Journal of Bioscience and Bioengineering

VOL. xx No. xx, 1e7, 2018

www.elsevier.com/locate/jbiosc

Rapid multiplex nucleic acid amplification test developed using paper

chromatography chip and azobenzene-modified oligonucleotides

Sotaro Sano,1, 2, * Shigehiko Miyamoto,1 and Seiji Kawamoto2

Medical Devices Solutions Vehicle, Kaneka Corporation, 1-8 Miyamaemachi, Takasago-cho, Takasago, Hyogo 676-8688, Japan1 and Department of Molecular Biotechnology, Graduate
School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530, Japan2

Received 31 January 2018; accepted 23 March 2018

Available online xxx
Although nucleic acid amplification test (NAT) is widely used for pathogen detection, rapid NAT systems that do not
require special and expensive instruments must be developed in order to enable point of care (POC)-NATs, which
contribute to early initiation of treatment. As a POC-NAT system, Kaneka DNA chromatography chip (KDCC), developed
using DNA tag-bound primer through modified substance, was shown to be suitable for POC testing, due to the rapid
detection time, simple procedures, and low manufacturing costs. However, owing to some modifications in primer, the
detection performance and amplification speed were shown to be reduced when using KDCC, counteracting the
increased speed of detection. To solve these issues and improve the speed of this NAT system, we investigated a better
modification substance for KDCC. Here, azobenzene-modified primers were shown to have the highest amplification
speed and detection performance in KDCC, of all modifications tested in this study, showing 10e100-fold lower detection
limit but maintaining the same reaction time. Additionally, rapid herpes simplex virus detection system with azo-
benzene modified primers was developed. We believed that this breakthrough will contribute toward enabling greater
utilization of POC-NATs for medical care, especially in developing countries and clinics.
Ó 2018, The Society for Biotechnology, Japan. All rights reserved.

[Key words: Paper chromatography chip; Nucleic acid amplification test; DNA polymerase; Modified nucleotide; Amplification speed]

Nucleic acid amplification test (NAT) has become an indis-
pensable diagnostic tool for medical care, as it can be used to detect
targets from trace amounts of nucleic acid. For example, to detect
herpes simplex virus (HSV), which may cause severe diseases, such
as HSV encephalitis and neonatal HSV infections, only 10 copies of
HSV-1/2 DNA are necessary (1e3). However, to perform NAT,
complicated procedures and expensive instruments are usually
required, which prevents a wider application of NATs in the
developing countries and smaller institutions, such as a clinic and a
quarantine station, despite the large demand in these fields.
Especially considering the recent pandemics of emerging and re-
emerging infectious diseases, the point of care (POC)-testing,
referring to the diagnostic procedures on site, has attracted atten-
tion due to its high infection control potential (4).
Paper-based chromatography chip systems are suitable for the
development of POC-NATs, because they require simple proced-
ures, the use of inexpensive instruments, and low manufacturing
costs. Previously, Corstjens et al. (5) reported the development of a
chromatography chip comprising a streptavidin immobilized on a
chip and anti-digoxigenin (DIG) antibody-immobilized phosphor
particles. Using PCR and biotin and DIG-modified primers, the ob-
tained amplified products can be detected on the chip as colored
lines. Although the application of this system is simple, multiplex
* Corresponding author at: Medical Devices Solutions Vehicle, Kaneka Corpora-
tion, 1-8 Miyamaemachi, Takasago-cho, Takasago, Hyogo 676-8688, Japan. Tel.:
þ81794452406; fax: þ81794452756.
E-mail address: Sotaro.Sano@kaneka.co.jp (S. Sano).
detection is limited by the antigeneantibody combination. Another
group developed a chromatography chip using DNAeDNA hybrid-
ization, comprising streptavidin immobilized on a paper chip and
single-strand DNA immobilized on colloidal gold nanoparticles (6),
which enabled the development of multiplex detection systems,
due to the different complementary sequence combinations.
However, since PCR products are double-strand DNA, melting and
temperature regulation are necessary, which reduces the usability
of the system. Furthermore, nucleic acid detection chips with
single-stranded DNA tags were reported as well (7,8). We desig-
nated this system as Kaneka DNA chromatography chip (KDCC) (9),
which requires special primers with the sequences complementary
to the 30 sequences of the target gene, and single-stranded DNA tag
sequence at the 50 end, containing a modification. During sequence
amplification, elongation by DNA polymerases is blocked at the
modified site and amplicons with single-stranded DNA tag are
synthesized, so that they would specifically hybridize to the DNA
probes on the chromatography chip and allow particle labeling at
room temperature. After the addition of amplicons on the chip,
they can immediately be detected as colored lines, without elec-
trophoresis or fluorescence detection, which simplifies the analysis.
For efficient KDCC-based detection, the generation of PCR
products with ssDNA tags at 50 ends is required, and they are syn-
thesized by inhibiting DNA polymerase-mediated product elonga-
tion, using modified sites in the primers. Inefficient elongation
inhibition affects the performance and the detection limit of KDCC,
because the tag is not recognized. Certain modification substances
that inhibit DNA polymerase elongation have been identified, such

1389-1723/$ e see front matter Ó 2018, The Society for Biotechnology, Japan. All rights reserved.
https://doi.org/10.1016/j.jbiosc.2018.03.017

Please cite this article in press as: Sano, S., et al., Rapid multiplex nucleic acid amplification test developed using paper chromatography chip and
azobenzene-modified oligonucleotides, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.017
2 SANO ET AL. J. BIOSCI. BIOENG.,

TABLE 1. Oligonucleotides used in this study.

No. Oligo Primer sequence (5 e30 )

0
Mer Remarks

1 Cy3-P [Cy3]ACCTCTTCCAGCGAGAAC 18 50 fluorescent dye (Cy3) modified

2 T25 GCTATAAGTTCTCGCTGGAAGAGGT 25
3 T50 TCGAGTGACAGCTAATGTGTGATTGCTATAAGTTCTCGCTGGAAGAGGT 50
4 T50 (Az) TCGAGTGACAGCTAATGTGTGATT-[Az]-GCTATAAGTTCTCGCTGGAAGAGGT 50
5 T50 (C3) TCGAGTGACAGCTAATGTGTGATT-[C3]-GCTATAAGTTCTCGCTGGAAGAGGT 50
6 T50 (S9) TCGAGTGACAGCTAATGTGTGATT-[S9]-GCTATAAGTTCTCGCTGGAAGAGGT 50
7 T50 (IN) TCGAGTGACAGCTAATGTGTGATT-[IN]-GCTATAAGTTCTCGCTGGAAGAGGT 50
8 R GATAGGATTAGAAGGTCGAACCGT 24
9 R (Az) ATTTTTCACTGGGTTTATAGT-[Az]-GATAGGATTAGAAGGTCGAACCGT 45
10 R (C3) ATTTTTCACTGGGTTTATAGT-[C3]-GATAGGATTAGAAGGTCGAACCGT 45
11 R (S9) ATTTTTCACTGGGTTTATAGT-[S9]-GATAGGATTAGAAGGTCGAACCGT 45
12 R (In) ATTTTTCACTGGGTTTATAGT-[IN]-GATAGGATTAGAAGGTCGAACCGT 45
13 I1 ATCACACATTAGCTGTCACTCGATGCA 27 Capture probe (immobilized on membrane)
14 I2 TTAGAGAGTTATCGTAGACCTCGCA 25
15 I3 TGGCAACATTTTTCACTGGGTTTATAG 27
16 A1 CTATAAACCCAGTGAAAAATGTTGCCA[C6-SH] 27 Detection probe (immobilized on Au nano-colloid), 30 C6-Thiol modified
17 C25 ACCTCTTCCAGCGAGAACTTATAGC 25 Complementary sequence of T25
18 i1-hsv-1f TGCATCGAGTGACAGCTAATGTGTGAT-[Az]-CTGTGGTGTTTTTGGCATCA 47 Primers were designed based on Muvunyi et al. (16)
19 a1-hsv-1r TGGCAACATTTTTCACTGGGTTTATAG-[Az]-GGTGGTGGAGGAGACGTTG 46
20 a1-hsv-2f TGGCAACATTTTTCACTGGGTTTATAG-[Az]-CATGGGGCGTTTGACCT 44
21 i2-hsv-2r TGCGAGGTCTACGATAACTCTCTAA-[Az]-TACACAGTGATCGGGATGCT 45

Az, azobenzene; C3, trimethylene; S9, triethylene glycol; IN, inverted nucleotide (thymidine).

as fluorescent dyes, methylation agents, uracil base, phosphor-
amidite, azobenzene, and C3 (7,8,10). These substances can be used
to modify the used primers, such that DNA polymerase functions
are inhibited; therefore, they are useful for KDCC. However, they
have not been analyzed in detail.
The reduction of amplification time is equally important for the
development of POC-NATs, and several strategies have been
developed to this end. A thermal cycler with high ramp-rate can be
used in order to adjust the arbitrary temperature rapidly (11), while
another approach may be the use of DNA polymerase with an
increased extension speed, allowing shorter time for DNA elonga-
tion (12). However, the binding efficiency of a primer and a tem-
plate is strongly associated with the applicability of these strategies
in specific tests.
As primer modifications, non-nucleotide modifications are
more suitable, because nucleotide modifications may be overcome
by DNA polymerase (13), resulting in the synthesis of undetectable
products. However, the modifications that do not imitate nucleo-
tides generally decrease the efficiency of primer-template bindings,
since they obstruct the proper formation of complementary
double-stranded DNA (14) and increase the time necessary for the
amplification. Therefore, to improve the KDCC-based analyses, the
use of modifications that inhibit the elongation by DNA polymerase
and do not affect primer-template binding is important. Here, we
investigated such modifications, and reported their detection per-
formance. Additionally, we further developed a rapid and sensitive
pathogen detection system based on KDCC.
MATERIALS AND METHODS
Materials In NATs, polymerases used can be bacterial A and archaeal B family
DNA polymerases. Here, we used family A polymerase derived from thermophilic
bacteria, Thermus aquaticus (Taq; New England Biolabs, USA) and family B DNA po-
lymerase derived from hyperthermophilic archaea, Thermococcus kodakarensis (KOD
exo (); Toyobo, Japan) (12,15). All oligonucleotides (Table 1; (16)) were purchased
from Kaneka Eurogentec (Belgium). Substances used for modifications were
azobenzene, trimethylene (C3), triethylene glycol (S9), and inverted nucleotides
(INs) (Fig. 1). Azobenzene, under visible light, forms trans-isomer, while under
ultra-violet light (UV), it forms cis-isomer (17). Lambda phage DNA was purchased
from Takara Bio (Japan). HSV-1/2 DNA was purchased from Bio-Rad (USA).

FIG. 1. Modification substances used in this study. Shadowed parts of the molecules indicate modification sites. For example, one of the modifications was inserted between 50
thymidine and 30 guanidine.

Please cite this article in press as: Sano, S., et al., Rapid multiplex nucleic acid amplification test developed using paper chromatography chip and
azobenzene-modified oligonucleotides, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.017
VOL. xx, 2018
FIG. 2. KDCC detection principles. (A) Structure of the DNA-tagged primer, with a primer domain, annealing to the target sequence, and a tag domain, hybridizing to the DNA probe
on chip or colloidal gold nanoparticles. These domains are connected with the modification site. (B) The obtained amplification products, with ssDNA tags at 50 end. (C) Captured
PCR product and colloidal gold nanoparticles on the chip. (D) KDCC detection process. PCR product with tagged primers can be immediately detected as a colored line on chip.
DNA chromatography KDCC principle is illustrated in Fig. 2. Two processes,
PCR amplification and detection, are employed to detect target DNA. For the
amplification, DNA-tagged modified primers are used. Primers have two domains,
a primer domain, capable of annealing to the target sequence, and a tag domain,
which can hybridize to the solid-phase DNA probe on chip or colloidal gold
nanoparticles. These domains are connected with the modification site that
inhibits the DNA polymerase-associated elongation. The amplicon synthesized
using these primers contains a single-strand (ss)DNA tag at 50 end, which
specifically hybridizes to the probe DNA on the chip or colloidal gold nanoparticles.
Following the PCR reaction, one aliquot of amplicon is used for KDCC analysis, with
a development buffer, to develop the amplicon on the chip, through the capillary
action (Fig. 2). During development, the amplicons interact with colloidal gold
nanoparticles that adhere to the DNA probes, forming an amplicon-colloidal gold
nanoparticle complex. As the complex moves on the chip, it interacts with the solid-
phase probe on a chip, which consists of the sequence complementary to the other tag
sequence, and is captured by the probe, resulting in a red signal originating from
colloidal gold nanoparticles, which allows the visual detection of the amplicons. By
using multiple sets of primer pairs with different tags, in combination with multiplex
PCR techniques, it is possible to simultaneously detect a number of targets.
Elongation inhibition assays The elongation inhibition assays were per-
formed as previously reported, with some modifications (10), using Taq and KOD exo
() DNA polymerases. Taq reaction mixtures contained 0.0125 U/mL Taq polymerase,
10 mM TriseHCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM deoxynucleotides
(dNTPs), 0.5 mM Cy3-probe, 1 mM of each modified oligonucleotide in the total
volume of 20 mL. KOD reaction mixtures contained 0.0125 U/mL KOD exo ()
polymerase, 1 KOD exo () buffer, 0.2 mM dNTPs, 0.5 mM Cy3-probe, and 1 mM
of each modified oligonucleotide in 20 mL. Elongation conditions were as follows:
1 min at 94 C, followed by 30 cycles of 5 s at 95 C, 5 s at 60 C, and 5 s at 72 C.
Following the incubation, 1 mL of 0.5 M EDTA was added to the mixtures, 2.5 mL of
each solution were mixed with sample buffer containing 10 M urea and 1 TBE
buffer (0.089 M Tris borate, 0.089 M boric acid, 0.002 M EDTA), and the samples
were electrophoresed on a 20% denaturing polyacrylamide gel, 7 M urea in TBE
buffer. After electrophoresis, polyacrylamide gels were analyzed with fluorescent
gel imager, ImageQuant LAS 4000 (GE Healthcare, USA). In this assay, 50-mer DNA
templates and 50 Cy3 labeled 17-mer primers were used. Each DNA template
contained a modified site at position 25. After incubation, if the sequence
elongation by DNA polymerase was completely blocked, 25-mer products were
obtained, whereas, if it was not blocked, 50-mer products were identified.
Real-time PCR assays Taq reaction mixtures contained 0.0125 U/mL Taq
polymerase, 10 mM TriseHCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs,
0.3 mM of forward and reverse primers each, and 1/20,000 SYBR Green I (Takara
Bio, Japan) in 20 mL. KOD reaction mixtures contained 0.0125 U/mL KOD exo ()
DNA polymerase and 1 KOD exo () buffer, 0.2 mM dNTPs, 0.3 mM forward and
reverse primers each, and 1/20,000  SYBR Green I in 20 mL. As a template
sequence, 100 pg/test lambda phage DNA was used. Primer combinations were as
follows: azobenzene (forward primer: T50 (Az); reverse primer: R (Az)), C3
(forward primer: T50 (C3); reverse primer: R (C3)), S9 (forward primer: T50 (S9);
reverse primer: R (S9)), IN (forward primer: T50 (IN); reverse primer: R (IN)).
Non-modified primers (forward primer: T25; reverse primer: R) were used as a
control. Real-time PCR was performed using LightCycler96 (Roche, Switzerland).
Melting temperature analysis Tm values of each modified oligonucleotide
were analyzed with UVevis spectrophotometer TMSPC-8 (Shimadzu, Japan). Modified
Please cite this article in press as: Sano, S., et al., Rapid multiplex nucleic acid amplification test developed using paper chromatography chip and
azobenzene-modified oligonucleotides, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.017
RAPID MULTIPLEX NAT WITH CHROMATOGRAPHY CHIP 3
oligonucleotides (T50 (Az), T50 (C3), T50 (S9) and T50 (In); 1 mM each) and a non-
modified oligonucleotide (T50) were hybridized with 1 mM complementary
oligonucleotide (C25) in the hybridizing buffer (100 mM NaCl, 10 mM Na2HPO4,
1 mM Na2EDTA, pH 7.0) (18). Absorbance at 260 nm of the hybridized samples was
recorded at temperatures between 25 C and 80 C using a ramp rate of 0.5 C/min.
The Tm values were calculated using the preprogrammed fitting methods offered in
the Tm analysis software provided with the TMSPC-8 UVevis spectrophotometer.
Detection of the PCR products with KDCC Two types of KDCCs were
generated. KDCC-1 was generated by linearly immobilizing capture DNA probe (I1)
onto the nitrocellulose membranes, whereas a detection probe (A1) was
immobilized on the colloidal gold nanoparticles. KDCC-3 was generated by
linearly immobilizing the capture DNA probes (I1, I2, and I3) onto the
nitrocellulose membrane and a detection probe (A1) on the colloidal gold
nanoparticles. Chromatography chips were assembled following the protocol
described by Takahashi et al. (7).
PCR reactions were performed with both described polymerases. Taq reaction
mixtures contained 2.5 U/mL Taq polymerase, 10 mM TriseHCl (pH 8.3), 50 mM KCl,
1.5 mM MgCl2, 0.2 mM dNTPs, and 0.3 mM forward and reverse primers each, in
20 mL. KOD reaction mixtures contained 2.5 U/mL KOD exo () DNA polymerase and
1 KOD exo () buffer, 0.2 mM dNTPs, and 0.3 mM forward and reverse primers each
in 20 mL. As templates, 100 pg/test lambda phage DNA, HSV-1, and HSV-2 DNA se-
quences were used. PCR analyses were performed with LifeECO (Bioer; China). Af-
terward, 5 mL of amplified products were analyzed on KDCCs, and developed with
65 mL of development buffer at room temperature. After 5 min, color signals from the
chip were analyzed using immuno-chromatography reader, C10066-10 (Hama-
matsu Photonics, Japan) and inspected visually.
RESULTS
Elongation inhibition assay We analyzed the efficiency of
elongation inhibition by the modification substances, azobenzene,
C3, S9, and IN. Following the electrophoresis, the inhibition effi-
ciency was calculated from detected fluorescence intensity as fol-
lows: (25-mer product)/(25-mer product þ > 25-mer product) [%]
(Fig. 3). We confirmed that azobenzene, C3, S9, and INs inhibit the
FIG. 3. DNA elongation with modified templates. DNA polymerase synthesizes com-
plementary sequences using the DNA templates until it reaches the modified site,
where the elongation is inhibited or it continues due to the translesion synthesis.
4 SANO ET AL. J. BIOSCI. BIOENG.,

FIG. 4. Efficiency of DNA elongation inhibition. Inhibition efficiency was calculated based on the fluorescence intensity of (25-mer product)/(25-mer product þ > 25-mer product)
[%]. (A) Taq polymerase assays. (B) KOD exo () polymerase assays (25-mer product, properly synthesized product; 50-mer, translesion synthesized product).

A. Taq B. KOD

Triethylene glycol (S9) Triethylene glycol (S9)

Florescent intensity

Florescent intensity

Trimethylene (C3) Trimethylene (C3)

Azobenzene (Az) Azobenzene (Az)

Inverted nucleotide (IN) Inverted nucleotide (IN)

Cycles N=3 Cycles N=3

FIG. 5. Real-time PCR assay. Amplification efficiency of each modified primer was analyzed. Fluorescence intensity and Cq values were determined. (A) Taq DNA polymerase assays.
(B) KOD exo () polymerase assays.

elongation of sequences when used with both tested DNA

polymerases. Azobenzene modification of the template DNA was
shown to be the most efficient (Taq: 100%, KOD: 96.3  0.4%),
followed by C3 modifications (Taq: 95.7  5.2%, KOD:
81.9  0.4%), S9 (Taq: 96.3  2.7%, KOD: 77.0  2.8%), and, finally,
INs (Taq: 84.2  7.1%, KOD: 81.2  0.6%) (Fig. 4). However,
products longer than 25 nucleotides were detected as well after
all modifications, except when azobenzene-Taq polymerase
combination was used.

Amplification efficiency The amplification efficiencies of

each modified oligonucleotide were analyzed by using real-rime
PCR. Lambda phage DNA was used as the template. Cq analysis
demonstrated that the PCR reaction with azobenzene-modified
primers had the lowest Cq values (Taq: 15.1  0.09, KOD:
13.6  0.06), followed by C3-modified (Taq: 16.0  0.32, KOD:
15.2  0.38), S9 (Taq: 16.8  0.33, KOD: 15.9  0.54), and IN-
modified (Taq: 17.0  0.60, KOD: 16.7  0.38) primers. The Cq
values obtained using azobenzene-modified primers were shown
to be very similar to those obtained with non-modified primers
(Taq: 15.3  0.09, KOD: 13.0  0.06) (Fig. 5).

Melting temperature analysis Tm values of each modified

oligonucleotide were analyzed by measuring absorbance of the
hybridized samples at 260 nm. Our analyses demonstrated that
azobenzene-modified primers showed the highest Tm values
(65.24  0.43), followed by the non-modified primer
FIG. 6. Melting temperature (Tm) analyses, using modified oligonucleotides. Tm values (63.79  0.10), S9 (63.55  0.52), C3 (63.27  0.60), and IN
obtained using the modified primers were analyzed and compared. (62.66  0.44) (Fig. 6).

Please cite this article in press as: Sano, S., et al., Rapid multiplex nucleic acid amplification test developed using paper chromatography chip and
azobenzene-modified oligonucleotides, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.017
VOL. xx, 2018 RAPID MULTIPLEX NAT WITH CHROMATOGRAPHY CHIP 5

FIG. 7. KDCC detection of PCR products. Color signals obtained on chips were evaluated visually and with immuno-chromatography reader. (A) PCR products obtained using Taq
polymerase. (B) PCR products obtained using KOD exo () polymerase. n. d., no data; minus, color signal was not visually detectable; plus sign, color signal was visually detectable;
two plus signs, easily detectable; three plus signs, a stronger signal. Az, azobenzene-modified primers used; C3, C3-modified primers used; S9, S9-modified primers used; IN, IN-
modified primers used.

KDCC detection profiles Using all modified oligonucleotides DISCUSSION

as primers, we performed PCR analyses. Primer combinations and
template DNA were the same as described for the analysis of
amplification efficiency. KDCC-1 was used to analyze all products,
and PCR products obtained by using the azobenzene-modified
primers showed the lowest detection limit (Taq: 0.3 pg/test, KOD:
0.03 pg/test) with the same reaction time (Fig. 7). The limit was
shown to be 10-fold lower than that obtained using C3-modfidied
primers, and 100-fold lower than those obtained using S9- and
IN-modified primers. Furthermore, by adding a larger amount of
template increased the signal intensity observed on the chip,
demonstrating the potential of KDCC for quantitative analyses.
HSV-1/2 detection with KDCC using azobenzene-modified
primers Using KOD polymerase and HSV-1/2 DNA as
templates, multiplex-PCR analyses were performed. Primers were
designed as previously described (16) and azobenzene was used
as a modifier. KDCC-3 was used for the analysis. HSV-1 and HSV-
2 were shown to be properly detected as on KDCCs (Fig. 8), while
the time required for the analysis was less than 5 min.
Here, we observed that the inhibition efficiency depends on the
type of modification substance used, and azobenzene modifications
were shown to induce the highest levels of elongation inhibition.
The mechanisms underlying these processes remain unclear,
however, azobenzene characteristics, such as bulkiness, hydro-
phobicity, and intercalation properties (17), may contribute to this
effect. Additionally, a considerable level of translesion elongation
products were observed, depending on the modification substance,
with the maximum rate of 23% of the total products observed for
the combination of KOD exo () polymerase and S9 modifications.
Furthermore, in KDCC detection analyses, two modified forward
and reverse primers were used. Since undetectable PCR products
are synthesized when translesion synthesis occurs, this could
involve either forward or reverse primers, or both. The use of KOD
exo () polymerase and S9 modifications showed that the proba-
ˇ
bility of synthesizing tagged PCR products was 59.29% (0.77 2 
100), demonstrating that translesion elongation and, therefore, the
synthesis of undetectable products lead to a decrease in KDCC
detection performance. Although the reduction in sensitivity can be

Please cite this article in press as: Sano, S., et al., Rapid multiplex nucleic acid amplification test developed using paper chromatography chip and
azobenzene-modified oligonucleotides, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.017
6 SANO ET AL.
FIG. 8. HSV-1/2 detection with KDCC. HSV-1/2 DNA samples were PCR-amplified using
azobenzene-modified primers. Amplicons were analyzed on KDCC-3, and the signals
were visually detected within 5 min. N, non-template negative control.
mitigated by increasing the number of thermal cycles, longer re-
action time is not suitable for POC diagnostics. Therefore, all our
analyses pointed to azobenzene modifications as superior for the
application in KDCC, due to the higher inhibition efficiency and the
synthesis of detectable PCR products.
The efficacy of the modification site-based elongation inhibition
depends on the DNA polymerase used. For example, although some
bacterial family A DNA polymerases are capable of accepting ribo-
nucleotide and uracil base, archaeal family B DNA polymerases are
inhibited by the presence of ribonucleotide and uracil bases
(19e21). Furthermore, thymine dimers and abasic sites allow the
translesion elongation (22). In this study, we analyzed the elon-
gation efficiencies of Taq and KOD exo () polymerases, and we
demonstrated that KOD polymerase is more capable of translesion
elongation. This was more prominent when using C3- and S9-
modified primers and KOD exo () polymerase, which decreased
inhibition efficiency, whereas the use of azobenzene primer led to
the inhibition efficiency if > 96%. KOD polymerase was shown to
have a high elongation rate and high tolerance against impurities in
PCR, making it suitable for the application in the ultra-rapid PCR
and PCR with no purification steps or with crude samples (11,23).
As these are the characteristics required for POC-NATs, the use of
KOD exo () represents a useful approach in the development of
POC tests.
Speed of the analysis is one of the crucial factors in POC-NAT
development. To investigate the speed of amplification, real-time
PCR assays were performed, showing that the reaction speed
when using all modified primers, except for azobenzene-modified
ones, was decreased (increased Cq values), compared with that
obtained when using primers with no modifications. This may be
due to the reduction of primer-template binding efficiency after the
modification, which stalls DNA polymerase and induces the for-
mation of inert complexes. However, when using azobenzene-
modified primers, the speed of reaction remained the same as
that for the non-modified samples when Taq polymerase was
applied, or it was higher than those obtained for other modifica-
tions when KOD exo () polymerase was used. This may be due to
the azobenzene functions as an intercalator, enhancing primer-
template binding efficiency. Based on our Tm analysis, we sup-
port this hypothesis as the azobenzene-modified oligonucleotides
Please cite this article in press as: Sano, S., et al., Rapid multiplex nucleic acid amplification test developed using paper chromatography chip and
azobenzene-modified oligonucleotides, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.017
J. BIOSCI. BIOENG.,
have higher Tm values than other analyzed oligonucleotides (the
buffer used in this analysis was not completely similar to the one
used in PCR; therefore, the Tm value maybe altered in PCR results).
Additionally, this counteracts the negative effect of primer modi-
fication, and contributes to increasing the amplification speed. The
superiority of azobenzene-modified primers for the use in KDCC
analyses was demonstrated throughout our study. The lowest
detection limit was observed when using azobenzene-modified
primers, with both analyzed DNA polymerases. Furthermore,
these results suggest that, by using azobenzene-modified primers
with the KDCCs, trace amounts of DNA can be rapidly detected, due
to the efficient inhibition of DNA polymerase-mediated sequence
elongation during the amplification step, in combination with a
higher amplification efficiency compared with those obtained
when using other primers.
Finally, rapid HSV-1/2 KDCC detection system was developed
using azobenzene-modified primers, allowing a rapid (within
5 min) detection of HSV-1/2 DNA. By combining this system with
simple sample pretreatment and rapid PCR technologies, multiplex
POC-NATs can be developed and widely used in future.
Supplementary data related to this article can be found at
https://doi.org/10.1016/j.jbiosc.2018.03.017.
ACKNOWLEDGMENTS
This work was supported by Kaneka corporation. Sotaro Sano
and Shigehiko Miyamoto are employees of the Kaneka corporation.
Seiji Kawamoto declares that there is no conflict of interest
regarding the work described here. We wish to thank Mr. J. Tomono
and Mr. S. Furuyoshi for advice on experimental design and valu-
able discussion.
References
1. Guatelli, J., Gingeras, T., and Richman, D.: Nucleic acid amplification in vitro:
detection of sequences with low copy numbers and application to diagnosis of
human immunodeficiency virus type 1 infection, Clin. Microbiol. Rev., 2,
217e226 (1989).
2. Fields, P., Popovic, T., Wachsmuth, K., and Olsvik, O.: Use of polymerase
chain reaction for detection of toxigenic Vibrio cholerae O1 strains from the
Latin American cholera epidemic, J. Clin. Microbiol., 30, 2118e2121 (1992).
3. Kaneko, H., Iida, T., Aoki, K., Ohno, S., and Suzutani, T.: Sensitive and rapid
detection of herpes simplex virus and varicella-zoster virus, J. Clin. Microbiol.,
43, 3290e3296 (2005).
4. Nam, T., David, W., Timothy, A., Stuart, C., David, G., Joseph, G., Ho, P., and
Gerald, K.: Quantitative point-of-care pathogen detection in septicemia, Point
Care, 7, 107e110 (2008).
5. Corstjens, P., Zuiderwijk, M., Brink, A., Li, S., Feindt, H., Niedbala, R., and
Tanke, H.: Use of up-converting phosphor reporters in lateral-flow assays to
detect specific nucleic acid sequences: a rapid, sensitive DNA test to identify
human papillomavirus type 16 infection, Clin. Chem., 47, 1885e1893 (2001).
6. Glynou, K., Ioannou, P., Christopoulos, T., and Syriopoulou, V.: Oligonucleo-
tide-functionalized gold nanoparticles as probes in a dry-reagent strip biosensor
for DNA analysis by hybridization, Anal. Chem., 75, 4155e4160 (2003).
7. Takahashi, K., Miyamoto, S., Jikihara, T., Sano, S., and Tomono, J.: Method for
amplifying nucleic acid and method for detecting amplified nucleic acid,
WO2013162026 (2013).
8. Niwa, K., Oribe, A., Okumura, H., Shimono, M., Nagai, K., Hirota, T., Yasue, H.,
and Kawase, M.: Tag/hybridization-based sensitive detection of polymerase
chain reaction products, Anal. Biochem., 464, 12e16 (2014).
9. Nagai, S., Miyamoto, S., Ino, K., Tajimi, S., Nishi, H., and Tomono, J.: Easy
detection of multiple Alexandrium species using DNA chromatography chip,
Harmful Algae, 51, 97e106 (2016).
10. Newton, C. R., Holland, D., Heptinstall, E., Hodgson, I., Edge, M.,
Markham, A., and Mclean, M.: The production of PCR products with 50 single-
stranded tails using primers that incorporate novel phosphoramidite in-
termediates, Nucleic Acids Res., 21, 1155e1162 (1993).
11. Neuzil, P., Zhang, C., Pipper, J., Oh, S., and Zhuo, L.: Ultra fast miniaturized real-
time PCR: 40 cycles in less than six minutes, Nucleic Acids Res., 34, e77 (2006).
12. Takagi, M., Nishioka, M., Kakihara, H., Kitabayashi, M., Inoue, H.,
Kawakami, B., Oka, M., and Imanaka, T.: Characterization of DNA polymerase
from Pyrococcus sp. strain KOD1 and its application to PCR, Appl. Environ.
Microbiol., 63, 4504e4510 (1997).
VOL. xx, 2018
13. Belousova, E., Rechkunova, N., and Lavrik, O.: Thermostable DNA poly-
merases can perform translesion synthesis using 8-oxoguanine and
tetrahydrofuran-containing DNA templates, Biochim. Biophys. Acta, 1764,
97e104 (2006).
14. Dames, S., Margraf, R. L., Pattison, D., Wittwer, C., and Voelkerding, K.:
Characterization of aberrant melting peaks in unlabeled probe assays, J. Mol.
Diagn., 9, 290e296 (2007).
15. Saiki, R., Gelfand, D., Stoffel, S., Scharf, S., Higuchi, R., Horn, G., Mullis, K.,
and Erlich, H.: Primer-directed enzymatic amplification of DNA with a ther-
mostable DNA polymerase, Science, 239, 487e491 (1988).
16. Muvunyi, M., Dhont, N., Verhelst, R., Crucitti, T., Reijans, M., Mulders, B.,
Simons, G., Temmerman, M., Claeys, G., and Padalko, E.: Evaluation of a new
multiplex polymerase chain reaction assay STDFinder for the simultaneous
detection of 7 sexually transmitted disease pathogens, Diagn. Microbiol. Infect.
Dis., 71, 29e37 (2011).
17. Asanuma, H., Ito, T., Yoshida, T., Liang, X., and Komiyama, M.: Photoregulation
of the formation and dissociation of a DNA duplex by using the cis-trans isom-
erization of azobenzene, Angew. Chem. Int. Ed., 38, 2393e2395 (1999).
Please cite this article in press as: Sano, S., et al., Rapid multiplex nucleic acid amplification test developed using paper chromatography chip and
azobenzene-modified oligonucleotides, J. Biosci. Bioeng., (2018), https://doi.org/10.1016/j.jbiosc.2018.03.017
RAPID MULTIPLEX NAT WITH CHROMATOGRAPHY CHIP 7
18. Dupouy, C., Iché-Tarrat, N., Durrieu, M., Vigroux, A., and Escudier, J.: Alpha,
beta-D-CNA induced rigidity within oligonucleotides, Org. Biomol. Chem., 21,
2849e2851 (2008).
19. Myers, T. and Gelfand, D.: Reverse transcription and DNA amplification by a
Thermus thermophilus DNA polymerase, Biochemistry, 30, 7661e7666 (1991).
20. Sano, S., Yamada, Y., Shinkawa, T., Kato, S., Okada, T., Higashibata, H., and
Fujiwara, S.: Mutations to create thermostable reverse transcriptase with
bacterial family A DNA polymerase from Thermotoga petrophila K4, J. Biosci.
Bioeng., 113, 315e321 (2012).
21. Connolly, B., Fogg, M., Shuttleworth, G., and Wilson, B.: Uracil recognition by
archaeal family B DNA polymerases, Biochem. Soc. Trans., 3, 699e702 (2003).
22. Boudsocq, F., Iwai, S., Hanaoka, F., and Woodgate, R.: Sulfolobus solfataricus
P2 DNA polymerase IV (Dpo4): an archaeal DinB-like DNA polymerase with
lesion-bypass properties akin to eukaryotic poleta, Nucleic Acids Res., 29,
4607e4616 (2001).
23. Miura, M., Tanigawa, C., Fujii, Y., and Kaneko, S.: Comparison of six
commercially-available DNA polymerases for direct PCR, Rev. Inst. Med. Trop.
Sao Paulo, 55, 401e406 (2013).