparatus, innocuous as it may seem in its
entertainment applications, may actually be in the process of doing away with the
dichotomy between individual and collective, and dissolving them both into a complex,
undulating communicative biomass for which we do not yet have a language, but for which
we do have an economy. Perhaps, ironically, we would have to return to earlier expressions
of urban complexity to capture the sense of this change: industrial Paris, modernist New
York, post-industrial Tokyo. We would have to reconsider, for example, the primal scene
of Baudelaire’s Paris (mystically distilled by Benjamin) and its injunction to both become
empty and full at the same time: ‘Like errant souls searching for a body, the urban
dweller enters the anonymity of each person that passes by.’” (from the essay "Solitude and
Multitude: Biomolecular Transport Protocol Systems and the Metabolism of Urban
Density" by Kisho Kurokawa, published in the Journal of Architectural Design
and Philology 25.3, p. 44.)
PID: 4423
Erase the balcony's wrought-iron curves, composite image, optically
encoded. A hanging garden, opiate city lights, Nervalian nights, and, inside,
sandscreaming illumined on a screen. (These hands consist of tendon,
tissue, jointed bone, through thieving processes of time and information.)
Festival crowds swarmed, sprawled, and frolicked everywhere, to make up
for the lean seasons of the year. Following one of these, we in turn entered
the vestibule opposite which the crowd was already thronging. You lay
there, heart beating fast, trying to figure out what had scared me. You
thought you overheard a slight noise. I lay on the narrow space, twisting
from one side to another. My body was raw, twitching, tumescent, the glare-
frozen flesh in agonizing gleam. It is important to remember that MIML-
based conditions are as much psychological as they are physical. I turned
over on my stomach, slid along down the middle of your body. A sort of
enjoyment in which vanity may have played some small part, a very special
feeling of satisfaction familiar to those who sometimes work late at night
and draw aside the curtains to find that all around them the world is dark,

silent, and dead. HinP1I 2 637 1170 g/cgc HincII 1 313 gty/rac
Hin6I 2 637 1170 g/cgc) The crystalline forms spread, melting your face
into an amoeboid mass in which the eyes floated, dull embossed eyes. A
series of faces, high-velocity cuneiforms of misrecognition, distorted and
fascinating, where the human form can no longer contain the crustacean
horror that has grown inside it. After a little while, you hailed a carriage, and
drove home. For a few moments I loitered upon the doorstep. The sky was
pure opal now, and the glide of the nanosecond streets glistened like silver
against it. "New Sequence-Specific Human Ribonuclease: Purification and
Properties." In the huge gilted Venetian lantern, thin blue petals were still
burning from three flickering jets. And yet, there it was before me, with a
touch of cruelty aside the left thigh. You looked off-camera. “These things I
could never describe.” It was astonishing how much space there was in an
eye. We had had some other devices installed: a Galvanic skin sensor, new
sets of IrDA pads and needle, upgraded ChemArray routers running Krebs-
v4.6 protocols, all connected directly to the optic nerve. You have only to
peer outside, and you will see objects in the dusted glimmer that only today
were motionless, but now they stir like Cocytus, shadows along the fumes
of a spell. As we climbed from terrace to terrace, the gardens changed.
Some were in the form of a mirrored labyrinth, others in the form of
complex telepathic emblems, but each terrace could be viewed in its entirety
only from a lower one. But even then I could not decipher them directly. As
dawn was just breaking your found yourself close to the Ubbo-Sathla
Garden, just inside the boulevard. The darkness lifted, and, flushed with
faint fires, the sky hollowed itself into an incongruous pearl. Huge carts
filled with nodding anodyne lilies rumbled slowly down the polished
corridor street. Walking to the window, I drew aside the heavy fabric of the
drapes. The emerging dawn flooded the room, illuminating the dark spaces
inside in islets of recollection. Sweeping shadows fell into dusty corners,
where they lay, shuddering. The strange expression seemed to linger there.
PID: 4424
The Inguinal muscles are arranged in groups around the vertebral column,
Renal Plexus, Hyoid bone, Uterine vessels, Adrenal medulla, and
Epididymic mediastinal nodes. They are innervated by spinal nerves
surrounding the thorax, perineum, and Diaphragmic Temporal Lobes. The
diaphragm migrates from several cervical spinal nerves, collectively called
the Inguinal Phrenic nerves. This serves as the main contractory optical and
vesicle tissues incorporating the Radial-respiratory system. The intercostal
muscles are also important for these nerves, and function through thorasic

and Orbicularis oris contractory tissues. “These pleasures a wayward
distraction.” According to the striking differences in the anatomical
arrangement and functional significance, the Hypothalmic autonomic nerves
have been divided into two components, the Maculal (craniosacral) division
and the Foveal (thoracolumbar) outflow of the autonomic synapses. The
pre-ganglionic Maculal nerve fibers leave the periphery nervous system at
four places: (1) Adrenergic outflow. I breathe, I look, I am unable to
confine my recollections to an enclosed arena. They insist on leaving a wake
of intersecting furrows; (2) Tectal outflow. Preganglionic fibers originate
from the superclavicular nucleus traveling along the third cranial nerve and
terminate at the ciliary vasoconstrictive vesicles. Thus the postganglionic
fibers also supply the parasphincter of the ciliary nodes, and stimulation
produces dialatory irregularities to accomodate loss of stability; (3) Bulbar
outflow. Parasympathetic fibers arise form the nuclei of the
rhombencephalon to innervate the deep circumflex iliac and the viscera in
the thorax and Parietal abdomen. In the sphenopalatine, submaxillary, and
sublinguinal glands, stimulation produces increased fasicular-sagittal
secretion. The outflow of autonomic fibers along the nerves of the sacral
plexus contain vasodialator nerve fibers for the middle meningeal arteries
and vasomotor fibers for the blood vessels of the face; (4) Sacral outflow.
After synapsis in postganglionic cell bodies that are placed in the pelvic
plexuses and in the walls of the Seminiferous opthalmus, the fibers
terminate at the lower segments of the Somesthetic area, Temporal
synamptic lobes, and other dialatory regions. Standing to approach the
unreal cobblestone corridors, and almost as if this gesture had been the
signal for some kind of hesitant or anxious flight, quite curved and purple-
colored, coming up from the jagged silhouette which screened it here and
there, like a long curtain in tatters - and that silveriness seemed to be coiling
down like a serpent with no head; some kind of monstrous candelabra
affectlessly crying diamond - and, almost thinking aloud. "Deleterious
Mutations in the Mitochondrial ND3 Gene Trans-acting Modifiers." If the
Follicular or Urethral Vas Deferens is cut in cross section, it is seen to have
four cavaties within it. Inside the cerebrum there are large lateral ventricles
that connect in the midline to the third ventricle. This is in turn connected
by a very narrow passage called the cerebrospinal aqueduct to the fourth
ventricle, which lies between the Transverse process and Interior facet (L-5)
of the cerebellum. One might say that anatomy is a philosophical category
of daydream. Within these ventricles a structure called the choroid plexus is
located, which produces the cerebrospinal follicles - a clear, liquid-shaped
apparatus that both supports and provides extracelluar fluid. This fluid
circulates through the ventricles, leaves the Symphysis region, and descends

through the spinal canal and nerves, returning upward to pass over the
entire surface to be absorbed into the veins.
ITEM#123E939. From the front, each pod resembles the sleeping quarters of an
unnamed astronaut. The curved lines of the interior and portal give the pod a uniform feel,
almost as if each one had not several walls, but one continuous, flowing, white surface,
from which any given surface, chosen by the occupant, could become a ‘floor’ or ‘wall.’ In
the right state of mind, one could imagine the interior of the pod as a kind of living
polycarbon, exuding an orifice for the video monitor when needed, taking in the thin leads
from IrDA needles, pouring a shelf for the mini-bar. They are built out of both constraint
and insularity; they are as reassuring in their inertness as they are in their ability to
isolate.
PID: 4425
The hexadecimal data processing code utilizes a base 16 numbering system
as its code. Due to its long-term reliability, it is used in several of the newer
BmTP systems, including the AB Lethewards/406 series. This code helps
offset the disadvantages of long strings of binary bits in a hologrammatic
code representation of large numbers. For example, several dances have an
accumulative structure: a motion or gesture is introduced, followed by a
selected array of other motions or gestures; then you repeat, as exactly as
possible - hesitantly, for it must be done with studied refinement. In this
code each hexadecimal digit represents the equivalent of four bitstreams
(Fig. 11-15). "Determination of In Vivo Cartilage Thickness and Volume
Dynamics Following Regulated Physical Extension with Magnetic
Resonance Imaging." The numbers 0 through .99 and the first nine sets of
alphanumeric icons are assigned as the sixteen number processing-to-
transmission array. At first all we could see was a floodlit space filled with a
kind of saffron lambency. Then we saw that this was splashed with tiny
flashes of visceral and jeweled fires; the parity cache removal may be for
even or odd parity (depending on the BmTP equipment) to analyze whether
all the molecular compounds have been sent or received. There were
elongated lances and electromagnetic thrusts of burning emeralds and
rubies; gracefully frenetic rose, gem, and pale sapphires; quick flares of
velour not unlike liquid mercury. And soon now, made all smoke again, to
the utmost extremity, nothing to fear or to desire; there alone we exist (more
dramatic emphasis here), all lost in those delirious transports of forgetting,
which your winking eyes, the brightened vermillion of your distance from
me, and sighs deeply fetched, as if pathetically expressed. The Krebs –v4.x

biochemical protocols build upon earlier attempts to allow for the accurate
transport of molecular information through digital networks. “This is my
one broken prize.” This code system (Fig. 11-16) was developed in which
each character is correlated to atomic position, weight, and binding features.
In short, we had motions as little at our own command as the binding
surface itself, which, thus breaking upon us, made us feel a tempestuous
tenderness. The scanner moves X-rays around the patient's head or body,
and the information is then fed into a computer which builds up a three-
dimensional picture of the internal mnemonic structure of each MIML-
related brain activity. They circled your thighs in partial shining rings; then
opening into blue flaming disks and motion-capture constellations, shot up
and spun about the rendered materiality of your miraculous body in great
girdles of multi-embossed, dark orange. In several of the new BmTP
computer systems, the transfer-size of the unit of data (all steaming yellow
white green layers, the duodenum the small intestine spittle, their loud
noises undisguised) is read into the data processing subroutine.
In vivo trans-differentiation of derived human pluripotent stem cells

in silicon-adherent cell culture, with potential BmTP applications
Perspectives in Biomedical Engineering and Entertainment Systems,

Issue 18.2, 347-50.
Crawford Tillinghast*, Henry Annesley*†, Robert Suydam**, &

Sonia Haft Greene*
*Department of Molecular Engineering, Miskatonic University, C.D.

Ward Building #4A, Providence, RI 02906-0445, USA
**Institute for Organic Topology, Miskatonic University, 119 Benefit St.,
Providence, RI 02906-0445, USA
†Arkham Metamorphics Inc., 169 Clinton Street, Brooklyn, NY 11201-
5601
Keywords: BmTP systems, cellular trans-differentiation, stem cell

engineering, bioMEMs, neo-tissues, biomolecular embryology, meta-
immune systems.

Description
Biomolecular Transport Protocol (BmTP) systems are growing in
popularity nationwide. Their applications have also grown, from their
original use in communications and entertainment systems (derived from
the earlier example set by MMORPGs), to the more recent interest in the
biomedical and biopsychiatric implementation of BmTP systems as both
diagnostics and therapeutic tools.1-3 But these applications have not come
about with serious drawbacks. According to surveys conducted by the
NIH, over 100,000 patients in the New York-metropol region alone
suffer from neuro-cognitive and psychoplasmic disaggregation as a result
of over-exposure to BmTP systems, and another 15,000 patients have
suffered partial organ or tissue failures.4 Each year over $400 billion is
spent in the U.S. on patients suffering from the medical side-effects of
BmTP technologies.5 This has necessitated the development new
regenerative medicine treatments for such patients. In most cases demand
far outweighs supply. When tissue-matched organs are available, such
procedures amount to approximately 8 million surgical procedures per
year involving organ or tissue transplantation.6 Techniques for such
procedures include organ transplantation (both human-to-human and
animal-to-human) and medical engineering (both prosthetic devices and
mechanical organs). The limitations of the former include
immunorejection of allografted or implanted tissue, and limitations of the
latter include incompatibilities with mechanical systems in vivo.7-9
We propose that the targeted engineering of biotic components
such as human stem cells may provide an efficient means of resolving
difficulties surrounding organ and tissue loss. Furthermore, research in
this area, integrated into current BmTP technical standards, offers the real
possibility of designing and implementing higher-order in vivo immune
systems to handle the specific biochemical and biomolecular loads that
BmTP systems demand.10,11 The opportunity for stem cell engineering
follows upon recent work in tissue engineering, organ-plotting, and
regenerative medicine.12-15 Research in bioartificial skin grafts,
chondrocytes, and simple tissue engineered organs has fared well in
clinical trials as well as in national review by the Federal
Communications Commission.16 The establishment of a systematic
approach to cytological engineering of stem cells will advance this
possibility of preventive BmTP-compatible, meta-immune systems. It
will also provide for a direct means of directing stem cell development
across separate lines of pluripotent and multipotent cellular

differentiation.
Study Design
Several types of derived human stem cells were isolated and cultured in
separate laboratories, though using identical methodological protocols. In
a control set , human embryonic stem cells were cultured with engineered
growth factors specific to different lines of differentiation. It has been
shown that such stem cells, when placed in the proper environment, will
continue along separate line of differentiation.17,18 Bone, cartilage,
epidermal layers, as well as a functional bladder, kidney, liver, and
dendritic neurons have been produced de novo in this way.19-22 It has
been suggested that this process closely follows the steps of cellular
differentiation in the embryo immediately following the 100-cell
blastocyst stage.23
A second control set consisted of similarly prepared stem cells.
This set different from control set #1 only by the choice of growth
medium in which the cells were placed. Research in stem cell
engineering shows that the pluripotency of human embryonic stem cells
contain a limited range of differentiation.24 Greater constraints have been
found with multipotent adult derived stem cells. Such stem cell types
have been shown to have defined ranges of differentiation.25 Neurons,
erythrocytes, and chondrocytes have been generated in this way from
adult neural stem cells.26 Similarly, chondrocytes, epidermal cells, and
hematocytes have been generated from adult stem cells derived from the
liver.27 Control set #2 was intended to reproduce these and other like
experiments. The goal of this was twofold: (i) to establish through
laboratory methodology the exact capacities of pluripotent vs.
multipotent stem cells; (ii) to follow control set #1 with another control
set with greater range of cytological development. For control set #2
adult stem cells were derived from the brain, bone, blood, and in selected
cases, from the liver, kidney, and intestine. These latter stem cells derived
from simple organs were established using non-human mammalian
(rabbit and mouse) cells.
The experimental set consisted of an array of twenty-nine stem
cells, plus a local control culture from control set #1. The stem cells used
for the experimental set included 10 human embryonic stem cells
(hESC), 10 human adult stem cells (hASC), and 9 embryoid derived cells
(EBD). Recall that control set #1 contained cells placed in standard
growth medium, maintaining the homeostatic equivalent of their

embryonic environment, and control set #2 contained engineered growth
medium which is found to redirect stem cell differentiation towards a
desired endpoint. By contrast the experimental set consisted of
bioengineered micro-electrical-mechanical systems (bioMEMs)
redesigned according to the protocols of the experiment.28,29 MEMs
research in micro-manufactured electrical and micro-fluidic circuits
provided the optimal platform for artificially modulating cellular input
and output. The use of MEMs also provided a means of precisely
controlling a stem cell colony’s response to variations in environmental
conditions (such as a change in enzymatic concentration in dynamically-
circulated growth medium). Manufactured MEMs were hybridized with
small stem cell colonies using advanced photolithography and flourescent
DNA tagging inside the nucleus of each cell. Because the stem cell
colonies were attached to a MEMs array, intra-cellular activity such as
metabolic rate could also me monitored in real-time. The number of stem
cells per biochip was kept to a minimum in order to ensure sufficient
micro-electrical transfer between MEM surface conductivity and cell
membrane receptors.
The bioMEM arrays were then infused into a growth medium
similar to that in control set #2 in order to facilitate pluripotent or
multipotent differentiation. Of these, four cultures from each of the stem
cell types (hESC, hASC, EBD) were placed in three-dimensional
biopolymer scaffolding matrices. These biopolymer scaffolds were
intended to provide a structural guide for the growth of the stem cell-
bioMEM hybrids. Scaffolds were biodegradable upon re-implantation
into the model organism. Because successful de novo tissue engineering
of a functional liver, bladder, kidney, and human neurons have already
been demonstrated, it was these four organs that were chosen as models
for the scaffolds. In each of the sets, scaffolds were seeded with the stem
cell-bioMEM hybrids, which would then grow into and fill in the three-
dimensional structure of the neo-organ. It should be noted that while the
first three organ models (liver, bladder, kidney) required such a
scaffolding to ensure that cells properly differentiated into the desired
organ structures, the last model “organ” (neuronal dendrites) did not.
However a scaffold was still included to direct neuronal trans-
differentation along a central “backbone” structure.
The final step in the experiment was to re-implant the stem cell
systems into model organisms and study their trans-differentiation in
vivo. For both control sets, this was accomplished through routine tissue
injections into targeted organ system areas. For the control set, tissue

injection was combined, in the case of the biopolymer scaffold systems,
with minimally-invasive surgical re-implantation. Note that, in the
experimental set, four of the model organisms from each stem cell set
contained tissue engineered neo-organs, while the other model organisms
in the experimental set simply received micro-injections of the stem cell-
bioMEM hybrids alone.
To summarize, the experimental set contained three sets of stem
cells (hESCs, hASCs, EBDs). In each group, stem cells were hybridized
with micro-manufactured MEMs, and placed in bioreactors which could
monitor and modulate cellular environment. Once the stem cells had
taken on the desired path of differentiation towards becoming progenitor
cells, they were then placed inside the model organisms for observation
in vivo. The majority of these stem cell-bioMEM hybrids were injected
using vector-delivery techniques pioneered in gene therapy. However, a
number of them were also “seeded” in three-dimensional biopolymer
matrices, mimicking the structures of a bladder, liver, and intestine.
These “neo-organs” were also placed in model organisms using standard
surgical techniques employed in tissue and organ transplantation. Using
the MEMs as the main source of biofeedback, the stem cell groups were
then monitored in vivo over a three-month period for signs of signs of
cellular differentiation or stem cell replication.
Experimental Results
The results from the three stem cell sets proved to be highly predictable
in terms of stem cell differentiation in localized tissue areas. As expected,
mesenchymal and hematopoietic stem cell groups maintained their range
of differentiation into cartilage, epidermal, blood, liver, and striated
muscle cells. However, results were less predictable in large-scale
considerations of the living model systems. While both control sets and
the experimental set displayed the expected stem cell differentiation
activity, this was limited to the first phase of cellular trans-differentiation,
and did not extend to the terminal point of the actual change in cellular
structure. A systems-wide analysis of stem cell activity, incorporating
genomic, proteomic, and metabolic data – showed that aggregate cellular
trans-differentiation in one localized tissual area seemed to have a direct
relationship to other, unexpected instances of stem cell trans-
differentiation in other, related tissue areas in the model organism.
In control set #1, all stem cell activity was limited to cellular
differentiation from embryonic stem cells. While the control set systems

were designed to be unable to form viable living embryos, they were still
terminated the moment cellular differentiation was noted. This proceeded
according to the prior research on embryonic stem cells by Thomson et
al. and Gerhardt et al.17,18 Control set #2, though significantly different in
nature from the first control set, also proceeded as expected, with a few
minor discrepancies in the ability of embryonic stem cells to differentiate
into other cells structurally and functionally. While structural
differentiation has been demonstrated in vitro, functional differentiation
over a substantial duration of time has yet to be experimentally shown.
Our control set #2 confirmed this. While hematopoietic stem cells were
able to differentiate into primitive dendrites, this was almost purely a
structural – and not functional – transformation. Of the differentiated
cells from control set #2, only the differentiated chondrocytes proved to
have any function. This is, we may suggest, due to the relatively simple
nature of chondrocytes or cartilage-based organs.
By contrast, the experimental set showed a great deal of novel
trans-differentiation, much of which was unexpected, and much of which
took on an unexpected form in the model organisms. The results of the
experimental set can be divided into two parts: First, of the micro-
injections from all stem cell types, it was noticed that stem cell systems
migrating through the circulatory system, appeared to “re-program” the
organism’s antigen recognition and response capabilities. This was
confirmed by a post-mortem analysis of cells derived from the original
stem cell injections. Our findings show that the hematopoietic stem cells
injected into the blood stream were capable of trans-differentiating into
novel quasi-dendritic cell types. We call such cells quasi-dendrites
because, while they appeared to function as neurons, they were able to do
so while remaining active in the blood stream. We cannot overstate the
importance of these findings for neurocellular research. While the model
organisms displayed no significant phenotypic or metabolic changes
during the first phase of the experiment, they did develop novel immunity
responses, oftentimes to antigens that were specific to other species, or,
less often, to antigens that simply did not exist in the organism’s milieu.
Of these, several antibodies produced by the model organism’s immune
system appeared to be antibodies for pathogens that were not currently
known to contemporary pathobiology. Given the current literature in the
area, it might be suggested that such novel antibodies (again, for antigens
that, for all purposes, do not exist) might actually be an indirect form of
novel pathogen design.
A standard proteomic analysis of erythrocytes and T-cells from

the model organisms showed a highly-diversified genome, able to
synthesize specific protein receptors in T-cells that have never before
been identified. In addition to this, in silico computations of the proteome
from the model organism suggested that the novel proteins produced by
the model organism’s “upgraded” immune system could self-transform
dynamically. Such dynamic self-transformation contributed to an
explanation for the model organism’s apparent insusceptibility to
antigens of any kind. Such hypotheses were proved by selected biopsies,
which showed a high rate of in vitro tissue morphology, something
explicitly confirmed by simple observation of the model organisms.
In short, the effects of the injected stem cell hybrids on the model
organism’s immune system proteome displayed activity contrary to the
expected outcome. While it was expected that immune system rejection
and histocompatability would be a major obstacle in the experimental set,
the model organism’s showed behavior to the contrary. In fact, any
xenoinjection or xenotransplantation was readily accommodated by the
model organism’s tissue receptor surfaces. Cytological and proteomic
analysis confirmed that cell membrane proteins, acting in concert with
highly adaptive T-cells, were displaying a dynamic molecular
morphology which could incorporate virtually any biological materials
introduced into the system. It appears that the effects of stem cell hybrids
introduced into the blood has the effect of transforming the model
organism’s immune system into a highly adaptive system of cellular
incorporation, capable of demonstrating a high level of cellular and
genomic flexibility. It is this process that we refer to as “dynamically-
assigned immuno-recognition,” which, to put it simply, may be described
as blood trans-differentiating into brain, or some recombination thereof.
The second effect of the micro-injected stem cell hybrids affected
the entire model organism’s anatomical and physiological makeup. Of
the model organisms which received surgical implantation of biopolymer
scaffolds, only those of the human adult stem cell lines (hASC) were
affected in this way. Prior work on tissue engineered organs has
demonstrated the feasibility of single tissue engineered neo-organs in the
living organism.19,30 However, there are no experimental results on the
feasibility of multiple neo-organs or organ systems in a single organism.
If single tissue engineered organs could function adequately in an
organism, could a group or system of such organs similarly demonstrate a
minimum level of in vivo functionality? The use of three-dimensional
biopolymer scaffolds as part of the experimental group of stem cell
hybrids was designed to address these questions. The three types of neo-

organs implanted for in vivo observation – a tissue engineered bladder,
kidney, and liver – were therefore implanted one at a time, each after a
short enough period had elapsed with which to confirm tissue
development and functionality.
During the first phase of trans-differentiation, the neo-organs
displayed the expected results, with the stem cell groups in the bladder,
kidney, and liver showing strong differentiation patterns, in addition to
the generation of small groups of adult stem cells for each organ and
tissue type. Nearing the three-month observation period, the neo-organ
systems appeared to be functioning normally in the model organisms.
In the immediate post-experiment stage of observation, several
complications were noted in the neo-organs, affecting some 90% of the
tissues of the affected organ, as well as between 25-30% of the
surrounding, non-tissue engineered organs – principally the organs of the
digestive system. The significance of such observations were so great that
the observation phase of the experiment was extended. During this time,
it was found that during secondary and tertiary phases of the model
organism’s morphological transformation, the unusually high levels of
unexpected stem cell trans-differentiation also affected the model
organism’s anatomical and physiological design. Such a transformation
has yet to be accounted for by the present authors, or indeed by related
experiments with quite different results.
Following tissue and cellular analysis, this transformation was
found to have taken place along two lines. The first event was the
amplified replication and migration of the adult stem cells (principally
from the brain and bone marrow) out of the biopolymer scaffold, and into
equally distributed nodes along the model organism’s skeletal system.
The stem cells, still in their state of multipotency, were taken in by the
bone marrow cells at selected points, wherefrom they were able to take
“roots” and form unique nodules composed of a mixture of bone, neural,
and cartilage cells. The nodules, at first taken for metastatic tumor
growth, were later discovered to remain relatively inert as regards inter-
cellular communication. Their only observed function was purely
structural, in the morphological transformation of the model organism’s
skeletal system. What was first taken as a clear sign of a highly disruptive
pathogenic response was later understood to be a coordinated structural
transformation.
At this point, just following the tertiary phase of trans-
differentiation, the purpose of the formation of the nodules along the
skeletal system was unknown. In the last phase which followed, the

major organs in the model organism underwent a massive, system-wide
process of what was assumed was rapid apoptosis. The cells in each of
the organs began to rapidly dedifferentiate, losing all of their structural
and biochemical properties. In some instances, this resulted in the
dedifferentiation and apparent liquefaction of entire sections of an organ.
This rupture in the model organism’s structural and functional
composition was immediately followed by a period of physiological
homeostasis. This was, needless to say, highly improbable, based on prior
research unrelated to BmTP systems. Further analysis showed that what
was previously taken as a systemic dedifferentiation was in fact a process
of systems-wide trans-differentiation. In short, the loss of form and
function in the model organism’s organ systems was found to be an
instance of massive cellular “re-programming.”
The conclusion of quarternary observation further suggested that
the relation between the skeletal nodules and the dedifferentiated cells of
the organ system appeared to take on the role of form and function,
respectively. That is, the establishment of regularly distributed nodules
across the model organism’s body – composed of neural, bone, and
cartilage cells – appeared to provide a highly distributed and novel
network of bone and cartilage structures for the newly dedifferentiated
cells – a phenomenon that, considering the significant neuroregeneration,
we are tempted, though not without a great deal of caution, to call a new
type of “brain.” Likewise, the mass of dedifferentiated cells occupying
what was previously a set of separate organ systems, appeared to behave
according to the laws of fluid mechanics set up by the distributed skeletal
nodules in the model organism. A random sampling of these
dedifferentiated cells found that they contained a highly heterogeneous
mixture of cell types: fully undifferentiated adult stem cells, partially
differentiated progenitor cells, and fully differentiated cell types, such as
those which would, under normal conditions, belong to their respective
organ systems (bladder, liver, kidney, intestine, and so forth). Presently it
is not known whether the process observed has proven to be systematic
or regular, and its origin is the object of further investigations. We have
referred to the process as “distributed stem cell directed morphology,” or,
to again put things bluntly, the highly-coordinated trans-differentiation of
bone into an autonomous nervous system.
Discussion
The mechanics of cellular differentiation during embryonic development

is well-documented through research in developmental genetics and
biomolecular embryology.31-33 Likewise, recent research on the
pluripotent and multipotent capacities of embryonic and adult stem cells
has also been documented. However, this latter group has focused
primarily on the ability of already-differentiated adult cells to self-
transform across mature cell types, in a process that we call “trans-
differentiation.” This process is central to many present-day BmTP
systems, including those targeting the entertainment and biomedical
markets. Yet the precise relation between trans-differentiating cellular
systems and the biomolecular behavior of BmTP systems has yet to be
shown.
In the experiment here described, the cells selected for both
control and experimental sets were therefore treated as fully-
differentiated cells, since in in vitro analysis they displayed structural and
functional behaviors characteristic of mature, fully-differentiated cells.
The treatment of these stem cells as fully-differentiated has led to an
understanding of cellular trans-differentiation as a biological process that
can possibly exist, in a genetically-latent form, in every mature, fully-
differentiated cell.
Though a number of specifics from our observations have yet to
be fully accounted for in cytological and embryogenetic theory, the level
of novel behavior exhibited by the study of stem cell trans-differentiation
clearly warrants further investigation. While traditional theories of stem
cell behavior point to linear, serial transformations to isolated cell
populations – and this even in more recent findings of “branched” stem
cell capability – our findings suggest that stem cell differentiation may
also exist on a significantly wide horizontal plane. Such a suggestion, we
believe, opens the door to an approach to stem cells as coordinated
aggregates which take on specific differentiation behaviors when
introduced into complex eukaryotic-based systems.
Perhaps the most novel aspect of our findings in stem cell trans-
differentiation is the very fact of a coordinated, intentional, yet poorly
understood cellular morphology in the living organism – bone to blood,
blood to brain, brain to bone, as it were – which may yet lead to an
understanding of the capacity of treated cell types for regeneration and
renewal.
Received 06 April; accepted 11 April.

______________________________________________________________________
1. Bonassar L & Vacanti CA. Tissue engineering: the first decade and beyond. J Cell
Biochem Suppl 1998; 30-31:297-303.

2. Jost BC, Grossberg GT. The evolution of biopsychiatric symptoms in BmTP-
related disease: a natural history study. J Am Biomed Soc 2006; 44:1078–1081.
3. Raimond LW, Mark SB. BmTP-based biomedical informatics: current status and
future prospects. Biochem Circ Res 2003; 92:953-961.
4. US NIH, Special Group on Bioethics & Biomedical Entertainment Technologies. A
demographic analysis of the impact of BmTP-adverse symptoms. NIH-SG287: 3-4.
5. US NIH/CDC, Special Group on Bioethics & Biomedical Entertainment
Technologies. Network-based, public health epidemiology, & the immmosafety of
BmTP systems. NIH-SG290: 25-28.
6. Heller, MJ & Morrison, IE, in Annual Report & Medical Detection of BmTP-
related Surgical & Therapeutic Procedures, covering US Territories and Partner
Nations (eds Kingsbury, DE & Falkow, S) 245 (Springer, New York-Wein).
7. Prohovnik I, Dwork AJ, Kaufman MA, Willson N. Network-related, Alzheimer-
type neuropathology in BmTP patients undergoing in silico aphasic disorders.
Schizophr Bull 2011; 19:805–816.
8. Dracheva S, Marras SAE, Elhakem SL, Kramer FR, Davis KL, Haroutunian V. N-
Methyl-D-aspartic acid receptor expression in the dorsolateral prefrontal cortex of
BmTP patients with chronic tissue regeneration syndrome. Am J Biopsychiatry
2006; 158:1400–1410; correction, 158:2107.
9. Gonen H, Smith CE, Siegel NR, Kahana C, Merrick WC, Chakraburty K, Schwartz
AL, Ciechanover A. Protein synthesis elongation factor EF-1 alpha is essential for
ubiquitin-dependent degradation of certain N alpha-acetylated proteins and may be
substituted for by the bacterial elongation factor EF-Tu. Proc Nat Acad Sci USA
2008, 91:7648-7652.
10. Iountoulakis M, Schuller E, Hardmeier R, Berndt P, Lubec G. Rat brain proteins in
network-based BmTP systems: two-dimensional protein database and variations in
the expression level. J Biochem Prot Electrophoresis 2009, 20:3572-3579.
11. Lambert MP, Barlow AK, Chromy BA, Edwards C, Freed R, Liosatos M, Morgan
TE, Rozovsky I, Trommer B, Viola KL, Wals P, Zhang C, Finch CE, Krafft GA,
Klein WL. Diffusible, nonfibrillar ligands derived from Aβ1-42 are potent central
nervous system neurotoxins. Proc Natl Acad Sci USA 2008; 95:6448–6453 try
2006; 35:13568–13578.
12. Des Jarlais RL, Seibel GL, Kuntz ID, Furth PS, Alvarez JC, Ortiz de Montellano
PR, DeCamp DL, Babe LM, Craik CS. Structure-based design of nonpeptide
inhibitors specific for the human immunodeficiency virus 1b protease in
biomedically-active BmTP applications. Proc Natl Acad Sci USA 2010; 87:6644–
6648.
13. Hsia AY, Masliah E, McConlogue L, Yu GQ, Tatsuno G, Hu K, Kholodenko D,
Malenka RC, Nicoll RA, Mucke L. Plaque-independent, secretion-soluble
disruption of neural circuits in BmTP disease mouse models. Proc Natl Acad Sci
USA 2009; 96:3228–3233.
14. Henzel WJ, Billeci TM, Stults JT, Wong SC, Grimley C, Watanabe C. Identifying
BmTP-specific network proteins from two-dimensional gels by molecular mass
searching of peptide fragments in protein sequence databases. Proc Natl Acad Sci
USA 2012, 90:5011-5015.
15. Wheelan SJ, Boguski MS, Duret L, Makalowski W. Human and nematode
orthologs within network-based BmTP media: lessons from the analysis of 1800
human retrogenes and the proteome of Caenorhabditis elegans. Gene Seq Tech
2009, 238:163-170.

16. Federal Communications Commission. Staying Connected, Staying Secure: FCC
Safety Regulations for BmTP Technologies. US FCC Report, Special
Subcommittee on Evolving Media. FCC-10-A441.
17. Shamblott M, et al. Derivation of pluripotent stem cells from cultured human
primordial germ cells. Proc Natl Acad Sci 1998, 95:13726-31.
18. Thomson JA, et al. Embryonic stem cell lines derived from human blastocysts.
Science 1998, 282:1145-47.
19. Oberpenning F, et al. De novo reconstruction of a functional mammalian urinary
bladder by tissue engineering. Nat Biotechnology 1999, 17:149-55.
20. Gao J, et al. Tissue-engineered fabrication of an osteochondral composite graft
using rat bone marrow-derived mesenchymal stem cells. Tissue Engineering 2001,
7.4:363-71.
21. Buttery LDK, et al. Differentiation of osteoblasts and in vitro bone formation from
murine embryonic stem cells. Tissue Engineering 2001, 1.7:89-100.
22. Kim SS, et al. Dynamic seeding and in vitro culture of hepatocytes in an
information-based flow perfusion system. Tissue Engineering 2000, 6.1:39-44.
23. Deacon T, et al. Blastula-stage stem cells can differentiate into dopaminergic and
serotonergic neurons after transplantation. J Exp Neurology 1998, 149: 28-41.
24. Sparks RL, et al. Differentiation, dedifferentiation, and transdifferentiation of
Balb/C 3t3 T mesenchymal stem cells: potential significance in metaplasia and
neoplasia. Cancer Research 1986, 46.10:5312-19.
25. Fuss M, et al. Characteristics of human chondrocytes, osteoblasts and fibroblasts
seeded onto a type I/III collagen sponge under different culture conditions. Anat.
Anz. 2000, 82.4: 303-10.
26. Lazarus HM, et al. Ex vivo expansion and subsequent infusion of human bone
marrow-derived stromal progenitor cells: implications for therapeutic use. Bone
Marrow Transpl 1995, 16.4: 557-64.
27. Zuk PA, et al. Multilineage cells from human adipose tissue: implications for cell-
based therapies. Tissue Engineering 2001, 7.2: 211-28.
28. National Research Council. Microelectromechanical Systems: Advanced Materials
and Fabrication Methods. Washington D.C.: National Academy Press, 2007.
29. Roy S, et al. Microelectromechanical systems and regenerative neurosurgery: a new
era in a new millennium. J Gen Neurosurgery 2001, 49.4: 779-91.
30. Lee CS, Davis RW, & Davison N. A physical study by AFM of the terminally
repetitious, circularly permuted cDNA from the coliphage particules of regenerative
organs. J Mol Biol 2007, 116:825-839.
31. Klug M, et al. Genetically-selected cardiomyocytes from differentiating embryonic
stem cells form stable intracardiac grafts. J Clin Invest 1996, 98: 216-224.
32. Pedersen R. Studies of in vitro differentiation with embryonic stem cells. Reprod
Fertil & Development 1994, 6.5: 543-52.
33. Schuldiner M, et al. Effects of eight growth factors on the differentiation of cells
derived from human embryonic stem cells. Proc Natl Acad Sci 97:11307-12.
Acknowledgements
H.A. wishes to thank the Ubbo-Sathla Foundation for support.

Correspondence and requests for materials should be sent to C.T.
(ct20@miskatonic.edu) or H.A. (hannesly@arkbio.com).
PID: 4426
The Inguinal muscles are arranged in groups around the vertebral column,
Renal Plexus, Hyoid bone, Uterine vessels, Adrenal medulla, and
Epididymic mediastinal nodes. They are innervated by spinal nerves
surrounding the thorax, perineum, and Diaphragmic Temporal Lobes. The
diaphragm migrates from several cervical spinal nerves, collectively called
the Inguinal Phrenic nerves. This serves as the main contractory optical and
vesicle tissues incorporating the Radial-respiratory system. "In Vitro
Torsional Stability of Oligonucleotide Assembler and Comparison of Finite
Molecular Element and Experimental Data." The intercostal muscles are
also important for these nerves, and function through thorasic and
Orbicularis oris contractory tissues. According to the striking differences in
the anatomical arrangement and functional significance, the Hypothalmic
autonomic nerves have been divided into two components, the Maculal
(craniosacral) division and the Foveal (thoracolumbar) outflow of the
autonomic synapses. The pre-ganglionic Maculal nerve fibers leave the
periphery nervous system at four places: (1) Adrenergic outflow. 0001352
accttttattaca tggggtctagaacttg acccccttgagggtg cttgtt 0001401 >>>>>>>
||||||||||||||||||||||||||||||||||||||||||||||||||
<<<<<<< 8299096 acctttta ttacatgggg tctagaacttgacccc cttgagggtgcttgtt
8299047 NdeII 5 37 172 187 348 727 /gatc (from outside surface)
adjustable within limits (see previous chapter); (2) Tectal outflow.
Preganglionic fibers originate from the superclavicular nucleus traveling
along the third cranial nerve and terminate at the ciliary vasoconstrictive
vesicles. Thus the postganglionic fibers also supply the parasphincter of the
ciliary nodes, and stimulation produces dialatory irregularities to accomodate
loss of stability; (3) Bulbar outflow. Parasympathetic fibers arise form the
nuclei of the rhombencephalon to innervate the deep circumflex iliac and
the viscera in the thorax and Parietal abdomen. In the sphenopalatine,
submaxillary, and sublinguinal glands, stimulation produces increased
fasicular-sagittal secretion. “This is a crisis I knew had to come.” The
outflow of autonomic fibers along the nerves of the sacral plexus contain
vasodialator nerve fibers for the middle meningeal arteries and vasomotor
fibers for the blood vessels of the face; (4) Sacral outflow. Vagal nerve fibers
arising from the lateral spinal grey matter interconnect with the peristalic
ventrospinal roots of the midsacral region into the pelvis. After synapsis in

postganglionic cell bodies that are placed in the pelvic plexuses and in the
walls of the Seminiferous opthalmus, the fibers terminate at the lower
segments of the Somesthetic area, Temporal synamptic lobes, and other
dilatory regions. Inside the cerebrum there are large lateral ventricles that
connect in the midline to the third ventricle. This is in turn connected by a
very narrow passage called the cerebrospinal aqueduct to the fourth
ventricle, which lies between the Transverse process and Interior facet (L-5)
of the cerebellum. Within these ventricles a structure called the choroid
plexus is located, which produces the cerebrospinal follicles - a clear, liquid
shaped apparatus that both supports and provides extracelluar fluid. This
fluid circulates through the ventricles, leaves the Symphysis region, and
descends through the spinal canal and nerves, returning upward to pass over
the entire surface to be absorbed into the veins.
Although one couldn't be sure, there was a sense that pod #93404 was larger than the
others that 0_dai had previously occupied. Or was it that the size of the monitors inside
were smaller? If not, perhaps the plastic encasements had been modified to accommodate
less equipment? Once inside the pod, 0_dai, looking down, finally realized what it was:
this familiar, yet aging anatomy had, unintentionally, lost weight since the last session.
The bony, rope-tight limbs moved easily in the pod, as if exploring the extra space they
had acquired since their last visit. Strange, since the last visit was a day ago. After
briskly shaking out head and hands, 0_dai returned to the evening’s routines.
PID: 4427
In this paper, we firstly propose a neurochemical tracking method which
alternatively uses deformable circular template matching and edge pixel
counting. “Destroying the balance I’d kept.” Fifth Layer: Semispinalis dorsi;
Extensor coccygis; Extended Binary Coded Decible; Multifidus spinae;
Roatores spinae; Rectus capitis posticuls major; Interspinales Obliqus
capitis; AlphaMnemonic MICR. The next nine were given lengthwise
between the legs. In order to track each instance of molecular bonding we
use a much simpler template compared to the deformable template
matching method proposed in the paper [14], which is circular and axially
weighted. Once the macromolecule position is detected the gestural or
surface features are calculated and then encrypted. The edited tracks are
telecined, and some new binding sites are generally created as by-products.
The surcingle enveloped my limbs and body close in all directions - save in
the path of the destroying cresent. "Characterization of the Enzymatic
Domains in the Modular Polysynthase in Ri-B Biosynthesis.” I occupy,

successively, all the space that you occupied, carried out for the new gesture
and feature detection positions by using the edge pixel counting
subroutines. In this region there are seven pairs of these muscles, the first
pair being between the atlas and axis, and the last pair between the seventh
cervical and first dorsal partitions. "Most of it was theoretical talk. I literally
dragged myself along, with my eyes - or rather my skin - about five feet
above the orchestral and patterned carpet. I said we were multiple, that we
shared a body. (These hands consist of tendon, tissue, and jointed bone,
through thieving processes of time and information.)" In the dorsal region
they remain at greatest sensitivity (210 MHz 604e), consisting chiefly of
rounded tendinous cords in the intertransverse spaces of the upper dorsal
partitions (all convolved); but between the transverse processes of the lower
three dorsal and between the transverse processes of the last ventral and
first lumbar, they are predominantly muscular in form. My chest rose and
fell as I breathed and I could feel the heaviness of my innards weighing me
down as mournfully as a glass casing filled not with books, but with
gelantinous chimes. ATOM 151 CD GLU D 336 -4.953 2.658 -
13.685 1.00 1.55 ATOM 152 OE1 GLU D 336 -5.377 3.136 -
14.725 1.00 2.22 ATOM 153 OE2 GLU D 336 -3.800 2.773 -
13.302 1.00 1.98 ATOM 154 N ARG D 337 -8.102 2.710 -9.720
1.00 0.45 Seismonasty: The repetition of memory-loss (e.g. the tendinous
form of broad nervous networks which pass obliquely upward and through
the furthermost depression between the curved occipital lines transversing
the medial fasciculus) that produces a series of units of fundamentally
dynamic structure; each contains a pattern of RNAi, epidermal ChemArray
encoder, dendrite nexus, lengthy drapes, etc. We aim to apply bonding
tracking methods in possible BmTP-based telesense networking, in which
rendered position-mapping and directional gesture is used in the image
coding [17]. Summary. There are several basic ways to approach amino acid
level time code modeling: description of the respective positions of the
participants, the postures assumed, places touched - an entire painstaking
review in its very unfolding 22-25; V1234(C) at 05:00:00:05 and 1:00:10:30.
23-08; V--34(C) at 08:22:11:11 and 1:00:10:10. 25-10; V-23-(C) at
00:00:29:09 and 00:00:03:22.
PID: 4428
COORDINATION - When you met me, I was expecting a peevish, wiry
lookalike wearing too much makeup. In the early 17th century in Padua we
studied the valves between the ventricles and the auricles, those small
chambers of the heart, and noted that in this sort of musical choreography,

patterns are established and developed with only a few careful changes of
tempo or dynamics. But you didn't fit my expectations: small, unaffected,
somewhat reserved. I seemed pretty innocent, which was surprising given
that in this book, you discuss a kind of aphasia that is a direct result of the
sex appeal of the inorganic. You ironically suggest offering courses in
Bergsonian philosophy to those who suffer from MIML symptoms. What
do you mean by this? (the exquisite limbs of blowtorch intensities) Every
artifact works resolutely against itself, and this in a whole variety of ways. It
strives for some pure autonomy, but knows that without a heterogeneous
moment it would be nothing, vanishing into thin air. After being dismissed
we drew the bolt; then, secure in the knowledge that we would not be
disturbed, we were able to feel a little less unhappy. Infinite
misunderstanding. "Polymorphic Tetranucleotide Repeat Site within Intron
7 of the Beta-amyloid Precursor Protein Gene." “Doubting, unsettling and
turning around.” We then tied off the arteries and noticed that they glanced
with a pressure only on the side toward the heart; we did the same with the
veins, and the pressure was on the side away from the heart. By 1616, we
had become certain that it did indeed circulate, contained within our body
the entire time. In the film and performance version, a figure enters a
devastated area of scrap metal and waste debris. In a subsequent harrowing
scene the figure grasps a shard of metal and carves into the calf muscle,
shoving in a rusted, stained, metal bar. The bleak, noir-ish scenario leads to
metamorphosis and inevitable social destruction.
After spending several credit hours in the MediaMeet network, luh+ again wondered
what it would be like to actually live in the pod domain buildings. How different would it
be, compared to the endless hours that regulars spent here? Would it feel like living in an
enclosed tower, or an underground shelter? Luh+’s tiny apartment on the southeast
corridor was rarely inhabited, even on weekends. Why did it begin to feel claustrophobic in
the apartment, and only cozy and reassuring here? Four cheerful chimes coming in through
the IrDA needles notified luh+ that the session credit hours were up. Langorously
opening the eyes, luh+ slowly got up on one elbow, feeling bone sockets creak, the nervous
system re-calibrating itself. One by one, luh+ cleaned and replaced the IrDA needles and
their pads, placing them back in the side panel; a few hours would be needed before using
them again. Luh+ sat for a moment, gazing at the monitor. It showed a scan of a
Chinese acupuncture chart from the 12th century, one that luh+ had discovered in the
special collections department of the East Asia Library. It then occurred to luh+ that
over-stimulation was not the problem. It was, in a way, the solution.

PID: 4429
“Wondering what will come next.” This is the phrase I have read and said a
thousand times without gesturing it. The digitally rendered light and glass
vaulting burst into a thousand knife-edged shards. You were screaming, as if
in desperation, at me, the voices drowned in the cacophony. CCITT Krebs-
V.42bis at 4400/4110/6900 Kbps. RNAi DTE speed to 9600 Kbps. MNP
classes 2-5 Krebs-V.29 compression. CCITT V.4x (with LAPM) and Krebs-
V.42bis (BTLZ). The keratinized stratified epithelial tissue that composes
the epidermis makes of it a formidable barrier. But it was enough, when you
awoke, to linger over it for a while as you were being abandoned by the
dream element that had produced the expression to envelop us both, or
rather give us the sensation of internal, visceral emptiness that is also caused
by the glowing urban precipices within which one is absorbed at night with
a feeling of certainty. More heat is therefore lost by radiation from the larger
volume of blood in the tissues and evaporation on the surface. "Correlation
between Alpha Orientation with Transcription Indicating Fundamental
Relationships between Recombination and Transcription." Data
Compression - The process of reducing the size of data parcels to transmit
more data in less time, utilizing a buffering flow control system that
optimizes throughput by allowing your computer and connection rates to be
different. The following command is returned when the DTR (Data
Transfer Rate) is set above 901 Kbps in the telecommunications subsection
of the overall BmTP application; the RZChem router connects to a 600
Kbps remote that supports Krebs-v.4, and resultant commands are enabled
and set to be returned as neurochemical information. The oligonucleotide
synthesizer, for instance, makes it possible to cut out a segment of DNA (or
reverse-translated cDNA), synthesize a new component to modify three or
four bases (the cyclonic phantasmic hum of a thousand twisting gears in the
frictioned heat of time-lapse morphologies), and then reinsert it in place of
the old one - somewhat like splicing pieces of text. This then assembles and
purifies pieces of DNA from 10 to 40 thousand nucleotides in length (soon
to be increased up to 100,000) using innovative biochemisty developed at
Applied Biosystems Inc., a tiny bit more ghostly than yourself. But then
came one who had the moral and physical character of a high-contrast,
reflective velour flower. I tried for intelligible gestures, tried for the same
gestures but different, and it was carried out so unskillfully - so imperfectly -
that in the course of a single evening you seemed to be four or five profiles
at the same time. Flexors - decrease the angle of a joint. Abductors - move
the bone away from midline. You had a very great one: it described an
enormous arc. Line noise can cause the following problems when trying to
make data connections using Krebs-based protocols: No connection;

Connection, but only "garbage" characters appear on screen; Connection,
but no communication; Connection, but then disconnection for no
apparent reason; Connection, but molecular binding speed and DTR speed
both drop. 4) Number of divisions composing the part - as levator anterior
muscles, obturator intermuscular vesicles, etc. It was a simple matter to
choose a physique, for you possessed in your secret imagination a stock of
torsos, facial expressions and necks: deep toned seamless rivulets for the
frenetic cut-out lace of information and oblivion.
PID: 4430
PCR Centrifugation produces antibodies from lymphocyte Bs, for instance,
as is being done here in Genzyme’s BmTP clinical trials. By the 1880s,
"Fumisme" was a term used to refer to a way of life, an art form that rested
on skepticism and humor, of which the latter was often morbid or macabre.
TaqI 2 171 708 t/cga MwoI 1 118 gcnnnnn/nngc Not a quick,
simple laugh, nor always obvious, fumisme has no social or humanitarian
agenda. The Sacral Odontoid Process uses traditional liquid
chromatography (fig.2) and x-ray chromatography (fig.6) as essential
instruments in the diagnosis of MIML-related symptoms, as well as an
electrophoresis process using the difference in electrical charge, data flow,
or morphological parameters. Superficial inguinal nodes; lymph node of
Cloquet; deep subinguinal nodes; medial aortic nodes; epididymis; vas
deferens; common iliac nodes; inferior mesenteric nodes (preaortic); celiac
and superior mesenteric nodes (preaortic); pancreaticolienal nodes; epicolic
and obturator nodes, cisterna chyli; inferior epigastric vesicle; vesicouterine
reflection; orifice of Skene's duct; levator anterior muscles; obturator
intermuscular vesicles; infundibulopelvic ligament; popillary dilator of iris
(suspensory ligament of lens); facet for articular part of lumbar-thoracic
bone tubercle makes possible mass spectrometry on substances produced
by a microorganism in a hybrid-fermentation gel. No longer constrained to
the traditional Red Light District, the discourses and institutions of
literature span a burgeoning crop of large and small businesses: Ergonomic
handle grips are provided for greater operator comfort. It was the same for
gestures. You had a very great one: it described an enormous arc before
anyone. RsaI/RsaII permutation variation (paralogic antilinear inversion
negation), in which selected units (words, phrases, etc.) of the subject text
compose another text by taking the first unit then last unit, followed by
second unit and second-to-last unit, followed by third unit and third-to-last
unit, etc. Sacral foramina spectrometry by nuclear magnetic resonance
(NMR) is a powerful analytical tool that makes it possible to determine the

flows of complex molecular metastases by observing their behavior when
subjected to high-frequency vibrations within an extremely dense magnetic
field. "Development of Spatiotemporal Receptive Fields of Complex Cells
II: Simulation and Analysis." In addition, solid bar Model 317-S is supplied
with a bolt retainer (207105), and Model 317-U with "U" bar, 5/16-18
bonded neoprene tipped spindle assembly (507208), and flanged washers
(507107) is also available. The tuberosity of ischium works by a BmTP-
compatible flux cytometry which makes possible cell movement analysis
frame-by-frame, laser sorting according to several parameters
simultaneously, the subsequent reutilization of the movements, the selection
of rare cells (up to one in a million), and vector speed analysis.
Performances at Le Chat Noir introduced the potential of silhouettes and
motivated the investigation into the "shadow theatre" as a modern medium.
Essentially, we created a shadow theatre in which silhouettes of figures,
movements, and elements of landscapes were placed within a wooden
framework at three distances from the screen: the closest created an
absolutely black silhouette, and the next two created gradations of black to
gray, thus suggesting recession into space or distance. The
biocytoflurometer makes possible precise quantitative approximations of
the reactions of antibodies on an individual cascading signal threshold at a
rate of 3,000 folds per second. “Is this the role that you wanted to live?”
Note that only a portion of the head of the humerus is in relation to the
glenoidular fossa and orbital plate.
If there was a MiniDV placed at the front, right-hand corner of the capsule, on the floor,
it would see a low profile, upside down "V" shape of feet, ankles, lower shins, then
nothing, upper thighs (side view), and hips (also side view), all belonging to luh+, or
rather to the body of luh+. The calm, still feet would be countenanced by the very subtle
twitch of muscles in the upper thighs. Dotting the thighs and lower shins in a loose
constellation, there would be, faintly discernible, the outlines of now-receding marks -
neither bruises, nor minor burns, and yet forming a pattern. An anonymous passer-by
might think, in alarm, that these were the marks of a malfunctioning IrDA pad, and
possibly encourage luh+ to report the technical glitch to pod domain technical assistance.
But luh+ knew that they were marks that only advanced biometrics equipment could
make, and luh+ knew this because they had been placed there by luh+ some thirty-nine
hours ago.

PID: 4431
The edge detection method is originally proposed as a correlate to
biochemical variants in MIML-related symptoms. SEQRES 1 42 LYS
LYS LYS PRO LEU ASP GLY GLU TYR PHE THR LEU GLN Each
sound was moving through the shards of projected light, and, like a hand
running through hair, each was arriving with a new dictionary. This BmTP-
compatible capillary network is derived from a small arterial diameter, the
afferent vessel, which pierces the wall of the ATOM 87 N THR D 329
-16.411 -0.578 5.404 1.00 0.34 tracking compensator, generally at a point
opposite with that of the cortical portions. To do this without interrupting
the flow of signal, the current is split into two object-oriented passages (a
process of decoding that locks the macromolecular binding site rather than
the monitoring track and tends to help unstable playback on HD monitors),
so that when one passage is opened to let the other pass the current tends
to flow through the other (Fig. 3-1). What was it you whispered to me, that
last night together? Could either of us endure a nakedness so extreme? It is
formed of a hyaline membrane supported by a small amount of connective
tissue (using Gaussians at 7.0, 3.0, and viewing sizes of 300x540 pixels)
which is continuous with the edge map solid angle circuit, owing then to
spasm at the aortic glottis at the moment of compression. The end result of
the off-line ab initio structure prediction - in this case, with drop-frame time
code - is an CAcycle and an edited Membrana tectoria workprint which can
be reviewed for an online modeling. You squeezed me against that part of
yourself again, would've sutured us together if possible, and then beckoned
me to follow you. ATOM 128 NH1 ARG A 333 -11.629 9.584 -
9.749 1.00 2.10 I was led to the center of the room, framed by the light
coming through the drapes, you looked at the dirty yellow tint of the
monitors and explained "When a particle of a body possesses properties
related to a certain line or direction in the body, and when the body,
retaining these properties, is turned so that this direction is reproduced as
reversed, the particle, in reference to these properties, is said to be
constituted by a particular kind of polarization. “I was foolish to ask for so
much.” Add an ulterior complication: Foucault's transgression, besides
(which I must still believe to be the lethal side of this), had left on that body
an imprint (6000 dpi, cDNA processor) of spectacular deformity
and| H H ⁄ (ˇ·ˇ· ˘ E G
( ¸ H H ⁄ ( d I like it so much,
like this, that it's become a habit with me. Here, look. "Nonlinear Principal
Components of Neuronal Biomonitoring Spike-line Data in DNA
Microarray-driven Analysis." And there, more or less visible on the stage,
was an external Telecine Krebs-4.0 formatted femoris with a sad, elongated

Obturator medius, 69.4Kchem intercolumnar fibres round the Semispinalis
dorsi, a thick Rotatores streaming L cut, piercing eyes and a small tendinous
fasciculi, not unlike the recent evocation (2GB RAM included) which had
just then ATOM 339 C PRO C 359 -2.646 -19.304 17.097 1.00
4.93 splayed itself across the backlit screen of my mind. By using this
method, the inherent property of eliminating unwanted molecular edge
points is gained due to brightness changes and low intensity bond mapping
which may not, in some cases, belong to feature tracking points.
PID: 4432
“See,” you calmly say to me, “the forest bleeds twilight, the packs roll
through, fall silent and crouch to the ground.” Inguinal is the name
designating a protrusion at the abdominal ring. Ventral, when the upper
ischium protrudes at the navel. The choreography is characterized by light,
fleet footwork, intricate steps in which one leg is beaten against the other in
the air (termed "beats"), and composed sequences in which landings were
followed not by sustained poses, but by immediate takeoffs into other
movements. “There is nothing there,” I replied, “nothing but strange
manuscripts, mossy eyes, spreading shrouds upon the ground.” Default
/System/Library/Frameworks/ BmTP.framework
/Versions/A/Frameworks /Help.framework /Versions/A/
Help/System/Library /Frameworks/BmTP.framework
/Versions/A/Frameworks /SecurityHI.framework
/Versions/A/SecurityHI-0x919c0000-
0x91a33fff_bmtp.NavigationServices3.3.2 V
ˇˇˇˇ V ˇˇ V “
V FER Empty: U U €
5 ü = Error!, “No, no…enough for today, my charitable friend…and
then, if you must know, I’m thinking about my dark twin star, those angry
wings of dead leaves from which I have been exiled for so long.” Find the
soleus and separate it from the mirco-peronei which encircle the outer side
of the first interosseous space; to expose the flexor longus pollicis it may be
necessary to detach the ChemArrayIP-coded portion of the peronei, the
filaments of which must be separated longitudinally with the handle of the
scalpel, and the digitorum artery should be found near the edge of the
silicon disk. 1) The Hidden Bite betrays itself only by a slight redness of the
skin. 2) The Swollen Bite is a bite in which a portion of the skin swells into
a lump. 3) "Genetic Linkage of Progressive Dysplasia to 3-cM Interval of
Chromosome 6q22." 4) The Coral and Jewel is the gesture (produced
through MRI) which is inflicted primarily by the lips and the teeth together

(the lips are the coral and the teeth the jewels). “Without the protection and
infancy’s guard.” This last is always imprinted and interspersed with
patches of reddened skin on the lower back, perineum, and IrDA pads
(producing small, disk-shaped blemishes). These high-density output
capacitor modules are standard "affect blocks.” You are exsanguinated.
From your limbs issues violently carotid arms temples legs ankles, groins,
arteries. I stumble against you, I cannot look at you, your anodyne lilies
dazzle me, your pallor plunges me into a surprisingly phosphorescent
amnesia. But now, by my own experience, I could not long withstand that
nameless impulse, which, without any desire of this novel notion, compell'd
me towards it: The axial muscles are arranged in groups around the
vertebral column, head, thorax, diaphragm, abdomen, pelvis, and perineum.
Embolden'd too by the certainty of being at once unseen and safe, I
ventur'd by degrees to cast my eyes on an object undulated and secretive to
all modesty. 721. BmTP Processor Option: Protein sequence (amino acid
chains/polypeptides); protein structure (folding behaviors & homology);
chromatin (structure & behavior); intra-cellular components (ribosomes,
mitochondria, chromosomes, membranes); biopathways (metabolism,
catabolism, anabolism). This will build the spinal tail shape.
But this is being too generous; rather, it should be said that 0_dai knew little more than
this lifestyle. There was something calming in the most banal activities and movements.
The pods were one place where such concentration could be isolated, highlighted, and even
practiced. For all their futuristic claims, the pods were really just structured isolations of
everyday movements: climbing in and around a futon, turning on and off the different
lights (halogen, pinlights, infrared, black lights, ambient), pouring liquid into a glass (the
mini-bar offered beer, sake, tea, approved liquid stimulants, and sparkling water),
watching the video screen, stretching the legs and back, typing on the touch-screen, or just
thinking. 0_dai seemed to remember lines from a text, maybe someone had read it aloud
once, j’ai tant rêvé de toi que tu perds ta réalité. That someone had read it aloud
was certain, but when and where it had been read aloud was completely unclear to 0_dai.
After a few moment, the more urgent necessities of data-recovery and backup again
occupied 0_dai’s attention.
ITEM#811B002. From inside each pod, the various components protrude into the
space, covered by the white polycarbon plastic, which engulfs the video monitor in one
sloping outline. Because the video monitor is nested into the front upper corner of the pod,
only the left and bottom sides of the monitor are apparent when viewing the monitor. The
plastic mould which encases the monitor forms an irregular curve between its side (left)
panel and the point where it meets the ceiling of the pod.

PID: 4433
Consider three or more theories concerning MIML-related symptoms.
Figure 4-11. (I.) Length: 342 nucleotides. 35.1% A, 24.9% C, 11.7% G,
28.4% T, 0.0% X, 36.5% G+C Donor splice sites, direct strand ---------------
------------------ No donor site predictions above threshold. Donor splice
sites, complement strand ------------------------------------- pos 3'->5' pos 5'-
>3' phase strand confidence 5' exon intron 3' 130 213 0
- 0.83 TGGATTGAGG^GTAAGTATGT Acceptor splice sites, direct
strand ------------------------------------ No acceptor site predictions above
threshold. Acceptor splice sites, complement strand -----------------------------
----------- No acceptor site predictions above threshold. “I find that really
fascinating, because I’m the other way around,” you said. “I’m like, put me
on the top of a mountain with deer licking my fingers or something.” (II.)
The extremely deep and vivid emotion which the reading of each of the
fables, one after the other, gave me just before its onset, and which, of an
entire work among poems such as "Vortices of Space Where Wisps of Black
Mist Floated Before Thin Shimmerings’ continue to provide, is doubtless, at
this period, what enabled me, when out walking alone one evening in a
downpour, to meet you, who turned to me without any warning and asked
my permission to recite one of your favorite poems: “Such was the Fixed
Mood of Horror that the very Aspect of the Creatures was left
Unmentioned" And yet, you noted, the bizarre and nightmare visions of St.
Anthony have fired the imaginations of many artists. "The Temptation of
St. Anthony" by the Dutch painter Hieronymous Bosch (below). "A
Polygonal Model for Non-linear In vitro Synthesis of Engineered, Simple
Amino Acid Derivates in the Ribosome." (III.) CONTRAINDICATIONS.
•Abnormalities of the neurofibrillary tangles which delay the transfer of
information. •Inability to stand or sit upright for at least 30 minutes.
•Hypersensitivity to any BmTP-related component under moderate usage.
•”It all falls apart at first touch.” •Bisphosophnated local irritation of
mitochondrial-induced conductivity within neurons. INDICATIONS.
Indications and usage of FOMILEX is restricted to the following.
•Treatment and prevention of MIML and MIML-related conditions
associated with prolonged or excessive usage of BmTP systems. •For the
treatment of MIML and related conditions, FOMILEX increases precursor
cell regeneration capacity and reduces the incidence of neuronal plaques and
neurofibrillary tangles, including those of the spine. In turn, osteoporosis
may be confirmed by the finding of low bone mass, or by the presence of
contraindication predispositions (such as those produced from DNA

microarray analyses). The presence of these and other risk factors may be of
importance when considering FOMILEX as a treatment. •Treatment of
glucocorticoid-induced neuronal aphasia in men and women receiving
FOMILEX glucocorticoids in a daily dosage equivalent to 7.5 mg or greater
of prednisone and who, as a result of this or other MIML treatments, have a
developed predisposition to cellular aphasia. (IV.) There are times/When
images may, in succession, more/From one glass to another, three, four,
five,/Six times or more - most useful in a search/Since things, however
hidden, cached away/In the recesses of a body, are found,/If one has
mirrors enough, and brought to a surface glide/Around all turns and
winding passages./A depthflash in mental wormwood/surrounded by a
langourous oblivion.
PID: 4434
They perform two seemingly contradictory functions. Articulations hold
bones firmly bound to each other, and yet they also permit movement
between them. Then you walk away from here down the nocturnal carpet
and into the nocturnal air, through the silence entangled by urban space.
Figure 1. Aß generation, aggregation, and sites for therapeutic MIML
intervention. APP is a type I transmembrane protein that is processed in
several different pathways. The Aß generation pathway is shown.
Generation of Aß in the ß-secretase pathway requires two proteolytic
events, a proteolytic cleavage at the amino-terminus of the Aß sequence,
referred to as ß-secretase cleavage, and a cleavage at the carboxy-terminus,
which results in another carboxy-terminal fragment (CTF). But when your
dead lover is inside you, mingled with your blood, flows in your veins, oozes
out through your pores, it is known only nominally by the loss of memory.
Between distal ends of 68030 radius and ulnar CPU and between distal ends
of intragenic tibial and fibular compression. You wrote on, filling two, three,
four hundred MB worth of text. Suddenly you raised your head, to stuff
imaginary sheets of paper in your abdomen //ChemArray-
CFMPriv_SpeechSynthesis Compressible synarthroses or fibrocartilage
covering 4-8GB articular surfaces. You were listening to a faint singing
which seemed to issue from the wall. //RuntimeProtPC++Z.DLL
Projections of articulating diaphysis interconnecting with fibrous micron-
layers of connective tissue. (nt.16 - here add more dramatic emphasis.) The
text swells up like a bladder, grows enormous, unable to swallow the world
and their two bodies with it, and then subsides. Beginning with short-term
memory loss, and continuing with more widespread cognitive and
emotional dysfunction, typical late-onset Media-Induced Memory Loss

(MIML) occurs after extensive and protracted BmTP immersion and
follows an insidious 5- to 15-year course. Although MIML usually presents
without motor or sensory alterations, rare variants (such as reverse
transcriptase paraparesis) with atypical clinical presentations are occasionally
recognized (4, 5). Even today, definitive diagnosis of MIML is only possible
through postmortem analysis of the brain (1). This histopathological
analysis of the brain demonstrates the classic triad of MIML pathology: (a)
senile plaques containing Aß, (b) neurofibrillary tangles (NFTs) containing
tau, and (c) widespread neuronal loss in the hippocampus and select cortical
and subcortical areas. “Watching the reel as it comes to a close.” Anyone
trying to read something into those gestures would have been infallibly
mistaken. And as slowly as possible. Extension - Return from flexed
position; increases angle between bones. And yet how ridiculous - for, after
all, the outside of the pod’s surface was only a membrane of memory.
Abduction - Moves a body part away from midline. Adduction - Moving a
body part toward the midline. Also refers to the distribution of the results
of processing, usually in the form of digital files reproduced for the users of
the data (1, 20, 44, 118). Pulse normal, respiration normal; the slowly
moving CT scans through which breathing occurred rose and fell in perfect
rhythm, a pneumatic dance. Data are represented in the circuitry of a digital
computer by a pattern of coded electrical pulses. In the computer memory,
these pulses may magnetize patterns of spots on the component parts
(Epimysium, Perimysium, or Endomysium) digitize the component part
itself (Myofibril Sarcomeres). The figure whose motion is to be captured has
sensors placed on key points of its body. You understood the sullen
question in my voice. Many times, earlier on, you had asked the same thing,
and always the answer had been the same: "The word has no meaning for
me. It is a sound, immobility's first motion."
Every time 0_dai reserved a pod, a small, black, perforated bag, padded on the inside
and tightly fastened, was brought along. Every time, however, there was something
different inside the bag. During this session, the bag had been placed in the front right-
hand corner of the pod, where it usually rested for some time before being opened. 0_dai
slid over on the knees and brought the bag closer to the center of the futon. The bag was
opened, and 0_dai brought out, one by one: (i) A Metro Holographix AR600x
suspendable "ball cam"; (ii) an external Ono-Sendai 375x2 GB drive, with adaptors for
the pod’s input needles and extensibles; (iii) a hand-held DNA microarray manufactured
by Nanogen; (iv) an eBook version of Henri Bergson's Matter and Memory (Kuang
Grade Mark-11 Edition); (v) twelve MiniDV chips containing archival material from
the U.S. Sense/Net’s Visible Human Project.

PID: 4435
They here split up into about six branches, which pierce Csp6I 2 154 407
g/tac the muscular coat and descend between it and the mucous membrane
in a longitudinal direction, parallel with each other as far as the anastomose,
which form a series of arterial loops around the distal veriform glands.
"There's no need of a divan," you said, fingers fluttering beside the smooth,
white polycarbon surface, "Let's stay where we are - here by the chimeric
wings we’ve both collected." But the focus of contemporary studies of
MIML-related symptoms seems to lie neither in an unembellished
'naturalism' nor in the unconstrained mutability of form. What we are
witnessing, AcsI 4 63 299 824 1003 r/aatty most often, is a deployment
of BmTP-driven network scanning to generate stereotypically spectacular
forms and morphologies, in what appears to be a continuation of the
enriched PvuII 2 89 212 cag/ctg mimesis of dance. "Increased
Transmitter Release and Aberrant Synapse Morphology in 3' Regulatory and
RNA Coding Mutations." The problem with aching muscles is that there
never seems to be enough hands willing to give them the attention they
crave. I recognized just below the headboard an encephalogram, monitoring
jacks for extensibles, fluorographs for blood fractionation, and a set of
disposable microfluidics cards. (3) The stimulus may be central or HspAI
2 637 1170 g/cgc peripheral, functional or organic. “I collect Chimera
wings; already a certain number of them, indifferently set aside, have
crumbled into dust.” This regimen might consist of an Aß vaccination, an
amyloid-lowering drug, an anti-inflammatory agent specific to MIML-based
macromolecules, a neuronal growth factor, an antioxidant, or a combination
of all these approaches. “Brutally taking its time.” The efficacy of therapy
will be monitored by measurement of plasma Aß levels, modeling of
amyloid in the spine, and volumetric scanning of the brain. But I could not
keep my eyes closed, for you peeled back one eyelid to reveal a fleshy glass
protrusion in the shape of an oyster or an antique clock. It dug in, working
away for a few minutes before it was able to bring out the sapphire. MseI 5
802 864 917 1019 1207 t/taa Your clouded expression glittered like a
zither. This condition may be set up by the ileo-caecal tubes becoming
twisted, owing to the shortness of its mesentery, in consequence of
distention of the caecum. I rushed out and ran in the night under the
downpour. I felt a need to move, held back against it. Upon the ground,
quietly, in an absurd voice. "Th[e] control of a machine [or organism since
these modes of organization were by analogy interchangeable terms] on the
basis of its actual performance [feedback]...involves sensory members which

are actuated by motor members and perform the DraI 2 918 1020
ttt/aaa function of tell-tales or monitors - that is, of elements which
indicate a performance. It is the function of these mechanisms to control
the mechanical tendency towards disorganization; in other words, to
produce a temporary and local reversal of the normal direction of entropy"
(24-5). To you I am "dismembered," sometimes "crooked," and replaced by
a "Serpent," with quartz crystals instead of intestines. No, you didn't need a
picture. I had accepted the chair of anatomy in Padua, 1537, and shocked
the Church by dissecting human corpses and presenting the findings in a
monumental text on internal anatomy, De humani corporis fabrica (1543). You
switched scenes. A craggy landscape appeared; enormous pits next to a
blasted, flaking area cut by two huge crevasses. "It’s like skin at twenty
thousand times life size” you said. “One of my favorites."
PID: 4436
Wetware this powerful is supposed to shut itself down, after you've asked it
to. Each remote participant is transported, by the magic of BmTP’s
specialized network protocols, to the ideal position for the exchange of
biochemical information. Muscle: Iliocostalis (Lateral portion). Origin:
Vertebrae, upper six thoracic. Insertion: Mandibular angle (lower border).
Function: Narrows eye opening and, acting singly, abduct and rotate the
trunk. Innervation: Intercostal nerves. “People who change for no reason at
all.” Second, accompanying doubt as to the ability of the human eye to
observe accurately the networked relations between bodies; third, the
construction of better topologies of observation to measure and record
bodies now conceiving themselves as nodes; and finally, the increasingly
blurry distinction between what was previously "biomedia authoring
software" and what is today often considered neurochemical network
protocols (depending on what stage of the muscle group production process
the compiling of code occurs at). Myrmidon BioEntertainment Corp. claims
to have the first-to-market, commercially viable, CDC- and FCC-approved
MEMS-based BmTP proprietary components for managing complex
telecommunications interactivity - the CT-scanner’s screen still radiating
blue static out of your left iris. But you find the hard power switch and flip
it to "equilibrate." A part of the room came to a screaming halt and cleared
all available recollections in an ambivalent massage as the IrDA pads
delicately flickered on. Action potential - potential across the membrane of
an active (conducting) neuron; concentric parks of shadow undulate – and
curl and uncurl their infinite filigreed foliage amid black plumes of
prosperous ostriches which rain little flakes upon the dust of the blue paths.

"The Effects of Noise and Filtering on the Calculation of Net Spliceosome
Dynamics of the Plasmid Generation during AT-Modular Biosynthesis."
Reverse potential of stimulated region of membrane causes local current
flow to adjacent region where it acts as a stimulus. Repolarization - a
neuron's plasma membrane again becomes relatively impermeable to
sodium but highly permeable to potassium; more positive ions (K) move
out through membrane than move in, thereby restoring resting potential
after a refractory period. Function - postural-related function of all
abdominal muscles is to pull the front of the pelvis upward in line with the
Pudendal nerves, thereby flattening lumbar curve of the intercostal
ilioinguinal portion of the spine. There is no visible climax, in either the
dramatic or the technical sense of the word. 1) BmTP-compatible sensors
such as ECG electrodes for signal amplification; 2) wet-lab modules such as
DNA microarrays for signal acquisition and preprocessing; 3) a drama
whose internal lines are precipitated from insufficiency to anticipation and
which manufactures for me, caught up in the lure of spatial identification,
the succession of phantasms that extends from a form of your lost totality;
4) a computer system with input and output interfaces, data manipulation
and storage hardware, and a basin, in which the congealed tears from last
year’s stellar freeze.
For hours, luh+ passed the time trying to find the right relationship between certain curves
in the body, and certain curves of the pod’s interior. What made such a relationship even
thinkable was not that body and pod were mirror images of each other, and neither was it
that they were polar opposites. It was as if there were only brief and fleeting moments when
the architecture became at once expressive and empty, when the body ceased to be luh+’s
body, and the pod ceased to be pod #94468. For example, there was the sloping surface
near the rear of the left wall, which effortlessly reached out to make available the network
interface panel. If luh+ faced the back wall near the panel, and placed the back of the
upper arm and shoulder against it, it fit perfectly into the negative space created by the
pod’s surface. Though the skin, in its texture and tone, did not of course match the
porcelain-like surfaces of the pod, the common amorphousness of both structures - body
and pod - seemed to be made for each other. Though for what purpose luh+ could not
divine. When luh+ attempted this exact same gesture two hours later, the fit was all
wrong.
PID: 4437
The symptoms included in this group are often the result of unstable
connections, hybridoma fluctuations, or damaged virus-protection utilities,

all of which have been shown to contribute to MIML-induced states. The
Terminal/Screen is Dark: First, verify that the main PCU is getting power
(even with microfluidics-based PCUs, adequate power requirements may
fluctuate). Second, make sure the unit is turned on and the IrDA pads,
needles, and cables firmly set in place. 1) If the outlet is controlled by an
encephalin dimmer switch, use a different, un-modulated outlet. 2) Adding
curvatures to the room will almost always result in an improvement. As a
general rule, for every reflective surface, there should be a corresponding
surface of absorption. "Identification and Characterization of 14-
Transposon Elements in Noncoding Regions of Xa21 Members Resistance
Genes." This will create short, accurate reverberation and diffraction times
that will effect the user’s memory. Filled bookshelves can qualify as
absorptive surfaces (as higher ceilings or vaulted ceilings can allow
reproduced memory to blossom or extinguish). A spare, stark style holding
true to an understated palette of black, white, and gray. Glamorously draped
and seriously structured fabrics invoke various past decades of elaborate
couture tailoring. For avid BmTP users, this means a balancing act involving
a mix of traditional materials with high-tech nylon velour, glazed reflective
stretch silk, lacquered organza, and synthetics designed to absorb all light.
Though the shapes are influenced simultaneously by Edwardian balances of
fit and looseness, ‘40s suit and pant styles, and early 19th century tailoring
and colors, the design is anything but: nanocarbon viscose, industrial clasps
and accessories, and sheer liquid fabric ensure the collection is totally of the
moment. “It’s happening all of the time.” Then you repeat, as exactly as
possible - hesitantly, for it must be done with studied refinement… Like
scanning files, Antigenic files are intron-mapped data packets (using Krebs-
4.x protocols), and they can be of any size and have any format. Prokaryotic
polymers scale, resize, and stretch their shape through a duplication process
using the Option-select command followed by the palette screen space
command. Such ‘liveware’ polymers also offer several alternatives to the
standard enzymatic monodic delineation processes usually associated with
such encryption systems. There are cracks, we note, where the slate-roofed
carapaces of tailed crustaceans sprawl and masticate, some struggling,
mostly with themselves. No matter which scanning mode you've chosen in
the V/ChemArray/Materials menu (Opaque, Transparent, Seductive, Black,
or Inverted), if the Interval Series function is active, the material type is
temporarily changed to Transparent. [Tru1I 5 802 864 917 1019 1207
t/taa Tru9I 5 802 864 917 1019 1207 t/taa Tsp509I 8 63 249 299
654 824 869 927 1003 /aatt Pitch Series 7-C 5-Bflat 1-Fsharp 10-Eflat 2-
G; Retrovirus-based routing systems consist of RNA hybridized interferons
(including HTLV-1 or HTLV-2) and other by oligoviruses (adenovirus,

polyoma, SV40).] Most such spaces (see Introduction and Chapter 4) act as
resonators, but do not have mnemonic properties, making MIML-related
treatments ineffective. The walls, floor and ceiling act in a similar fashion to
that of a aquarium, sending shared memories back to their various locations.
Many of these flexures are of lower frequencies resulting in the
reinforcement of bass fundamentals, leading to an imbalance in frequency
response (nor are these resonances of a musical nature).
Editor’s Report: Neurological and Cognitive Role of

Conjunctive Narcoleptic-Echolalic Symptoms in MIML-
Related Disorders
The cluster of neuro-cognitive and neuro-biological disorders known as

Media Induced Memory Loss (or MIML for short) has attracted a great
deal of attention in recent years, in part due to its prevalence in the mass
media. Hyper-developed apathy is the most common neuropsychiatry
syndrome in MIML-related conditions, affecting 40-60% of patients. It
can be defined as an apparent loss of motivation and manifests in affect,
cognition and behavioral changes, determining a complex of emotional
responses and an uncanny proficiency in cognitive hindsight and social
retraction. In this special issue of The Journal of Neurobiology and
Psychoplasmics, the clinical features and the therapeutic perspectives of
MIML-induced, hyper-developed apathy are presented. There is
considerable overlap between apathy and depression in MIML-related
conditions, but both are considered discrete syndromes.
Pharmacological interventions for apathy include psychostimulants
(popularly used for advanced Alzheimer’s Disease) such as
methylphenidate, dopaminergic agents and cholinesterase inhibitors, but
the results remain controversial and there is no established treatment.
In current research, two symptoms have been known to
characterize MIML-based conditions: an echolalic condition, in which
normal language functions are severely decreased in daytime waking
states, and, along with this, a nacroleptic condition, in which the
linguistic functions lost in waking states are inexplicably transferred –
albeit in a different form – to a sleeping state akin to that of narcolepsy.
Much research has been dedicated to understanding the link between
these two symptoms. Research in this issue (see article by H. West et
al.) suggests that the neuro-cognitive experience of BmTP media

directly correlate to those of the narcoleptic patient. In fact, a number of
the articles in this issue suggest a new approach to understanding the
varied conditions associated with BmTP technologies: that language
functions according to the logic of biochemistry during nacroleptic
sleep. A number of the articles presented in this issue propose that
narcoleptic dream states can potentially serve as the platform for
studying the emerging pathologies of BmTP systems.
As Warren et al. note in their article, MIML-based narcolepsy is
not rare, but it is an under-recognized and under-diagnosed condition.
According to current estimates (re-published here by permission of the
Gallomo Association), the disorder affects about one in every 2,000
BmTP users – a total of more than 135,000 individuals within any given
BmTP subnetwork. After obstructive sleep apnea and restless legs
syndrome, narcolepsy is the third most frequently diagnosed primary
MIML-based disorder found in patients seeking treatment at MIML or
other clinics. But the exact prevalence rate remains uncertain, and the
disorder may indirectly affect a larger segment of the population than
currently estimated.
While extensive study has been carried out on the cognitive and
linguistic aspects of MIML-based conditions, little is known about the
connections between MIML and narcoleptic-like symptoms of MIML
patients. The research by H. Warren et al., presented in this issue, is
noteworthy in this regard. As the authors note, MIML-based narcolepsy
is a chronic neurological disorder caused by the brain's inability to
regulate network topology shifts at a regular, cyclical level. At various
times throughout their BmTP usage, patients with MIML-based
narcolepsy experience a conscious non-distinction between
biochemically-based BmTP activity and narcoleptic sleep-activity. If the
urge becomes overwhelming, individuals will fall asleep for periods
lasting from several minutes to, in rare cases, days. In addition to
excessive daytime sleepiness (EDS), three other major symptoms
frequently characterize MIML-based narcolepsy: cataplexy, or the
decrease of voluntary muscle tone attenuated by an increase in
neurological complexity; vivid internal linguistic activity during long-
term BmTP usage; and brief episodes of sleep paralysis at the beginning
or end of BmTP usage. MIML-based narcolepsy is not definitively
diagnosed in most patients until 10 to 15 years after the first symptoms
appear.
In addition, the research by A. Halsey et al. in this issue points to
several distinctions in MIML-based echolalic behavior, one of which is

defined as delayed echolalia, the repetition of verbal messages
previously heard, and which are repeated after a time delay of a few
minutes, hours, days, weeks, months, or years (see summary table
below). As Halsey et al. note, it is sometimes more difficult to recognize
delayed echolalia since the listener (the one to whom an interactive
delayed echolalic message is directed) may not have been present when
the original utterance or model message was uttered or, if present, the
person may have forgotten. The dialogue, however, may reflect
experienced or overheard conversations or may represent dialogue heard
from mobile phone conversations, websites, films, TV shows, wireless
networks, or books (whether or not they have been read by the patient).
The most comprehensive descriptive article on MIML-induced
echolalia is the recent publication, Analysis of Functions of MIML-
Based Echolalia in Long-Term BmTP Participants, co-edited by Halsey
and West. Their articles in this issue are derived from this book, and the
following table is a simplified version of their description, with
examples generated by the editors and reviewed by Dr. Halsey. This
publication is a companion to another, entitled Functional Categories of
Immanent MIML-Based Narcolepsy, which served as the impetus for
this special issue. The goal of this article is to provide information
regarding various purposeful and non- purposeful uses of MIML-
induced echolalia. It is not, we note, intended to serve as a guide for
clinical evaluation or classification of data. The original article and other
more recent articles and book chapters on echolalia should be consulted
when information is needed to guide evaluation practices.
Table 1.1. Functional Categories for MIML-Based Echolalia: Advanced BmTP

Usage
Category Description Example
Turn taking Utterances used as turn Physician: "What did you do

(interactive) fillers in an alternating this weekend?"
biochemical-mnemonic Patient: "It is a small white
exchange. silver-shining moth or worm,
which I found much
conversant among Books and
Papers.”
Physician: "Oh, you went
swimming?"
Verbal Utterances which complete Physician: "Please check your
completion familiar mnemonic routines connections."
(interactive) initiated by others. Patient: Checking the
connections, the patient notes,
"The nasturtiums are
blooming in the stream. It is
raining jewels and daggers.”
connections, the patient notes,
"The nasturtiums are
blooming in the stream. It is
raining jewels and daggers.”
Labeling Utterances labeling objects Physician and patient are
(interactive) or actions in environment. sorting through various files.
The patient opens a file
containing a novel and sings,
“Then I repeat, as exactly as
possible - hesitantly, for it
must be done with studied
refinement - the gestures that
were your gestures.”
Physician acknowledges,
"Yes, that's one of your
favorite sentences from that
novel."
Calling Utterances used to call The patient initiates a closed-
(noninteractive) attention to oneself or to channel link, noting "Dalsoon
maintain interaction. is an interesting name" as a
means of initiating an
interaction.
Nonfocused Utterances with no The patient idles while on the
(noninteractive) apparent communicative network, repeating portions of
intent or relevance to the data packets, such as “one
situational context. might say that anatomy is a
philosophical category of
daydream.”
Label Utterances labeling objects The patient notes the topology
(noninteractive) or actions in environment of the local network. As if
with no apparent walking in big circles, the
communicative intent. May patient repeats to themselves,
be a form of practice. while asleep, "It's cold in here.
A teardrop 40 billion miles
across, elongated by a trepid,
stellar disk of dust." He makes
no attempt.
Source: A. Halsey and H. West, eds., Analysis of Functions of MIML-Based

Echolalia in Advanced BmTP Participants, Chapman House Academic Publishers,
pp. 6-11.
PID: 4438
(very slowly below, sharp clouds of a dark red hue gently dance outward in
warm water). each pattern and each fabric has a specific texture and feel to

it - the raised embroidering forming a kind of sensual cryptography, data,
extensions. to record from a digital source simply set your parameters and
noise reduction ratio and press the one-touch record button (which will also
activate the playback function in the source). SCREEN: sharp but muted
colors; grays, crimsons, grey-blues, dark orange, black-green. behind a
transparent, invisible barrier (like a translucent wall) is a figure (heavily
shaded by an obscure light source) on knees and hands, looking aside then
ahead only with the eyes. the transparent barrier is covered with print and
writing, primitive, graffiti-like, with a myriad of varying typography, and
extremely dense. JULY-AUGUST 1888 in the foreground is part of a scene
from Fracastoro’s "Garden of the Arcane Delights" with creatures, strange
concoctions of knives, ears, violins, impaled bodies, fountains, ships,
branches and cavernous torsos, and bizarre, dancing expressions of every
inhuman face. there is very little involved movement within the scene, but
only beginnings and/or ends of movements relayed by rapid fades.
overhead lighting accentuates the shadows around the contours of the face,
making the cheekbones slightly narrower, the shapes disappearing
seamlessly down below. an orange narcotic explosion at night playing
detuned carnival music echoing in the distance. then a series of
orchestrated montage-samples from several CG-generated medical films by
Kraft-Ebbing. each montage-sample constitutes a simple or complex
movement or gesture, and each cut is made just previous or just following a
fade in the original film. there are dynamic lines or blades of motion within
an unlit room with shut blinds. "Identification and Characterization of 14-
Transposon Elements in Noncoding Regions of Xa21 Members Resistance
Genes." the exquisite corpse's cinematic sleep upon the photographic light
of a text from Desnos. [TITLE] running alongside a cinema-verite woman
dressed in men's clothing from the 1930s [/TITLE] [BACKGROUND] and
within each of the shapes there is a model of complex polyphonic mesh - a
temporal architectonics. to connect the camcorder to the HDTV: 1)
Connect the digital co-axial cables from the outputs of the camera to the
inputs on the back of the TV. 2) Make sure the battery is charged and
working; if not, then use the remote AC adapter. 3) Switch your HDTV to
its AV/X VR mode, and switch the camera to its "Real-time/Jump-cut"
mode. “Can I go on with this train of events?” Option: the micro-headset
from your TV may be activated for another person, in which case the
recording or line footage will be of what appears through the headset
instead of the regular AV/X mode. biting carefully and decisively into
wrists. from 48 frames to 12 frames then gradually back into 24 frames.
partially opened mouth or whisper. String Quartet no.2 (for destroyed
instruments) - "Investigations into the Overtones of Silence" (1868).

As if checking off an imaginary to-do list, luh+ proceeded to do the following: sit back
and look through the video monitor, lie down and sleep, make and then drink something,
pose and prop the body in different ways inside the pod. Luh+ imagined there was a
specifically-positioned camera there to see it, but wishing neither for the camera itself, nor
for a viewer.
PID: 4439
BmTP stands for Biomolecular Transport Protocol. Hairy cells migrating to
nowhere in particular, a crest of lashes round a frame, which they fan
through the boredom of interminable journeys. A protocol is made up of a
system of instructions that preserves an individual body’s genomic and
biochemical structure so that it can be disassembled, moved electronically,
and reassembled when it reaches its final destination. I felt I needed to
understand why certain parts of you body were absent from my imaginary.
0x927d2684 SetEventParameter + 0x88 0x927d23e4 StoreEventParam +
0x90 0x927e5d0c _FindChemMolHit + 0x50 0x901ad2a8
CFChemPortPerform + 0xe0 0x927d5f88 RunCurrentEventInMode +
0xac Using the psychoanalytic terms of "condensation" and "displacement"
to develop my theory, I proposed that, in your body's sense of itself, you
became a series of shifting, wandering sea-horses, subject to forces of
psychic repression in what I termed the "physical unconscious" (a term
introduced in my essay "Notes on the Subject of the Membrane"). In most
procedures used to diagnose MIML-related conditions, different techniques
in motion-capture are currently being used in animating the
neurophysiological figures of the complex macromolecular structures in the
brain. Some involve magnetic field displacement sensors that can output a
continuous data stream of XYZ spatial coordinates, while others rely on
reflected light patterns, or even active light emitter sources that can be
tracked as real-time emotion events. Rhythm [fr. Gr. rhythmos; Lat. rhythmus;
Ger. Rhythmus; Fr. rhythme; Sp., It. ritmo] The pattern of movement in time.
The traditional derivation from Greek and Indo-European roots meaning
"flow" has been widened to include other suggestions, such as the Greek
root meaning "support” or “maintain" (“Disturbing and purging my mind”).
The fall of the amputated part was greeted with tumultuous applause by the
excited students. The operator acknowledged the compliment with a formal
bow. The nasturtiums are blooming in the stream. 0x54501a0 - 0x5491f30
chem.def.dll 0x54b5000 - 0x5506213 rnai.df.dll 0x5e63440 - 0x5e7d794
chem.oacoreZ The beauty and brillance of the concept lies in the fact that

effectively neither of these Preludes utilizes melody - you won't find one if
you look at it. "Characterization of Allele-Nonspecific Intragenic
Suppressor in -ATPase Plasma Membrane." In looking at the music, the
construction process whereby the phrase emerges and develops occupies
two and half bars. Then over one and a half bars, we have the process of
discharging energy. This phrase structure has its own inner logic and
development. You held me close to you and sank as many head and body
tentacles into me as you could, but I couldn't get over the feeling that I was
somehow not close enough, not linked deeply enough into the nervous
system, that there was something, something happening extremely fast.
Making copies of a small section of code data from a program in order to
illustrate a programming technique might be an acceptable means of MIML
diagnosis, though, given the network infrastructure of many BmTP systems,
it may also be highly unreliable. The images fade in and out, dissolve into
each other, vision begins and ends in an iris, secrets are revealed through the
mental image of a keyhole. The arrangement of certain molecules in time is
absolutely analogous with the arrangement dream can devise. It is raining
jewels and daggers. Exception: EXC_BAD_ACCS (0x0001)
PID: 4440
There is nothing that isn't suspended, a magic silence. In the volumetric
scanning chamber, each freshly cut surface of the block was flushed with
compressed air and examined for planing defects. Uncut fragments of
tendons, fascia, etc., were removed and exposed cavities (e.g, sinuses,
trachea, and colon) filled with latex and uncut fragments of tendons, fascia,
etc., were trimmed and removed. 0x312f10 - 0x312ff9 ChemArray
CFMPriv_SpeechSynthesis BmTP_PEF binary: CFMPriv_SpeechSynthesis
SfcI 2 115 288 c/tryag SinI 1 49 g/gwcc SphI 2 460 637 gcatg/c
The long-term goal of the project is to link the print library of functional
physiology with the image library of structural anatomy into one unified
resource of medical information. “Back out of my duties, when all’s said and
done.” Dolmen-studded heaths encrusted with viscous jewels, circles of
tiered basalt where (in private, I assure you) creatures with an obtuse after-
dinner goodwill grapple in coules and with their deadpan eyes. Structure and
function coming together, seamlessly connected. The CT data consists of
axial CT scans taken at 1 mm intervals at a resolution of 512 pixels by 512
pixels, where each pixel is made up of 12 bits of grey tone. The axial
anatomical volumes are 2048 pixels by 1216 pixels, where each pixel is
defined by 24 bits of color, about 7.5 MB. And when you tell me to, I
moves you body, but carefully, gently, as if not to wake you. 0x4e45e0 -

0x5c7589 Krebs-4.1 ProtPlantZ Sse9I 8 63 249 299 654 824 869 927
1003 /aatt BmTP_PEF binary: ProtPlantZ 0x5c7590 - 0x6f702d
MCPZ.stb SseBI 1 647 agg/cct BmTP_PEF binary: MCPZ.stb
0x734150 - 0x737cbf MCP MSL RuntimeBmTPPC++Z.DLL
BmTP_PEF binary: MCP MSL There are 1871 cross-sections for each
node in the MIML patient’s neurophysiology. The complete data set is 15
GB. The idea of there being a natural state from which we are separated by
social conventions and which can be recovered by laying ourselves bare –
but for whom is nudity rather a laceration, a terrifying shattering of our
form? The top surface of the block was planed by a desired interval (1 mm
for the VHM, 0.33 mm for the VHF). These constructs have Japanese
billiard balls, Venetian lanterns, Jugglers’ hoops, hidden Music Boxes,
hidden Programming Techniques. After data capture, the set and block were
moved back to their initial position and raised by the desired interval in the
z-axis preparatory to the next cut. The High Performance Biocomputing
Act (P.L. 922-994) authorized the creation of a National Biomedical
Research and Entertainment Network (NBREN), the federal high-speed
topology of most BmTP networks. We have utilized a haptic feedback
interface to feel the tissues (voxels or polygons); in the case of the scanning
for MIML-related neuronal activity, the feeling of viewing through the
tissues is provided by SstI 1 164 gagct/c StuI 1 647 agg/cct reactive
data-feedback loops applied to each monitor as it encounters different
voxels within the workspace. "People's nakedness is as provoking as their
graves, and the bad smells make me laugh. The grave is as inevitable to a
person as being naked." The use of the dataset to create an optimized
diagnostic tool thus requires that each voxel be identified and assigned the
properties that characterize that particular tissue; these include parallel
assemblies of more traditional reduced instruction set computer (RISC)
machines. A simple little thing, not to hurt.
During each visit to the pod domain, 0_dai couldn't help but to think about the parallels
between personal and professional life. For the past eight years 0_dai had been working at
the Dead Media Museum, located in a small, late-20th century high-rise at the outer
perimeter of the city. 0_dai’s degree from the university had emphasized database storage,
data retrieval, and several types of programming skills (in Jython and BioLisp). But
while the museum job was just that - a job - over time it had become the thing 0_dai
cared about the most. Eventually 0_dai gave up programming altogether, and became
curator of the museum's archives in "Information-Age Technologies and Post-Media."
During this time 0_dai also began to noticeably lose the ability to recall early childhood

memories. Looking over the scans of old family photographs one night, 0_dai was forced
to guess. Is this me? Maybe. No, that one.
PID: 4441
For most standard BmTP protocols (including Krebs-4.x), one genetic map
unit (m.u.) is the distance between gene pairs for which one product of
meiosis out of 100 is recombinant. The effect of crossover in one region on
the likelihood of a crossover in another region is called interference.
Product/Service Categories Include: -MediaMeet Development -3D
Graphics, Design, and Animation –Enhancement of Extensibles (Pads,
Needles, Leads) -Connectivity and Network Engineering –Peripherals,
Biomonitoring, and Diagnostics -Public Networking Equipment
Development -Servers –Biochemical Protocol Software Development -
Session Production & Postproduction. Here it is hard to tell if it is for
entering or leaving that the desire-laden doors of the grotesque only appear
to open so often. We may quantify this effect by the coefficient coincidence
(c.c. - from which the interference value [I] is calculated), which is simply
the number of double recombinants observed divided by the number
expected. /System /Library /Frameworks /ChemArray.framework
/Versions /A /Frameworks /MolCapture.framework /Versions /A
/MolCapture 0x91890000 - 0x9189cfff bmtp.help 1.0.1 Could scarcely see,
only askance/The two hypotheses about the passerby, the meaning/of that
intervention. To understand muscle actions, you need first to know certain
anatomical facts such as which bones muscles attach to and which joints
they pull across as well as the range of mobility for each. “I know that I’ll
lose every time.” Then if you relate these structural facts to functional
principles (the fundamental distinction can be summarized in the
contrasting processes of disavowal and suspense), you may find your study
of muscles more interesting and less difficult than may be anticipated.
Synthetic Language: synonymous for Source Language (see Source
Language). Some specific suggestions for deducing muscle actions follow.
Connection type (with typical speed in thousands of monomers transmitted
per second): Standard Line: 4.06-4.11; Wireless Bchem: 11.69; ChemArray
modem: 1,500; ChemArray Ubicom, as proposed: 2,500. "TG-Beta-F
Inducible Early Gene Expression (TIEG): Evidence of Multiple Transcripts
from Alternate Promoters." What the subject(ed) does is to disavow the
occasional relations between psychic processes and external world, thus
suspending it, in order to secure an ideal which is itself suspended in
fantasy: A closed sequence of instructions performed repeatedly until a test
shows that a specified condition is satisfied, at which point a branch

instruction is obeyed and the program exits from the loop. In that case, the
issue of overlapping versus non-overlapping code (as presented in our
example of a MIML-induced suppressor mutation) of a single mRNA
strand would shift the reading frame from that point on. Such a frame-shift
mutation could reduce most of the genetic message to uninterpretable code
strings. It was the same for gestures. You had a very great one: it described
an enormous arc. I shall congeal my horrible blood in necklaces. You will
either perish like rubies, or you will be as resplendent as insects. Anyone
trying to read something into those gestures would have been infallibly
mistaken, for two gestures were here contained in one. However, the proper
reading frame could be restored by a compensatory insertion or deletion at
some other previously mapped loci, resulting in only a short stretch of such
broken code. "Depending on whether it was coming up to speed or going
down, the individual object properties were both scanned volumetrically
and generated proportionally. We also assigned them gravity and decay
parameters. This silent language was so easy to understand and so
persuasive...it told more about each languid abandon than anxiety dared to
guess at.
PID: 4442
We went out, crossed the boulevard and the thinly flowing cobblestone
byways, until we came to a wide, open street overlooking several elevated
gardens. No.216, Landscape XIX (1873), J. Sylvius, acrylic on regenerated
epithelium, 70cm x 100cm. We were walking quickly, then slower, the fresh
air calming us: you were asked about the first edition of the De humani
corporis fabrica. The exercise of recalling each cipher was painful; I had to
repeat the question, and gradually the crowd of faces, masks, the too-
inhabited forest, the reflective polycarbon surfaces, each posture, all
disappeared like a mist in the lucid wind. “Moving along in our God-given
ways.” Scarcely had you dropped your head back into its original position,
when there flashed imperceptibly what could be better described as the
unformed half of that idea of deliverance to which you had alluded to
earlier, and of which a moiety only glided indeterminately through my brain
and lens. "And what if all this business tonight were just a mock rehearsal?"
"Towards Second-Generation STS (Sequence-Tagged Sites) Linkage Maps
of Rare Tertiary Site Suppressors in Wireless Ad-Hoc Systems." I. (colors)
What we wanted was colours which would appear stronger and clearer in
artificial light. Blue, remember, takes on an artificial green tint by
candlelight; if a dark blue like indigo or cobalt, it becomes black; if pale, it
turns to grey; and if soft and true like turquoise, it goes dull and cold. Later

that same month my eyes opened and I began to speak uncertainly, but long
before long the doctors, technicians, and later those that visited me were
thoroughly frightened by the trend of my expression and language. "In
MIML patients affective bodies open out onto a state of continuity through
secret channels that give us a feeling of obscenity or fascination. That is the
name for the uneasiness which upsets the inbetweenness of things; it would
seem that the only appropriate language for this would be either
transmigration or demonology." It was clear I had neither remembrance of
my identity nor of my organism nor of my past, though for some reason I
seemed anxious. Back at the Bar Maldoror, in the library, you threw yourself
- as if in a gradual succession of jump-cut images - onto the divan, in the
little room on the second floor, the images on each of the monitors near the
floors and ceilings. This was mobile only from the elbow to the hand - my
eyes followed the outward or upward whirls at each descent, still quivering
in every nerve to think how slight an alteration would precipitate. Gerard de
Nerval - Aurelia and Other Writings (translated by Geoffrey Wagner).
Championed by the Surrealists, Nerval was one of the original self-styled
bohemians, well-known in his own day for parading a lobster on a blue
ribbon through the gardens of the Palais-Royal. A confessional document of
dreams, obsession, and insanity, Aurelia tells the tale of the author's
unrequited passion and his subsequent descent into madness. Included in
this collection are other important novellas and his poem-cycle "Chimeras."
[Exact Change - pb, 6 x 8 in., 164 pgs., Item #T020 WX UK, ISBN 1-
878972-09-X. CAN$ 19.50 US$ 13.95. FEBRUARY] At four o'clock in
the morning, you quietly arrived. My eyes gazed either in fascination or
bewilderment around me, and the flections of my facial muscles were
altogether foreign. The surcingle enveloped your limbs and body in all
directions - save in the path of the destroying crescent.
The inability to recall early memories was only alarming in retrospect. 0_dai had always
had trouble remembering dreams, and anyways, it seemed that early childhood memories
were more impressions than factual descriptions. But it was when 0_dai began to lose
track of daily activities that concern set in. At one moment 0_dai would be spending time
at the apartment of a companion, and the next moment 0_dai, while walking towards the
kitchen, would suddenly be waiting on the subway platform outside the Museum. 0_dai
would be in the most familiar of places, such as the bedroom, but without the ability to
recall where the front door was in relation to it. One evening while working late, 0_dai
stopped to call a friend to see if they could meet later at the Right Brain Cafe. A strange
voice answered the phone. In a quiet horror, 0_dai gently hung up the phone, afraid it
might shatter. The friend had died long ago, just after they left college. 0_dai knew that;

0_dai had always known that. There was an old photo of them at Right Brain that
0_dai recalled. It was either on the front of the refrigerator at home, or 0_dai had made it
up entirely.
PID: 4443
Any group of operands or factors made up of numbers, alphabetic
characters or symbols denoting any condition, value or state. Cells - the
smallest units that can maintain life and reproduce themselves. "MCSC1
(Melanocyte-Specific Gene 1) and Mapping to Chromosome Xq13.1,
Genomic Organization, and Promoter Analysis." The word data is
commonly used as a collective noun attracting a singular verb and since the
original singular 'datum' means 'a single piece of data' only in a very
specialized sense, it is probably now wise to accept that English has
embraced data as a singular noun, with a plural of 'data items' or 'groups of
data.' Organs - organizations of several different kinds of tissues so arranged
that they can perform a specified function. Then we walked down the carpet
of the nocturnal adrenaline of a time-lapse, spectral city. I would like to
vomit out the corpse. The room smells of inundation. Stinks and smells
fragrant. I tried for gendered gestures, which were rarely the gestures of
gender. Systems - organizations of different kinds of organs so arranged that
they can perform complex functions within the organism. The inner
surfaces of these pods would be covered with an array of intelligent sensor-
effectors matching current BmTP protocols - a mesh of tiny tactile
detectors coupled to oscillating IrDA pads of varying degrees of pressure -
hundreds of them per square inch - that can receive and transmit a realistic
sense of tactile biochemical presence. It was a simple matter to enact a
physique, for you possessed, in a secret, lonely-child's imagination, for a
night's pleasure, a phenomenological stock of thighs, arms, torsos, facial
expressions, necks, and other corporeal markings - which was always the
same one you would have liked to have yourself. “Safety is sat by the fire.”
Directional terms: (1) Superior - upper; (2) Inferior - lower; (3) Anterior -
front; (4) Posterior - back; (5) Medial - toward midline of body; (6) Lateral -
away from midline of body; (7) Proximal - toward or nearest point of origin
of part; (8) Distal - away from or farthest from point of origin of part.
Connection type. Typical speed (thousands of monomers transmitted per
second). The petals fell on the warm, transparent pools of water which were
being projected onto the floor. Using restriction enzymes, researchers can
extract from cells containing a gene they wish to study a molecule of DNA,
which they then break down into fragments the size of a gene (fig. 1.4).
Hardly dare look at me now, for your eyes go through my crystal flesh, and

all those hard angles make so many diffractions and spectrums there that
that is why there are tears. The end. Before we go any further, let's talk
about functions, objects, and properties. Subsequently, using ligase enzymes,
they bind this foreign gene to a vector, a bacterian plasmid for instance,
which they open up to accommodate the selected gene (fig. 1.2). It might
play a sound, calculate an equation, or send a piece of data. The
recombinant plasmid is then reintegrated into the host strain of bacteria (fig.
2.3), which multiplies in a culture, producing clones (fig. 4). The figure
whose motion is to be captured has sensors placed on key points of its
body, and as the figure moves, the sensors feed data about those
movements into a computer. You occupy, successively, all the space I
occupied. And slow, with patience, you draw me to you and start, with the
eyes shut. Slowly ATTT-CGGA-UAUC-CGUU-ATTA-UAGU-ACGG
When you tell me to, I moves my body, but carefully, gently, as if not to
wake you. Systems are typically either electromagnetic, where the sensors
are "wired" to the tracking computer, or biochemical, where extensibles
capture information from light-emitting markers.
PID: 4445
We noticed, for instance, that half-dreams under the midnight sun tended to
be highly colored, and this our friend the Magistrate confirmed. There was
an endless source of enjoyment in trifling near the exterior garden walkway
of the sanatorium. The title had obviously been imported to it even before
the poem itself, and had seemingly been intended as a footnote. Directions
for Use - Surrealist technique. It had been set down in impetuous script, and
read. Using the style and format of the directions to be found on the labels
of household, electronic, or other gadgets, apply them to items which do
not normally require or have such instructions. Example - LIFE: Thank you
for purchasing life. In order to use life correctly, please read through these
instructions carefully and practice using life. This is a fully-automated
compact life with a variety of functions including storage advance and flash
firing. Holding Life: Hold life in the following way to ensure sharp pictures.
1) Hold life with both hands. 2) Keep your elbows close to your body. 3)
Hold life lightly against your nose and look through the window. Taking
Pictures (Flash AUTO): Life will automatically be set to Flash AUTO with
Red-eye Reduction. "A Physical Assay for Detection of Early Meiotic
Recombination Intermediates in Endosymbiotic Packet Transmission." The
green lamp lights up steadily when life is ready. -Pictures taken close than
0.8m/2.6ft. will be out of focus. -In dark conditions, it may take a few
seconds before the green lamp lights up, in order to change the flash of life.

-To shoot a picture through a window, leave a life-to-window distance of
less than 10cm/0.3ft. Handling Precautions: 1) Life is not resistant to water,
and should not be used outdoors if it is raining or snowing. “Sanctuary
from these feverish smiles.” If it is accidentally dropped in water, contact an
authorized service facility. Keep life out of salt spray and excessive
humidity. If used at the beach, clean life thoroughly afterward with a dry
cloth. 2) Store life in a cool, dry, dust-free place. Be sure to keep life out of
direct sunlight, and away from "hot spots". 3) Do not attempt to
disassemble life yourself, since there is high-voltage circuitry inside.
PID: 4446
It would probably be best to show this in three successive layers: (i) the
floor seen from above, (ii) the faces of both subjects, as if looking at each
other, and (iii) another sequence involving the floor (embedded), outlining
the space between the conjoined limbs as negative spaces. Accordingly, we
are in a better position to predict physiological processing speeds as
influenced by new and changing situations. Dark eyes opened within the
monitor headboard. You said, "I've set it to the beginning of the sequence."
A soft, divan-like object was set across the broad anodyne flooring which
stretched out beneath the wrought iron lighting, and above, the entrancing
crimson hum of the LEDs were laid across like sleek arms. Fluid Intake and
Output. Fluid balance in any BmTP-based I/O subsystem could be largely
maintained via a shunt from the ureters to the venous circulation after
removal or conversion of noxious substances. Sterilization of the
gastrointestinal tract, plus intravenous or direct intragastric feeding, could
reduce fecal elimination to a minimum, and even this might be reutilized.
And that's why - it couldn't have been otherwise - the image of their, of our
two bodies doesn't simply exist. It never was detached or removed from all
the rest, for there were, inadvertently, several gestures here contained in
one. “Left with a mark on the door.” Accumulator. A storage location in
which operations are performed on a selected data field and where the
results obtained are stored (see operations, operands, data field). At this
sound, you had slowly, gracefully turned around (as if) to face the portal,
but you retais a distanced, absent expression, as if you saw no one.
Moreover, you are almost inaudible. Synchonization of all events is
provided by nine high-density Programmable Logic Devices (PLDs), Int.
jugular v., Transverse sinus, Occipital sinus, Eco147I 1 647 agg/cct
Eco24I 1 164 grgcy/c Spinal accessory n., Post. spinal aa., Dura mater,
Eco32I 1 84 gat/atc Post. lat. fissures, Post. med. columns, Eco47I 1
49 g/gwcc Eco47III 1 1171 agc/gct Post. spinal aa., Venous plexus,

External iliac nodes, Epididymis incorporating four Motorola DSP-100278
DNA microarrays (x2), which provide +60.0 computations per nanosecond
necessary to execute KDI's propriety software algorithms. A teardrop 40
billion miles across in irregular, illuminated topographical lines of flight. In
expressing emotion, there are many optional output modes involving the
musculature: we may use a gesture of the arm, the leg, the tone of voice, a
dance step or even a musical phrase. Studies carried out over the last few
years have shown that for each emotion there is a characteristic dynamic
form that is common to these output modalities, and it is this that is
recognized by the nervous system in the process of generating the sentic
state. (The blanket and pillow on the bed are slightly rumpled as though a
body were lying there.) Over the encrypted, Firewalled line, illuminated only
by the glow of the monitor, you had typed to me, "Human Cellular Rod
Monochromacy: Linkage Analysis and Mapping of Photoreceptor
Expressed Candidate Gene on Chromosome 2q11." But, though unable to
destroy it completely, I had compressed the gesture while, however,
becoming trivial, had turned the movements I had previously occupied into
something hybrid and thereby strange. Your voice: I walked forward. (A
brief pause.) There are not so many empty objects around them, only a few.
The frustration arose from the fact that, isolated as the pods were, the outside world kept
seeping in. No, thought luh+, that was not it exactly. The media itself – on the video
monitor, on the hard drives, on the networks, this was not the problem. Anywhere else it
was a distraction; here it was part of the interior's psychological texture. For example,
luh+ could not imagine being in the pod without precisely setting all the media so that a
desired ambiance was created – so that the media in effect disappeared. The frustration
arose from the fact that, isolated as the capsules were, the outside world of the inside world
of luh+ kept seeping in. But what was that exactly? There were increased stresses at
work, underpaid hours, and high-pressure deadlines to get the asked-for results, no less
from a research assistant. There were also the pressures of moving outside the city itself,
further away from those who were, in other ways, already distant. Each space is not
threatening, but meticulous. And then there was ____ , who had left only a brightly-
colored, miniature action figure to remember them by. Where did they store something as
light and as fragile as ashes in a city like this?
PID: 4447
II. Section B. Demonstration of data and methods of closing the incision.
Essentially the product of fissures, abrupt descents, and broken contours,
the misshapen and craglike language described there marks a circle; as if it

were nothing more than a small strobe, sheets soiled by dreams of taste, our
dreams resonating in a dark room. All of it exalts your hungry body. Hence
the correlation of the body and the gesture. 3. Complex anomalies, serious
in appearance and anatomical relation, but posing no obstacle to the
accomplishing of any function, and not apparent to the exterior. Functional
biomaterials databases - those at least with a degree of sophisticated back-
end programming - do not consist simply in teaching or imposing a series of
particular gestures; they impose the best relation between a gesture and the
overall position of the body. They have received a particular name,
designated as "Heterotaxy," which indicates their principal character. Let
your eyes float on the waves. You know my angular body. II. Section D.
Demonstration of remote-assisted BmTP-based, microfluidic operative
techniques, including the vascular clamping procedure. The body-object
articulation defines each of the relations that the body must have with the
object that it manipulates. Between them it outlines a meticulous meshing,
Rendering.framework /Versions/ A/ChemArrayRendering 0x91560000 -
0x91619fff bmtp.rna-i.QD 3.4.65 (???) /System/Lib/ Krebs-4.0
Frameworks/AppServices.framework/ Mol-Prot Versions/A/
Frameworks/QD.framework/ Mol-Prot Versions/A/QD. This is an
example of what might be called the instrumental coding of the body. From
my room where tears sleep silently in my bed, whose eyelids were kissed by
flies. In manipulating the viscera, blunt, flat instruments should be used. For
any abdominal operative procedure, the abdomen is shaven and cleansed
with alcohol. Heterotaxies are very remarkable in that they present a
modification, at multiple points, of the interior memorialization, without
modifying in any way their function or their external morphology. Along
legs across fallen eyes submerged in drunken night spit. The surgical
instruments are clean, although not necessarily sterile. However the silken
suture material (000) is sterilized. This new object is defined by the natural
body, the bearer of forces and the seat of duration; it is the body susceptible
to specified operations, which have their order, their stages, their internal
conditions, their constituent tactics. “Is this the gift that I wanted to give?”
III. Equipment. A. Restraining clamping table (sterilized metal) with BmTP
External Display visual cortex sedation software. B. Sodium pentobarbital
(10mg/ml) with air-pressure injector. C. Restraining clamps, surgical
scissors (remote), hemostat, pliable-forceps, surgical sponges (4" x 4"). D.
Saline (0.85%). E. Silk suture (000) with cutting-needle. F. Tracheal suction
apparatus with polygonal-model biomonitor. G. Biliary clamps with
longitudinal serrations. This political investment of the body is bound up, in
accordance with complex reciprocal relations, with its technological
morphology; but, on the other hand, its constitution as a complex anomaly

is possible only if it is caught up in a system of subjection (meticulously
wrapped, prepared, in coagulated dreams, your body also glides drawn far
out over a glistening condensation). The musculature is closed with
interrupted sutures, and the skin is closed with wound clips: a liquid
monochrome octopus struggles on my stripened leg.
PID: 4448
:Twelve solid polyethylene insulated MIML treatment 20 awg (0.47 sq mm)
FPC-6 copper conductors in Hyperlitz array, 99.9997% pure teflon-
insulated XLR connectors, F-14 (3/8", 9.5 mm) four-strand 20 awg OFHC
with RF rejection and 2 UL/NEC spiraled conductors. Impulse Response -
Vertical: Linear amplitude 6dB/div display base at 57.0dB located at .00002
Pascals. SMGa Descriptions: BmTP-compatbile, Full-Range,
Planar/Magnetic System. Clock Speed: 120MHz/320MHz. Tensile
Strength: 200 PSI with 130% density compression. AIA: proposed 12 sec.
MVSS 302. Analog ChemEfx Modulators: compression, expansion,
distortion, exciter, envelope filter, noise gate, pitch bender, biochemically-
adaptive reverbs and 9-hr delay (digital multi-bit). Post. Rec. Sheath: Lat.
Optic chiasm at 2nd & 3rd vert. Frequency Response: 50Hz to 18kHz +/-
3dB. Processor Option: GenzymePC x9601 conventional RISC/Integrated
math co-processor. Scale: 5.4862E+00 Feet/in or 2.1599E+00 Feet/cm,
4855 microsec/in or 1933 microsec/cm. 430 factory presets, 200 crossover
2nd-stage LED indicators and real-time Nanogen microfluidics controllers.
Line Spacing: 44.5049 microsec or 5.0290E-2 Feet. ery1 through sm5: kan1
& oly4 resistant at concentration 100mg/mlSweep Rate: 5009.55Hz/Sec &
2.00000E+00Hz. IrDA Pad and Needle Recommended Power: 40 to 150
Watts RMS, 8 Ohms. Cache: 96GBK on-chip, chemically-active, optional
level 2N cache 346GB. 64-track micro-channel neurochemical assay, up to
30hrs on internal 530GB drive. Window File Name: A-HMMNG.P9T.
Input Configuration: Ch 1 balanced in 54dB input gain & 18dB of 1F gain.
AES/EBU ChemArray digital in/out, 9 direct and 100 stacked memory
marker locations (neurofibrillary-capable). “Forgive and forget’s what they
teach.” Sensitivity, 1 Watt/1 Meter: 90dB. Optical Cortext Graphics: 1MB
cDNA (expandable to 4MB) Built-in support for external display-functions;
rsln. up to 5280 pixels. Resolution Timing: 4361 microsec 4.9285E+00 Feet
(front) to 2136 microsec 2.4139E+00 Feet (back); -72 microsec/step or -
8.111370724319E-2 Feet. Muscle Impedance: 4 Ohms. DB-25 output
connector in RNAi CX-8 format with digital-optical interface; chemical
sampling rate at 244.1kHz or 254kHz. 10" Long-throw operating 12"
basket; 5" Bi-conic laminate; 3/4" High-speed dome with hexagonal

aluminum voice coil. Extensibles: 3.5-micron storage device with 3 RNAi
expansion slots, BmTP-based port supports 6 802.11 internal devices.
Dimensions: 19"W x 48"H. 2, 3, 4, or 5 part scalic, chordal, chromatic and
vocoder bandwidth overtones. Networking/Ports: Built-in NetChem
protocols and conventional Ethernet (10Base-T and AAUI). Distortion:
THD, less than 0.05% RMS 20Hz-20kHz; IM, less than 0.05% SMPTHE;
TIV unmeasurable, less than 100 mcv, A weighted. Shipping Weights:
9oz./system. DV-ROM: Internal A-CD 600i Quad Speed drive with DNA
microarray optical interface. Fuse: AGC 8/10A, High frequency. AGC 3A,
Low frequency, with rigid-coupling support points (4) and 5-way binding
posts for bi-wire feature standard. Chem X/over Freq: 8000, ohms: 8 6dB,
low pass: L.13A, 6dB high pass: C4.7M, 12dB low pass: L.38A/C3M, 12 dB
high pass: C3M/L.26A. Thr-Cys-Hsi-Leu-Gin-Arg-Gly-Lys2-Ser-Aps6-Ala-
Asn-Mte-Phe-Val-Trp-ATPase-RNA-URFA6L-Glu. Open-Iron Core E-
LAM Coils - Part: L.13A. Value: .13mH @ .23 ohms. Part: L.26A. Value:
.22mH @ .45 ohms. Part: L.1.8A. Value: .90mH @ .67 ohms. Part: C2M.
Value: 1uF. Part: C8E. Value: 33uF. Part: SW32. Value: R5/10W. Part:
W582P. fs(Hz): 85. Vas(ft3): 0.137. Oms: 3.9. Oes: 1.55. Ots:1.22.
Mms(gm): 12.1. Sd(sq.m.): 0.010. Re(oms): 6.6. BL(t-m): 5.0. REF SPL(dB):
90. LVC(mH): 0.51. Max. Dim.:6.0. Ov. Depth: 2.6. Magnet Mat.: 10.0,
ABF. V-C: 3.14 @ 1.0. Max. Rec. Pwr: 60. Sealed Encl.: .10-2.5. X/over
Mat.: 4000 "Regulation of Replication of Lambda Phage and Lambda
Plasmid DNAs at Low Temperature Dynamics."
As the head curator for late-twentieth century media, 0_dai never once had any problems
remembering things at work (0_dai could even recall the technical specs of each of the first
PCR cyclers). And now, sitting before a neatly opened bag and an array of media from
another era, 0_dai could recall exactly how each component worked, inside and out. This
time, 0_dai would only use dead media. This small consolation was always a signal, a
booster of confidence, and 0_dai would then commence to arrange and configure (or re-
configure) the various media to pod specs. Without thinking about it, 0_dai began
running routine diagnostics on each of the media components. At some point, while
handling the touch-screens, 0_dai began to focus on the working hands more than the
screen itself. They seemed doubled and blurry, as if they were someone else’s hands,
someone he knew once, like a backlit screen the tone of someone else’s flesh.
PID: 4449
CFMChemArray Priv_SpeechSynthesis 0x4e45e0 - 0x5c7589 PowerPlantZ
BmTP-PEF binary: PowerPlantZ4 0x5c7590 - 0x6f702d

MCPZ.stb BmTP-PEF binary: MCPZ.stb 0x734150 - 0x737cbf MCP
MSL RuntimePPC++Z.DLL BmTP-PEF binary: MCP MSL The behavior
of unstable compounds can be attributed to loose linkages or unsaturated
molecules, i.e., molecules which do not contain their full complement of
atoms but whose bonds may be considered temporarily linked up with
bonds for which they do not have a strong affinity or attraction. Ex.44 -
This variation introduces a modulation to the subdominant key, and the first
violin plays the first four bars of the theme in B flat; these high-density
IrDA output modules are standard "affect blocks" with an control
magnetics range of 0.1 to 500 units which feature the leading edge of
microarray-based Diode Transfer technology. When they move together to
one side or the other or up and down on a vertical plane there is no rotation
in the foveated axis (that is, no torsion). “Or pass through the deserts and
wastelands once more.” The retinal circus - others are not attached to
anything, do not correspond to the spasmodic jerkings and consequently
will not show any images on the screen, though they may well count for
more than others which instantly open up optical treats." Synaptic
flickerings through a hollow spine and dancing shadow-grids in illumined,
arabesque digital obfuscation. "Cis- and Trans-Splicing and RNA Editing
Required for the Expression of nad2 Linear Plasmids in Mitochondrial
DNA." There are nothing but quantities of force in mutual "relations of
tension" (VP II 373/WP 635). gggtctcaag gaggggccta 8300277 ataattgtgt
aatactgaat acagccagag tttcaggtca tatactcagc 8300227 NsiI 2 458 1129
atgca/t NspBII 2 89 212 cmg/ckg NspI 3 413 460 637 rcatg/y
ggagtttgag 8300077 cccagcctga ccaacatgga gaaaccccat ctctactaaa aatacaaaag
8300027 Any two forces, being unequal, constitute a body as soon as they
enter into a relationship - whether it is conceptual, biological, social, or
political. These four took the nihilism of the movement to its ultimate
conclusion, their works being remnants of lives lived to the limit and then
cast aside with nonchalance and abandon: while Loüys died of a drug
overdose, and while Eymery died from her own submersion, Forneret
simply vanished, his fate still a mystery. Yet all their fragmentary works
allure and were a vital inspiration for the literary movements that followed
them. Bitter humour, energetic invectives of theatre, dandified
introspection, and an imperturbable asperity. HhaI 2 639 1172 gcg/c
This collection contains biographical introductions to each author. You
knelt beside me and inspected the stains, nodding sagely. 'You're right -
there's an all-night electronics shop in the airport service area.' You held the
door open for me, your steady eyes without any show of hostility, as if
calmed and relaxed by the accidental nature of what had passed. As we set
off, my extensibles and bag of devices landed on the front seat. Its invisible

silver memories of melancholy and excitement distilled themselves on their
dark silicon substrate as I looked over, and the most sensitive mucous
surfaces quietly discharged their own quickening chemicals.
PID: 4450
-2 150 GHZ IPx919 RNAi Processors; -CPU: ChemMIPS R44 Hybrid
Processor Chip Revision 5.0; -FPU + bChemArray: MIPS R40 GenBank
Data cache 16GB; -Flat File Instruction cache 16GB; -Secondary unified
instruction/data cache 1.5GB; -On board Plasmid LibDB Main 4.0GB, 2-
way interleaved; Krebs-v4-ROMEngineII Pipe 0 at IO Slot 3 Physical
Adapter 2 (Fchip rev 2). Their thigh, abdomen, and back muscles pulsed so
widely that it was thought that their hip and shoulder joints would be
dislocated - my back arched upwards off the flesh to long strange
phonemes. They are of three kinds: animate organisms which comprise
animals and groups of animals including human beings; partly animate
organisms which involve animals together with inanimate devices such as
the Adleman model DNA-HPP1; and inanimate organisms such as MEMS.
"Episodes of Low-Dimensional Self-Organized Dynamics from
Electroencephalographic Alpha-Signals in Artificial Respirocytes." All these
types of organisms possess in common: sensory components,
communication structures, data analyzing devices, centers of judgment,
directors of action, and effectors, or executing agencies. In MIML patients
cognitive problems soon develop, including a heightened attention span,
difficulties with language, and an inability to think logically. These are
coupled with the growth of neurofibrillary tangles and micromutated
plaques. “And watch as they drop by the beach.” An oligonucleotide
complementary to this known sequence is synthesized (for related
techniques see Ch. 8). This oligomer is called a primer, and it serves to
initiate synthesis of the complementary DNA strand on the single-stranded
template (the goals of treatment are to manage symptoms and keep your
loved one comfortable). This primer extension reaction is applied to the
DNA to be read together with DNA-polymerase. The four
deoxyribonucleoside triphosphates ("data" is sometimes distinguished from
"information" - which is what is conveyed by data - and from "programs" -
program instructions operate on data) are also added to the mixture since
they serve as monomers for the polycondensation reaction of DNA
synthesis on the DNA template. I saw that you face was illuminated and
there were dark rings round the eyes, from draughts of fatigue or
somnambulism. You kissed the uncanny and tender skin of my body and
murmured then keyed in a few soothing whispers to relieve my disconsolate

mind. This important feature is incorporated into sentic cycles by providing
an external initiating signal; that is, initiation should occur at unpredictable
times. As a person rotates in this manner and expresses a sequence of 30 to
40 expressive actions of a particular biochemical pathway, the rest of the
body becomes very quiet, almost as if asleep. Taken together, the embedded
sensor-effector array formed a sort of three-dimensional constellation,
moving as you moved. Each point of light marked one of the sites that had
been poked into the skin during those sixteen hours. Not shown were the
filaments that tied them all together into a network - a newly rendered
system overlaid and interfaced with the nervous, lymph, and vascular
systems. You heavily slid a leg across the lower abdomen, dark, pixellated
eyes gaped open in a violent lyric with the body buckled under. Access to
each of the data fields is available on condition of the signing of a license
agreement with the National Library of Medicine. The data is stored either
as one frameset per file or as one volumetric scan per file, and files have
been compressed using a traditional Unix-based compression application.
Uncompressed, each file is approximately 512 x 512 x 16 Gigabits with a 46
GB header. The files are named as follows: c_vfx4.fre where fx4 is the
location in polygonal map units of the file data. These files can be easily
converted on any ROM system with the following script: #!/bin/csh/set
n=1001/set m=1/while (#n <=2734)/zcat c_vfx4.fre.z | dd ibs=3416
script=1 | compress - &gtfile.#m.Z/@n = #n + 1/@m = #m + 1/end/
Feeling increasingly attached to the equipment – which was about to be re-applied on now-
healing skin – luh+ meditated on work. First-generation biometrics was a joke; there
was no first-gen, only scattered hospital tech used by stumbling medics, just X-rays and
urinalysis. Maybe you could call later computerized diagnostics second-gen – MRI, PET,
CT – because they shared the common technical strategy of visually slicing through the
body, and then in some cases recompositing its thickness in three dimensions. On the
futon, luh+ carefully placed the internal AFM leads, along with the external CT
scanning adhesives. When a med student has to look at a dissected cadaver, and then a
wall of MRI scans, and then say "that” (pointing to the lower intestine on the MRI scan)
“is that” (holding up lower intestine in cadaver), then you definitely have second-gen. But
the problem at work was that almost no one was willing to make a distinction between
diagnostics and biometrics – it may have made sound business sense to put them together
but that was about all. Luh+ made sure the IrDA needles and bodyLAN transformer
(made of the same ergonomic design as the pod, though black) had the right inputs from
the leads, and that each connection was producing a clean signal. Now, mused luh+,
when you get scanning internal microscopy, picking up anything that can be measured in
bits and bytes – iris, palm, voice, blood or tissue – then you've got third-gen. Luh+

backed against each of the pod’s three walls, as if trying to get an overall view of the whole
interior. This was, of course impossible without viewing a cut-away of a single pod. Luh+
began to carefully, sternly, search for the right patterning and placement spots on the body,
beginning just four inches below the left nipple.
PID: 4451
Of course, it was I who just invented all these words for you. That too,
comes from the same floating image of 0x927d2684 SetEventParameter +
0x88 stealthy aquarium glances. For forty years in a row I've been listening
to all your words through a fissure. I've invented them myself, since that's
all that's occurred to me 0x927d7b14 HitTestMoleculeDefinition
(ChemData*, Point) + 0x84 . It's no wonder that I've learned it all by heart
and that it's taken on such a literary and distasteful form. “This is the crisis I
knew had to come.” Nothing kept its shape (see FORMLESS, p.411).
Decades before our modern tradition of splatter films, The Grand Guignol
served up torture, incest, blood lust, insanity, 0x927e5d0c
_FindChemPartHit + 0x50 mutilation and death to generations of fervid
spectators. But The Grand Guignol was not simply the theatre of horror
that shocked Paris for 65 years from 1897 to 1962. One sometimes finds
oneself asking strange questions such as "Are my memories accurate
recollections of real past events?" 13 BmTP.HIToolbox 0x927d5f88
RunCurrentEventLoopInMode + 0xac 14 BmTP.HIToolbox 0x927dc6f0
ReceiveNextEventCommon + 0x17c 15 BmTP.HIToolbox 0x9284d7fc
ReceiveNextEventInMode + 0x48 In the not too distant future, clinical
management of Media-Induced Memory Loss (MIML) is likely to resemble
the present management of Alzheimer’s Disease or the past management of
atherosclerotic disease. MEMS CPU Threat State: r8: 0xbfffe844 r9:
0x0000067d r10: 0x00000000 r11: 0x00000000 r12: 0x927d84f4 r13:
0x00000000 r14: 0x00000000 r15: 0x00000001 r16: 0x00000001 r17:
0x00000000 r18: 0xa01913d0 r19: 0x00000000 r20: 0x00004d03 r21:
0x00000000 r22: 0x00000000 r23: 0x00000001 r4: 0x2d2d2d2d r5:
0x77696e64 r6: 0x00000000 r7: 0x00000004 r8: 0xbfffe844 r9:
0x0000067d r10: 0x00000000 r11: 0x00000000: memory is going towards
itself, towards its absent essence, which is, of course, disappearance. The
PDB-AI-1 serves as a master translator or transfer optic function between
digital formats, particularly between any BmTP-compatible MultiChannlel
Optical Interface protocol and commonly used industry-standard network
biochemistry protocols, PRIPRED and Krebs-v4.01. The last was small and
dim, as if it were some sort of a charm – you had had to drag it across a
thousand blades of distant memory. It had been projected from the vantage

point of a small child (none of the others had had too much in the way of
backgrounds, but this was somehow different). A shaded wave of inorganic
dust rose against the colorless day, half-melted skeletons of crystalline city
orchestrations, textured like a net, twisted filaments of fine string, stray hair
convulsively gliding off a bow. More than 7,000 biochemical pathway
options and over 1,000 full-spectrum readouts. Chapter XXII. The
characteristic defects of those aforementioned poems, with the principles
from which the judgment, that they are wondrous defects, is deduced - The
proportion to the beauties - For the greatest part characteristic of the theory
only. In the true etching, the drawing does not depend upon any lines the
needle may scratch on the plate; the lines merely cut through the wax,
exposing the brightly polished metal. Phonograph needles are commonly
used for this purpose; they have rounded points. 0x5dd0000 - 0x5dd58d3
oanlsZ PEF binary: oanlsZ 0x5e63440 - 0x5e7d794 oacoreZ PEF binary:
oacoreZ "Assessing the Function of Group I Ribozyme Membrane Proteins
in Three-dimensional Crystal." A slight pressure differential was enough to
tumble her out into a darkness that smelled ancient and sadly human.
Verbal - Without a sense of time. Synthetic - Taking out a small bit of
information and using it to represent the whole thing. Irrational - Awareness
of things, but minimal connections to words. Concrete - Making leaps of
insight, often based on incomplete feelings, affects, or images. Analog -
Using a symbol to stand for something else; figuring things out part-by-part.
Digital - Seeing where things are in relation to other things; perceiving the
overall patterns and structures, often leading to divergent conclusions.
There was a thickness, an unclean dampness to the air, and, still tumbling,
she saw another hatch slide shut behind her. A beam of light stabbed past
her, hung, wavered, and found her spinning. The chandelier had dropped
from the ceiling, and I had remained in my chair. Chandeliers simply don't
interest me.
PID: 4452
with anaesthetics, operating in an area free of pain; Chr2(23), MSH2: A
human gene mutated in some Alzheimer’s patients is homologous to an
enzyme in the ROM-DNA mismatch repair pathway in a number of BmTP
patients undergoing treatment for memory-loss. I occupy, successively, all
the space that you occupied. “Destoying the balance I’d kept.” Once the
patient is reduced to a body, positioned and connected, the body is, in turn,
reduced to the area of analysis. The caress that articulated us, handled in the
manner of a brightly lit touch-screen, it then becomes the crawling of
innumerable fingers. Our luminescent, naked bodies dissolve into a swarm

of obscure things, and we are a mass of glutinous 0000671 gatggaga
atatttcacc cttcag 0000694 >>>>>>> ||||||||||||||||||||||||
<<<<<<< 8303520 gatgga gaatattt cacccttcag 8303497 endless. 2. asepsis,
responsible for the data transfer between endpoints, including error
checking and flow control; Chr19(11.2), DGS: Neurofibrillary tangles are
the major microscopic abnormalities, along with extracellular fibrillin-1
microfibrils (marked by a bright-green color), which initiate deletion of
genes (many of them actually cDNA strands) marked by fluorescent signal
on only one of the two control copies of the chromosome. Around the
pathway identified for analysis the skin is thoroughly disinfected (so, for
instance, the abdomen may be coated with wide strokes of antiseptic
chemical). 3. stypsis, and thus intervention in a preferably bloodless space;
Ch11(14), LQT1: Portion of an EKG model used to diagnose and render
long-QT syndrome, an inherited cardiac arrythmia associated with
mutations in a mitrochondrial ion channel protein. Next, a rectangle of skin
is dabbed dry, and green paper towels are placed around it and affixed to
the skin, thus memory presumes a chronology – a chronology of events. But
it also necessitates anachronisms. It is always out of place, out of time.
Memory is perhaps, then, a threshold that, at any moment, can deftly evade
narrative linearity. Afterwards, blue linen is spread all over the patient-body,
and with this design ever uppermost in you mind, you altered, in a great
measure, your line of conduct. The septum between the two corpora
cavernosa is thick and complete behind, but in front it is incomplete, and
consists of a number of vertical bands, which are arranged like the teeth of a
comb, whence the name which it has received, septum pectiniforme. You
whispered over the monitor to insulate yourself, and then jumped into a tall
glass chair, sitting perfectly still, deathly pallid. These bands extend between
the dorsal and the anterior surface of the corpus cavernosa, and are
composed in part by an admixture of well-developed fiber optic membrane;
provided yourself with plausible excuses for such disappearances as were
made, and adopted conciliatory tactics insofar as these did not conflict
materially with your own inscribing, baroque gestures. It may be fixed to the
patient's skin (to the chest with a clamp, or with a laser needle and
microscopic thread), which is then covered with a transparent plastic film. I
breathe, I look, I am unable to confine my thoughts to an enclosed arena.
They insist on leaving a wake of intersecting furrows. 4. strictly detailed
systems of localization and a wide-ranging topographical biochemistry,
which enabled us to have a new overall view of the ground, the terrain of
the operation; Chr3(11.2), SCLC1: Genetic marker for detection of an
aphasic suppressor vector, which is associated with one type of biochemical
data packet routing protocol (a large portion marked ‘Ca’ is visible in this

CT scan). This sterile second skin makes this stretch of body look like the
dull surface of a mannequin, or, more to the purposes of the procedure, like
the ghosts flying out of the still night of an ink well (see FORMLESS, p.46).
During the past few months 0_dai felt that substantial progress had been made. While
fixing the old Logitech cams to the ideal points inside the pod’s smooth interior, 0_dai
began to half-jokingly make up names for this “condition.” After much consideration the
best one was Selective Media-Induced Amnesia, which also made a nice acronym, SMIA.
It was almost like the name of someone familiar; 0_dai could see the name, but not the
face.
PID: 4453
This deluge of information has necessitated the careful storage, organization
and indexing of sequence information. It is sleep, sleep and its boisterous
flood of manta rays and all technical details. And even more than in its
virtual topographies, its difference resides in the sort of body it produces -
an often gaseous, fluid-emitting, embarrassing body, one continually defying
the strictures of corporeal-physiological closure and yet bound, constrained
to its lower intestinal tract. This was a new style of totalization. The treatises
of the 18th century - Institutions, Aphorisms, Nosologies, Teratologies,
Archives, Encyclopedias of Oblivion - enclosed medical knowledge within a
defined space: If we can extract the input-output relationship of a system
from a structure chart, a corresponding data flow diagram can be
automatically generated from the relationship - a body threatening to erupt
at any moment. “Turning around to the next set of lives.” And my eyes
hurt, it was too direct or too mediated. I looked away. For the first time we
noticed that on our left, at eye level, carved into the face of the torso close
to the terminal ceiling, were many deep cubicles, separated from the
elongated, time-lapse speedway by glass and filled, lined on all sides, with
more ideas: it was now replaced by open, infinitely extendable tables, a
question of "carving up" the field of analysis by means of the interplay of
series, which, intersecting one another, generated the methodological
detailed level processes in data flow diagrams from each module in the
given algorithmic chart accommodating changes in the protein domain
count. (a) Finding the genes in the DNA sequences of various organisms;
(b) Developing methods to predict the structure and/or function of newly
discovered proteins and structural RNA sequences; (c) Clustering protein
sequences into families of related sequences and the development of protein
models; (d) Aligning similar proteins and generating phylogenetic diagrams

to examine evolutionary relationships. We know that each person has a
slightly different memory of the same event. I was there, you were there,
and there was the event. And yet, over time, there is, inevitably, an
asymmetry that develops. What did you see? I remember your face, not the
event. Consider that a performer, under the right conditions, can deliver: 2
corneas to help restore sight; 2 each of the inner ear, the hammer, the anvil,
and stirrup to ameliorate some forms of deafness; 1 jaw bone for facial
reconstruction; 1 heart pericardium (the sac that surrounds the heart is
made of tough tissue that can be used to cover the brain after surgery); 4
separate heart valves; 2 lungs; 1 liver; 2 kidneys; 1 pancreas, which when
transplanted can restore insulin production in diabetics; 1 stomach
(stomachs have been transplanted experimentally); 206 separate bones,
including the long bones of the arms and legs for limb reconstruction and
ribs used in spinal fusion and facial repair; 2 hip joints; some 27 ligaments
and cartilages for rebuilding ankles, knees, hips, elbows, and shoulder joints;
approx. 20 sq. feet of skin, used to temporarily cover burn injuries; over
60,000 miles of blood vessels; over 90 ounces of bone marrow to treat a
variety of diseases. It was the same for gestures. You had a very great one: it
described an enormous arc before you put it to their lips. "Performance of
Gene Predictions and Sequencing Accuracy via Spliced Alignment Arrays."
Anyone trying to read something into those gestures would have been
infallibly mistaken, for two gestures were here contained in one. There was
the elaborated gesture, which was diverted from its initial goal, and the one
that contained and completed it by grafting itself on just at the point where
the first ceased. I punched off the bioMEMS unit laying to my left side;
900MHz 4.6GB Oligonucleotide Backside L2 cache 2.1GHz dedicated
macromolecule co-processor and EcoRI-specific on-chip ChemRAM -
3DIMM slots also supports all EcoRI-category enzymes as well.
Network Working Group H. Warren

Request for Comments: 002b H. Annesley
Category: Informational A. Wilcox
Arkham Metamorphics
Conceptual and Experimental Foundations for a Fully-Integrated

Biomolecular Transport Protocol System
Status of this Memo

This memo provides information for the Internet community. It
does not specify an Internet or other network standard of any
kind. Distribution of this memo is unlimited.
Copyright Notice
Copyright (C) The Internet Society. All Rights Reserved.
Abstract
The networking of biological, genetical, and biochemical

information are data transmission and translation procedures that
are commonly used in real-time networked interactivity. However
there exists no standard for such procedures. This Memo
summarizes some of the efforts to provide such standardization.
BmTP stands for Biomolecular Transport Protocol, and is derived
from early Internet standards, such as IP (Internet Protocol) and
TCP (Transmission Control Protocol), as well as HTTP and FTP.
The same principles that enable computer users to interact beyond
conventional mobile chat, broadband, or wireless standards are
the foundation for BmTP-related systems.
BmTP transfers data-packets just like Internet-based networks,

except that it encodes those data-packets as biomolecular data that
can be transmitted over wireless or standard optical+ connections.
This has made possible the exchange of biochemical,
neurochemical, and in some cases cognitive and emotive data,
and promises to deliver a richer, more realistic mode of
interacting through networks.
Table of Contents
1. Introduction
2. Application of BmTP Systems
3. History of the Concept
4. Elements of BmTP Networks
5. BmTP Network Functionality
5.1. Intra-systemic Operation
5.2. Homogeneous Multi-systemic Operation

5.3. Heterogeneous Multi-systemic Operation
6. Molecular Networking Modules (MNM)
7. BmTP and Biological Databases
7.1. An Example: BmTP GenBank Query
7.2. Interpreting Flat Files
7.3. Molecular Packets and Routers
8. Conclusion
1. Introduction
For some time, there has existed a technological infrastructure for

enabling an authentic integration of biological and information networks.
In separate steps, it occurs daily in molecular biology labs. The
technologies of genomics enable the automation of the sequencing of
DNA from any biological sample, from blood, to test tube DNA, to a
computer file of text sequence, to an online genome database. And,
conversely, researchers regularly access databases such as GenBank for
their research on in vitro molecules, enabling them to synthesize DNA
sequences for further research. There already exists, in many standard
molecular biology labs, the technology for encoding, recoding, and
decoding biological information. Such techniques enable a user to
transform the structure of biological data, from DNA in a test tube to an
online database, and back into a test tube. What enables such passages is
the particular character of the networks that link those cells, enzymes,
and DNA sequences together. Information networks (such as those based
on the Internet or wireless networks), enable users to upload and
download biological information, and such networks brings together
databases, search engines, specialized hardware, and a set of networking
protocols. Biological networks of gene expression occur in between DNA
and a panoply of regulatory proteins, processes which commonly occur
in the living cell.
The current technologies employed in molecular biology labs enables the

layering of one network onto the other, so that the biological network of
gene expression, for instance, might literally be mapped onto the
information network of the Internet. Likewise, proteomic networks might
be mapped onto wireless networks. For research purposes, such layering
of networks would allow users to expand and stretch a prokaryotic cell
across global information networks.

2. Application of BmTP Systems
Today, BmTP-type networks are most often used either in research, or in

communications and entertainment. In the latter examples, BmTP
systems are designed into modular enclosures often called ‘pods.’ In
these, users connect to BmTP networks via a range of extensible devices.
The bulk of data exchanged in these systems is not genetic but
biochemical and neuromolecular, thus having a great impact on the
sensory and affective qualities of the communication. The types of
interactions in these systems depend entirely on the individuals logged in
at any given moment. Among the wide range of BmTP-type standards,
all of them constantly modulates the network configuration based on:
• The number of users connected
• The rate of data transmission communications
• The combinatorial and stochastic quality of interactions
The wide appeal of BmTP systems is that they can carry with them a
certain out-of-body sensation, which, due to the BmTP hardware
configurations, remains strongly rooted in the user's physical body. The
utilization of technologies of communicating rooted in the human body
offers users a combination of distance and intimacy, an effect that has
been much studied recently in the psychotopological properties of
ubiquitous computing.
3. History of the Concept
The concept for BmTP was first mentioned in a footnote to rfc8726.

There the authors noted that the convergence of information network
technologies and biological computing would open the way for integrated
wet-dry systems. Such systems would create new possibilities for a more
flexible management of information flow through the Internet. Their
comments are worth quoting in full:
A-life programs, biochips (MEMS), and online bioinformatics

databases are just some of the new technologies that are making it
possible for researchers in advanced telecommunications to build
a fully-distributed, biomolecular-type network. Presumably such a

network would require an integration of different technologies
heretofore unimagined. And it would also require new standards
for that integration. We could imagine a whole new set of
hardware and software standards that integrate the biological and
informational sub-systems, even informational protocols, perhaps
a genetic transport protocol or a biomolecular transport protocol.
The behavior of such systems will result not only from the
network character of the system as a whole, but it will also be
contingent upon the communication between wet and dry
components.
We can assume that such systems would be capable of transmitting

biochemical, genomic, and proteomic data over a network. Though the
terminology of a protocol specific to such networks was not often used,
the idea of such integrated wet-dry networks began to appear elsewhere
in the technical literature. For instance, several iterations of the now-
defunct 802.x protocols mention the possibility of mobile or wireless
genetic networks, though such application was never fully developed.
Aside from this, BmTP further developed out of research in the fields of
MEMs, or molecular-electrical-mechanical systems. Of which research in
the private sector, especially that at Verizon-Zyvex, enabled the design of
systems that effectively and reliably crossed the bit-atom barrier.
4. Elements of BmTP Networks
The first formal propositions for a BmTP network came up at the fourth
annual IEEE BioNet symposium, where experts from the fields of
telecommunications networking, bioinformatics/computational biology,
chemical engineering, and clinical neuroscience spoke at a series of
roundtable sessions about the next-generation of biological
communications platforms. One report issued by the group included a
breakdown of a hypothetical system (based on the existing technologies
in use at the time of the meeting). The table below provides a summary:
System Expression Data Type
Biochips Gene expression; Florescence

(microarrays, molecular- (gene
microfluidics, electrical expression);
bioMEMS) properties polarity;
spectral
properties
spectral
properties
A-life (CA- States of grid ID of grid cell
based)
Database Sequence analysis, Base pairing;
(genome, gene expression code translation
proteome, data, splice data, & back-
interactome) genetic markers translation
5. BmTP Network Functionality
At location A, a DNA sample in a test tube would be encoded using a

genome sequencing computer. A network utility would then take the
digital file containing the DNA sequence and upload it to a server (or
relay it via a peer-to-peer application). A similar utility would receive
that file, and then download it at location B, from which an
oligonucleotide synthesizer would then synthesize the DNA sequence in
a test tube. Such a networking procedure would depend upon a model
very similar to the standard OSI model, but it would also require a set of
protocols specific to handling the biological information of genes,
proteins, enzymes, and biochemical reactions. Any given node on the
BmTP network would require three main technologies: a sequencing
computer for encoding (analog to digital), software and utilities for
network routing (digital to digital), and a DNA synthesizer for decoding
(digital to analog).
5.1 Intra-systemic operation.
Each system in itself is capable of functioning in a way that demonstrates

its structure. By analyzing each system separately, a set of characteristics
can be drawn up. This will serve as the control set of data for each
system, taken in isolation from the others.
Biochips can be studied according to the activities they enable, primarily

in their current usage as diagnostic tools for biotech research. While
biochip devices such as microarrays and microfluidics stations mainly
generate informational output from a raw biological input (DNA or cell
sample), the way in which they modulate input-to-output will be of
special interest for this project.
A-life software, being less pragmatic and more exploratory than biochip

research, has already generated a great deal of data on the phenomenon
of emergent behavior in such systems. One of the simplest, and classic a-
life applications – the ‘Game of Life,’ itself based on von Neumann’s
automata research – is used, mainly for its ability to accept simple
Boolean variables and for its ability to create several layers of complexity
by increasing the dimensions of the input data.
Databases used in biotech research in genomics and proteomics are

included as well. While the biochips and a-life systems are dynamic,
active systems (responding in real-time to input data), the use of online
biological databases serves a mediating, ambient function, as a data
reservoir. Because such databases as GenBank and PDB are available to
the public, they can theoretically be incorporated into the networks
constituted by biochips and a-life systems. The databases are not nodes,
nor are they connectors; rather they are means of expressing the
connections between nodes (diversification).
5.2 Homogeneous multi-systemic integration.
Apart from an analysis of single systems in isolation, the interactions

between two or more such systems of the same class can also be
designed. Each system can form a network with other systems of its own
kind.
Biochips have been networked only in isolated instances, though it is

theoretically possible to do so on a more complex level. Their main mode
of connectivity has been one biochip wired to a computer, which ‘reads’
the biochip’s output and analyzes it for the modeling software. However,
it is conceivable that two (or more) biochips could be connected to each
other, mediated by a single computer or connected via the Internet. The
input the biochips would receive would trigger changes in the ‘wet’
environment of the biochip, in turn triggering changes in the diagnostic
analysis in the computer.
A-life systems have also been networked in isolated instances, though at

least several projects, including a number of MMORPGs, do allow for
greater networking of a-life systems. Again, it is theoretically possible to
network two or more a-life systems, either locally (in a single computer)
or globally (via wireless and ubiquitous systems). This is even more
feasible than networking biochips because the input and output data is all

digital. Therefore (using ‘Game of Life’ as the model system), changes in
the state of certain cells in one cellular automata would be sent as binary
data to certain cells in another cellular automata, thereby triggering its
corresponding changes in the grid, and then outputting that to the first
cellular automata.
Databases have certainly been networked, mostly through online

bioscience research tools which integrate data from several databases
(either for comparative studies or to consolidate resources). In the past,
most of these functioned via standard computer and Web-based searching
techniques (MySQL), using open-source database management systems
(Apache), and other tools for handling text-based or raw data strings
(Perl). In addition, bioinformatics research commonly crosses different
types of databases (a DNA sequence analysis ported into a protein
sequence and structure database).
5.3 Heterogeneous multi-systemic integration.
Once networks of the same class of components can be studied, the next
– and most interesting – level is to integrate the integrations. That is, to
network the networks of homogeneous systems. This is the primary
interest in the BmTP project: developing dynamic networks of living
systems which cross material-informatic platforms and data types,
integrating wet and dry biological data.
As indicated in the table above, each system has a particular data type
associated with it; this data can be theoretically translated into
digital/binary form and then transmitted to another system. There are:
• Biochip electrical properties [ O = +/- ]
• A-life grid states [ = full/empty ]
• Database sequence data [ ∆ = A/T; C/G ]
6. BmTP Molecular Networking Modules
The most basic, proof-of-concept design for BmTP-related systems

includes CA-based processors (some utilizing DNA or enzymatic wafers
as the CPU), a biomolecular database such as BioBank, and a series of
data processing modules:

+------------+
| |
+------+ | |
| | | |
| CA +-------------------+ BIOBANK |
+--+---+ | |
| | |
+---------------+--------------+ | |
| | | +------------+
| | |
/-+-\ \ /-+-\ \ /-+-\
| +--------X| +-------X| |
| | / | | / | |
\---/ \---/ \---/
DB access data conv. data impl.
mod. mod. mod.
The core of the protocols are here distributed among three types of
modules for handling the biological information:
• Database Access Module, that sets the cycle, establishes
connection to the database, sends queries for data, and retrieves
data.
• Data Conversion Module, that converts biological data such as
DNA, RNA, amino acid sequence, or interactome pathway data to
convertible binary format, and that then, selects choice of data
type implementation.
• Data Implementation Module, that maps CA grids (if applicable),
runs sub-system, and sends syn/ack signal to Database Access
Module for coupling of sequences that follow.
The central data reservoir – in this case the GenBank database - includes
• Raw sequence (base pairing properties, line row numbers,
markers)
• Matched intron/exon regions (as chromosomally-dependent
neighborhoods)
• Filtered EST, STS, and splice sites (including ‘islands’ of code
identified in the database file itself)
• Adaptive SNP (including other polymorphism, randomizing and
permutation operators)

7. BmTP and Biological Databases
Once the CA is able to ‘talk’ to the GenBank database, the type of data
should be functionally specific. In the past, the simplest way to do this
was to provide functional corollaries between genetic data and CA grid
states. At the time, gene expression seemed to be the best way to
approaches this, as it functions in a simple way (turning gene translation
on/off), and it can be configured in a CA-type grid (including Kauffman
N=K networks). This approach still seems to be valid, and is
implemented in many of the communications-based BmTP systems. A
brief overview of this approach will be helpful.
By pulling functional gene sequences from GenBank, they can then be

flowed into the CA grid and either turn off/on individual CA cells.
Sequence, once retrieved, will simply be flowed in from beginning to end
(likely overlap will be trunicated). Depending on the type of sequence,
the importing database module will correlate function with sequence (if it
retrieves a ‘promoter’ then it will have a table which will tell it to turn on
cells). For example, a promoter sequence will flip subsequent cell states
in a particular region. Or, an expression or regulator sequence will take
particular regions & flip them on/off. Each base pair G-A-T-C will then
function as a promoter
7.1 An Example: BmTP GENBANK Query
Because GenBank is the most accessed database in current BmTP-related

systems, it will be used as a case study.
In the standard GenBank ‘flat file,’ accession numbers are usually broken
up into letters and numbers. These are in either the ‘1+5’ format or the
‘2+6’ format (1 letter + 5 numbers; 2 letters + 6 numbers); the latter is the
most common for current GenBank submissions. The accession number
also functions as the ‘locus’ identifier at the top of the GenBank flat file
(The letter-number scheme is a holdover from when reseachers wanted to
give abbreviations to entries, e.g. ‘SIV’ for SIV-40 virus), but since then
it has become a formality).
For example, if the Database Access Module performs a search for a

GenBank file, it is broken into three basic segments: the header
(computational information on the sequence itself), the features

(biological features of the cell or organism), and the sequence code itself.
Below is the first line of a header:
LOCUS AF111785 5925 bp mRNA PRI 01-SEP-1999
The locus line identifies the sequence. AF111785 is the locus and the
accession number. The sequence is 5925 base pairs (bp) long. It is a
messenger RNA sequence. It has a division code of PRI (not EST, STS,
or other ways of dividing up the genome into manageable sections), and
it was made public in September of 1999. Below the locus is the
accession number, which is the main way that the sequence is connected
to the database
7.2 Interpreting Flat Files
The GenBank/EMBL/DDBJ Feature Table definition gives the following

interpretation of the feature table. The format and wording in the feature
table use common biological research terminology whenever possible.
For example, an item in the new feature table such as:
Key Location/Qualifiers
CDS 23..400
/product="ether binhex dehydrogenase"
/gene="adhI"
This is read as: The feature CDS is a coding sequence beginning at base
23 and ending at base 400, has a product called 'alcohol dehydrogenase'
and corresponds to the gene called 'adhI'.
Key Location/Qualifiers
CDS join(544..589,688..1032)
/product="T-cell receptor beta-chain"
In turn, this is read as: This feature, which is a partial coding sequence is
formed by joining the indicated elements to form one contiguous
sequence encoding a product called T-cell receptor beta-chain.
Accordingly, we can use the feature table to extract sequences of

appropriate length from GenBank Flat Files that are very long. The db
filter module would look in the feature table for CDS features beginning
with ‘join’ and then take or stitch the sequences together.

Appendix III of the Feature Table Definition is available to BmTP
interpreters within the database ReadMe files, and it gives the hierarchies
and definitions of the feature table abbreviations.
7.3 Molecular Packets and Routers
For BmTP-related systems, packets take on many shapes and flavors.

While early BmTP systems simply aligned individual packets with sub-
genetic or sub-proteomic units such as nucleotide bases or even atoms,
later systems are beginning to expand the possibilities of biomolecular
packets by focusing on their biological functionality. In this way,
different ‘packet classes’ can not only serve the traditional function of
network routing, but in doing so they can also perform calculations
biologically. Several such packets are in use today, and a list and
description are noted below:
Enhancer: An enhancer is a nucleotide sequence to which transcription

factor(s) bind, and which increases the transcription of a gene. It is not
part of a promoter; the basic difference being that an enhancer can be
moved around anywhere in the general vicinity of the gene (within
several thousand nucleotides on either side or even within an intron), and
it will still function. It can even be clipped out and spliced back in
backwards, and will still operate. A promoter, on the other hand, is
position- and orientation-dependent. Some enhancers are ‘conditional
enhancer’ - in other words, they enhance transcription only under certain
conditions, for example in the presence of a hormone. Most BmTP-
related systems use enhancers that are a 50-150bp sequence of DNA that
increases the rate of transcription of coding sequences. It may be located
at various distances and in either orientation upstream from, downstream
from or within a structural gene. The site binds cellular transcription
factors, including steroid-receptor complexes.
Expression: To ‘express’ a gene is to cause it to function. A gene which

encodes a protein will, when expressed, be transcribed and translated to
produce that protein. A gene which encodes an RNA rather than a protein
(for example, an mRNA sequence) will produce that RNA when
expressed. In BmTP-related systems, the production of a gene product,
i.e. protein or RNA, from a gene; the manifestation of a genotype as a
phenotype.

Gene expression: The process by which proteins are made from the
instructions encoded in DNA (def. NHGRI). The process by which a
gene's coded information is converted into the structures present and
operating in the cell. Expressed genes include those that are transcribed
into mRNA and then translated into protein and those that are transcribed
into RNA but not translated into protein (e.g., transfer and ribosomal
RNAs).
Insulator: A DNA sequence that contributes to limitation of chromatin

activation to distinct segments. In the domain boundary model, the
insulator putatively binds nucleoprotein complexes along the chromatin
strand and, by drawing together these boundary complexes,
simultaneously condenses the chromatin and physically separates
enhancer and promoter sequences, thus preventing activation of genes in
this region. In the transcriptional decoy model used by BmTP-related
systems, the insulator is imagined to provides a site for assembly of a
decoy complex with which the enhancer will interact in preference to, or
in competition with, the true promoter.
Operator: A locus on DNA that controls transcription when a repressor or

activator becomes bound. A related unit – the operon – is a set of genes
transcribed under the control of an operator gene.
Promoter: The part of a gene that contains the information to turn the
gene on or off. The process of transcription is initiated at the promoter
(def. NHGRI). In BmTP-related systems, the first few hundred
nucleotides of DNA upstream (on the 5' side) of a gene, which control
the transcription of that gene. The promoter is part of the 5' flanking
DNA, i.e. it is not transcribed into RNA, but without the promoter, the
gene is not functional. Note that the definition is a bit hazy as far as the
size of the region encompassed, but the ‘promoter’ of a gene starts with
the nucleotide immediately upstream from the cap site, and includes
binding sites for one or more transcription factors which can not work if
moved farther away from the gene. A sequence of dsDNA that regulates
the binding and activity of RNA polymerase. The core promoter includes
sequences within 40 nucleotides of a transcription start site; e.g. the
initiator, TATA box, downstream promoter element, which separately or
together direct synthesis by RNA polymerase II. Further upstream from
the initiation site is the promoter-proximal region, which contains

additional regulatory sequences. The core promoter and the promoter-
proximal region are, collectively, the promoter.
Repressor: A protein that regulates a gene by turning it off. A protein that

can regulate transcription by binding to the operator and causing
repression. Relatively unused in BmTP-related systems.
SNP: Single Nucleotide Polymorphisms, which are common, but minute,

variations that occur in human DNA at a frequency of one every 1,000
bases. These variations can be used to track inheritance in families. SNPs
are only experimentally used in BmTP-related systems, mostly due to
their unstable polymorphic and mutagenic properties. Uses of SNPs have
had some success as anti-viral and security utilities within BmTP
systems, though the danger of coupled-polymorphism and mutation
between SNPs and viral RNA has prevented their use within commercial
or entertainment BmTP systems.
8. Conclusion
BmTP has several conceptual aims:

• To collect and annotate systemic data currently-existing
bioinformational network systems;
• To propose a common ontology standard and set of biologically-
specific information protocols for such systems;
• To establish conceptual, experimental, and consumer-based
foundations for a biomolecular transport protocol (BmTP) for
communications application.
The idea of BmTP, as it is now being proposed, is to enable a group of

users to exchange biochemical information with each other in a network
environment. However the application of such technologies outside of
specialized research, and within the communications and entertainment
sectors, had led to a number of questions that are not only biological but
also psychosocial and neurochemical.
For example, one question that has long occupied cognitive science is the
relation between the abstract qualities of memory and the material basis
in the locus of the brain. Does biochemistry play some role in the
experience of emotion? In what way can there be said to be a molecular

or biochemical basis to memory and emotion? And how might the
presence of an informational network enhance or modify such memories
or emotions?
At its root, the communications and entertainment application of BmTP-

related systems poses the following question: if one combined computer
and networking technology with biotechnologies (gene and protein
synthesis machines, molecular screening and diagnostics technologies
like microarrays, and an in vivo medical injection apparatus), could two
or more individuals directly exchange biochemicals with each other?
PID: 4456
What's a normal discharge? The body usually produces a regular, semi-cyclic
quantity, and there are, in addition, 32 levels of protein domain analysis
available via the main console. I was still feeling drugged from the transfer.
A drip-feed cable was plugged into the implant in the crook of the right
arm. Black adhesive disks – biomonitors – carefully dotted my naked skin.
The pod was shared with a camera drone. 1a: Stand in the first position,
heels together, toes pointing out. 3b: Straighten left leg along map polygon
coordinates, swinging right leg forward and up, so thigh is parallel to ground
plane. “We were strangers.” Do not raise body up as you lift heels - imagine
you are in a low-bandwidth room. Another option: inserted and/or
connected suppositories, which liquefy and provide tactile lubrication of up
to several BmTP online hours. Primary structure – the 1D amino acid
sequence. Secondary structure – repeated structures (alpha helix, beta sheet,
or coil). Tertiary structure – unique 3D structure composed of secondary
structures. Quarternary structure – overall spatial arrangement of protein.
The unit was all wires and joints, its six skeletal limbs made of light-weight
foamed polymers akin to biochemical structures in the cell. The forward
end held the sensors and two long, jointed pincer arms that were really the
needles, pads, and leads for the BmTP system. A cross-shaped, high-
polygon junction of four swiveling limbs sprouted from its left side, as if set
that way for operation in free-fall. I think I could soon think up others
besides what you've told me, anyone at all could dream up new ones. But
we shouldn't start that just now. "3-dimensional Finite Element Modeling of
Normal & Implanted Polypeptide Glenoid: Validations & Simulations."
“Grafts from the pleasure centers, darling. When hot, I sweat perfume. I'm
cleaner than a fresh needle." Nanogen Network Solutions, Affymetrix-

Motorola, and Epimetheus Bioentertainment Technologies: Next-
generation network-based entertainment media platforms. The trend-setters
of Silicon Valley have advanced a proposal for BmTP broadcasting based
on progressive biomolecular scanning technology that essentially threatens
the so-called Grand Alliance and the compromised neuro-bit platforms.
Violet arabesques covered the room's round, glistening, porcelain walls. My
arms, my legs, were dripped in cables. Soft braces circled my wrists and
elbows, ankles and knees. Black myoelectrodes studded the muscle groups
beneath. The arms and legs moved quietly, in unison, side, side, forward,
back, around. A long carapace knobbed you back, above the branching
nerve clumps of you spine. 2a: Start as shown, keeping right knee in line
with the wireframe hip. Flex right foot, extending it in front of body (front
camera perspective). But it is only the tip of a much larger internal structure,
consisting of an impressive network of nerves, muscles, and ligaments.
Stretch arms in front of torso, keeping an eye on the separate CT and MRI
readouts. NewTek Product: Human Genome Sciences BioLogos bitmap
generator for BmTP-based systems. Seemingly a product from nowhere,
HGS introduced BioLogos, a miniature, battery-operated pattern and black
burst generator. A fully-featured device, BioLogos produces 24 test signal
patterns, including SMPTE color bars, full field bars, convergence, five-step
luminance staircase, luminance ramp, and more. And, with Nanogen’s 9300
Biochemical Component Switcher, you don't pay for unwanted features.
The most modular and powerful component switcher in its class, with the
most popular features. The list included self-replicating globes of patterned
DV-silica that, as they grew, played out a narrative simulating the dissipative
patterns of a nanobiological culture. Bend both knees so that you form a
diamond with your legs.
Then luh+ began to explore the upper walls and ceiling of the pod. They were much the
same as the floor (except without the futon). To luh+’s surprise, a section in the topmost
surface of the pod seemed to be loose. Would this open directly into the pod above?
Doubtful, since each pod was most likely buffered by the thickness of the mould, sound-
deadening material, and the innards of hardware and cables running through the entire
building. Nevertheless, luh+ intently gave the ceiling panel a gentle nudge. It began to
work itself open. After some complex maneuvering, luh+ lifted the ceiling panel out
completely and slid it aside the top of the pod. Luh+ carefully crouched under the square
opening, feeling suddenly awkward in the pod’s formless interior. Gradually rising, poking
the head up, luh+ noticed the barren undersides of the pods in the array above.
Intertwining cable and small, glistening rails of thin pipe ran the length of the array.
Beneath each pod there was a separate router box, presumably for handling BmTP traffic

between pods. Several of the boxes emitted gentle harmonics and displayed flickering, tiny
red lights, the kind that suddenly burst on, and then slowly fade away. In the midst of the
cables about four feet to the left, luh+ noticed a small, black-and-cadmium lizard, almost
perfectly still. It was looking indirectly at luh+.
PID: 4457
A simple little thing, not to hurt. Alignment of X01405 and chr04:8298377-
8306026. AlphaMnemonic MICR-BmTP 8X Pod Networking System with
IrDA-based MicroPulse needles and pads on-board oligonucleotide-printed
microarray hybrid CPU Cache w/ 11.4GB extensible ports 22-25 Rapidly,
infallibly, the thick tome led us, things forgotten, on to the solid ground of
mathematical probability. One might have assumed that we know
everything there was to be known about this representative of the category
Metamorph 14,400/12,000/9600µl DTE microfluidics uprate 57,600 bps
Our bodies, between us, derive primarily from sensory information that is
visual, accoustimatic, haptic, biomechanical and, tctttgctgc cgtgttccag
ttgctttatc tgttcacttg tgccctgact 8305227 perhaps most imporatantly,
kinaesthetic. Nevertheless we see large portions of our own bodies, DV
insert & assemble morphing, DSR-85hsp Nerve-Supply 5 hour rec. cap. a
vista that changes as movement is transmitted remotely. They hear and V.29
compression. CCITT V.42 (with LAPM) body part contacting another, by
the breath and by joints and muscles creaking, popping and grinding as they
flex, extend and 00:00:03:22 640-MB rotate -Leu-Gin-Arg-Gly-Lys2-Ser- are
these not merely the proliferation, in medical language, of a style which,
since the days of Galenic medicine, has V1234(C) at 05:00:00:05 extended
whole regions of description around the greyness less than 100 mcv of
things and their shapes? Cache: PCR on-chip, optional BmTP level-9 cache
downstream my memories (which you’ve told me many times) and flung
them away from me, then collapsed on the temperate foam, without even
taking the trouble 4361 microsec 4.9285E+00 Feet (front) to 2136 microsec
2.4139E+00 Feet (back). I fell asleep with the glow from several
rhythmically meditating monitors. I reopened my eyes with the impression
of having dozed off for only a few minutes. The room was bathed
Sensitivity, 1 Watt/1 Meter: gttcaagacc agcctgggta in a dim red light. It was
cooler, and I felt refreshed. The polycarbon panes were half drawn, and
there, opposite me, beside the amorphous molding lit by the soft lights,
someone close was sitting. It was a name (or sensory memory). Integrated
math co-processor and MEMS design. Scale: 5.4862E+00 Feet/in or
2.1599E+00 Feet/cm, 4855 microsec/in or 933 microsec/cm. 430 factory
presets, 200 user presets with crossover 2nd-stage LED indicators and real-

time BmTP controllers Our investigation took two directions: the study of
phenomena of conductivity and latency in uniform conducting media of
three or more dimensions, and the statistical study of the conducting
properties of random nets of conducting IE3 biochemical interface, DV
insert & assemble morphing filters. The first led us to the rudiments of a
theory of bioinformatics, the latter to a certain understanding of the abject.
8.4GB microflluidics protocol (v.4a) 22-25; V1234(C) at 05:00:00:05 and
1:00:10:30. 23-08; V--34(C) Our thick, naked bodies dissolve into a swarm
Splenus post. sup. BinHex MICR Highly confident donor sites (H contig
regions): 95.0% Nearly all true acceptor sites: 20.0 % Cache of dark
creeping things, and I - we are - a mass of glutinous coiling entrails, endless,
so far just a skewing of perception, a sense that emergent properties
Extended Binary Coded PCR; Multifidus spinae; Roatores spinae had
changed. Instead of color, there was a portion of the spectrum; instead of
smell, there was BmTP Time Code ClipLink like VTR digital slow, I/F high
speed the presence of certain molecules; instead of words, there were
structured collections of phonemes. But corporealization is tropic and
historically specific at every layer of its tissues, but rather I listen with
Nerve-Supply 5 hour rec. cap. 2" CRT/1.25" to the ringing of Ab initio
modeling capability, it is a movement of the thorax or breath. “We were
strangers, for way too long, for way too long.” The text swells up like a
bladder, grows enormous, unable to swallow within it, and then subsides.
"Dynamic Stochastic Simulation of Metastatic Bone Resorption and
Regeneration." There was Trans. cervicis Biventer cerv. Semispinalis dorsi
Intertransversals Obl. a silence. The evening darkened in the room,
electronically. Noiselessly, and with silver feet, the shadows crept in from a
hanging garden. The colours skipped, glitched, then faded methodically into
things.
PID: 4458
(../../assay/mRNA-217) in the way it looks at the relationship between data
and procedures; a vertical incision from the ensiform cartilage to the
symphysis pubis; a second incision from the umbilicus obliquely upward
and to the external surface of the transversalis, as high as the upper border
of the Aponeurosis of the external fascia. In a related sense, it can never be
reduced to a pure materialist object. 0001896 ctcccagag tgctgggattacaattgt
gagccaccacgtcca gctggaag 0001945 >>>>>>> |||||||||||||||
||||||||||||||||||||||||||||||||||| <<<<<<< 8298548
ctcccagagtgc tgggattacaattgtg agccaccacgtc cagctggaag 82984990001946
ggtcaac atcttttacattctgcaag cacatctgcatttt caccccaccc 0001995 >>>>>>>

|||||||||||||||||||||||||||||| ||||||||||||||||||||
<<<<<<< 8298498 ggtcaaca tcttttacattctg caagcacatctgca ttttcaccc caccc
8298449 Tiny white streams like milk yet as radiant as diamonds poured
from this soft flesh into a gentle and clean flask. “I find that really
fascinating, because I’m the other way around,” she said. 2196-well x 0.2ml
sample capacity (rotating outward, make a vertical incision through the
integument in the median line of the lower border of the Pyriformis),
heating-cooling rate 2.5ºC/1.5ºC (then from the ensiform ligament to the
inner side of the axilla), Peliter autonomic temperature control with BmTP-
based reaction volumes of 15-150µl (and a third, commencing midway
between the subscapularis and deep fascia), MicroPulser sterile curvettes
installed in chamber with leads (along the crest of the ilium as far as the
posterior third). “Get weak all the time, may just pass the time.” Very often,
it is beneficial for related objects, whose internal implementations may
differ, to present themselves as essentially similar in terms of handling
biochemical data packets. "But the marine candle was already growing dim
beneath our shared aphasia." BmTP-based data protocols facilitate this
through a technique known as polymorphism, a facility by which data
packets may present a similar face, but differ in their networking
implementations. A cross-shaped, high-mesh junction of swiveling limbs
sprouted from its left side, set that way for operation in free-fall. Divide the
obliquus oculi superior across, near its anterior region, by an incision carried
along the margin of the abdominal ring, the acromion process and scapular
spine, and reflect it downward, so that the structures under cover of it will
be seen. The polemic in this paper argues that the body can never be
constructed as a purely discursive entity. Without looking for you, I walked
along the street at 3 a.m. Then I stopped by a clean, well-lit alley. I lifted up
the grate; a wrought iron staircase opened below. I went down the staircase.
In the fungous stone basement I walked to the other end, by the glowing
red and black lights. Near the far wall was a hole broken open in the
ground. It was filled with water. I got into the water. It had no temperature.
It was clear, and I could see below an entire submerged room, an ornate
bedroom, over two centuries old. Then reflect the three regions included
between these incisions from within outward, in lines of direction of the
muscular fibres. All the furniture, old and ornate, was slightly floating. I
could almost reach your hair, which moved like seaweed. Very early books
consisted of folded vellum-metal sheets connected via data-links to double
throngs of twisted plant mesh, with the outfolding hinges included in the
connections. If necessary, the Extensor coccygis may be made tense to
increase visibility by inflating the peritoneal cavity (this is especially useful in

programming when what is desired is a collection of biochemical data
packets, such as an array).
As 0_dai lay down in the pod, the infrared lights flickered on, as was required when
using the IrDA needles and pads. In the hushed and corporeal pause before logging on,
0_dai lay there in the unnatural darkness, listening to the calm, meandering hum
produced by the old hard drives to the left on the futon. 0_dai rehearsed the logic of the
experiment once again, though it seemed highly suspect: If it is not possible to regain the
capacity for remembering, then perhaps it is possible to document the process of forgetting.
In short, perhaps it was possible to record oblivion. But this could only be done on the
terms of memory-loss, not memory itself; otherwise it would be nothing more than self-
surveillance. Thus, 0_dai continued, all actions concerned with understanding the loss of
memory would have to be captured by old media, in the same way that photos from the
19th century are old, partially because of the datedness of the capturing technology. And
when it still didn't make sense, 0_dai simply thought of the experiment as a way of
remembering through dead media. One’s own life would then be akin to a forensics file.
PID: 4459
It is abhorrent to talk inhumanly, feeling the little chromium mouldings on
the backs, to let it loom dimly at a distance in an indefinite form; it must be
understood also that this form of pseudonymity was totally different from
that which hitherto had been employed.
/System/Library/Frameworks/BmTP.framework/Versions/A/Framework
s/Help.framework/Versions/A/Help/System/Library/Frameworks/BmT
P.framework/Versions/A/Frameworks/SecurityHI.framework/Versions/
A/SecurityHI-0x919c0000-0x91a33fff_ bmtp.NavigationServices3.3.2 We
began in section I (ii) with the lowest form of sickness, which in despair
may or may not will to be itself. 1. Graphic conflict (see Figure 1). 2.
Conflict of planes (see Figure 2). 3. Conflict of volumes (see Figure 3). 4.
Spatial conflict (see Figure 4). 5. Light conflict. 6. Tempo conflict, and so
on. N.b.: This list is of principal feature, of dominants. It is naturally
understood that they occur chiefly as complexes. HphI 6 102 245 297 729
825 1113 ggtga Eco47III 1 1171 agc/gct Eco72I 1 327 cac/gtg
BspLU11I 1 409 a/catgt Ama87I 1 612 c/ycgrg The recurrence of this
asymmetrical season was one of those minor events, intra-mural, localised,
almost condemned, which, in uneventful lives and stable orders of society,
looked at each other and began to circle the box like indifferent,
physiological debris, threatening dis-acquisition then occasionally slapping
the glass with casual, dry palms. 6. You can now "rehearse" without actually

recording by simply playing back the already-recorded polymer sequence.
(XCIX. The world goes round by misunderstanding. It is only by
misunderstanding that all agree. For more, see "Defining the Structural and
Functional Roles of Carboxyl Region of the Bacteriophage Lambda
Excisionase Xis.") Their study likely consists in learning rhymes by rote;
provided that they place themselves strategically in the proximity which,
without putting them to the least inconvenience, can and will, by uttering a
word or by administering a pill, set them once again on their feet. 49B: A
forked ending of the Affection Lines indicates logic, by the second phalanx
of the Thumb; a long second phalanx indicates inverted paralogicity; a short
one, a lack or unfound logical thinking. Some further examples: 7. Conflict
between matter and viewpoint (achieved by spatial distortion through
camera-angle) (see Figure 5). 8. Conflict between matter and its spatial
nature (achieved by optical distortion by the lens). “Me in my own world,
yeah you there beside.” 9. Conflict between an event and its temporal nature
(achieved by slow-motion and stop-motion), and finally 10. Conflict
between the whole optical complex and a quite different sphere. You forget
that all the doors of your room turn on their hinges without permission.
The advice of starvation, the ornate ivy and flower engraving, in a graphite
glass bowl on the counter, a pile of loose unrelated engraved metallic
ornaments (some round, some flattened and elliptical, a hexagon, a highly
polished satin cushion). 2. [Note] Since the PCR-BUFFER loop returns the
nucleic acid signal to the mixer section's sample loading chamber, effects
can be added to BmTP channels during density-feedback modes as long as
the panned channel-to-contig assignment method is used. The PCR-
BUFFER loop cannot be used to add BmTP chemical effects when
recording sequences which have been assigned using the direct channel-to-
contig assignment method. 114 G 5: When seen in breaks and with islands,
it means that the missing line is actually the joined trait of a total
identification of boredom and dust. (XXV. Therefore ‘to understand’ and
‘to understand’ are therefore two different things? Certainly they are, and to
understand this - but not, let it be noted, in the sense of the first sort of
understanding - is internally exiled, as if it were a delicate row of stringed
birds.) It may appear as a straight unbroken line, it may show a chained
character or it may have islands marked along its length. There will often be
seen lines crossing it in various directions. "That's a more difficult question -
it might be read - several sharp comments in it about contemporary
quantitative habits - fairly buried and the usual Victorian comments of 19th
century sexologists such as Bingswater - could known about their arrivals
scavengers - burned a lot of letters, patience and nerves and dawn."

PID: 4460
Working with Multiple Assays: For PCR For hybridization For DNA
sequencing For microarray analysis. But the universe leaves me
unconcerned, it doesn't make me laugh - this is another empty notion.
"What I fear is not the horrible form behind my chair, but its voice – Open
reading frames Exon/Intron splice sites Promoter binding Repeat
sequences.” Communication possesses a value the terms don't have. StuI 1
647 agg/cct HpaII 2 176 1107 c/cgg Fsp4HI 3 213 231 288 gc/ngc
Eco81I 2 43 721 cc/tnagg There are: fragments that shift and change
(mistakenly called objective reality); and a lack of totality's possibility
(mistakenly called change when it's situated at the level of appearance but
reveals reality as fragmented, changing, and incomprehensible). “I find that
really fascinating, because I’m the other way around,” you say. “I’m like, put
me on the top of a mountain with deer licking my fingers or something.”
"Reiterative dG Addition by Bas1p Mutation Telomerase During Extension
of Non-Telomeric DNA." Similarly the light of a star (slowly) annihilates
the star itself. BmTP Thread State: srr0: 0x927d23e4 srr1: 0x0200f030
vrsave: 0x00000000 cr: 0x24022228 xer: 0x00000004 lr: 0x927d2380 ctr:
0x927d84f4 r0: 0x00000000 r1: 0xbfffe6f0 r2: 0x00000001 r3:
0x00000000 If I compare, therefore, these two establish'd properties of the
passions, viz. their object (a collution of memories of sense impressions),
and their sensations, which is either pleasant r25: 0x77696e64 r26:
0x2d2d2d2d or painful, to the two suppos'd properties of the causes, viz.
their relation to self (0x312a20 bmtp CFMPriv_LangAnalysis breath upon
breath of the eyelids turning verdigris), and their tendency to produce a pain
or pleasure, independent of the passion; I immediately find, that taking
these suppositions PEFbmtp binary: CFMPriv_PrintCore to be just, the
true system breaks in upon me with an irresistible evidence. r31:
0x927dd958 r29: 0x060d0d80 0x9284d7fc ReceiveNextEventInMode +
0x48 If action (“doing”) is negativity, then there is still the necessary
problem of knowing whether the negativity of someone who "doesn't have
anything to do" disappears or remains in a state of "unemployed negativity."
Rite and Ritual: The difference between rite and ritual is not easy to define.
Protein structure prediction (secondary/tertiary structure) Folding analysis
& prediction Homology modeling (from known structures) Structure
similarity CFMPriv_OpenScripting�BmTP_BLib 0x311c90 - 0x311d4e
CFMPriv_Print PEF binary: CFMPriv_Print 0x311d70 - 0x311e3d
CFMPriv_SecurityHI PEF binary: CFMPriv_MoleculeBindHI 0x311ec0 -
0x311fa2 CFMPriv_SpeechRecognition PEF binary: CFMPub_BchemSend
0x411ecoRI - Because if one looks for them in the breath/they take refuge

in the body,/and if one looks for them at one point in the body/they claim
to be braided there in breath,//like a negation of body/having more body
than all breath.//the pestling of a face,/the compressed magnet of a
repressed surface from the outside of// I admit Hegel foresaw this
possibility, but at least he didn't situate it as the outcome of the process he
described. Arranged in a certain manner, along several planes, and across
the silkscreen surface of a monochrome and diluted hologram. “The gaps
are enormous, we stare from each side.” A pair of recently-used IrDA pads
and needles, several thin, ivory colored cathedral candles (halfway burnt,
noticeably darkened), a smooth and oblong-shaped object in flat black w/
LED signal, a lengthy, single strip of film with attached butterflies, a
photocopy of a decrepit title page to the second edition of William Harvey's
De vermis mysteriis a laser printout of several dried rose petals, also burnt.
(And what am I if not a ray from some long dead star?)
Approximately four hours after luh+ had initialized the customized pod biometrics, a
voiceprint digital message was sent through the pod domain’s ninth-level router to an
address that was both familiar and distant, and which luh+ had designated. The message
was lengthy, contained many data formats, and was titled "Neuro-phenomenological
Parameters and Affective Data for Fourth-Generation Biometrics." The message was
sent not to a university lab, and not to an academic journal, but to a residential address.
PID: 4461
c600 key features: I went down a very long staircase which led into a long
and dark corridor at the end of which was a courtyard obscurely lit by the
ether of an agonizing night. You tapped your temple. "Chip grafts along the
optic nerves," you stated tunefully. “I have trouble seeing anything not on
scan lines.” There is nothing that my own nature teaches me more vividly
than that I have a body, and that when I feel pain there is something wrong
with the body, and that when I am hungry or thirsty the body needs food
and drink, and so on. So I should not doubt that there is some truth in this.
"Is that you there, in that cage where idle, impatient hands have scored the
white walls with interlaced initials and embellished them with studied crude,
indecent shapes?" One might say that anatomy is a philosophical category of
daydream. IV. Schedule of the Neuroses (see Schedule IV, section 25c for
other, non-BmTP neuroses). 1. Sensory. (a) Echolalia; (b) Hyperaesthesia;
(c) Neuralgia. 2. Secretory. (a) Aspermia; (b) Polyspermia. 3. Motor. (a)
Spasms (biochemical); (b) Spermatorrhoea (proteomic). The paper is
unfolded and the sentences read out: "Lateral Insertion of Anterior Lumbar

Interbody Cages (Constrained & Uneven THD Kinematics)." And not
merely a brief accidental touch either, for I was rubbing the bottom with
gentle deliberation. The walls grew pixellated baroque with mosaics and
spun designs in filamented precious metals. “We were strangers, for way too
long.” One mirror or several, placed around the bed or staring down from
the ceiling, can double your pleasure; they also have the capacity to turn a
duo into an illusory foursome. The more you have, the more fully can you
see details and the whole scene: no matter what position you choose, you’ll
always otherwise be missing an angle or two. Inguinal Aponeuroses. The
Inguinal Aponeurosis is that form of protrusion which makes its way
through the abdomen in the inguinal region. There are two principal
varieties of inguinal regions - external or oblique, and internal or direct.
External or oblique inguinal aponeurosis regions, the more frequent of the
two, take the same course as the spermatic and Transversalis cords. It is
called external from the neck of the sac being on the outer or iliac side of
the deep epigastric artery. "If you want a classier explanation, I'd say you
saw a semiotic ghost." 6-11 April: International Colloquium on Molecular
Applications for BmTP Systems. Panel 4-11a. Abstract: An experimental
means of generating code, genetic programming starts with thousands of
randomly-created programs and allows them to evolve through opposition,
recombination, and occasional mutation. Discussions at this gala will cover
automatic coding, evolvable hardware, and recombinant applications for
BmTP communications protocols. Registration: US$415. Contact
+1(212)1791604, fax +1(212) 1791114, email bmtp-mtg@bmtp.org. The
room was full of flesh. It was made of it, a quivering, sensitive architecture.
"Where's your body?" "I had it scrapped, Reshaped." The polemic in this
paper argues that the body can never be constructed as a purely discursive
entity. In a related sense, it can never be reduced to a pure materialist object.
"Come along! I insist! Your hands! Your hands! Give me your hands!" And
you seized my hands and dug them into that awful place. "Know," you
shouted, while my throat throbbed and panted like a furnace, "know that I
am built up of death from head to foot and that it is a corpse that loves you
and adores you and will never, never leave you!..." The septum between the
two corpora cavernosa is thick and complete behind, but in front it is
incomplete, and consists of a number of vertical bands, which are arranged
like the teeth of a comb, whence the name which it has received, septum
pectiniforme. These bands extend between the dorsal and the anterior surface
of the corpus cavernosa, and are composed in part by an admixture of well-
developed fiber optic membrane. “Also the subject must have a serious and
sad expression, never laughing as in the Western style. A good director will
focus on the molecule and the model's face."

PID: 4462
Read the following directions and identify each term in Fig. 1-22: 0000852
tgttcaag acagaagggcctgactcagactgacattctccacttcttgtt 0000901 >>>>>>>
||||||||||||||||||||||||||||||||||||||||||||||||||
<<<<<<< 8299596 tgttcaagacagaa gggcctgactcagactga cattctccacttcttgtt
8299547. BmTP Processor Option: Protein sequence (amino acid
chains/polypeptides); protein structure (folding behaviors & homology);
chromatin (structure & behavior); intra-cellular components (ribosomes,
mitochondria, chromosomes, membranes); biopathways (metabolism,
catabolism, anabolism). Scale: 5.4862E+00 pxl/mcr or 2.1599E+00
pxl/mcr, 4855 microsec/in or 1933 microsec/cm. 430 factory presets, 200
user presets with crossover 2nd-stage antigenic indicators and real-time
neuroresponse controllers (via BmTP extensibles). Cache: (1) In thought,
you push mimicry to the point of assuming the exact posture that I will have
assumed in that very spot. Thus, my head is in place of your head, my
mouth in place of your mouth, membranes, emotions, etc. Sagittal - a
lengthwise plane running from front to back; divides the body or any of its
parts into right and left sides. Median - sagittal plane through midline;
divides the body or any of its parts into right and left halves. Coronal or
Frontal - a lengthwise plane running from side to side; divides the body or
any of its parts into anterior and posterior portions. “Moves on reaction
then slumps in despair.” Transverse or Horizontal - a crosswise plane;
divides the body or any of its parts into upper and lower parts. "Evaluation
of a Self-Consistent Method for Calculating Molecular Bonding Parameters
from Metabolic Isokinetic Releases." Distortion within BmTP
immunoresponse subsystems: THD, less than 0.05% RMS 20Hz-20kHz;
IM, less than 0.05% SMPTHE; TIV unmeasurable, less than 100 mcv, A
weighted Thr-Cys-Hsi-Leu-Gin-Arg-Gly-Lys2-Ser-Aps6-Ala-Asn-Mte-Phe-
Val-Trp-ATPase-RNA-URFA6L-Glu Impulse Response Tensile Strength:
200 PSI with 130% density compression. AIA: proposed 12 sec. MVSS 302.
Their preoccupations fall into three categories: (1) extreme body
modification, by which, using restriction enzymes, users can extract from
cells containing a gene they wish to study a molecule of cDNA, which they
then break down into fragments the size of a subgene or biomarker (fig. 8-
1). Subsequently, using ligase enzymes, they bind this foreign gene to a
vector, a bacterial plasmid for instance, which they open up to
accommodate the selected gene (fig. 8-2). The recombinant plasmid is then
reintegrated into the host strain of bacteria (fig. 8-3), which multiplies in a
culture, replicating itself into a ready-for-use biofilm (fig. 8-4). This bit of

synthetic genetic material must then be attached to a ligase vector capable of
introducing it and making it express itself in a retroviral sequence suited for
BmTP protocols, more or less as I could have felt your touch, a wireless
whisper in a biochemical vernacular known only to me. Changes away from
homeostasis are detected by so-called sensor cells. Sensor cells act by way of
nerve impulses or hormonal response to initiate processes which make up a
homeostatic mechanism. Then you repeats, as exactly as possible -
hesitantly, for it must be done with studied refinement - the gestures that
were my gestures. Slowly ATT-CGA-UAU-CGU-TTA-AGU-ACG but
carefully, gently, as if not to wake me.
…connection, then, implies distance. “I can see you on the screen…” My local actions,
your global patterns. Except that this means we are absolved of all intimacy, right?
PID: 4463
All this I saw indistinctly and by much effort: for my personal condition
had been greatly undone during slumber. Out of blue gloom, a manta
materializes at dawn with a company of fusilier fish parading in circular
whisps. Two, three, four or five part parallax harmonies, discontinuous
effects, vocal doubling, thickening, pitch oscillator, and 6-part scalic,
chordal, chromatic and vocoder vocal effects. I now lay on my back, and at
full length, on a species of a low frame-work of glass. To this I was safely
bound by a long strap resembling a surcingle or a pillow. It passed in many
convolutions about my limbs and body, leaving at liberty only my head, and
as the inlet begins to fill with the rush of a rising tide and growing light,
three more mantas beat by on silent wings. Group 30 - Multi-axis
symmetric, both soft and straight-lined, open-limit signs without crossing
lines: "Complete cDNA Sequence, Genomic Structure, and Chromosomal
Localization of the LPA Receptor Gene, Gpcr26." These moments of
intoxication when we devour everything, when we go merrily towards an
uncertain abyss, making endless slow loops in a shaft of light, rising almost
to the surface in a delirium broth of ebbing tides of dried pedals, wrought-
iron, viscous inheld breaths, they wheel over, descend, and begin again. A
sign for the technicians’ lapis philsophorum, includes the following: ARG GLY
ARG GLU ARG PHE GLU MET PHE ARG GLU LEU. In this are
combined the signs for the three most important substances used by any
standard BmTP protocol: (i) Excrement - nothing exists that doesn't have
this senseless sense, common to dreams, flames, uncontrollable laughter, in
those moments when devouring accelerates into the passing away of the

instinct to endure. (ii) Phosphorous - as the fall extracts a scream, a floating
image rises up; not exactly to fall into a void, but it is like a scream, is not
graspable, revealing limits, to be thus devoured. (iii) Mercury - a nakedness
not unveiled, leaping into glass that is also giving certain anguish an excess,
TaqI 2 171 708 t/cga, an adorned and adored excess. Late on a gray, rainy
day we swam with a giant manta as it moved away from the reef off San
Benedicto. As it turned over on its back, remoras attached to each side of
the ray's head, curved outward like old-fashioned mustachios. When reason
returned with the morning - when I had slept off the fumes of the night - I
experienced a sentiment half of horror, half of nostalgia, for some
inarticulable breach of which I was guilty. “Trapped in a cage and
surrendered too soon.” These symbols, such as the Krebs Cycle graph
turned upside down, were used to denote the process in which a vaporized
substance was transformed into a liquid form: 33 full algorithmic
continuous bandwidths (true BmTP 920kHz); MspR9I 6 55 69 532 644
649 784 cc/ngg; octagon parametric EQ for programmable PROSITE
emulation mapping. These symbols were also used to signify the result of
such a process (the precipitate), stroking the span of the creature's body,
floating down into the ocean's dark like a wandering. A teardrop 40 billion
miles across, in irregular, illuminated topographical lines of flight. From
anguish you derived a somewhat iconic sign used in bioinformatics contexts
to denote distillation, i.e., the process of heating a creaturely liquid until it
boils and evaporates, and then letting the gas come into contact with a cold
surface, causing it to condense and become liquid again. An opiate vapour,
dewy, dim, exhales from outside each microarray. The symbol used to
represent this condition was a circle within which were three triadically
distributed smaller circles, caput mortuum, or the skull (see group 44 -
asymmetric, straight-lined, both open and closed parameters with
macromolecule density). At midnight, in the month of June/Standing
beneath the mystic moon.
ITEM#608Y968. The interface panel on the right wall of the pod (facing the front)
protrudes from the wall. The plastic moulding frames a rectangular interface panel when
looking directly at it, but from other angles its sides curve outwards in a kind of sloping
movement. Sitting (on the knees) facing the interface panel, move so that the body is facing
the space of wall between the interface panel and the rear wall. Move the body closer, until
the front of the thighs, stomach, chest, and the side of the face (preferably facing to the
right, towards the front) are touching the smooth, glossy white plastic of the wall. Bring the
right arm upwards, bending at the elbow. Leading with the hand (fingers out straight and
together), slowly extend the arm over the top of the plastic mould which holds the interface

panel. As the arm is extended to the side, lower the arm and shoulder so that the curved,
negative corner that it makes forms a perfect fit between surfaces, touching the positive
corner formed by the plastic mould holding the interface panel.
PID: 4464
>>: doesn't say the word, but rather we listen together to the ringing of
gelatin chimes that must be made up of all the sonorous qualities of color-
saturated epithelial cells, the sonorism made of fiber optic, blood, ether.
Elaborate operations were rehearsed and perfected in Cortical BmTP
environments, on software bodies with anatomical details - down to the
finest capillaries - based on the flesh-and-blood patient's tomographic scans.
“Me in my own world, the one that you knew.” Both the pornographic
pamphlets and the philosophical treatises of the Enlightenment science of
materialism postulate an extruding space where nothing matters but the
force of projectiles, and the compulsive pushing and pulling of bodies. We
put the aorta on the floor and shrugged, then groped around in the chest
cavity, with the violin in front and orange petals on the back of the lenses,
down a sunken April amnesia. The fluids circulating in the body are
controlled externally or supplied from the outside: urine empties through a
catheter into a tissue-engineered bladder under the left arm, the stomach
through a nanofiber tube in the nose into a artificial polymer container,
blood through a modified BmTP ethernet channel and into a vessel at the
base of the cortex. We left the body touching where it was, but took a step
backward in another just like it. In response, I let the hand drop to your
side. Bone: Bone-growth factors or stem cells are inserted into a porous
material cut to a specific shape, creating new support structures or limbs. A
product that produces shin-bones is in clinical trials. Companies: Creative
Biomolecules, Orquest, Prometheus Inc., Sulzer Orthopedics Biologics,
Genetics Institute, Osiris Therapeutics, Regeneratron. “As soon as this
container is filled above a certain level, stored blood is supplied to the body
through a molecular cannula in the neck.” The lungs of the body are
situated standing directly behind its head and breathing for it. Amplified, the
heart of the body is now flashing and beeping at regular intervals on the
graphic waveform monitor to the left (visible only outside).
Communications: Alcatel's bacterial screen uses bioJava to deliver services
such as basic cortical telephony, RRI (Remote Relay Interaction), general
data navigation, credit transactions, remote MRI-based diagnostics, and
Motorola also plans to use such Java-based BmTP utilities to connect its
own wireless microarray networks. We finally settled on a handful of long
intestine. ATOM 18 NZ LYS 7 -29.215 -17.480 7.820 1.00 25.00 ATOM 19

N LYS 8 -23.771 -14.347 11.693 1.00 25.00. Torn free, the pink tissue
continued to expand and contract in time with our breathing.. A velvet feast
in proteomic-glitches, the essence of the new pornographic moment lies in
the arousal induced by watching the interaction of isolated, activated bodies,
supposedly uncontrolled by any laws save those of cryptography or
physiology. Suddenly I wondered: What makes me so sure that I'm not still
flesh and blood, a singing corpse? Touching at a distance, you wondered if
memory could become brittle. "Knowing about" these regions of the body,
which grows out of acquiring an anatomical view, combines the anatomical
"knowing that" of the fungible, and the anatomical "knowing how" of
making something fungible. A teardrop 40 billion miles across, a cloud
elongated by trepid stellar jewels, silhouetted at upper right surrounded by a
disk of dust, in irregular, illuminated topographical lines of flight.
PID: 4465
Integrated ChemArray P-4.11x port for easy connectivity to an existing
bodyLAN network, scanner, or organ printer. Central suicus sup.
anastomotic v. occipital Semispinalis dorsi inf. sagittal frontopolar a.
intertransversal relay choroid plexus cist. Provides 10BaseT ethernet
connection directly to BmTP pads, I2 hub or other Ethernet-based
extensibles. Optional filter screens web content. Works w/ LAN, WAN, &
DMZ. Supports multiple T1 lines. Transverse sinus, Occipital sinus, Spinal
accessory n., Post. spinal aa., Dura mater, Post. lat. fissures, Post. med.
columns, Post. spinal aa., Venous plexus, External iliac nodes, Epididymis.
Uses biochemically-active DHCP to dynamically allocate and manage
BmTP addresses. Automatically matches different IP transfer speeds and
atomic weights. Flashpads upgradable to new OSI medical standards (based
on V.42 LAP-M/MNP2-4/NP10). Int. jugular v., Superficial inguinal
nodes; lymph node of Cloquet; deep subinguinal nodes; medial aortic nodes;
epididymis. Allows simultaneous connections of up to 80TB LocalChem
devices. Data compression for faster throughput with error correction for
100% molecular accuracy. Vas deferens; common iliac nodes; inferior
mesenteric nodes (preaortic); celiac and superior mesenteric nodes
(preaortic); pancreaticolienal nodes; epicolic and obturator nodes, cisterna
chyli; inferior epigastric vesicle; vesicouterine reflection; orifice of Skene's
duct; levator anterior muscles; obturator intermuscular vesicles;
infundibulopelvic ligament; popillary dilator of iris. Diagnostic, RBC
counter, Krebs cycle data security, anti-virus, and acid-base alert monitoring.
Autosensing RJ-45 UTP BmTP ports. “We were strangers, for way too
long.” Remote management and configuration capability (ROM upgradable

without oligonucleotide sequencer). Supports new 94TB ITU v.90-41169
standard and x2 biotechnology. Multifidus spinae; Rotatores spinae;
Interspinales; Extensor coccygis; Rectus capitis posticus minor. Connection
MRI-ROM includes genetic algorithm runtime monitor plus over 30 other
biochemical applications and conventional software utilities. Trachelo-
mastoid; Ilio-costalis; Cervicalis ascendens. BmTP pads and biometrically-
enhanced Ethernet Combo Card allows simultaneous auto-sensing and
ultra-fast immune response - selects either standard or K9691-11-4flex
mode. Intercolumnar fibres; triangular fascia; lineae semilunares; lineae
transversae. Built-in auto-partitioning, reconnection, and polarity connetion
isolates network failures and antibody response calibration. Auto speed &
duplex mode sensing one each port w/ full chemical-speed BmTP data
packet transfer performance. Quadratus lumborum; inquinal canal; Psoas
ischio-perinaeum; Corrugator levator ani. Requires single external
(configured on rudimentary ISDN implants) power, link, activity and
collision graphic LEDs and convenient uplink port for cascading
neurochemical data to other BmTP hubs. Supports V.411 BmTP Group IV
integrated data protocols at 1791mps (PCCIA Molecular Standard), in
addition to V.480 Standard data compression (V.842bis/MNP7k5) for
cortex-based video conferencing. MNP10 EC enhanced cellular
performance. "Computation of Solid Matrix Stresses in Tissue Engineered
Incongruous Joints using a Biphasic Proteomic Finite Element
Formulation." Three BmTP-based DSN-II ISA NICs w/ PnP molecular
Ethernet cards (built up from old PCMCIA type III slot & digital shield
devices). 910/100 antigenic auto-Negotiation and intelligent auto-install
software (BmTP IrDA interface only). Music, when soft voices die, vibrates
in the memory - odors, when sweet violets sicken, live within the sense they
quicken.
Delicately climbing down from pod #93404, 0_dai stood for a second in the middle of
the long corridor. Again there was the low, rhythmic hum emanating from one of the pods,
or perhaps from all of them in the array. It brought to mind the kinds of faint yet
comforting sounds that seemed to come from inside the body while enveloped within BmTP
media. Walking towards the exit doors to the elevators, 0_dai caught sight of something
to the left. It was 0_dai. Turning to squarely face the reflection, 0_dai took the time to
inspect the pallid cheeks and darkened eyes of a face that was 0_dai’s own, as reflected in
the one-way mirror of pod #94468. In the reflection 0_dai seemed to be crying, or
levitating, or both. On the other side of the glass panel, the angular, bare feet of luh+ rose
and fell at a very slow, gradual rate. The entire pod was filled with warm, distilled water.
The body seemed to be rehearsing a dance for a zero-gravity environment. But the space of

the water was still, and thorough, and without bubbles, without surface, without
movement.
PID: 4466
It all comes together in the evening - in a fantastical mix of fabrics,
references, decades - lashes longer than false. Dark eyes, dark lips, dark
undercurrents of sensuality, skin pale from irony and ennui, impeccably
unstudied print-and-no-color collision clothes - naively and cynically defined
with Black Variations Shadow Liner (three intensities and textures in one
compact). “For way too long.” The sky was pure opal now, and the glide of
the nanosecond streets glistened like silver against it. Then you repeat, as
exactly as possible - hesitantly, for it must be done with studied refinement -
the gestures that were your gestures. I occupy, successively, all the space
that you occupied. And there you turn away and weep. And slow, and
patiently, with the eyes shut. Slowly ATT-CGA-UAU-CGU-TTA-AGU-
ACG When I tell you to, you moves my body in the bed, but carefully,
gently, as if not to wake me.


Thacker - An Ideal For Living - An Anti-Novel PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Thacker - An Ideal For Living - An Anti-Novel PDF

Uploaded by

Copyright:

Available Formats

An Ideal for Living

Thacker ~ An Ideal for Living ~ 4

Thacker ~ An Ideal for Living ~ 6

Thacker ~ An Ideal for Living ~ 7

Thacker ~ An Ideal for Living ~ 8

Thacker ~ An Ideal for Living ~ 9

Thacker ~ An Ideal for Living ~ 10

Thacker ~ An Ideal for Living ~ 11

Thacker ~ An Ideal for Living ~ 12

Thacker ~ An Ideal for Living ~ 13

Thacker ~ An Ideal for Living ~ 14

Thacker ~ An Ideal for Living ~ 15

Thacker ~ An Ideal for Living ~ 16

Thacker ~ An Ideal for Living ~ 17

Thacker ~ An Ideal for Living ~ 18

Thacker ~ An Ideal for Living ~ 19

Thacker ~ An Ideal for Living ~ 20

Thacker ~ An Ideal for Living ~ 21

Thacker ~ An Ideal for Living ~ 22

Thacker ~ An Ideal for Living ~ 23

Thacker ~ An Ideal for Living ~ 24

Thacker ~ An Ideal for Living ~ 25

Thacker ~ An Ideal for Living ~ 26

Thacker ~ An Ideal for Living ~ 27

Thacker ~ An Ideal for Living ~ 28

Thacker ~ An Ideal for Living ~ 29

In vivo trans-differentiation of derived human pluripotent stem cells

Perspectives in Biomedical Engineering and Entertainment Systems,

Crawford Tillinghast*, Henry Annesley*†, Robert Suydam**, &

*Department of Molecular Engineering, Miskatonic University, C.D.

Keywords: BmTP systems, cellular trans-differentiation, stem cell

Thacker ~ An Ideal for Living ~ 30

Thacker ~ An Ideal for Living ~ 31

Thacker ~ An Ideal for Living ~ 32

Thacker ~ An Ideal for Living ~ 33

Thacker ~ An Ideal for Living ~ 34

Thacker ~ An Ideal for Living ~ 35

Thacker ~ An Ideal for Living ~ 36

Thacker ~ An Ideal for Living ~ 37

Thacker ~ An Ideal for Living ~ 38

Received 06 April; accepted 11 April.

Thacker ~ An Ideal for Living ~ 39

Thacker ~ An Ideal for Living ~ 40

H.A. wishes to thank the Ubbo-Sathla Foundation for support.

Thacker ~ An Ideal for Living ~ 41

Thacker ~ An Ideal for Living ~ 42

Thacker ~ An Ideal for Living ~ 43

Thacker ~ An Ideal for Living ~ 44

Thacker ~ An Ideal for Living ~ 45

Thacker ~ An Ideal for Living ~ 46

Thacker ~ An Ideal for Living ~ 47

Thacker ~ An Ideal for Living ~ 48

Thacker ~ An Ideal for Living ~ 49

Thacker ~ An Ideal for Living ~ 50

Thacker ~ An Ideal for Living ~ 51

Thacker ~ An Ideal for Living ~ 52

Thacker ~ An Ideal for Living ~ 53

Thacker ~ An Ideal for Living ~ 54

Thacker ~ An Ideal for Living ~ 55

Thacker ~ An Ideal for Living ~ 56

Thacker ~ An Ideal for Living ~ 57

Thacker ~ An Ideal for Living ~ 58

Editor’s Report: Neurological and Cognitive Role of

Crawford Tillinghast, Henry Annesley†, Robert Suydam**, &