This article appeared in a journal published by Elsevier.

The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/authorsrights
 Author's personal copy

International Journal of Food Microbiology 175 (2014) 6–13

Contents lists available at ScienceDirect

International Journal of Food Microbiology

journal homepage: www.elsevier.com/locate/ijfoodmicro

Anaerobic green fluorescent protein as a marker of Bifidobacterium strains

José M. Landete a, Ángela Peirotén a, Eva Rodríguez a, Abelardo Margolles b,
Margarita Medina a, Juan L. Arqués a,⁎
a
Dpto. de Tecnología de Alimentos, INIA, Carretera de La Coruña Km 7, 28040 Madrid, Spain
b
Instituto de Productos Lácteos de Asturias, CSIC, Paseo Río Linares s/n, 33300 Villaviciosa, Asturias, Spain

a r t i c l e i n f o a b s t r a c t

Article history: Some strains of Bifidobacterium are considered as probiotics and are being added as adjunct culture in food prod-
Received 7 November 2013 ucts due to their potential in maintaining a healthy intestinal microbial balance. However, despite these benefits,
Accepted 11 January 2014 bifidobacteria still remain poorly understood at the genetic level compared with other microorganisms of indus-
Available online 16 January 2014
trial interest. In this work, we have developed a non-invasive green fluorescent based reporter system for real-
time tracking of Bifidobacterium species in vivo. The reporter vector pNZ:Tu-GFPana is based on the pNZ8048
Keywords:
Fluorescent proteins
plasmid harboring a bifidobacterial promoter (elongation factor Tu from Bifidobacterium longum CECT 4551)
Bifidobacterium and a fluorescent protein containing a flavin-mono-nucleotide-based cofactor (evoglow-Pp1) which is fluores-
Plasmid cent under both aerobic and anaerobic conditions. pNZ:Tu-GFPana was constructed and found to stably replicate
Anaerobic conditions in B. longum CECT 4551 and in the intestinal strain Bifidobacterium breve INIA P734. The subsequent analysis of
these strains allowed us to assess the functionality of this plasmid.
Our results demonstrate the potential of pNZ:Tu-GFPana as a real-time reporter system for Bifidobacterium in
order to track the behavior of this probiotic species in complex environments like food or intestinal microbiota,
and to estimate their competition and colonization potential.
© 2014 Elsevier B.V. All rights reserved.

1. Introduction
Members of the genus Bifidobacterium are high G + C Gram positive
bacteria belonging to the phylum Actinobacteria, and represent common
inhabitants of the gastro-intestinal tract (GIT) of mammals, birds and
certain cold-blooded animals (Turroni et al., 2011). The importance of
bifidobacteria as constituents of the human microbiota is generally ac-
cepted, and different ecological relationships between bifidobacteria
and their host can be developed, ranging from opportunistic pathogenic
interactions (e.g. in the case of Bifidobacterium dentium) (Ventura et al.,
2009a) to a commensal or health-promoting relationship (e.g. in the
case of Bifidobacterium bifidum and Bifidobacterium breve species)
(Ventura et al., 2009b). Bifidobacteria are difficult to study due to their
growth requirements, oxygen sensitivity and resistance to genetic mod-
ification. Thus, there is only limited information available on the molec-
ular mechanisms responsible for their beneficial effects on human
health. In the last years, the whole genome sequences of different
bifidobacteria are currently available, although there is still a lack of
knowledge on the genetic modification of these bacteria, which is es-
sential to manage this enormous genetic data (Álvarez-Martín et al.,
2010). Moreover, host-microbiota interactions and cross-talk between
different members of the gut microbiota are far from being completely
understood, although they represent a crucial factor in the development
and maintenance of human physiology and immune system (Hart et al.,
⁎ Corresponding author. Fax: +34 91 3572293.
E-mail address: arques@inia.es (J.L. Arqués).
2004). Colonization of the gut during early infancy is a multifaceted pro-
cess that represents a critical period for the gut development and mat-
uration of the immune system, being Bifidobacterium species as one of
the main bacterial groups in the infant gut (Turroni et al., 2012). In
the last decades, bifidobacteria have attracted strong interest from the
food industry for probiotic applications, and several species are listed
as GRAS (Generally Recognized As Safe) microorganisms (Gaggìa
et al., 2010).
Probiotic bacteria selected for use in foods must survive in sufficient
numbers the manufacturing process and storage, as well as the passage
through the gastro-intestinal tract. In a first step, it is important to be
able to identify the bifidobacteria of interest among several naturally
occurring bacteria during the fermentation process. Furthermore,
probiotics have several modes of action and there is increasing interest
in the understanding of the mechanisms that bacteria use to survive
through the gastrointestinal tract, to interact with the resident microbi-
ota, and to modulate host health. Therefore, it is also essential to be able
to discriminate the probiotic strain from the endogenous microbiota, to
analyze the interaction of these microorganisms with the gastro-
intestinal epithelia and to unravel the mechanisms underlying the pos-
tulated health-beneficial effect. In order to study these mechanisms and
to track their survival and implantation, the use of appropriate molecu-
lar tools is indispensable. In this aspect, the fluorescent proteins have
been exploited as a stable marker system with an easily detectable phe-
notype to track bacteria in complex ecosystems.
Fluorescent reporter proteins are valuable non-invasive molecular
tools for in vivo real-time imaging of living cells and tissues as well as

0168-1605/$ – see front matter © 2014 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.ijfoodmicro.2014.01.008
 Author's personal copy

J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13 7

in vitro fluorescent labeling (Chudakov et al., 2005). The green fluores-
cent protein (GFP) has been successfully used to detect many microor-
ganisms in real time. However oxygen is essential for the post-
translational folding of the protein into the fluorescent chromophore
(Cubitt et al., 1995), which has hindered the employment of GFP in an-
aerobic or microaerophilic environments. Luciferases are enzymes that
need presence of oxygen to emit light, and which have been also
employed as a marker for monitoring bacteria (Greer and Szalay,
2002; Hutchens and Luker, 2007). A luciferase reporter system has
been used to trace the colonization potential and persistence of the pro-
biotic strain B. breve UCC2003 in real time within the mouse GIT (Cronin
et al., 2008).
In the present report, we describe the implementation of a cyan-
green fluorescent protein that is functional under completely anoxic
conditions, as a marker for Bifidobacterium in both aerobic and anaero-
bic conditions. We evaluate the capacity of this tool to monitor
bifidobacterial fate in complex ecosystems, without the potential prob-
lems caused by oxygen limitations that could impede the development
of fluorescence or luminescence.
P426 (Rodríguez et al., 2012) and Enterococcus faecium INIA TAB7
(Rodríguez et al., 2000) strains were routinely cultivated under anaero-
bic conditions at 37 °C in MRS broth (Scharlau Chemie SA, Barcelona,
Spain). Escherichia coli DH5α was grown in LB medium at 37 °C with
aeration.
Chloramphenicol (Sigma Chemical Co., St. Louis, MO, USA) was
added at 8 μg/ml for Lactobacillus, 5 μg/ml for Lactococcus and
Enterococcus and 4 μg/ml for Bifidobacterium. Ampicillin at 100 μg/ml
was added for E. coli.
The plasmids used are listed in Table 1. Plasmid pNZ8048 was ob-
tained from Dr. Kuipers and described in Kuipers et al. (1998). All
vectors shown in Table 1 contain the chloramphenicol resistance gene
from pNZ8048, which was used for selection in bifidobacteria. pGlow-
C-Pp1 plasmid (Evocatal GmbH, Düsseldorf, Germany) was used as
template for anaerobic gfp (evoglow-Pp1) and E. coli DH5α was used
as host microorganism for this plasmid.
Commercial lactic culture YC-X16 — Yo-Flex® (Chr. Hansen,
Hoersholm, Denmark), that contains a mixture of Streptococcus
thermophilus and Lactobacillus delbrueckii subsp. bulgaricus, was pre-
pared as specified by the manufacturer and kept at −20 °C.

2. Material and methods

2.1. Bacterial strains and growth conditions
The bacterial strains used in this study are listed in Table 1.
Bifidobacteria strains were routinely cultivated under anaerobic condi-
tions at 37 °C in RCM broth (Difco, BD Diagnostics, Sparks, MD, USA).
B. breve INIA P734, isolated from human breast milk, was deposited at
the Spanish Type Culture Collection (CECT; Burjassot, Spain) under ac-
cession number CECT 8178. Lactococcus lactis MG1363 used as host mi-
croorganisms was grown at 30 °C in M17 broth (Scharlau Chemie SA,
Barcelona, Spain) supplemented with glucose (5 g/l). Lactobacillus
brevis INIA ESI38 (Cogan et al., 1997), Lactobacillus rhamnosus INIA
2.2. DNA manipulation and molecular techniques
The general procedures used for DNA manipulation were essentially
those described previously by Sambrook et al. (1989). Restriction endo-
nucleases and Taq DNA polymerase came from Biolabs (New England
Biolabs, Hitchin, United Kingdom) and Applied Biosystems (Foster
City, CA, USA) respectively, and T4 DNA ligase was obtained from
Invitrogen (Carlsbad, CA, USA). All were used according to the manufac-
turers' instructions. Amplicons were purified using the QIAquick PCR
Purification Kit (Qiagen, Clopper Road, Gaithersburg, MD, USA). When
required, purified plasmids and amplicons were sequenced (Secugen
SL, Madrid, Spain).

Table 1
Bacterial strains, plasmids and primers used in this work.

Relevant phenotype or genotype Source or reference

Strains
MG1363 L. lactis subsp. cremoris strain, plasmid-free derivative of NCDO712 Gasson (1983)
MG1363 pNZ:Tu MG1363 with pNZ:Tu-plasmid This work
MG1363 Tu-GFPana MG1363 with pNZ:Tu-GFPana plasmid This work
INIA P734 Bifidobacterium breve INIA P734/CECT8178 CECT
INIA P734 Tu-GFPana B. breve INIA P734 with pNZ:Tu-GFPana plasmid This work
CECT4551 Bifidobacterium longum subsp. infantis CECT
CECT4551Tu-GFPana B. longum subsp. infantis with pNZ:Tu-GFPana plasmid This work
INIA TAB7 Enterococcus faecium INIA TAB7, isolated from cheese Rodríguez et al. (2000)
INIA TAB7 Tu-GFPana E. faecium INIA TAB7 with pNZ:Tu-GFPana plasmid This work
INIA ESI38 Lactobacillus brevis INIA ESI38, isolated from cheese Cogan et al. (1997)
INIA ESI38 Tu-GFPana L. brevis INIA ESI38 with pNZ:Tu-GFPana plasmid This work
INIA P426 L. rhamnosus INIA P426, isolated from breast-fed infants Rodríguez et al. (2012)
INIA P426 Tu-GFPana L. rhamnosus INIA P426 with pNZ:Tu-GFPana plasmid This work
E. coli DH5α Host microorganisms for pGlow-C-Pp1 This work

Plasmids
pNZ8048 Expression vector for Gram-positive bacteria harboring the inducible nisine promoter; Cmr Kuipers et al. (1998)
pNZ:Tu pNZ8048 with promoter of elongation factor Tu from B. longum subsp. infantis CECT4551 This work
pNZ:Tu-GFPana pNZ:Tu with anaerobic gfp This work
pGlow-C-Pp1 Plasmid used as template for anaerobic gfp Evocatal GmbH, Germany
pGFPuv Plasmid used as template for aerobic gfp Clontech Laboratories, Inc. USA

Primersa
For-GFP TTTTCCATGGATCCCCGGGTAGAAAAAATGAG This work
Rev-GFP TTTTCTAGATGACCGGCGCTCAGTTGGAATTCATTA This work
For.GFP.bif TTTTCCATGGTCAACGCAAAACTCCTGCAACTG This work
Rev-GFPana.XbaI TTTTTCTAGATCAGTGCTTGGCCTGGCCCTGCTG This work
For-Prom.bif TTTTAGATCTGCGCCACATCATGAAGTGGCCGG This work
Rev-Prom.bif TTTTCCATGGCTTTTGTCCTCCTGGACGTCTC This work
For-pNZ8048 GGAATTGTCAGATAGGCCTAATGACTGG This work
a
Restriction sites used for cloning are underlined.
 Author's personal copy

8 J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13

2.3. Cloning of gfp plasmids
The pNZ8048 vector was digested with restriction endonucleases BglII
and NcoI to remove the nisine promoter (PnisA). The promoter of elonga-
tion factor Tu from Bifidobacterium longum subsp. infantis ATCC15697
was amplified by PCR using the oligonucleotides For-prom.bif and Rev-
prom.bif listed in Table 1 after digestion with BglII and NcoI. The resulting
fragment was cloned into pNZ8048 vector previously digested and the
resulting plasmid was named pNZ:Tu, which were used to transform
L. lactis MG1363 by electroporation. Transformants were checked by re-
striction mapping and sequencing of the inserted fragment.
2.3.1. Aerobic gfp
The gene encoding aerobic gfp from Aequorea victoria was amplified
by PCR using DNA of pGFPuv as the template following a standard pro-
tocol. The forward primer For-GFP (Table 1) introduced an NcoI site
around the initiation codon of the gfp gene, and the backward primer
Rev-GFP introduced an XbaI site downstream of the stop codon. The
PCR product was digested with the two restriction enzymes and ligated
into the corresponding restriction sites of vector pNZ:Tu. The ligation
mixture with the resulting plasmid, named pNZ:Tu-GFPuv, was subse-
quently introduced into the L. lactis strain MG1363 by electroporation
(Holo and Nes, 1989) and transformants were checked by restriction
mapping and sequencing of the inserted fragment.
2.3.2. Anaerobic gfp
The gene encoding anaerobic gfp was amplified by PCR using DNA of
pGlow-C-Pp1 as the template following a standard protocol. The for-
ward primer For-GFP.bif (Table 1) introduced an NcoI site around the
initiation codon of the gfp gene, and the backward primer Rev-
GFPanaXbaI introduced an XbaI site downstream of the stop codon.
The PCR product was digested with the two restriction enzymes and
ligated into the corresponding restriction sites of vector pNZ:Tu. The li-
gation mixture with the resulting plasmid, named pNZ:Tu-GFPana
(Fig. 1), was subsequently introduced into the L. lactis strain MG1363
by electroporation (Holo and Nes, 1989) and transformants were
checked by restriction mapping and sequencing of the inserted frag-
ment. Subsequently, plasmid pNZ:Tu-GFPana was used to transform
bifidobacteria strains shown in Table 1.
2.4. Transformation procedures
The electrotransformation procedure for bifidobacteria strains de-
scribed by Álvarez-Martín et al. (2008) was tested and modified. The
optimized transformation procedure was as follows. Bifidobacteria
strains were cultivated under anaerobic conditions at 37 °C in RCM
plates during 48 h. Colonies were inoculated into 10 ml of filtrated
RCM and incubated anaerobically at 37 °C during 20 h. Tryptic Soy
Broth (TSB; Biolife, Milano, Italy) with proteose peptone 20 g/l and
bile 0.2% (Oxgall, Sigma) and filtrated RCM with glycine 1% were also
tested. Cells were collected by centrifugation at 4 °C and 2000 g for
15 min and washed twice with ice cold 0.5 M sucrose in 1 mM citrate
buffer (pH 5.8). Finally, cells were resuspended in 50 μl of ice cold buffer
and kept on ice for 20 min before electroporation. The electroporation
conditions were 25 μF, 200 Ω and 2.0 or 2.5 KV in a 0.2-cm cuvette by
using a Gene Pulser and a Pulse Controller apparatus (Bio-Rad, Rich-
mond, CA, USA), and 2 μl of plasmid DNA (0.3 ng/μl) were used. After
electroporation, cells were resuspended in RCM broth (950 μl), incubat-
ed anaerobically at 37 °C for 2.5 h, and then plated on RCM supplement-
ed with chloramphenicol (4 μl/ml). The plates were incubated at 37 °C
for 2 to 3 days under anaerobic conditions.
For each parameter tested at least three independent transformation
assays were performed. The transformation efficiencies were expressed
as the number of transformants per microgram of plasmid DNA.

MmeI
NcoI BsrDI
PfoI HaeII
ZraI BglI
MspA1I BsaHI Cfr10I AleI
Bst1107I AatII BsaHI MslI
AccI BsmBI Eco57MI SgrAI
MspA1I BssSI AlwNI AgeI
Eco57MI ++ SapI FspI BsaWI
BpmI XmnI Cfr10I
Cfr10I NruI ++ Alw44I
EaeI Eco57MI ++ Bme1580I
BspHI Tu HindIII BsiHKAI
BglII Bsp1286I
GFPana AvaII
XmnI MspA1I
PvuII

cm T
3500 AvaII
500 XhoI ++
Eco57MI ++
EarI pNZ.Tu.GFPana
3000 BsmBI

1000
3737 bps ORI
2500
MmeI
1500
2000 HaeII
repC
SalI
AccI

repA

HaeII

BspHI
NdeI

Fig. 1. Physical and genetic map of pNZ:Tu-GFPana expressing the anaerobic GFP downstream the promoter of elongation factor Tu from Bifidobacterium longum subsp. infantis ATCC15697.
 Author's personal copy
J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13
Lactobacillus and Enterococcus strains were transformed according to
Posno et al. (1991).
2.5. Segregation stability of vectors in bifidobacteria
The stability of the constructions was assayed by growing the
bifidobacteria in nonselective media for approximately 50 generations
and plating on alternate days onto nonselective agar plates. Antibiotic
resistance maintenance was monitored by the transference of the
resulting colonies onto antibiotic-containing agar plates. Finally, plas-
mids were monitored by plasmid extraction from antibiotic-resistant
and -susceptible colonies as described above.
2.6. Growth and probiotic features of anaerobic gfp bifidobacteria
transformants
The control strains and their transformants were grown and moni-
tored over 48 h in RCM broth at 37 °C under anaerobic conditions in
order to check the effect of the plasmid harboring anaerobic gfp on the
growth of B. longum CECT 4551 and B. breve INIA P734. Their resistance
to consecutive exposition to gastric and intestinal conditions was per-
formed as described by Lebeer et al. (2007). Quantification of biofilm
formation in plastic microtitre-plates was assessed according to the
method of Stepanovic et al. (2000) with some modifications. Briefly,
wells of a sterile 96-well flat-bottomed polystyrene microplate were
filled with 180 μl of TBS with proteose peptone 20 g/l, and inoculated
with 20 μl a bacterial culture. The negative control wells contained
broth only. The plates were incubated anaerobically for 48 h at 37 °C.
The content of the plate was then poured off and the wells washed
three times with 300 μl of sterile PBS. The microplates were stained
with 200 μl per well of crystal violet for 30 min. After being washed
and dried, the dye bound to the adherent cells was resuspended with
200 μl of 33% (v/v) glacial acetic acid per well. The optical density
(OD) of each well was measured at 570 nm in a Multiskan Spectrum mi-
croplate reader (Thermo Fisher Scientific, Vantaa, Finland). All assays
were performed in duplicate.
2.7. Direct detection of fluorescent colonies
Bifidobacterium, Lactococcus, Lactobacillus and Enterococcus contain-
ing the plasmid pNZ:Tu-GFPana were grown in broth supplemented
with chloramphenicol. All the strains were propagated overnight, ex-
cept bifidobacteria which was incubated for 48 h. Then, serial dilutions
were cultured in RCM, GM17 or MRS agar plates with and without
chloramphenicol. Strains with pNZ8048 plasmid were used as control.
After incubation at 37 °C during 24–48 h in anaerobic conditions, fluo-
rescent bacteria colonies were checked for fluorescence under the
ChemiDoc MP imaging system (Bio-Rad Laboratories S.A., Alcobendas,
Madrid, Spain) with a blue epi illumination and emission filter of 530/
28 nm.
2.8. Epifluorescent microscopic detection of cells
For imaging bacteria expressing anaerobic GFP, fluorescence in
suspended cells from liquid cultures was observed by applying 5 μl of
culture on a microscope slide followed by examination using a fluores-
cent microscope Leica DM LB light microscope (Leica, Bensheim,
Germany) equipped with 450–490 band-pass excitation filter and 515
long-pass suppression filter.
2.9. Flow cytometry
Cells harboring anaerobic GFP were washed in PBS containing 0.1%
BSA and 0.01% NaN3 and analyzed in a FACScalibur cytometer (Becton
Dickinson, Oxford, UK). Strains harboring pNZ8048 plasmid without
9
gfp gene were used as control, 20 000 events were collected for each
measurement.
2.10. Measurement of fluorescence intensity by fluorometer
Strains harboring the plasmid pNZ:Tu-GFPana were grown in the
broth above mentioned in anaerobic conditions without agitation. Fluo-
rescence of cells (0.2 ml from each culture at 0.5 OD) was measured
after sedimentation by centrifugation and resuspended in distilled
water. The fluorescence was measured on Tecan GENios microplate
reader (Salzburg, Austria) by excitation at 410 nm with a slit of 2.5,
and detection of emission at 500 nm with a slit of 10. As a background,
the same strains harboring pNZ8048 plasmids were used, and their
values of fluorescence were subtracted from those obtained from cell
harboring plasmids with the anaerobic gfp gene. Experiments were per-
formed in duplicate.
2.11. Detection of anaerobic GFP-marked bacteria against a background of
food and human fecal microbiota
Two experiments were carried out in order to test whether the an-
aerobic gfp marker could be used to detect GFP-marked bifidobacteria
following addition to a fermented food or to a complex fecal microbiota.
Yogurt was made in sterile screw-capped flasks containing 50 ml of
UHT semi-skimmed milk with 1.6% fat (Pascual, Aranda de Duero,
Spain) supplemented with 5% skim milk powder. Commercial YC-X16
lactic culture was added as specified by the manufacturer. Flask was in-
dividually inoculated with B. longum CECT 4551-GFPana and B. breve
INIA P734-GFPana strains at approximately 8 log cfu/ml. A flask without
Bifidobacterium-GFPana served as control. Milk was then incubated at
40–43 °C to reach a pH value of 4.55–4.60 (approx. 5 h).
Fecal samples used in this study were collected from a healthy breast-
fed infant younger than 6 months. Samples (1 g) were homogenized in
9 ml of sterile peptone (0.1%) water with a Stomacher 400 (Seward Lab-
oratory, London, United Kingdom) and individually inoculated with
B. longum CECT 4551-GFPana and B. breve INIA P734-GFPana at approxi-
mately 9 log cfu/ml. Homogenized feces with no addition of GFPana-
marked bifidobacteria served as control. In both cases, decimal dilutions
were cultured in RCM plates and incubated during 48 h at 37 °C in anaer-
obic conditions. Colonies were checked for fluorescence under the
ChemiDoc MP apparatus. The presence of pNZ:Tu-GFPana in fluorescent
colonies was checked by means of PCR with the primers For-pNZ8048
and Rev-Prom.bif. Non-fluorescent colonies were subjected to cell mor-
phology examination. All assays were carried out in duplicate.
3. Results
3.1. Construction of gfp plasmids
An aerobic gfp gene (gfpuv) and an anaerobic gfp gene (evoglow-
Pp1) were cloned downstream from the constitutive promoter of elon-
gation factor Tu from B. longum CECT 4551, using the pNZ8048 plasmid
after deleted PnisA promoter.
Expression of aerobic and anaerobic GFP was detected by a fluores-
cence imager and by fluorescence microscopy. For the anaerobic gfp,
the resulting transformant, L. lactis MG1363 containing pNZ:Tu-GFPana
was brightly fluorescent (Fig. 2) and harbored the expected plasmid. A
plasmid stability test revealed that pNZ:Tu-GFPana was stable for at
least 50 generations of growth under nonselective pressure. L. lactis
MG1363-GFPana and its parent strain were shown to have similar
growth rates (data not shown).
L. lactis cells carrying pNZ:Tu with aerobic gfp from A. victoria
showed fluorescence in aerobic conditions. However, fluorescence
was not observed when it was grown in anaerobic conditions. For
these reason, bifidobacteria strains were only transformed with plasmid
contained anaerobic gfp.
 Author's personal copy
10 J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13
Fig. 2. Detection of anaerobic GFP in L. lactis MG1363 by a fluorescence imager. Bacteria on the right side of the figure have the anaerobic GFP expression plasmid. Bacteria on the left side of
the figure have the control plasmid pNZ8048. The filters used were A) Colorimetric: standard filter, white epi illumination B) Alexa: Filter: 530:28, Blue epi illumination.
3.2. Bifidobacteria transformation with pNZ:Tu-GFPana
To prepare electrocompetent bacteria, Bifidobacterium strains were
grown in the presence of different cell wall-altering compounds with
the aim of improving transformation efficiencies. When the cells were
cultivated in filtrated RCM and electroporated with 2.5 kV, B. breve
INIA P734 showed a high transformation efficiency of approximately
106 cfu/μg plasmid, whereas 102 cfu/μg plasmid was observed for
B. longum CECT 4551. However, the presence of glycine lysed the cells
and drastically reduced transformation efficiencies (N101 cfu/μg plas-
mid) were observed for both strains. No transformants were observed
when the cells were incubated in TSB with proteose-peptone and bile.
Transformation of B. longum CECT 4551 and B. breve INIA P734 with
pNZ:Tu-GFPana generated strains B. longum CECT 4551-GFPana and
B. breve INIA P734-GFPana, respectively. Serial subcultures of these
two strains showed stability of pNZ:Tu-GFPana in the bifidobacterial
host for at least 50 generations under non-selective conditions.
The putative effect of the constructions in B. longum CECT 4551 and
B. breve INIA P734 was examined. Growth and ability to form biofilm
in vitro of the transformed strains were not affected when compared
to their parent strains (data not shown). The exposition to gastric and
intestinal conditions resulted in reductions in the cell counts of both
strains higher than 2 log units, with no significant differences
(P b 0.01) in viability between the transformed bifidobacteria and
the parent strain (data not shown).
3.3. Detection of anaerobic GFP-marked bifidobacteria
The anaerobic GFP fluorescent colonies were visualized by a fluo-
rescence imaging system, whereas fluorescent cells were detected by
fluorescence microscopy and by flow cytometry. The resulting
transformants, B. longum CECT 4551-GFPana and B. breve INIA
P734-GFPana were brightly fluorescent and harbored the expected
plasmid pNZ:Tu-GFPana.
Bacterial colonies of B. longum CECT 4551-GFPana and B. breve INIA
P734-GFPana remained fluorescent after 10 days at refrigeration temper-
ature under anaerobic conditions. It was also possible to detect fluores-
cent cells as late as 300 h after inoculation by fluorescence microscopy,
suggesting that anaerobic gfp may indeed be a good marker gene to use
for bifidobacteria growing under anaerobic conditions.
Flow cytometry experiments were conducted to determine if the an-
aerobic GFP-marked bifidobacteria strains could be detected by this
technology, cells carrying pNZ8048 were used as control. The presence
of the pNZ:Tu-GFPana leads to an increase in overall green fluorescence
in B. longum CECT 4551-GFPana and B. breve INIA P734-GFPana com-
pared with that in controls without the plasmid (Fig. 3). However, we
must consider that UV (emission 405 nm) of flow cytometer is far
from the optimal of the anaerobic GFP used. The B. longum CECT 4551-
GFPana histogram showed an initial high peak that represents cells
with low/medium fluorescence intensity and a second lower peak for
those with high fluorescence intensity. Light scattering analysis re-
vealed that a possible explanation for the later peak is the existence of
cell doublets (data not shown).
3.4. Lactic acid bacteria transformation with pNZ:Tu-GFPana
The application of pNZ:Tu-GFPana as a marker system for non-
bifidobacteria strains was studied. E. faecium INIA TAB7-GFPana showed
similar fluorescence to those found in L. lactis MG1363-GFPana when
ChemiDoc MP imager and fluorescence microscopy were used. Howev-
er, when L. brevis INIA ESI38 and L. rhamnosus INIA P426 were
 Author's personal copy
J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13
Fig. 3. Fluorescent protein expression of B. longum CECT 4551-GFPana (A) and B. breve INIA
P734-GFPana (B) by flow cytometry. The open histogram represents the controls with the
plasmid pNZ8048.
transformed with pNZ:Tu-GFPana fluorescence was weak or absent
(data not shown). A slight increase in fluorescence was observed with
L. lactis and E. faecium carrying pNZ:Tu-GFPana when flow cytometry
was used, whereas no Lactobacillus carrying pNZ:Tu-GFPana was detect-
ed by this method.
3.5. Fluorescence quantification
Experiments were conducted to quantify the difference in fluores-
cence intensity between the different species harboring pNZ:Tu-
GFPana. The highest fluorescence intensity was observed with
B. longum CECT 4551 and B. breve INIA P734 carrying pNZ:Tu-GFPana.
L. lactis MG1363 and E. faecium INIA TAB7 harboring pNZ:Tu-GFPana
also showed fluorescence, although the fluorescence intensity was ap-
proximately four times lower than that of bifidobacteria strains.
L. brevis INIA ESI38 and L. rhamnosus INIA P426 containing pNZ:Tu-
GFPana did not show fluorescence in the fluorometric reader (Fig. 4).
In addition, the fluorescence of strains harbor anaerobic gfp increased
linearly with the cell mass, indicating that the fluorescence is correlated
with the cell growth (data not shown).
3.6. Detection of anaerobic GFP-marked bifidobacteria against a
background of food and human fecal microbiota
The use of anaerobic gfp as a marker for detecting a specific
bifidobacteria in food or fecal ecosystems was evaluated. B. longum
CECT 4551 and B. breve INIA P734 carrying pNZ:Tu-GFPana were easily
detected by direct green fluorescent cell counting methods by plating
and subsequent visualization by a fluorescence imaging system
(Fig. 5). Fluorescent colonies were still detected on RCM plate after 10
days at refrigeration temperatures. No green fluorescent cells were ob-
served in controls (without addition of marked cells).
In control yogurt, colonies from RCM plates were identified as cocci
or bacilli by contrast microscopy. However, L. delbrueckii formed large
colonies, while S. thermophilus formed very small colonies. In the yogurt
manufactured with commercial lactic culture plus GFPana-marked
Bifidobacterium, fluorescent bifidobacteria were clearly distinguishable
from neighboring colonies from the commercial lactic culture (Fig. 5A).
Bifidobacterium levels decreased to approximately 7 log units at the
end of yogurt manufacture. Non-fluorescent colonies were identified as
bacteria from the starter culture by contrast microscopy.
11
Fig. 4. Comparison of fluorescence intensity between the different strains containing pNZ:
Tu-GFPana.
In homogenized feces not inoculated with Bifidobacterium-GFPana,
the counts in RCM plates reached the values of 9.3 log cfu/ml (N80%
were initially identified as bifidobacteria). In samples that were inocu-
lated with the B. breve INIA P734-GFPana, the fluorescence imager
showed that approximately the 25% of the colonies were fluorescent
(Fig. 5B), reaching counts of 8.7 log cfu/ml. GFP-positive colonies were
confirmed by PCR using specific primers and conditions. Similar results
were observed with B. longum CECT 4551-GFPana.
4. Discussion
There is a need to identify and to monitor the bifidobacteria of inter-
est among several naturally occurring bacteria during food fermenta-
tion process or in the gastrointestinal tract when administered in vivo
for probiotic studies. Fluorescent marker genes have some advantages
since their intrinsic property of fluorescing does not require added sub-
strates or cofactors. A major drawback of common GFP-like reporter
proteins is that they require oxygen for chromophore formation
(Tsien, 1998), and therefore it cannot be applied in strict anaerobic con-
ditions. Recently, Cronin et al. (2008) constructed a luciferase reporter
system for B. breve UCC2003 which was used to investigate the persis-
tence of the strain in the GIT of mice. However, luciferases only emit
light in the presence of oxygen, and the level of luminescence should
be correlated to the number of cells under a given set of experimental
conditions to verify that there is enough oxygen for the reaction to
occur. The flavin-mono-nucleotide-based fluorescent protein used in
this paper overcomes these restrictions. Here we have described the
construction of a plasmid carrying an anaerobic gfp gene downstream
the constitutive promoter Tu of B. longum CECT 4551 as a real-time re-
porter to monitor the fate of bifidobacteria in complex environments.
This anaerobic GFP can be used as fluorescent reporter in both aerobic
and anaerobic biological systems (Drepper et al., 2007; Ernst and
Tielker, 2009), demonstrating its functionality in the anaerobic strains
B. longum CECT 4551 and B. breve INIA P734 in this paper.
Efficient transformation protocols remain a major obstacle to apply
genetic manipulation in bifidobacterial research. To date, several proto-
cols for transformation of bifidobacteria based on electroporation for
DNA transfer are available, but their transformation efficiencies are gen-
erally very low (Argnani et al., 1996; Guglielmetti et al., 2007; Rossi
et al., 1997; Sun et al., 2012). However, transformation efficiencies of
approximately 107 cfu/μg plasmid DNA have been reported for
B. breve UCC2003 (Pokusaeva et al., 2010, 2011; Ruiz et al., 2012). In
this work we optimized the procedure proposed by Álvarez-Martín
et al. (2008). The use of a transformation buffer containing citrate, an
optimized voltage, and an extended incubation at 4 °C prior to electro-
poration resulted in further improvements. With this procedure, our
strain B. breve INIA P734 showed high transformation efficiencies (ap-
proximately 106 cfu/μg plasmid DNA). The use of cell wall-altering
treatments to prepare competent bacteria has been reported for other
Gram-positive organisms (Holo and Nes, 1989; Monk et al., 2008;
 Author's personal copy
12 J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13
Fig. 5. Detection of expression of anaerobic GFP by Chemidoc. Fluorescent B. breve INIA P734-GFPana are discriminated from their non-fluorescent counterparts against a background of
yogurt (A) or human fecal (B) microbiota.
Powell et al., 1988). Here, the pre-treatment of bifidobacteria with bile
salts or glycine did not improve transformation efficiencies.
The use of GFP as a molecular marker for differentiation and identi-
fication of starter cultures or other desired bacteria among the microbi-
ota of the fermented foods has been proven previously in cheese
(Fernandez de Palencia et al., 2000, 2004) or fermented meat products
(Gory et al., 2001; Phumkhachorn et al., 2007). Moreover, GFP
marked-strains were also used to detect lactic acid bacteria within a
background of fecal bacteria (Scott et al., 1998, 2000). However, al-
though some of these studies have reported that cells grown anaerobi-
cally were able to become fluorescent after the exposure to air, the
visualization in situ of the GFP labeled strains in highly anaerobic re-
gions of the gut would not be possible as oxygen is required for GFP to
fluoresce. The reporter vector pNZ:Tu-GFPana obtained here provides
a simple method to differentiate the added bifidobacteria strain against
a natural large complex background of bacteria from food or fecal origin,
allowing the in situ detection of individual cells or colonies and their
spatial distribution even in completely anoxic environments.
Fluorescent bifidobacteria colonies were easily discriminated and
enumerated from their non-fluorescent counterparts by a fluorescence
imager (Fig. 5). The anaerobic GFP expression in B. longum CECT 4551
and B. breve INIA P734 cells carrying pNZ:Tu-GFPana were also con-
firmed by epifluorescence microscopy and by flow cytometry (Fig. 3).
Several methods have been used to identify GFP-marked bacteria, and
one of the advantages of flow cytometry over other methods is that
the information obtained does not reflect a mean of the entire cell pop-
ulation but rather a discrimination of individual cells in a population.
The results obtained using the fluorescence imaging system and the
flow cytometer were in concordance with the fluorometric assays
(Fig. 4).
The promoter from B. longum CECT 4551 used in the expression cas-
sette was strong enough to allow expression in L. lactis MG1363 and
E. faecium TAB7, although lower fluorescence levels than in bifidobacteria
were detected by all the methods mentioned above. However, this tool can-
not be used as general reporter for lactic acid bacteria since Lactobacillus
containing pNZ:Tu-GFPana did not show fluorescence. Then, new con-
structions must be developed to report anaerobic GFP in lactic acid bac-
teria. Work is in progress in this direction.
According to our results, pNZ:Tu-GFPana could be used as a reliable
vehicle for other bifidobacteria reporters under a variety of growth con-
ditions. Moreover, this plasmid provides an easy way for introducing
the promoter and GFP fusion protein of interest into bifidobacteria.
In conclusion, pNZ:Tu-GFPana provides a stable real-time and non-
invasive reporter system for bifidobacteria that does not disturb any im-
portant physiological properties of the parent strain, and in which fluo-
rescent signal was strong enough to be detected by several techniques.
Our work is the first to report a reliable method to track fluorescently la-
beled bifidobacteria in food or fecal environments under both aerobic
and anaerobic conditions, and provides a powerful tool for survival
studies under in vivo conditions.
Acknowledgments
This work was supported by projects RTA2010-00116-00-00 and
RM2010-00008-00-00. J.M. Landete has a postdoctoral contract with
the research program “Ramón y Cajal” (MINECO, Spain). The authors
thank the valuable help of Concepción Revilla from INIA (Spain), and
of V. Monedero and M. Zuñiga from IATA-CSIC (Spain).
References
Álvarez-Martín, P., Flórez, A.B., Margolles, A., del Solar, G., Mayo, B., 2008. Improved clon-
ing vectors for bifidobacteria, based on the Bifidobacterium catenulatum pBC1 repli-
con. Appl. Environ. Microbiol. 74, 4656–4665.
 Author's personal copy
J.M. Landete et al. / International Journal of Food Microbiology 175 (2014) 6–13
Álvarez-Martín, Guglielmetti, S., Mayo, B., 2010. Mobile genetic elements, cloning vectors
and genetic manipulation of bifidobacteria. In: Mayo, B., van Sinderen, D. (Eds.),
Bifidobacteria: Genomics and Molecular aspects. Caister Academic Press, Norfolk,
UK, pp. 235–258.
Argnani, A., Leer, R.J., van Luijk, N., Pouwels, P.H., 1996. A convenient and reproducible
method to genetically transform bacteria of the genus Bifidobacterium. Microbiology
142, 109–114.
Chudakov, D.M., Lukyanov, S., Lukyanov, K.A., 2005. Fluorescent proteins as a toolkit for
in vivo imaging. Trends Biotechnol. 23, 605–613.
Cogan, T.M., Barbosa, M., Beuvier, E., Bianchi-Salvadori, B., Cocconcelli, P.S., Fernandes, I.,
Gomez, J., Kalantzopoulos, G., Ledda, A., Medina, M., Rea, M.C., Rodríguez, E., 1997.
Characterization of the lactic acid bacteria in artisanal dairy products. J. Dairy Res.
64, 409–421.
Cronin, M., Sleator, R.D., Hill, C., Fitzgerald, G.F., van Sinderen, D., 2008. Development of a
luciferase-based reporter system to monitor Bifidobacterium breve UCC2003 persis-
tence in mice. BMC Microbiol. 8, 161.
Cubitt, A.B., Heim, R., Adams, S.R., Boyd, A.E., Gross, L.A., Tsien, R.Y., 1995. Understanding,
improving and using green fluorescent proteins. Trends Biochem. Sci. 20, 448–455.
Drepper, T., Eggert, T., Circolone, F., Heck, A., Krau, U., Guter, K., Wendorff, M., Gärtner, W.,
Jaeger, K.-E., 2007. Reporter proteins for in vivo fluorescence without oxygen. Nat.
Biotechnol. 25, 443–445.
Ernst, J.F., Tielker, D., 2009. Responses to hypoxia in fungal pathogens. Cell Microbiol. 11,
183–190.
Fernandez de Palencia, P., Nieto, C., Acebo, P., Espinosa, M., Lopez, P., 2000. Expression of
green fluorescent protein in Lactococcus lactis. FEMS Microbiol. Lett. 183, 229–234.
Fernández de Palencia, P., De la Plaza, M., Mohedano, M.L., Martínez-Cuesta, M.C.,
Requena, T., López, P., Peláez, C., 2004. Enhancement of 2-methylbutanal formation
in cheese by using a fluorescently tagged Lacticin 3147 producing Lactococcus lactis
strain. Int. J. Food Microbiol. 93, 335–347.
Gaggìa, F., Mattarelli, P., Biavati, B., 2010. Probiotics and prebiotics in animal feeding for
safe food production. Int. J. Food Microbiol. 141, S15–S28.
Gasson, M.J., 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic
streptococci after protoplast-induced curing. J. Bacteriol. 154, 1–9.
Gory, L., Montel, M.C., Zagorec, M., 2001. Use of green fluorescent protein to monitor Lac-
tobacillus sakei in meat fermented products. FEMS Microbiol. Lett. 194, 127–133.
Greer III, L.F., Szalay, A.A., 2002. Imaging of light emission from the expression of lucifer-
ases in living cells and organisms: a review. Luminescence 17, 43–74.
Guglielmetti, S., Karp, M., Mora, D., Tamagnini, I., Parini, C., 2007. Molecular characteriza-
tion of Bifidobacterium longum biovar longum NAL8 plasmids and construction of a
novel replicon screening system. Appl. Microbiol. Biotechnol. 74, 1053–1061.
Hart, A.L., Lammers, K., Brigidi, P., Vitali, B., Rizzello, F., Gionchetti, P., Campieri, M., Kamm,
M.A., Knight, S.C., Stagg, A.J., 2004. Modulation of human dendritic cell phenotype and
function by probiotic bacteria. Gut 53, 1602–1609.
Holo, H., Nes, I.F., 1989. High-frequency transformation, by electroporation, of Lactococcus
lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Envi-
ron. Microbiol. 55, 3119–3123.
Hutchens, M., Luker, G.D., 2007. Applications of bioluminescence imaging to the study of
infections diseases. Cell. Microbiol. 9, 2315–2322.
Kuipers, O.P., de Rayter, P.G.G.A., Kleerebezem, M., Vos, W.M., 1998. Quorum sensing-
controlled gene expression in lactic acid bacteria. J. Biotechnol. 64, 15–21.
Lebeer, S., Verhoeven, T.L.A., Perea Vélez, M., Vanderleyden, J., De Keersmaecker, S.C.J.,
2007. Impact of environmental and genetic factors on biofilm formation by the pro-
biotic strain Lactobacillus rhamnosus GG. Appl. Environ. Microbiol. 73, 6768–6775.
Monk, I.R., Gahan, C.G.M., Hill, C., 2008. Tools for functional postgenomic analysis of
Listeria monocytogenes. Appl. Environ. Microbiol. 74, 3921–3934.
13
Phumkhachorn, P., Rattanachaikunsopon, P., Khunsook, S., 2007. The use of gfp gene in
monitoring bacteriocin-producing Lactobacillus plantarum N014, a potential starter
culture in nham fermentation. J. Food Prot. 70, 419–424.
Pokusaeva, K., Neves, A.R., Zomer, A., O'Connell-Motherway, M., MacSharry, J., Curley, P.,
Fitzgerald, G.F., van Sinderen, D., 2010. Ribose utilization by the human commensal
Bifidobacterium breve UCC2003. Microb. Biotechnol. 3, 311–323.
Pokusaeva, K., O'Connell-Motherway, M., Zomer, A., Macsharry, J., Fitzgerald, G.F., van
Sinderen, D., 2011. Cellodextrin utilization by Bifidobacterium breve UCC2003. Appl.
Environ. Microbiol. 77, 1681–1690.
Posno, M., Leer, R.J., van Luijk, N., van Giezen, M.J., Heuvelmans, P.T., Lokman, B.C.,
Pouwels, P.H., 1991. Incompatibility of Lactobacillus vectors with replicons derived
from small cryptic Lactobacillus plasmids and segregational instability of the intro-
duced vectors. Appl. Environ. Microbiol. 57, 1822–1828.
Powell, I.B., Achen, M.G., Hillier, A.J., Davidson, B.E., 1988. A simple and rapid method for
genetic transformation of lactic streptococci by electroporation. Appl. Environ.
Microbiol. 54, 655–660.
Rodríguez, E., González, B., Gaya, P., Nuñez, M., Medina, M., 2000. Diversity of bacteriocins
produced by lactic acid bacteria isolated from raw milk. Int. Dairy J. 10, 7–15.
Rodríguez, E., Arqués, J.L., Rodríguez, R., Landete, J.M., Medina, M., 2012. Antimicrobial
properties of probiotic strains isolated from breast-fed infants. J. Funct. Foods 4,
542–551.
Rossi, M., Brigidi, P., Matteuzzi, D., 1997. An efficient transformation system for
Bifidobacterium spp. Lett. Appl. Microbiol. 24, 33–36.
Ruiz, L., O'Connell-Motherway, M., Zomer, A., de Los Reyes-Gavilán, C.G., Margolles, A.,
van Sinderen, D., 2012. A bile-inducible membrane protein mediates bifidobacterial
bile resistance. Microb. Biotechnol. 5, 523–535.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: a Laboratory Manual, 2nd
ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
Scott, K.P., Mercer, D.K., Glover, L.A., Flint, H.J., 1998. The green fluorescent protein as a
visible marker for lactic acid bacteria in complex ecosystems. FEMS Microbiol. Ecol.
26, 219–230.
Scott, K.P., Mercer, D.K., Richardson, A.J., Melville, C.M., Glover, L.A., Flint, H.J., 2000. Chromo-
somal integration of the green fluorescent protein gene in lactic acid bacteria and the
survival of marked strains in human gut simulations. FEMS Microbiol. Lett. 182, 23–27.
Stepanovic, S., Vukovic, D., Dakic, I., Savic, B., Svabic-Vlahovic, M., 2000. A modified
microtiter-plate test for quantification of staphylococcal biofilm formation.
J. Microbiol. Methods 40, 175–179.
Sun, Z., Baur, A., Zhurina, D., Yuan, J., Riedel, C.U., 2012. Accessing the inaccessible: molec-
ular tools for bifidobacteria. Appl. Environ. Microbiol. 78, 5035–5042.
Tsien, R.Y., 1998. The green fluorescent protein. Annu. Rev. Biochem. 67, 509–544.
Turroni, P., van Sinderen, D., Ventura, M., 2011. Genomics and ecological overview of the
genus Bifidobacterium. Int. J. Food Microbiol. 149, 37–44.
Turroni, F., Peano, C., Pass, D.A., Foroni, E., Severgnini, M., Claesson, M.J., Kerr, C.,
Hourihane, J., Murray, D., Fuligni, F., Gueimonde, M., Margolles, A., De Bellis, G.,
O'Toole, P.W., Van Sinderen, D., Marchesi, J.R., Ventura, M., 2012. Diversity of
Bifidobacteria within the infant gut microbiota. PLoS One 7, e36957.
Ventura, M., Turroni, F., Zomer, A., Foroni, E., Giubellini, V., Bottacini, F., Canchaya, C.,
Claesson, M.J., He, F., Mantzourani, M., Mulas, L., Ferrarini, A., Gao, B., Delledonne,
M., Henrissat, B., Coutinho, P., Oggioni, M., Gupta, R.S., Zhang, Z., Beighton, D.,
Fitzgerald, G.F., O'Toole, P.W., van Sinderen, D., 2009a. The Bifidobacterium dentium
Bd1 genome sequence reflects its genetic adaptation to the human oral cavity. PLoS
Genet. 5 (12), e1000785.
Ventura, M., O'Flaherty, S., Claesson, M.J., Turroni, F., Klaenhammer, T.R., van Sinderen, D.,
O'Toole, P.W., 2009b. Genome-scale analyses of health-promoting bacteria:
probiogenomics. Nat. Rev. Microbiol. 7, 61–71.