Professional Documents
Culture Documents
Biology1 Final Teaching Guide
Biology1 Final Teaching Guide
GENERAL
BIOLOGY 1
SPECIALIZED SUBJECT | ACADEMIC-STEM
Lesson 1: The Cell: Endomembrane System, Mitochondria, Lesson 12: Forms of Energy, Laws of Energy Transformation
Chloroplasts, Cytoskeleton, and Extracellular Components . . . 9 and Role of ATP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
....
Lesson 2: Mitochondria and Chloroplasts . . . . . . . . . . . . . . . . 15 Lesson 13: Energy Transformation Part 1 . . . . . . . . . . . . . . . . . . 111
. ..
Lesson 3: Structure and Functions of Animal Tissues and Cell Lesson 14: Energy Transformation Part 2 . . . . . . . . . . . . . . . . . . 120
..
Modification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 Lesson 15: Energy Transformation Part 3 . . . . . . . . . . . . . . . . . . 128
.... ..
Lesson 4: Cell Cycle and Cell Division . . . . . . . . . . . . . . . . . . 36 Lesson 16: Cellular Respiration Part 1 . . . . . . . . . . . . . . . . . . . . 133
.. ..
Lesson 5: Transport Mechanisms Part 1 . . . . . . . . . . . . . . . . . 46 Lesson 17: Cellular Respiration Part 2 . . . . . . . . . . . . . . . . . . . . 150
.. ..
Lesson 6: Transport Mechanisms Part 2 . . . . . . . . . . . . . . . . . 50 Lesson 18: Cellular Respiration Part 3 . . . . . . . . . . . . . . . . . . . . 165
.. ..
Chapter 2: Biological Molecules Lesson 19: ATP in Cellular Metabolism and Photosynthesis . . . . . 176
The SHS for SHS Framework, which stands for “Saysay-Husay-Sarili for Senior High School,” is at the
core of this book. The lessons, which combine high-quality content with flexible elements to
SHS for SHS accommodate diversity of teachers and environments, promote these three fundamental concepts:
Framework
SAYSAY: MEANING Why HUSAY: MASTERY SARILI: OWNERSHIP
is this important? Through How will I deeply understand this? What can I do with this?
this Teaching Guide, Given that developing mastery When teachers empower
teachers will be able to facilitate goes beyond memorization, learners to take ownership of
an understanding of the value teachers should also aim for their learning, they develop
of the lessons, for each learner deep understanding of the independence and self-
to fully engage in the content subject matter where they lead direction, learning about both
on both the cognitive and learners to analyze and the subject matter and
affective levels. synthesize knowledge. themselves.
About this Biology I is a Science, Technology, Engineering and Mathematics (STEM) Specialized Subject
taken in the first half of Grades 11/12. Learners go on a journey geared toward the deeper
Teaching Guide understanding and appreciation of life processes at the cellular and molecular levels previously
introduced in Grades 7-10. They will also apply basic chemistry and physics principles as they
examine the transformation of educators in partnership with educators from focus groups all over the Philippines to provide
energy in organisms. opportunities to develop the following:
Implementing this course at 1. Saysay through meaningful, updated, and context-specific content that highlights
the senior high school level is important points and common misconceptions so that learners can connect to their real-
subject to numerous world experiences and future careers;
challenges with mastery of 2. Husay through diverse learning experiences that can be implemented in a resource-
content among educators poor classroom or makeshift laboratory that tap cognitive, affective, and psychomotor domains
tapped to facilitate learning are accompanied by field-tested teaching tips that aid in facilitating discovery and
and a lack of resources to development of higher-order thinking skills; and
deliver the necessary content
3. Sarili through flexible and relevant content and performance standards allow
and develop skills and
learners the freedom to innovate, make their own decisions, and initiate activities to fully
attitudes in the learners, being
develop their academic and personal potential.
foremost among these.
These ready-to-use guides are helpful to educators new to either the content or biologists
In support of the SHS for SHS
new to the experience of teaching Senior High School due to their enriched content presented
framework developed by
as lesson plans or guides. Veteran educators may also add ideas from these guides to their
CHED, these teaching guides
repertoire. The Biology Team hopes that this resource may aid in easing the transition of the
were crafted and refined by
different stakeholders into the new curriculum as we move towards the constant improvement
biologists and biology
of Philippine education.
2
This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly
Parts of the usable for teachers. It contains classroom activities and pedagogical notes, and is integrated with
Teaching Guide innovative pedagogies. All of these elements are presented in the following parts:
1. Introduction
• Highlight key concepts and identify the essential questions
• Show the big picture
• Connect and/or review prerequisite knowledge
• Clearly communicate learning competencies and objectives
• Motivate through applications and connections to real-life
2. Motivation
• Give local examples and applications
• Engage in a game or movement activity
• Provide a hands- 4. Practice
on/laboratory activity • Discuss worked-out examples
• Connect to a real-life • Provide easy-medium-hard questions
problem • Give time for hands-on unguided classroom work and discovery
3 • Use formative assessment to give feedback
. 5. Enrichment
• Provide additional examples and applications
I
• Introduce extensions or generalisations of concepts
n
s • Engage in reflection questions
t • Encourage analysis through higher order thinking prompts
r 6. Evaluation
u • Supply a diverse question bank for written work and exercises
c Provide alternative formats for student work: written homework, journal, portfolio, group/individual
•
t
projects, student-directed research project
i
o
n
/
D
e
l
i
v
e
r
y
• Give a
demonstration/lecture/simulati
on/hands-on activity
• Show step-by-step solutions
to sample problems
• Give applications of the
theory
• Connect to a real-life
problem if applicable
On DepEd Functional Skills and CHED College Readiness Standards
As Higher Education Institutions (HEIs) welcome the graduates of On the other hand, the Commission declared the College
the Senior High School program, it is of paramount importance to Readiness Standards that consist of the combination of knowledge,
align Functional Skills set by DepEd with the College Readiness skills, and reflective thinking necessary to participate and succeed -
Standards stated by CHED. without remediation - in entry-level undergraduate courses in
The DepEd articulated a set of 21st century skills that should be college.
embedded in the SHS curriculum across various subjects and tracks. The alignment of both standards, shown below, is also presented in
These skills are desired outcomes that K to 12 graduates should this Teaching Guide - prepares Senior High School graduates to the
possess in order to proceed to either higher education, revised college curriculum which will initially be implemented by AY
employment, entrepreneurship, or middle-level skills development. 2018-2019.
Systematically apply knowledge, understanding, theory, and skills for the development of Global awareness, scientific and economic literacy, curiosity,
the self, local, and global communities using prior learning, inquiry, and experimentation critical thinking and problem solving skills, risk taking, flexibility
and adaptability, initiative and self-direction
Work comfortably with relevant technologies and develop adaptations and innovations for Global awareness, media literacy, technological literacy,
significant use in local and global communities creativity, flexibility and adaptability, productivity and
accountability
Communicate with local and global communities with proficiency, orally, in writing, and Global awareness, multicultural literacy, collaboration and
through new technologies of communication interpersonal skills, social and cross-cultural skills, leadership
and responsibility
Interact meaningfully in a social setting and contribute to the fulfilment of individual and Media literacy, multicultural literacy, global awareness,
shared goals, respecting the fundamental humanity of all persons and the diversity of collaboration and interpersonal skills, social and cross-cultural
skills, leadership and responsibility, ethical, moral, and spiritual
groups and communities
values
4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly life processes at the
cellular and molecular levels. It also covers the transformation of energy in organisms.
6. Cell Cycle 1. characterize the phases of the cell cycle and their control STEM_BIO11/12
a. Mitosis points -Id-f-6
b. Meiosis
2. describe the stages of mitosis/meiosis given 2n=6 STEM_BIO11/12
-Id-f-7
3. discuss crossing over and recombination in meiosis STEM_BIO11/12
-Id-f-8
4. explain the significance or applications of mitosis/meiosis STEM_BIO11/12
-Id-f-9
5. identify disorders and diseases that result from the STEM_BIO11/12
malfunction of the cell during the cell cycle -Id-f-10
7. Transport Mechanisms 1. describe the structural components of the cell STEM_BIO11/12
a. Simple Diffusion -Ig-h-11
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 1 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 3 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Sample: STEM_BIO11/12-IIa-j-12
LEGEND SAMPLE
Domain/Content/
Uppercase Letter/s General Biology
Component/ Topic
Roman Numeral
Quarter Second Quarter II
*Zero if no specific quarter
Lowercase Letter/s
*Put a hyphen (-) in between letters to Week Weeks one to ten a-j
indicate more than a specific week
-
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 4 of 4
General Biology 1
The Cell: Endomembrane System, Mitochondria, Chloroplasts,
60 MINS
raw materials processed? Relate this to the functions of the Golgi Apparatus.
Orient the learners on the proper use and care
of the microscopes, particularly on focusing
first on LPO before shifting to HPO.
Compare animal cells from plant cells. For the animal cells, scrape cheek cells using a toothpick. Ask the learners
to place the scrapings on a microscope slide and add a drop of water to the scrapings. Tease the scrapings into a Cheek cells are very transparent. Adjust the iris
thin layer and cover with a slip. Examine under HPO. Instruct the learners to draw the cells on their workbooks and diaphragm or add a small amount of dye (i.e.,
to label the cell parts that they were able to observe under the microscope. methylene blue) to the scrapings.
For the plant cells, instruct the learners to obtain a Hydrilla leaf and place it on a microscope slide. Examine The learners will only see the cell membrane and
under LPO. Ask the learners to draw the cells on their workbooks and to label the cell parts that they were able the nucleus. Remind the learners to
to observe under the microscope. draw what they observe. Students may observe
cytoplasmic streaming in the plant cell.
INSTRUCTION/PRACTICE (30 MINS) 10. Draw the Golgi Apparatus and then
a vesicle from the rough
endoplasmic reticulum that travels
1. Draw the cell membrane on one end of the board.
to the Golgi Apparatus and attaches
2. Draw the double membrane of the nucleus (nuclear membrane) on the other end of the board. to the part which is nearest the
3. From the nuclear membrane, draw the reticulated structure of the endoplasmic reticulum. Ask the learners rough endoplasmic reticulum.
what the two types of endoplasmic reticulum are and their corresponding functions. 11. Ask the learners what the function of
4. Draw the ribosomes as separate units. the Golgi Apparatus is. Synthesize
5. Draw a DNA and an mRNA. Explain that the mRNA is a copy of the DNA that will be sent to the cytoplasm their answers and compare the Golgi
for protein synthesis. Apparatus to a factory with an
assembly manufacturing line.
6. Explain to the learners that the mRNA leaves the nucleus and goes to where the ribosomes are located (i.e.,
mRNA + functional ribosome) 12. Draw the polypeptide travelling
along the Golgi Apparatus stack;
7. Explain the possible ‘pathways’ for protein synthesis (e.g., within the cytosol or the endoplasmic reticulum)
pinching off as a vesicle to travel to
8. Draw the mRNA + functional ribosome on the endoplasmic reticulum. With a lot of these, the the next stack. Repeat the process
endoplasmic reticulum becomes a rough endoplasmic reticulum. while increasing the complexity of
9. Draw the formed polypeptide inside the rough endoplasmic reticulum. Discuss the formation of a cisternae the polypeptide drawing.
and pinching off as a vesicle.
13. On the last stack, explain the ‘pathways’ that the vesicle may follow: become a lysosome through fusion with Teacher tip
an endosome (i.e., formed by endocytosis), or travel to the cell membrane, fuse with it, and empty its contents. Use chalk or white board markers with different
colors. Explain the structure and function of each
14. Present the composition of the endomembrane system and discuss how these parts are connected to each cell part as you draw them.
other by structure and by function.
15. Draw the mitochondria and label its parts. Explain the importance of the enfolding (cristae) in increasing the Explain to the learners that a more detailed
discussion of the structure and functions of the
surface area of the inner mitochondrial membrane. Further explain to the class that
cell membrane, mitochondria, and chloroplast
will be given in succeeding lessons.
enfolding is a common structural strategy to increase surface area. As an example, you may draw a
cross-sectional structure of the small intestine.
16. Draw the chloroplast and label its parts. Explain the function that each part performs in the process
of photosynthesis.
17. Discuss the similarities of the mitochondria and chloroplast (e.g., both are involved in energy
transformation, both have DNA, high surface area, and double membranes).income accounts and
lastly, expenses accounts.
Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to
his/her partner. Reshuffle the groupings and repeat until all learners have performed the exercise.
• (n.d.). Retrieved from< http://study.com/academy/exam/topic/cell-biology.html> This strategy is aimed at ensuring that the
Assign a research assignment on this question: How do environmental toxins like lead and mercury learners have read the topic rather than just
affect the functions of the cell? The assignment shall be submitted one week after this lesson. copying and printing from a source.
RESOURCES (CONTINUED):
(4) (n.d.). Retrieved from <http://www.schools.manatee.k12.fl.us/072JOCONNOR/celllessonplans/
lesson_plan cell_structure_and_function.html>
(5) (n.d.). Retrieved from <http://www.phschool.com/science/biology_place/biocoach/cells/endo.html>
(6) (n.d.). Retrieved from <http://study.com/academy/lesson/the-endomembrane-system-functions-
components.html>
(7) (n.d.). Retrieved from <http://www.ncbi.nlm.nih.gov/books/NBK26907/>
(8) (n.d.). Retrieved from <http://staff.um.edu.mt/acus1/01Compart.pdf>
ASSESSMENT
Learning Competency Assessment Tool Exemplary Satisfactory Developing Beginnning
The learners shall be able Learner Learner was able to Learner was able to answer Learner was able to (1) Learner was not
to: participation (during answer all the question/s the main question without answer the questions able to answer the
1. describe the structure and lecture) without referring to his/ referring to his/her notes but he/she referred question/s
function of major and her notes but was not able to answer to his/her notes (2) Learner read notes
subcellular organelles follow-up question/s of his/her classmate
(STEM_BIO11/12-Ia-c-2)
Assignment Learner submitted an Learner submitted a Learner submitted a (1) Learner did not
assignment beyond the comprehensive and well- well written report submit an assignment
requirements written assignment but some responses (2) Learner submitted
lack details a partially-finished
assignment
The learners shall be able Learner Learner was able to Learner was able to answer Learner was able to (1) Learner was not
to: participation (during concisely answer all the the main question without answer the questions able to answer the
2. describe the structural practice) questions referring to his/her notes but he/she referred question/s
components of the cell but was not able to answer to his/her notes (2) Learner read notes
membrane follow-up question/s of his/her classmate
(STEM_BIO11/12-Ig-h-11)
Laboratory Learner submitted Learner submitted drawings Learner submitted (1) Learner was not
(Examination of drawings that were that fulfilled the drawings that were able to submit
Animal and Plant beyond the requirements requirements (complete incomplete drawings
Cells) and detailed) (2) Learner’s drawings
were haphazardly
done
The learners shall be able Examination Learner obtained 90% to Learner obtained 70% to Learner obtained Learner obtained less
to: 100% correct answers in 89.99% correct answers in 50% to 69.99% that 50% correct
3. relate the structure and the examination the examination correct answers in the answers in the
examination examination
Learner submitted a Learner submitted a Learner submitted a (1) Learner did not
(STEM_BIO11/12-Ig-h12) Assignment research assignment comprehensive and well- well written report submit an assignment
beyond the requirements written research assignment but some responses (2) Learner submitted
lack details a partially-finished
assignment
14
General Biology 1
Mitochondria and Chloroplasts 60 MINS
Content Standards
The learners demonstrate an understanding of the structure and function of the LESSON OUTLINE
mitochondria and chloroplasts, the organelles involved in energy Introduction Review of relevant terminologies and 5
transformation. definitions
Smooth ER Centrioles
Rough ER Cytoskeleton
Golgi Apparatus
Mitochondria
Lysosomes
Peroxisomes
Explain that in eukaryotic cells, the machinery of the cell is compartmentalized into organelles. The compartmentalization of the cell into
membrane-bound organelles:
• allows conflicting functions (i.e., synthesis vs. breakdown) and several cellular activities to occur simultaneously without interference from
each other
• separates the DNA material of the nucleus, mitochondria, and chloroplast
• increases the surface area-volume ratio of the cell
16
Encourage the learners to look at the cell as both a system and subsystem. They should develop an
understanding of how the parts of a cell interact with one another and how these parts help to do the
‘work’ of the cell (Source: (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-cell-as-
a-system/>)
Emphasize to the learners that energy transformation is one of the characteristics of life. This refers to
the ability to obtain and use energy. This characterizes the main function of the mitochondria and the
chloroplasts.
MOTIVATION (5 MINS)
Ask the learners how they understand the concept of compartmentalization. Relate the concept to how
the cell is compartmentalized into organelles.
Compare compartmentalization to the division of a house into a receiving room or sala, kitchen, dining
room, comfort rooms, bedrooms, etc.
Teacher tip
Ask the learners why they think a house is divided into several rooms. Explain to the learner that this is how the
cell is able to allow conflicting functions
A possible response is that partitioning of the house into different parts facilitates the simultaneous (e.g., synthesis vs breakdown) and several
occurrence of several activities without interfering with one another. Also, materials needed for each cellular activities to occur simultaneously
activity can be stored at their specific areas. For example, pots and pans are being stored in the kitchen without interference from each other.
and not in the bedroom. Beds and pillows are found in the bedroom and not in the toilet/bath.
Explain to the learners that the mitochondria and chloroplasts have a small amount of DNA. Although
most of the proteins of these organelles are imported from the cytosol and are thus programmed by
the nuclear DNA, their DNA programs the synthesis of the proteins made on the organelles’ ribosomes
(Source: Campbell et al). Compartmentalization separates the DNA material of the nucleus,
mitochondria, and chloroplast.
Ask the learners if they have experienced going to a city/municipal hall and if they have observed that
the Mayor, Vice-Mayor, and the City/Municipal Administrator have separate offices. You can use other
examples such as the University President, VP for Academic Affairs, VP for Finance; Philippine
President, Vice President, Senators, etc.
Compare the nuclear DNA to the Mayor and the mitochondrial DNA and chloroplast DNA to the Vice
Mayor. The Mayor runs the city/municipality but the Vice Mayor also performs functions that are Introduce the concept of surface
specific to their positions. They need different offices (or compartments) to avoid conflict in their area-volume ratio/relationship to
functions. the learners. Show a fruit to the
learners and explain that the
outer surface of the fruit is the surface area. Peel the fruit and show them what’s inside, explaining Teacher tip
that the inside of the fruit is the volume.
Select a fruit that can be easily peeled like
calamansi or dalandan
Explain to the learners that surface area (SA) and volume (V) do not increase in the same manner. As
an object increases in size, its volume increases as the cube of its linear dimensions while surface area
increases as the square of its linear dimensions.
Example: If the initial starting point is the same: SA = 2; Volume = 2 (Ratio = 1:1)
A one-step increase will result to: SA = 22 = 4 while V = 23 = 8 (Ratio = 1:2)
Explain and discuss the nature and functions of the Adenosine Triphosphate (ATP) to the learners.
Adenosine Triphosphate (ATP)—It is the major energy currency of the cell that provides the energy
for most of the energy-consuming activities of the cell. The ATP regulates many biochemical pathways. Teacher tip
Ask questions to the learners while
Mechanism: When the third phosphate group of ATP is removed by hydrolysis, a substantial amount of giving the lecture.
free energy is released.
If an LCD projector is not available,
ATP + H2O → ADP + Pi where ADP is adenosine diphosphate and Pi is inorganic phosphate
draw the structure of the mitochondria
Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to his/ and chloroplast on the board.
her partner. Reshuffle the groupings and repeat until all learners have performed the exercise.
18
Illustration 1: Energy release in Hydrolysis (Source: (n.d.). Retrieved from http://scienceaid.co.uk/biology/biochemistry/atp.html)
Illustration 2: Chemical Energy and ATP (Source: (n.d.). Retrieved from http://winklebiology.weebly.com/chemical-energyatp.html)
Synthesis of ATP
• ADP + Pi → ATP + H2O
• requires energy: 7.3 kcal/mole
• occurs in the cytosol by glycolysis
• occurs in mitochondria by cellular respiration
• occurs in chloroplasts by photosynthesis
Consumption of ATP
ATP powers most energy-consuming activities of cells, such as:
• anabolic (synthesis) reactions, such as:
• joining transfer RNAs to amino acids for assembly into proteins
• synthesis of nucleoside triphosphates for assembly into DNA and RNA
• synthesis of polysaccharides
• synthesis of fats
• active transport of molecules and ions
• conduction of nerve impulses
• maintenance of cell volume by osmosis
• addition of phosphate groups (phosphorylation) to different proteins (e.g., to alter their activity in cell
signaling)
• muscle contraction
• beating of cilia and flagella (including sperm)
• bioluminescence
Extracellular ATP
In mammals, ATP also functions outside of cells. ATP is released in the following examples:
• from damaged cells to elicit inflammation and pain
• from the carotid body to signal a shortage of oxygen in the blood
• from taste receptor cells to trigger action potentials in the sensory nerves leading back to the brain
• from the stretched wall of the urinary bladder to signal when the bladder needs emptying
In eukaryotic cells, the mitochondria and chloroplasts are the organelles that convert energy to other
forms which cells can use for their functions.
20
Mitochondria (singular, mitochondrion)—Mitochondria are the sites of cellular respiration, the
metabolic process that uses oxygen to drive the generation of ATP by extracting energy from sugars,
fats, and other fuels.
The mitochondria are oval-shaped organelles found in most eukaryotic cells. They are considered to be
the ‘powerhouses’ of the cell. As the site of cellular respiration, mitochondria serve to transform
molecules such as glucose into an energy molecule known as adenosine triphosphate (ATP). ATP fuels
cellular processes by breaking its high-energy chemical bonds. Mitochondria are most plentiful in cells
that require significant amounts of energy to function, such as liver and muscle cells.
Figure 1: Structure of the Mitochonsdria (Source: (n.d.). Retrieved from http://www.britannica.com/list/
6-cell-organelles)
The mitochondria has two membranes that are similar in composition to the cell membrane:
• Outer membrane—is a selectively permeable membrane that surrounds the mitochondria. It is the
site of attachment for the respiratory assembly of the electron transport chain and ATP Synthase. It
has integral proteins and pores for transporting molecules just like the cell membrane
• Inner membrane—folds inward (called cristae) to increase surfaces for cellular metabolism. It
contains ribosomes and the DNA of the mitochondria. The inner membrane creates two enclosed
spaces within the mitochondria:
• intermembrane space between the outer membrane and the inner membrane; and
• matrix that is enclosed within the inner membrane.
Ask questions to the learners on the structure of the mitochondria. A sample question could be: What
is the importance of the enfolding of the mitochondria? The response would be to increase the surface
area that can be ‘packed’ into such a small space.
22
As mentioned, the mitochondria has two membranes: the outer and inner mitochondrial • Outer Membrane
membranes.
• fully surrounds the inner membrane, with a small intermembrane space in between
• has many protein-based pores that are big enough to allow the passage of Teacher tip
ions and molecules as large as a small protein
• Inner membrane
• has restricted permeability like the plasma membrane Lecture on mitochondrial membranes
• is loaded with proteins involved in electron transport and ATP synthesis can be accessed at (n.d.). Retrieved
• surrounds the mitochondrial matrix, where the citric acid cycle produces the from
<http://www.nature.com/scitable/
electrons that travel from one protein complex to the next in the inner topicpage/mitochondria-14053590>.
membrane. At the end of this electron transport chain, the final electron acceptor
is oxygen, and this ultimately forms
water (H20). At the same time, the electron transport chain produces ATP in a
process called oxidative phosphorylation
During electron transport, the participating protein complexes push protons from the matrix
out to the intermembrane space. This creates a concentration gradient of protons that
another protein complex, called ATP synthase, uses to power synthesis of the energy carrier
molecule ATP.
Figure 4: The Electrochemical Proton Gradient and the ATP Synthase (Source: (n.d.).
Retrieved from http://www.nature.com/scitable/topicpage/mitochondria-14053590)
Chloroplasts—Chloroplasts, which are found in plants and algae, are the sites of
photosynthesis. This process converts solar energy to chemical energy by absorbing sunlight
and using it to drive the synthesis of organic compounds such as sugars from carbon dioxide
and water.
The word chloroplast is derived from the Greek word chloros which means ‘green’ and
plastes which means ‘the one who forms’. The chloroplasts are cellular organelles of green
plants and some eukaryotic organisms. These organelles conduct photosynthesis. They
absorb sunlight and convert it into sugar molecules. They also produce free energy stored
in the form of ATP and NADPH through photosynthesis.
Chloroplasts are double membrane-bound organelles and are the sites of photosynthesis. The
22
chloroplast has a system of three membranes: the outer membrane, the inner membrane,
and the thylakoid system. The outer and the inner membranes of the chloroplast enclose a Teacher tip
semi-gel-like fluid known as the stroma. The stroma makes up much of the volume of the
chloroplast. The thylakoid system floats in the stroma.
If an LCD projector is not available,
draw the structure of the chloroplast
on the board.
Structure of the Chloroplast
• Outer membrane—This is a semi-porous membrane and is permeable to small molecules
and ions which diffuse easily. The outer membrane is not permeable to larger proteins.
• Intermembrane Space—This is usually a thin intermembrane space about 10-20
nanometers and is
present between the outer and the inner membrane of the Lecture on structure and functions of
chloroplast. the chloroplast can be accessed at
• Inner membrane—The inner membrane of the chloroplast forms a border to the (n.d.). Retrieved from <http://
biology.tutorvista.com/animal-and-
stroma. It regulates passage of materials in and out of the chloroplast. In addition to the
plant- cells/chloroplasts.html>.
regulation activity, fatty acids, lipids and carotenoids are synthesized in the inner
chloroplast membrane.
• Stroma—This is an alkaline, aqueous fluid that is protein-rich and is present within the
inner
membrane of the chloroplast. It is the space outside the thylakoid space. The
chloroplast DNA, chloroplast ribosomes, thylakoid system, starch granules, and other
proteins are found floating around the stroma.
• Thylakoid System
Important protein complexes which carry out the light reaction of photosynthesis are
embedded in the membranes of the thylakoids.
Thylakoids are of two types: granal thylakoids and stromal Group the learners into pairs. Ask one to draw the
thylakoids. Granal thylakoids are arranged in the grana. mitochondria and label its parts while the other does the
These circular discs that are about 300-600 nanometers in same for chloroplast. Once done, the partners exchange
diameter. The stromal thylakoids are in contact with the tasks (i.e., the learner that drew the mitochondria now does
stroma and are in the form of helicoid sheets. the same for the chloroplast).
The granal thylakoids contain only Photosystem II protein Reproduce these diagrams without the labels and use these
complex. This allows them to stack tightly and form many for the class activity.
granal layers with granal membrane. This structure increases
stability and surface area for the capture of light. To demonstrate how folding increases surface area, ask the
learners to trace the edges of the outer membrane with a
thread and measure the length of the thread afterwards.
The Photosystem I and ATP synthase protein complexes are
Repeat the same for the inner membrane. Compare the
present in the stroma. These protein complexes act as
results and discuss how the enfolding of the inner
spacers between the sheets of stromal thylakoids.
membrane increases surface area through folding.
2
4
ENRICHMENT (30 MINS)
1. Using the figure below, ask learners to compute surface area vs. volume.
2. Draw the table on the board and instruct the learners to write their measurements.
EVALUATION (60 MINS) Teacher tip
Ask the learners to answer practice questions on the following electronic resources: Clarify to the learners the
misconception that the appearance
of organelles are static and rigid.
• http://www.mcqbiology.com/2013/03/multiple-choice-questions-on_25.html#.Vl7Uq3YrLrc
• http://www.uic.edu/classes/bios/bios100/summer2004/samples02.htm
• http://www.tutorvista.com/content/science/science-i/fundamental-unit-life/question-answers-
1.php
• http://www.buzzfeed.com/kellyoakes/the-mitochondria-is-the-powerhouse-of-the-
cell#.fajAl0b6o
• http://global.oup.com/uk/o rc/biosciences/cellbiology/wang/student/mcqs/ch10/
Possible responses to the homework (Source: Campbell et al, 10th Ed.): Teacher tip
Check the electronic resources on
Endosymbiotic Theory:
• They have double membranes and are not part of the endomembrane system.
• Their shape is changeable. https://www.youtube.com/watch?
v=bBjD4A7R2xU (Endosymbiotic
• They are autonomous (somewhat independent) organelles that grow and occasionally pinch
Theory in plain English)
in two, thereby reproducing themselves. https://www.youtube.com/watch?
• They are mobile and move around the cell along tracks of the cytoskeleton, a structural network v=- FQmAnmLZtE
of the cell.
• They contain ribosomes, as well as multiple circular DNA molecules associated with their
inner membranes. The DNA in these organelles programs the synthesis of some organelle
proteins on ribosomes that have been synthesized and assembled there as well.
2. Give out the homework for next meeting.
What are the characteristics shared by these two energy transforming organelles?
Instruct the learners to write an essay on probable reasons for these the shared characteristics of
the mitochondria and the chloroplast. Learners shall submit a handwritten essay on the
Endosymbiotic Theory and how it explains the similarity between the mitochondria and chloroplast.
26
EVALUATION
The learners shall be Learner Learner was able to Learner was able to Learner was able to (1) Learner was not
able to describe the participation answer all the question/ answer the main question answer the able to answer the
following: (during lecture) s without referring to without referring to his/ questions but he/ question/s
his/her notes her notes but was not she referred to his/ (2) Learner read
able to answer follow-up her notes notes of his/her
1. structure and question/s classmate
function of major and
subcellular organelles Assignment Learner submitted an Learner submitted a Learner submitted a (1) Learner did not
(STEM_BIO11/12-Ia- assignment beyond the comprehensive and well- well written report submit an
c-2) requirements written assignment but some responses assignment
lack details (2) Learner
submitted a
partially-finished
assignment
Examination Learner obtained 90% Learner obtained 70% to Learner obtained Learner obtained
to 100% correct 89.99% correct answers 50% to 69.99% less that 50% correct
answers in the in the examination correct answers in answers in the
examination the examination examination
Essay Assignment Learner submitted an Learner submitted an Learner submitted a (1) Learner did not
essay beyond the essay that was well-written essay submit an essay
requirements comprehensive and well- some details are (2) Learner
written lacking submitted a
partially-finished
essay
General Biology 1
Stru
ctur
e and Functions of Animal Tissues and Cell 180 MINS
Modification
Content Standard LESSON OUTLINE
The learners demonstrate an understanding of animal tissues and cell
Introduction Communicating learning objectives to the 5
modification.
learners.
Performance Standard
Motivation Class Activity: Pinoy Henyo Classroom 10
The learners shall be able to construct a three-dimensional model of the animal
Edition
tissue by using recyclable or indigenous materials.
Instruction/ Review on the Hierarchy of Biological 95
Learning Competencies Delivery Organisation and PTSF; Lesson on Animal
The learners: Tissues and on Cell Modfication
• classify different cell types (plant/animal tissue) and specify the functions of
each (STEM_BIO11/12-Ia-c-4) Practice Class Activity: Reporting on structure and 60
function of animal tissue or showing of
• describe some cell modifications that lead to adaptation to carry out
infomercial on diseases.
specialized functions (e.g., microvilli, root hair) (STEM_BIO11/12-Ia-c-5)
Evaluation Class Quiz 10
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to: Materials
microscopes, LCD Projector (if available), laptop or computer
• present a five-minute report on how the structures of different animal
(if available), manila paper, cartolina, photos, images, or
tissues define their function or show a two-minute infomercial about a
illustrations of different types of tissues, drawing materials
disease that is caused by animal tissue malfunction;
(e.g. pens, pencils, paper, color pencils, etc.)
• provide insights, offer constructive feedback, and note areas of
improvement on their classmates’ reports or infomercial
Resources (continued at the end of Teaching Guide)
(1) Reece JB, U. L., (2010). Campbell Biology 10th. San Francisco (CA).
28
INTRODUCTION (5 MINS)
Introduce the following learning objectives by flashing these on the board:
• classify different cell types (plant/animal tissue) and specify the functions of each (STEM_BIO11/12- Teacher tip
Ia-c-4) For this particular lesson, start with the
• describe some cell modifications that lead to adaptation to carry out specialized functions (e.g., Motivation first (i.e., class activity on Pinoy
microvilli, root hair) (STEM_BIO11/12-Ia-c-5) Henyo Classroom Edition). After the game,
proceed to the Introduction by
communicating the learning objectives to
the learners.
Ask the learners to work in pairs and write the learning objectives using their own words. For the part when the learners have to state
the learning objectives using their own
words, ask the learners to face their
seatmates and work in pairs. If the learners
are more comfortable in stating the learning
objectives in Tagalog or In their local
dialect, ask them to do so.
Explain to the learners that instead of having the typical one-on-one Pinoy Henyo, only one In choosing the mystery words for the
game, do not limit yourself with the four
representative from each group shall be asked to go to the front and have the mystery word card on
types of animal tissues. You may choose
his/her forehead. Only three words shall be allowed from the groups: “Oo”, “Hindi”, or “Pwede”. terms that describe the tissue type or even
Violation of the rules of the game (e.g., communicating the mystery word to the guesser) shall merit body parts wherein the tissues are located.
corresponding penalties or disqualification. Assign three representatives per group to guess the You may also include diseases that are
caused by certain malfunctions on the
mystery words. Each guesser shall be given one minute and 30 seconds.
tissues.
Illustrate this by showing photos of the actual hierarchy using animals that are endemic in the
Philippines (e.g., pilandok, dugong, and cloud rat). Teacher tip
For the review on “form fits function”, if the
class does not respond well, start giving your
Review on the unifying theme in Biology: “form fits function” own examples for the students to figure out
this unifying theme.
1. Ask the class what the relation of form (structure) to function and vice versa is Make sure to relate structure to function.
Mention the role of fossils in determining
2. Ask for examples of versaingit of life that shows all life properthe torpedo shape of the body of the habits of extinct animals. By doing this, it
dolphins (mammals with fishlike characteristics) and the bone structure and wing shape of birds in shall establish a strong connection between
relation to flying. form and function and shall give relevance
on the study of this connection in
Biology. After this, you may now proceed to
the new topic on animal tissues.
30
Facilitate a class activity (i.e., observation of cells under a microscope) to illustrate that animals are made Teacher tip
up of cells. This shall be the foundation of the definition of and discussion on animal tissues. The whole If microscopes are available for this activity,
activity and discussion shall last for 90 minutes. allot 20-30 minutes for the observation of
cells. If microscopes are not available, allot
only 10-15 minutes.
If microscopes are available for this activity, set up the equipment and the slides that were prepared
Prior to the activity, prepare the slides that
prior to the activity. Each slide should show one type of tissue (i.e., epithelial tissue, connective tissue,
will be put under the microscopes. The
muscle tissue, and nervous tissue). Make sure that the labels are covered because the learners will be slides shall contain the different types of
asked to name the tissues based on their observations during the discussion. tissue. Make sure to focus the slides so that
the learners can observe them clearly.
If there are no microscopes available for the activity, prepare cut-out images, photos, or illustrations that Give the learners enough time to observe
show the different types of tissues (i.e., epithelial tissue, connective tissue, muscle tissue, and nervous the specimens and then ask them to draw
on their notebooks what they were able to
tissue). Make sure that the images, photos, or illustrations are not labeled because the learners will be
observe under the microscopes. Encourage
asked to name them. the learners to write down the description
and function of the specific tissue type as
you go through the discussion.
Also, do not immediately identify the type of tissue based on the descriptions that you will be presenting
to the class. The learners will be asked to identify which among the slides under the microscope or which If microscopes are not available and you
image, photo, or illustration matches the description of the structure and function that will be given have shown photos, images, or illustrations
instead, ask the learners to draw them on
during the discussion.
their notebooks and encourage them to
write down the description and function of
the specific tissue type as you go through
After the class activity, proceed with the actual lecture. If a computer, laptop, or projector is available,
the discussion.
show a PowerPoint presentation that shows the description and function of tissues. If there is no
available equipment, you may use flash cards or manila paper where description of structure and
function of the different tissue types are written down. Ask the learners which among the microscope
Teacher tip
slides, image, photo, or illustration fits the given information on description and function. After the Prepare the lecture in such a way that you
learners’ responses, you can flash or show the next slide which shall reveal the image of the specimen do not immediately reveal the label of the
with the corresponding label or type of tissue. images or the terms that are being
described. The learners should first be
asked to identify the images or slides that fit
Epithelial Tissue—This type of tissue is commonly seen outside the body as coverings or as linings of the description of the structures and
functions. This will make the students more
organs and cavities. Epithelial tissues are characterized by closely-joined cells with tight junctions (i.e., a engaged in the discussion. Always remind
type of cell modification). Being tightly packed, tight junctions serve as barriers for pathogens, the learners to take down notes while you
mechanical injuries, and fluid loss. flash information for each tissue type.
• simple columnar—brick-shaped
Cells that make up epithelial tissues can have distinct arrangements: cells; for secretion and active
absorption
• cuboidal—for secretion
• simple squamous—plate-like cells; for exchange of material through diffusion Teacher tip
• stratified squamous—multilayered and regenerates quickly; for protection Take note that the part on cell modifications
• pseudo-stratified columnar—single layer of cells; may just look stacked because of varying height; is incorporated in the discussion on the
structure of the respective cells that make
for lining of respiratory tract; usually lined with cilia (i.e., a type of cell modification that sweeps the
up the tissue that is being discussed. Give
mucus). emphasis on the differences on the features
of the cells that make up the tissue type.
Figure 1: Epithelial Tissue (Source: Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco (CA):.)
32
Connective Tissue—These tissues are composed of
the following:
BLOOD —made up of plasma (i.e., liquid extracellular matrix);
contains water, salts, and dissolved proteins; erythrocytes that
carry oxygen (RBC), leukocytes for defense (WBC), and
platelets for blood clotting.
Teacher tip
Assess if the learners are ready to answer
this individually. If they are not yet ready,
this activity can be done in pairs or in
groups of threes. Make sure that you
provide enough time for the group to
discuss their responses. Remind the learners
to answer briefly and clearly.
The learners demonstrate an understanding of the cell cycle and cell division Introduction Presentation of a simplified life cycle of a 5
(i.e., mitosis and meiosis). human being or plant
36
INTRODUCTION (5 MINS)
Introduce a simplified life cycle of a human being or plant. Let the learners identify the changes
throughout the different stages and how these organisms grow and develop.
Teacher tip
Figure 1: Life Cycle of Man and Higher Plants (Source: (n.d.). Retrieved from http://
www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/postmeio/ )
MOTIVATION (5 MINS)
1. Play the video on ‘Cell Cycle and Cell Division’. This video can be accessed at http:// Teacher tip
www.youtube.com/watch?v=Q6ucKWIIFmg.Divide the class into two groups. You can download the video prior to this
session or if internet connection is available
during class, you can just make use of the
2. Show diagrams of cell division in multicellular or eukaryotic organisms to the class. hyperlink to play the video. To access the
video through the hyperlink, simply hold the
Control (Ctrl) Key on the keyboard and click
on the hyperlink.
The Cell Cycle control system is driven by a built-in clock that can be adjusted by external stimuli (i.e.,
chemical messages).
Checkpoint—a critical control point in the Cell Cycle where ‘stop’ and ‘go-ahead’ signals can regulate
the cell cycle.
• Animal cells have built-in ‘stop’ signals that halt the cell cycles and checkpoints until
overridden by ‘go-ahead’ signals.
• Three major checkpoints are found in the G1, G2, and M phases of the Cell Cycle.
38
The G1 Checkpoint—the Restriction Point
• The G1 checkpoint ensures that the cell is large enough to divide and that enough nutrients are available to support the
resulting daughter cells.
• If a cell receives a ‘go-ahead’ signal at the G1 checkpoint, it will usually continue with the Cell Cycle.
• If the cell does not receive the ‘go-ahead’ signal, it will exit the Cell Cycle and switch to a non-dividing state called G0.
• Most cells in the human body are in the G0 phase.
The G2 Checkpoint—ensures that DNA replication in S phase has been successfully completed.
The Metaphase Checkpoint—ensures that all of the chromosomes are attached to the mitotic spindle by a kinetochore.
Kinase—a protein which activates or deactivates another protein by phosphorylating them. Kinases give the ‘go-ahead’ signals at the
G1 and G2 checkpoints. The kinases that drive these checkpoints must themselves be activated.
• The activating molecule is a cyclin, a protein that derives its name from its cyclically fluctuating concentration in the cell.
Because of this requirement, these kinases are called cyclin-dependent kinases or CDKs.
• Cyclins accumulate during the G1, S, and G2 phases of the Cell Cycle.
• By the G2 checkpoint, enough cyclin is available to form MPF complexes (aggregations of CDK and cyclin) which initiate
mitosis.
• MPF functions by phosphorylating key proteins in the mitotic sequence.
• Later in mitosis, MPF switches itself off by initiating a process which leads to the destruction of cyclin.
• CDK, the non-cyclin part of MPF, persists in the cell as an inactive form until it associates with new cyclin molecules
synthesized during the interphase of the next round of the Cell Cycle.
Mitosis (apparent division)—is nuclear division; the process by which the nucleus divides to produce two new nuclei. Mitosis results in two
daughter cells that are genetically identical to each other and to the parental cell from which they came.
Cytokinesis—is the division of the cytoplasm. Both mitosis and cytokinesis last for around one to two hours.
Prophase—is the preparatory stage, During prophase, centrioles move toward opposite sides of the nucleus.
• The initially indistinct chromosomes begin to condense into visible threads. • Chromosomes
first become
visible during
early prophase as long, thin, and intertwined filaments but by late prophase,
Teacher tip
chromosomes are more compacted and
can be clearly discerned as much shorter and rod-like structures. You may show diagrams or a video
• As the chromosomes become more distinct, the nucleoli also become demonstrating animal and plant mitosis. The
video can be accessed at http://
more distinct. By the end of prophase, the nucleoli become less distinct,
www.vcbio.science.ru.nl/en/virtuallessons/
often disappearing altogether. mitostage/
Metaphase—is when chromosomes become arranged so that their centromeres become aligned in
one place, halfway between the two spindle poles. The long axes of the chromosomes are 90
degrees to the spindle axis. The plane of alignment is called the metaphase plate.
Anaphase—is initiated by the separation of sister chromatids at their junction point at the
centromere. The daughter chromosomes then move toward the poles.
Telophase—is when daughter chromosomes complete their migration to the poles. The two sets of
progeny chromosomes are assembled into two-groups at opposite ends of the cell. The
chromosomes uncoil and assume their extended form during interphase. A nuclear membrane then
forms around each chromosome group and the spindle microtubules disappear. Soon, the nucleolus
reforms.
Meiosis—reduces the amount of genetic information. While mitosis in diploid cells produces
daughter cells with a full diploid complement, meiosis produces haploid gametes or spores with only
one set of chromosomes. During sexual reproduction, gametes combine in fertilization to
reconstitute the diploid complement found in parental cells. The process involves two successive
divisions of a diploid nucleus.
40
Prophase I—has been subdivided into five substages: leptonema, zygonema, pachynema, diplonema, and diakinesis.
• Leptonema—Replicated chromosomes have coiled and are already visible. The number of chromosomes present is the same
as the number in the diploid cell.
• Zygonema—Homologue chromosomes begin to pair and twist around each other in a highly specific manner. The pairing is
called synapsis. And because the pair consists of four chromatids it is referred to as bivalent tetrad.
• Pachynema—Chromosomes become much shorter and thicker. A form of physical exchange between homologues takes
place at specific regions. The process of physical exchange of a chromosome region is called crossing-over. Through the
mechanism of crossing-over, the parts of the homologous chromosomes are recombined (genetic recombination).
• Diplonema—The two pairs of sister chromatids begin to separate from each other. It is at this point where crossing-over is
shown to have taken place. The area of contact between two non-sister chromatids, called chiasma, become evident.
• Diakinesis—The four chromatids of each tetrad are even more condensed and the chiasma often terminalize or move down
the chromatids to the ends. This delays the separation of homologous chromosomes.
In addition, the nucleoli disappear, and the nuclear membrane begins to break down.
Metaphase I—The spindle apparatus is completely formed and the microtubules are attached to the centromere regions of the homologues.
The synapsed tetrads are found aligned at the metaphase plate (the equatorial plane of the cell) instead of only replicated chromosomes.
Anaphase I—Chromosomes in each tetrad separate and migrate toward the opposite poles. The sister chromatids (dyads) remain attached at
their respective centromere regions.
Telophase I—The dyads complete their migration to the poles. New nuclear membranes may form. In most species, cytokinesis follows,
producing two daughter cells. Each has a nucleus containing only one set of chromosomes (haploid level) in a replicated form.
5. Produces four daughter nuclei 5. Produces two daughter nuclei Significance of Meiosis and Chromosome
Number: Chromosomes are the cell's way
of neatly arranging long strands of DNA.
6. Produces daughter cells genetically 6. Produces daughter cells genetically Non-sex cells have two sets of
chromosomes, one set from each parent.
different from parent and each other identical to parent and to each other
Meiosis makes sex cells with only one set of
chromosomes. For example, human cells
7. Used only for sexual reproduction 7. Used for asexual reproduction and have 46 chromosomes, with the exception
growth of sperm and eggs, which contain only 23
chromosomes each. When a sperm cell
fertilizes an egg, the 23 chromosomes from
each sex cell combine to make a zygote, a
Table 1: Comparison of Mitosis and Meiosis (Source: http://courses.washington.edu/bot113/spring/
new cell with 46 chromosomes. The zygote
WebReadings/PdfReadings/TABLE_COMPARING_MITOSIS_AND.pdf) is the first cell in a new individual.
42
Meiosis I compared to Mitosis Meiosis II compared to Mitosis Teacher tip
Significance of Meiosis for Diversity:
Meiosis I Mitosis Meiosis II Mitosis One of the benefits of sexual reproduction
is the diversity it produces within a
Prophase I Prophase Prophase II Prophase
population. That variety is a direct product
Pairing of homologous No pairing of No pairing of No pairing of of meiosis. Every sex cell made from meiosis
chromosomes has a unique combination of chromosomes.
chromosomes chromosomes chromosomes
This means that no two sperm or egg cells
Metaphase I Metaphase Metaphase II Metaphase are genetically identical. Every fertilization
event produces new combinations of traits.
Bivalents at metaphase Duplicated Haploid number of Diploid number
This is why siblings share DNA with parents
plate chromosomes at duplicated of duplicated and each other, but are not identical to one
metaphase plate chromosomes at chromosomes at another.
metaphase plate metaphase plate
Anaphase I Anaphase Anaphase II Anaphase
Homologues of each Sister chromatids Sister chromatids Sister chromatids Teacher tip
You may show a video that demonstrates
bivalent separate and separate, becoming separate, becoming separate
how crossing over and recombination of
duplicated daughter daughter becoming chromosomes occur. The video can be
chromosomes move to chromosomes that chromosomes that daughter accessed at http://
poles move to the poles move to the poles chromosomes highered.mheducation.com/sites/
that move to the 9834092339/student_view0/chapter11/
poles meiosis_with_crossing_over.html.s
Facilitate a discussion on disorders and diseases that result from the malfunction of the cell during the
cell cycle. Present some diagrams or illustrations on some errors in mitosis and allow the learners to
predict possible outcomes, diseases, or disorders that may happen:
• incorrect DNA copy (e.g., cancer)
• chromosomes are attached to string-like spindles and begin to move to the middle of the cell (e.g.,
Down Syndrome, Alzheimer’s, and Leukemia)
Other chromosome abnormalities:
• arise from errors in meiosis, usually meiosis I;
• occur more often during egg formation (90% of the time) than during sperm formation;
• become more frequent as a woman ages.
• Aneuploidy—is the gain or loss of whole chromosomes. It is the most common chromosome
abnormality. It is caused by non-disjunction, the failure of chromosomes to correctly separate:
• homologues during meiosis I or
• sister chromatids during meiosis II
44
ADDITIONAL RESOURCES:
Books:
1. Raven, P. a. (2001). Biology 6th Ed. The McGraw Hill Company, USA
2. Reece, J. B. (2013). Campbell Biology, 10th Ed. Pearson Education, Inc. United States of America.
Electronic Resources:
3. (n.d.). Retrieved from Bright Hub Education: http://www.brighthubeducation.com/middle-school-science-lessons/94267-three-activities-for-
teaching-cell-cycles/#
4. (n.d.). Retrieved from http://www.uic.edu/classes/bios/bios100/lecturesf04am/lect16.htm
5. (n.d.). Retrieved from MH Education: http://highered.mheducation.com/sites/9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html
6. (n.d.). Retrieved from http://www.vcbio.science.ru.nl/en/virtuallessons/meiostage/
7. (n.d.). Retrieved from http://csls-text.c.u-tokyo.ac.jp/active/12_05.html
8. (n.d.). Retrieved from http://education.seattlepi.com/biological-significance-mitosis-meiosis-sexual-reproduction-5259.htm
General Biology 1 480 MINS
Transport Mechanisms
LESSON
Pt.1 OUTLINE
Content Standards
The learners demonstrate an understanding of Transport Mechanisms: Introduction Visualization of the plasma membrane and its 30
Simple Diffusion, Facilitated Transport, Active Transport, and functions
46
INTRODUCTION (30 MINS)
1. Before this lesson, ask the learners to read about the topic on transport of materials across
membranes.
2. Introduce the topic by providing the learners with background information.
In order for the cell to stay alive, it must meet the characteristics of life which include taking
nutrients in and eliminating wastes and other by-products of metabolism. Several mechanisms allow
cells to carry out these processes. All of the cell’s activities are in one way or another tied to the
membrane that separates its interior from the environment.
3. Ask the learners how they understand and visualize a plasma membrane and what characteristics
are essential for it to perform its function.
4. Ask the learners to identify the different mechanisms on how materials are transported in and out of
the cell.
Teacher tip
MOTIVATION (60 MINS) Different responses to the question will be
1. Divide the learners into groups and ask them the following question: “What comes to your mind drawn from students. Their responses will
when you see a 20 year old man who is 7.5 ft. tall and 3.5 ft. tall man of the same age?” Among depend on what aspect they are looking
their respective groups, let the learners discuss the similarities and differences between the two. into.
(Hint: Give students a clue by giving them the giant and pygmy as examples).
Acknowledge the responses of the learners.
2. Ask a representative from each group to report the result of their discussion to the whole class. Point out and explain that the two men are
3. Before the start of the lesson on diffusion, spray an air freshener in one corner of the room and ask both abnormal. Their growths are abnormal
the learners to raise their hands if they have smelled the scent of the spray. such that one is too big in size and the
other one is too small. Both men have
4. Ask the learners what they have observed. Who smelled the scent first? Who are the last ones to
defective membranes. Insufficient amount
smell the scent? How would you explain the phenomenon wherein learners in the same classroom of growth hormones pass through a
smelled the spray at different times? pygmy’s body while an excessive amount of
growth hormones is released in a giant.
Phospholipids are the foundation of all known biological membranes. The lipid bilayer forms as a result of the interaction between the
nonpolar phospholipid tails, the polar phospholipid heads, and the surrounding water. The nonpolar tails face toward the water.
Transmembrane proteins float within the bilayer and serve as channels through which various molecules can pass.
7. Ask the learners to enumerate the different transport interior to accommodate the natural inward movement. Most
mechanisms. plants are hypertonic with respect to their immediate
8. Differentiate between diffusion and osmosis. environment. Osmotic pressure within the cell pushes the
cytoplasm against the cell wall and makes a plant cell rigid.
9. Compare and contrast facilitated diffusion and active transport.
10. Present photos of plant and animal cells immersed in an
To control the entrance and exit of particular molecules,
isotonic, hypotonic, and hypertonic solution.
selective transport of materials is necessary. One simple process
11. Describe solution and solute movement in and out of the cell is facilitated diffusion that utilizes protein transmembrane
under hypertonic, hypotonic, and isotonic conditions. channels that are specific to certain molecules. It is a passive
12. Explain the effects of the different solutions to the cells. Ask process driven by the concentration of molecules both inside
which among the three solutions is the best for plants? How and the outside of the membrane. Certain molecules are
about for animals? Explain to the learners the water requirement transported in and out of the cell, independent of concentration.
in plants. This process requires the expenditure of energy in the form of
ATP and is called active transport.
Diffusion is the natural tendency for molecules to move 13. Differentiate among endocytosis, phagocytosis, pinocytosis,
constantly. Their movement is random and is due to the energy receptor-mediated endocytosis, and exocytosis.
found in the individual molecules. Net diffusion occurs when the
materials on one side of the membrane have a different Large molecules enter the cell by generalized nonselective
concentration than the materials on the other side. process known as endocytosis. Phagocytosis is endocytosis of a
particulate material while endocytosis of liquid material is called
Osmosis is a special type of diffusion specifically associated with pinocytosis. Exocytosis is the reverse process. Receptor-
the movement of water molecules. Many cells are isotonic to the mediated endocytosis is a complicated mechanism involving the
environment to avoid excessive inward and outward movement transport of materials via coated vesicles.
of water. Other cells must constantly export water from their
48
PRACTICE (45 MINS) Ask the learners to answer the following practice or guide
questions:
• What is the difference between diffusion and facilitated
EVALUATION (180 MINS)
diffusion? Ask the learners to design and a model of a plasma membrane
• How do endocytosis and exocytosis allow movement of using recyclable or indigenous materials.
materials in and out of the cell?
Divide the learners into groups and assign different concentrations
• What solution is best for a plant cell? How about for an animal
of salt solution to be used in making salted eggs.
cell?
• Explain the orientation of the phospholipid molecules in the Ask the learners to answer the following questions:
presence of water. • Why does putting salt on meat preserve it from bacterial
spoilage?
• Compare specific transport processes (i.e., diffusion, osmosis,
facilitated transport, active transport, endocytosis, and
exocytosis) in terms of the following:
ENRICHMENT (45 MINS) • concentration gradient
Let the learners recognize the effect of a defective membrane in
• use of channel or carrier protein
normal body functioning. Ask them to write an essay about the
• use of energy
possible effects of a faulty plasma membrane aside from the
• types or sizes of molecules transported
examples given earlier.
Ask the learners to individually submit a concept map about plasma
membrane and the different transport mechanisms.
General Biology 1 240 MINS
Teacher tip
Allow some time for the learners to smell
the spray until everyone has already smelled
the scent. Remember to instruct the
learners to raise their hand once they smell
the scent.
The nonpolar tails face toward the water. Transmembrane proteins float within the bilayer and serve as
channels through which various molecules can pass. They function as ‘identification tags’ on cells
which enable the cell to determine if the other cells that it encounters are like itself or not. It also
permits cells of the immune system to accept and reject foreign cells such as disease-causing bacteria.
Many membrane proteins function as enzymes that speed up reactions in cells. Others act like paste or
glue-forming cell junctions where adjacent cells stick together. Membranes also contain cholesterol
which reduces the cell’s permeability to substances and make the bilayer stronger.
Transport Mechanisms
1. Ask the learners to enumerate the different transport mechanisms.
2. Differentiate between diffusion and osmosis.
52
Molecules and substances move in several ways that fall within two categories: passive transport and active transport. In passive transport,
heat energy of the cellular environment provides all of the energy, hence, this is not energy-costly to the cell. Active transport, however, requires
the cell to do work, requiring the cell to expend its energy reserves.
Diffusion is a type of passive transport described as the natural tendency for molecules to move constantly. Their movement is random and is
due to the energy found in the individual molecules. Net diffusion occurs when the materials on one side of the membrane have a different
concentration than the materials on the other side. Osmosis is a special type of diffusion specifically associated with the movement of water
molecules.
A solution with a higher concentration of solutes is said to be hypertonic while a solution with a lower concentration of solutes is hypotonic.
Water crosses the membrane until the solute concentrations are equal on both sides. Solutions of equal solution concentration are said to be
isotonic. This only occurs when the solute concentration are the same on both sides of the membrane.
Compare and contrast facilitated diffusion and active transport. Then present photos of plant and animal cells immersed in an isotonic,
hypotonic, and hypertonic solution. In addition, describe a solution and solute movement into and out of the cell under hypertonic, hypotonic
and isotonic conditions.
Explain the effects of the different solutions to the cells. Ask which among the three solutions is the best for plants? For animals? Let them
understand water requirement in plants.
Many cells are isotonic to the environment in order to avoid excessive inward and outward movement of water. Other cells must constantly
export water from their interior to accommodate the natural inward movement. Most plants are hypertonic with respect to their immediate
environment. Osmotic pressure within the cell pushes the cytoplasm against the cell wall and makes a plant cell rigid.
When an animal cell such as red blood cell is immersed in an isotonic solution, the cell gains water at the same rate that it loses it. The cell’s
volume remains constant in this situation.
What will happen to the red blood cell when immersed in a hypotonic solution which has a lower solute concentration than the cell? The cell
gains water, swells, and may eventually burst due to excessive water intake. When placed in a hypertonic solution, an animal cell shrinks and
can die due to water loss.
Water requirement for plant cells is different due to their rigid cell walls. A plant cell placed in an isotonic solution is flaccid and a plant wilts in
this condition. In contrast with animal cells, a plant cell is turgid and healthy in a hypotonic solution. In a hypertonic solution, a plant cell loses
water, shrivels, and its plasma membrane detaches from the cell wall. This situation eventually causes death in plant cells.
To control the entrance and exit of particular molecules, selective transport of materials is necessary. One simple process is facilitated
diffusion that utilizes protein transmembrane channels that are specific to certain molecules. It is a passive process driven by the concentration
of molecules on the inside and the outside of the membrane. Certain molecules are transported in and out of the cell, independent of
concentration. This process requires the expenditure of energy in the form of ATP and is called active transport.
Large molecules enter the cell by generalized non-selective process known as endocytosis. Phagocytosis is endocytosis of a particulate
material while pinocytosis is endocytosis of liquid material. In this process, the plasma membrane engulfs the particle or fluid droplet and
pinches off a membranous sac or vesicle with a particular fluid inside into the cytoplasm.
Exocytosis is the reverse process where a membrane-bound vesicle filled with bulky materials moves to the plasma membrane and fuses with
it. In this process, the vehicle’s contents are released out of the cell.
Receptor-mediated endocytosis is a complicated mechanism involving the transport of materials through coated vesicles. Cells take up
molecules more efficiently in this process due to the receptor proteins on their surfaces. Each receptor protein bears a binding site for a
particular molecule. If the right molecule contacts a receptor protein, it attaches to the binding site, forming a pocket and eventually pinching
off into the cytoplasm.
54
• How do diffusion and facilitated diffusion differ?
• How do endocytosis and exocytosis allow movement of materials in and out of the cell?
• What solution is best for a plant cell? How about for an animal cell?
• Give two ways by which one could determine whether active transport is going on.
• Compare and contrast the effects of hypertonic and hypotonic solutions on plant and animal cells.
• What role do vacuoles play in endocytosis and exocytosis?
Assessment questions:
Instruct the learners to answer the following questions to assess their knowledge and understanding of
the lesson:
• Why does putting salt on meat preserve it from spoilage by bacteria?
• Compare specific transport processes (i.e., diffusion, osmosis, facilitated transport, active transport,
endocytosis, and exocytosis) in terms of the following:
• concentration gradient
• use of channel or carrier protein
• use of energy
• types or sizes of molecules transported
56
General Biology 1
Carbohydrates and Lipids: 120 MINS
58
You may ask the following questions to facilitate the Teacher tip
discussion and call on several groups to present in front of
the class: For the food labels, local products that are
familiar to the learners will make the best
•How many servings are in this container? samples. Make sure that the labels have
carbohydrates, fats, and fibers in them. If
• Would you agree that this is the reasonable amount of there are no food labels available, you may
do an image search and print some sample
food you would consume per serving? How many total
food labels from the internet.
food calories (C) are in this container?
Division into small groups of two or three
• How much fat is present in one serving? What kind of fat? may facilitate sharing. Only call on two or
What is the importance of consuming fats in our diet? three groups to present if there is limited
time.
• How much carbohydrates are present in one serving? Expect the responses to vary depending on
What kind of carbohydrates? What is the importance of how realistic the serving sizes are. You can
consuming carbohydrates in our diet? also discuss about how advertisers can
influence how people perceive food.
Take note that a food calorie is the same as
• Decide on whether this food sample can be eaten often 1 kcal or 1000 calories. A young adult would
or sparingly and justify. often need to take 1800-2500C per day
depending on their size and level of activity.
3.Recall that human beings, like all animals, are Responses may include saturated,
heterotrophs that need to take in energy and organic unsaturated, and trans fats. Explain to the
molecules (carbohydrates, fats, and proteins) from plant learners that these fats will be discussed in
more detail during the lesson. Regarding its
and animal matter.
importance, expect responses ranging from
energy source, insulation, for flavor, for aid
4.Explain to the learners that this lesson will describe the in cooking, for heart health, skin health, etc.
structure of carbohydrates and lipids and explain the role that these biomolecules play in important
Possible responses include sugar, fibers, etc.
biological processes.
Regarding its importance, responses may
include energy source, for aid in regular
bowel movement, for provision of building
blocks for biosynthesis, etc.
INSTRUCTION/DELIVERY (60 MINS)
Present a diagram similar to the one below.
Point out that the bulk (i.e., more than 90%) of the human body weight is provided by only three
elements: oxygen, carbon, and hydrogen. We get these elements primarily from the food we eat, from
the water we drink, and from the air we inhale around us.
Explain to the learners that biogeochemical cycles such as the carbon-oxygen cycle and the water cycle
play important roles in ensuring that we have access to these important elements. All forms of life, not
only that of humans, are made up of four kinds of important large molecules: carbohydrates, lipids,
60
proteins, and nucleic acids. All of these have carbon atoms as their backbones since carbon is capable of forming up to four chemical
bonds with atoms of other elements.
Carbohydrates are usually good sources of raw materials for other organic molecules and energy. One gram of carbohydrates
provides four food calories or 16 kJ of energy. In the human diet, carbohydrates mainly come from plants although they are found in
all organisms.
These monomers, called monosaccharides, form covalent bonds when one monomer loses a hydroxyl group and the other loses a hydrogen
atom in dehydration or condensation reactions, forming disaccharides. This reaction requires energy to occur. The bond formed is called a
glycosidic linkage.
62
Longer polysaccharide chains are formed by monomer addition through succeeding dehydration
reactions. These reactions can occur in the human liver as carbohydrates are stored as polysaccharides
called glycogen or in ground tissues of plants where these are stored as starch.
Polysaccharides are broken down into simpler components through the use of water to break covalent
bonds and release energy. The process, known as hydrolysis (hydro means water and lysis means split),
is the opposite of dehydration reactions and often occurs in the digestive tract during chemical and
mechanical digestion. Here, enzymes break bonds within polysaccharides. With the aid of water, one –
H group attaches to a monosaccharide while another –OH group attaches to the other.
Comprehension question: How many molecules of water are needed to completely hydrolyze a
polysaccharide that is one thousand monosaccharides long?
Teacher tip
Use ball and stick models or plastic blocks to demonstrate how dehydration and hydrolysis reactions occur. Simple reusable
ones may be constructed from toothpicks or clay or similar materials.
If a projector is available, you may also use animations like the ones found at <http:// www.cengage.com/biology/
discipline_content/animations/ reaction_types.swfto> to help in visualization.
During the discussion, invite the learners to find different kinds of carbohydrates in their food labels.
How are carbohydrates classified?
Carbohydrates can be classified into three main categories, according to increasing complexity:
• monosaccharides (monos means single and sacchar means sugar)
• disaccharides (di means two)
• polysaccharides (poly means many)
Some notes on their structures and functions are found in the following table:
component monosaccharides is a source of energy for infants; an enzyme why alpha helix structures are
called lactase is required to digest this. Many associated with storage
polysaccharides and beta sheets with
adult Filipinos have low levels of this enzyme
structural polysaccharides.
leading to a condition called lactose
intolerance.
• Sucrose (glucose + fructose)—found in table
sugar processed from sugar cane, sweet fruits,
and storage roots like carrots
Misconception
Clarify the misconception that consuming
fats is entirely dangerous for health. Fats
are an essential part of a healthy diet when
consumed in moderation.
66
ENRICHMENT (20 MINS) Teacher tip
Divide the class into groups. Instruct the learners to prepare the following materials that are needed for This activity may be done as a class if time
the laboratory activity: does not permit for the activity to be done
in separate groups. If Benedict’s solution is
• eight glass droppers, medicine droppers, or caps • ethanol solution not available, you may only perform the last
• 12 test tubes • glucose solution two tests.
• test tube holders or tongs • flour or cornstarch
In the absence of laboratory grade
• beaker • cooking oil
chemicals, you may improvise with store-
• alcohol lamp • sample of student- bought chemicals like iodine and 70% ethyl
• Benedict’s solution brought food or drink alcohol for medical use. Make sure to test
• iodine solution • mortar and pestle the procedure before performing the
activity in the class.
Materials
recyclable materials for construction of protein models,
software for molecular modelling (available for
70 free download)
Resources
(1) SwissPDB Viewer software (available for free download)
(2) Protein Data Bank (can be accessed at www.db.org
Teacher tip
Prepare an Amino Acid Alphabet table.
In the table, provide respective columns for one-
letter and three-letter codes for each amino acid.
Teacher tip
Familiarize yourself with the features of the
molecular viewer. SwissPDB Viewer allows
you to select amino acids of certain types
(e.g., hydrophobic residues).
Teacher tip
These may be colored or labelled to show
their positions in the protein. The position
of hydrophobic patches and charged
surfaces in proteins can signify areas of
potential interaction.
Molecular Biology
Content Standard
The learners demonstrate an understanding of the structures and functions Motivation Class activity on the important functions of 5
of biological molecules`
biological molecules (i.e., carbohydrates, lipids, nucleic acids, and proteins)
categorize the biological molecules (e.g., DNA, RNA, proteins) 5 sequences into mRNA transcripts and mRNA
•
transcripts into polypeptide sequences.
according to their structure and function (STEM_BIO11/12- II-j-15)
• explain the role of each biological molecule in specific metabolic processes Evaluation Practice exercises on identification of
(STEM_BIO11/12 -II-j-16) 10 b iomolecule s base d on g ive n cha in
• explain oxidation/reduction reactions (STEM_BIO11/12- II-j-18) structures, identification of important
• determine how factors such as pH, temperature, and substrate structural features in the chain structures,
affect enzyme or protein activity (STEM_BIO11/12 -II-j-19) and generating non-coding sequences
(DNA), transcripts (RNA) and polypeptides to
assess learners’ understanding of the topics
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to: Materials
recyclable materials for construction of models of biological
• discuss key structural features of DNA, RNA, and proteins
molecules, software for molecular modelling (available
• discuss structural and functional differences between DNA and RNA for free download)
• discuss the different levels of protein structure (i.e., primary,
secondary, tertiary, and quaternary) Resources
(1) SwissPDB Viewer software (available for free download)
Teacher tip
INSTRUCTION/DELIVERY (30 MINS) Note the following expected responses:
Elaborate on the main functions of the biomolecules: • DNA—repository of genetic
• DNA—is the repository of genetic information information
• RNA—serve as the transcripts and regulators of expressed genetic information • RNA—transcripts and
• Proteins—are the functional products and executors of cellular functions regulators of expressed
genetic information
• protein—functional products
and executors of cellular
functions
DNA Complementary Base Pairs Allows each strand to serve as a template for replication and
transcription
Ci-1 : Carbonyl C of
previous AA
Ni : Amide Nitrogen of current AA
Cαi: Alpha Carbon of current AA
Ci : Carbonyl C of
current AA
a. non-polar
i. aliphatic
(G,A,V, L, I, M)
ii. aromatic
(Y,W,F)
b. polar, uncharged (S,T,C,P,Q)
Table 1: Important Physical Properties of Biomolecules Teacher Tip:
The correct response is:
76
ENRICHMENT (5 MINS)
Convert the given coding sequence into an mRNA transcript:
Complementary Non-coding / Template sequence: 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
2. Translate the given mRNA transcript into a polypeptide sequence: Teacher tip
The correct responses are the following:
Coding sequence ~ mRNA transcript: 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
For no. 1, the coding sequence ~ mRNA
transcript is 5’
AUGCAUAGAUUAGGAUAUCCCAGAUAG
3’
EVALUATION (10 MINS) Teach the learners the single letter codes
Ask the learners to identify the type of biomolecule represented by a given chain structure: for the amino acids (e.g., Tryptophan Trp
W).
• DNA
• RNA Instruct the learners to spell their names
using the amino acid codes (e.g., N-E-I-L
• Protein Asn – Glu – Ile – Lue).
You may ask the learners to identify the important structural features in these chain structures. The
features are listed in Table 1 in the Instruction/ Delivery section of this Teaching Guide. Teacher tip
Worksheets with partially-completed
sequences may be used to help the learners
A similar exercise of generating non-coding sequences (DNA), transcripts (RNA), and translated practice the generation of complementary
sequences.
polypeptides may be performed to test the learners’ understanding of the topic.
For example:
Template sequence
3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’
5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’
7
8
INTRODUCTION (5 MINS) • I can determine how factors
Introduce the following learning objectives using any of the suggested protocols (e.g., verbatim, own such as pH, temperature, and
words, or read-aloud): substrate affect enzyme activity.
• Follow-up questions: If this is so, why will a sterile starch solution sit for years at room temperature
Numerous chemical reactions support life.
without significantly hydrolyzing? Can you think of ways to hydrolyze starch more quickly? The regulation of these reactions may take
place in two major ways:
• through the use of enzymes
• through the regulation of genetic
material (This which will be discussed
later.)
80
Proceed to the lecture proper. • Can you imagine what would
happen if it takes many years
for our body to hydrolyze the starch in the food that we eat? Starchy food comprises an
important part of our diet and our bodies use enzymes called amylase to quickly hydrolyze starch Teacher Tip:
into simple sugars. A visual aid may be used to show the
contortion. For example, a string of paper
clips or a bunch of keys on a key ring can
• What are enzymes? stand for starch. The contortions involved in
• Enzymes are organic or biological catalysts. Catalysts are substances that speed up a detaching one paper clip or removing one
reaction without being used up, destroyed, or incorporated into the end product. They are key can serve as analogies for the process.
vital to the
regulation of the metabolic processes of the cell. Many enzymes are proteins. We will focus on
this type of enzymes in this discussion. RNA enzymes called ribozymes will be discussed later.
Figure 1 (on the right): Energy profile for a spontaneous exergonic reaction: AB+CDAC+BD (Source: Reece, J. U (2011
). Campbell Biology, 9th ed. . San Francisco, CA: Pearson Benjamin Cummings)
• The reaction shown in Figure 1 is spontaneous but the activation energy provides a barrier that
determines the rate of the reaction. Reactants have to absorb enough energy from their View Part I of the animation at
environment to surmount this barrier before the reaction can proceed. http://www.sumanasinc.com/webc
• Knowing this, how can you cause reactants to absorb more energy from their environment? ontent/animations/content/enzym
es/ enzymes.html. Click on ‘Show
How do enzymes affect reactions? Narrative’ to reinforce the
Heat speeds up reactions. This is inappropriate for biological systems because it denatures proteins, kills aforementioned concepts on
spontaneous reactions. Ask the
cells, and speeds up all reactions, not just those that are needed. Enzymes catalyze specific reactions by
lowering the activation energy barrier and allowing the reactant molecules to absorb enough energy at
moderate temperatures. Enzymes cannot change the !G for a reaction and can only hasten reactions
that would eventually occur anyway.
learners to answer the following questions and call on a small group to explain their responses using
their own words:
• What is the activation energy of a reaction? Teacher tip
• How do enzymes affect the activation energy of a reaction? Relate the discussion with the hypothetical
reactions in Figures 1 and 2.
Enzyme structure and function
View http://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/
animation how_enzymes_work.html. Click on ‘Text’. Ask the learners to answer the following question
and call on a small group to explain their responses using their own words:
On a molecular level, how does the shape of an enzyme enable it to perform its function? Use
the following terms in your responses: ‘active site’, ‘substrate’, ‘enzyme-substrate complex’, and
‘product’.
The active site and functional groups of its amino acids may lower activation energy by:
• acting as a template for substrate orientation
• stressing the substrates and stabilizing the transition state
• providing a favorable microenvironment
• participating directly in the catalytic reaction
82
View http://www.wiley.com/college/boyer/0470003790/animations/enzyme_binding/
enzyme_binding.htm. Click on ‘Binding Models’. Ask the learners to answer the following questions
and call on a small group to explain their responses using their own words:
• How does the shape of an enzyme enable it to perform its function?
• What is the difference between Emil Fisher’s lock-and-key model and Daniel Koshland’s induced-
fit model? Describe the current model.
The presence of non-protein helpers called co-factors and of organic molecules like co-enzymes may activate apoenzymes to produce
holoenzymes by binding to their active sites. Common examples may be found in popular supplements such as ions of iron, copper, zinc, or
in vitamins like vitamins A, C, and B-complex.
Explain that many living tissues contain catalase or peroxidase that catalyzes the reaction conversion of
H2O2 → H2O + O2.
Cut the liver into equal-sized cubes and demonstrate the effect of placing the liver in a 2mL solution of
hydrogen peroxide. Evolution of gas (i.e., bubbling) will be observed. Groups of learners may prepare
solutions that they can test using the different factors.
Instruct the learners to rank the different solutions based on the rates of reactions.
84
EVALUATION (20 MINS)
Making models of enzyme-catalyzed reactions 1. Divide the class into small
groups.
2. Distribute different examples of important enzyme-catalyzed reactions to the groups.
Teacher tip
3. Ask the groups to create models using common or recyclable materials and label the following
Before this session, inform the learners that
components: enzyme, substrate, product, and active site. they will be making models of enzyme-
4. Ask the learners to demonstrate how this enzyme works. catalyzed reactions next meeting and ask
them bring recyclable materials that they
can use for this activity.
Written Task
In grading the models, check to see if the
1. Divide the class into small groups. learners were able to label the parts
2. List the materials for Enrichment (See previous section). correctly. Demonstrate that the substrate
goes into the active site, gets contorted and
3. Ask the learners to design their own experiment in order to explore the effect of one factor on moves out as a product. Check if the
enzyme activity. Explain that the experimental design should include: substrate and the products are consistent
a testable hypothesis with the reaction being modeled (e.g.,
•
anabolic, catabolic, or recombination)
• complete list of dependent and independent variables
• complete list of controlled variables
• logical procedure in a flowchart format
• short and accurate explanation of what you expect to happen and why
• sufficient replicates
General Biology 1 240 MINS
Content Standard Motivation Post questions on the board and ask the 5
The learners demonstrate an understanding of photosynthesis and cellular students to identify the processes involved in
respiration energy transformation
Describe the major features and chemical events in photosynthesis and • functionally define photosynthesis and cellular respiration;
•
cellular respiration (STEM_Bio11/12-IIa-j-1) • identify the reactants and products of photosynthesis
and cellular respiration;
• differentiate the major chemical events of photosynthesis
Specific Learning Outcomes and cellular respiration; and
At the end of the lesson, the learners shall be able to:
• summarize in a form of illustration or diagram the similarity in the
Enrichment Similarity of photosynthesis and cellular 25
organization of chloroplast and mitochondrion in carrying out
respiration and connecting the concepts with
photosynthesis and cellular respiration, respectively. the biological systems
Resources
(1) Alumaga, Maria Jessica B. et al., (2014). Science and Technology 9. Quezon
City: Vibal Publishing House
(2) Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
(3) Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/
Cole
(4) www.biologycorner.com accessed July 19, 2015
86
INTRODUCTION (5 MINS) NOTE: Energy transformation (e.g.,
Review with the class that oxidation-reduction (redox) reactions involve electrons passing from one photosynthesis and cellular
molecule to another. Oxidation (also splitting) is the loss of electrons while reduction is the gain of respiration is one of the difficult
electrons. You can show this picture to your students and try to ask questions so that you can generate topics in biology. To capture the
critical-thinking skills from them. To help them visualize the concept, a diagram of redox reactions is general picture of the topic, students
also shown below. Ask your students which organisms (in the picture below) photosynthesize and which have to be encouraged to read and
respire (take note that plants both photosynthesize ad respire at the same time). Then show the re- read the key concept, write and
equation of redox reactions after your students have given their responses. You may also ask examples re-write, outline and re-outline, draw
of oxidation reactions (e.g., browning of peeled potato, banana, and eggplant). For redox reactions and re-draw, and to recite orally if
examples are rusting of iron, burning of combustible material (e.g., wood, coal, etc.) they want the ideas to sink in their
system. Patience and steadfastness are important virtues that should be included as you study this Teacher Tip:
concept. Note: This lesson merely describes the
major features of (or an overview)
photosynthesis and cellular respiration. A
more detailed concept and deeper
explanation will be presented in another set
of learning competencies.
For additional information, tell the class that ATP is also involved in rigor mortis—a temporary stiffness
of the body that happens soon after death of a person.
88
• Which groups are released?
• Chemical reactions for cellular respiration:
C6H12O6 + 6 O2 + about 38 molecules of ADP 6 CO2 + 6 H20 + about 38 molecules of ATP
• Which groups participate in the reaction?
• Which groups are released?
Processing Questions:
1. What are the two kinds of reactions in photosynthesis?
2. What are the basic stages of the Calvin cycle?
3. What are the reactants and products of photosynthesis?
4. In which part of the cell glycolysis happens? What about the citric acid cycle and electron transport
chain?
5. How many metabolic pathways are there in cellular aerobic respiration? In anaerobic respiration?
6. What are the reactants and products of cellular respiration?
7. About how many ATP molecules does a cell obtain from the breakdown of one molecule of glucose
in cellular respiration?
8. Given the glucose, carbon dioxide and water, which one(s) is/are called high-energy molecule and
which one(s) is/are called low-energy molecule?
Suggested Answers:
1. Light-dependent reaction and light-independent reaction (also known as Calvin cycle reaction or
carbon fixation reaction).
2. The basic stages of Calvin cycle reaction are: carbon dioxide fixation, carbon dioxide reduction,
RuBP regeneration.
3. Reactants: carbon dioxide and water; products: carbohydrates and oxygen
4. Glycolysis happens in the cytoplasm of the cell; citric acid cycle (Krebs cycle) and ETC are in the
mitochondrion of the eukaryotic cell.
5. In cellular aerobic respiration: three; in anaerobic respiration: one
6. Reactants: carbohydrates, oxygen, and about 38 ADP molecules; products: carbon dioxide, water
and about 38 ATP molecules
7. About 36 to 38 ATP molecules (NOTE: This number is just a ratio. Some biology authors say there
are 30, 32 or 34 ATP molecules produced depending on the shuttle used to transport the electrons
and on the kind of species.)
8. High-energy molecules: glucose; low-energy molecules: carbon dioxide and water
Directions:
Fill-in the two tables below for the major events and features of photosynthesis and cellular respiration,
respectively. The option tables are given for you to answer the needed materials and end products of
photosynthesis and cellular respiration.
90
Major Events and Features of Photosynthesis
2. Preparatory reaction
a. Pyruvate, ATP, NADH b. NADH, FADH2, c. Glucose, ATP, NAD d. Pyruvate, Coenzyme
O2, ADP Pi +
, ADP Pi A, NAD+
e. Acetyl CoA, H2O, f. Acetyl CoA, CO2, g. CO2, NADH, h. ATP, H2O, NAD+,
NAD+, FAD, ADP Pi NADH FADH2, ATP FAD
Suggested Answers:
Light-dependent reactions
(take place in the thylakoid a. Light-energy; pigments (chlorophyll) a. Electrons
membrane) b. NADPH, O2
b. Electrons, NADP+, H2O, electron acceptors
a. Photochemical reactions
c. Proton gradient, ADP + P, ATP synthase c. ATP
b. Electron transport
92
Activity: Gaseous Products of Photosynthesis
NOTE: If there is enough time and the materials are available, let the class do this activity.
Materials needed:
1000 mL beaker, 3 grams of sodium bicarbonate, Hydrilla or Elodea, funnel, test tube
Procedure:
1. Half-fill a 1000 mL beaker with tap water.
2. Add 3 grams of sodium bicarbonate.
3. Place Hydrilla or Elodea in the bottom of the beaker.
4. Put a funnel over the plant.
5. Fill the test tube with water up to the brim. Secure the mouth of the test tube with your thumb. Invert
the tube and place it on top of the funnel.
6. Place the beaker under direct sunlight. Count the bubbles that appear in the test tube after 30, 60,
90, 120, 150, 180, and 210 seconds.
7. After several minutes, slowly remove the test tube from the funnel. Place your thumb over its mouth.
Turn the tube right up and insert a glowing match to the test the presence of the oxygen in the tube.
Adapted from: Science and Technology II for the Modern World. (2003). Makati City: Diwa Scholastic
Press, Inc.
Note: An illustration of the set-up will help teachers and students to visualize how the experiment
should be performed.
ENRICHMENT (25 MINS)
Directions: Show the basic similarity and differences between photosynthesis and cellular respiration.
The options are provided for in the other table below.
PART I
1. Raw materials
2. End products
3. Electron transfer compound
4. Location of electron transport chain
5. Organelle involved
6. ATP production
7. Source of electron for ETC
8. Type of metabolic reaction
9. Terminal electron acceptor for
electron transport chain
Available Choices
a) O2 b) Anabolism
c) Glucose, oxygen d) Carbon dioxide, water
e) NADP+ is turned to NADPH f) NAD+ is turned to NADH+
94
Suggested Answers
Photosynthesis Cellular Respiration
Contrast and Shows exceptional artistic and skillful Shows generally acceptable artistic Shows generally vague color contrasts;
intensity of drawing color contrast; and meaningful color and skillful color contrasts; and and indiscernible sense of color
concentration meaningful color concentration concentration
Blending of colors Color mix is exceptionally creative, Color mix is generally creative, Color mix needs improvement
appropriate and meaningful appropriate and meaningful
Neatness Completely free from mess Almost free from mess Too messy
PART III
Directions: Group the class into triad. Make each group construct a concept map to help them develop their understanding of photosynthesis
and cellular respiration. Prepare a rubric for easy scoring.
Content knowledge Information is complete and Information is mostly complete and Information is mostly incomplete and
accurate accurate inaccurate
Originality in Exceptionally well organized and Generally well-organized and Fairly understandable
organization of ideas understandable understandable
Neatness Completely free from mess Almost free from mess Too messy
PART IV
Directions: Arrange the following to get the right energy flow sequence in aerobic respiration.
NADH Electron Transport Chain Glucose ATP
Suggested Answers:
1. Energy-releasing pathways
2. Energy-acquiring pathways
Suggested Answers:
1. Cellular respiration
2. Photosynthesis
98
1. Introduce the learning objective by writing it on the board, then give the students 5 minutes (to work MOTIVATION (10 MINS)
Start the motivation by
in pairs) to write down on a piece of paper what they already know or what they expect to learn under
reviewing/introducing the terms
the specified topics: Metabolism, Anabolism, Catabolism,
• Forms of energy
Bioenergetics, free energy, Entropy, Equilibrium, Digestion, Cellular Respiration, Photosynthesis and Teacher Tip:
ATP. After refreshing the students with the terms and processes, group your students into groups of 3’s Through this introduction, you will have an
and allow them to think of how they can relate their mom (“NANAY”) to these processes. Have at least idea where to start or how you will
approach your discussion. You may also ask
3 groups of students share their analogy in front of the class.
your students which topic would interest
them the most and what would interest
them the least.
“Nanay” analogy example:
Metabolism manages materials and energy resources of the cell. We can relate it to our mom/ Nanay
because our mom is responsible most of the time in budgeting the finances and cooks food for the
family.Entropy is the measure of disorder or randomness, Nanay makes sure that all the things inside
the house are well organized especially after the kids played. Nanay lessens the house’s entropy after
the increase in entropy done by the kids after playing by placing all the things in their proper places.
Teacher Tip:
Another set of analogies may include putting together the ingredients of a dish to create a palatable The teacher can also encourage the
students to think of other analogies that will
viand as an example of anabolism. Or removing one by one the parts of an engine to fix a broken car
help them relate the lesson to their
as an example of catabolism. everyday lives. Please make sure that you
look for the meaning of the terms
mentioned and read about the topic to
facilitate and make the discussion more
interesting
Start the discussion by establishing that living organisms are open systems (energy and matter can be
transferred between the system and its surroundings). Remind the students that this was already
mentioned in one of the characteristics of living organisms. Obtain and use materials for Energy, and in
the unifying theme- interaction with the environment. This way students will clearly understand that
processes (Bioenergetics) that happen within a living organism is still influenced and affects the
surroundings. The teacher may directly involve students by pointing out that humans breath the carbon
dioxide needed by plants as raw materials to produce food via photosynthesis, the teacher may use the
figure below.
Emphasize as well the role of oxygen as final electron acceptor in cellular respiration. Students should
appreciate why they need to breathe in oxygen and not other form of gases.
Teacher tip
In the start of the lesson, since the terms
metabolism, catabolism, anabolism were
already used in the motivation, the teacher
can explain it further by the use of the
downhill and uphill metabolic avenues.
Downhill avenue (Catabolism)- releases
energy that will be used, enabling energy
be stored. While Uphill avenue (Anabolism)
uses energy to build complex materials.
Teacher tip
Make sure that for every form of energy,
you will be able to show a solid example in
living systems how energy forms exists and
transformed.
102
Laws of Energy Transformation transformation makes the matter
Thermodynamics is the study of energy transformations that occurs in a system (collection of matter). more disordered. Disorder of
Living systems are considered as open systems because energy and matter are transferred between matter is measured through
systems and the surroundings. entropy.
1st Law: The energy of the universe is constant: Energy can be transferred and transformed but it 2nd Law: Every energy transfer or
cannot be created nor destroyed. Plants do not produce energy, but transforms energy from the sun. transformation increases the energy
Some energy becomes unavailable to do work because most is lost as heat. Transfer of energy and of the universe.
• i.e In a room full of people, breathing increases entropy since all are exhaling carbon dioxide. Teacher Tip
• Organisms as open system increase order as long as the order in their surroundings decreases. This Use the figure used, but make sure to note
shows that as living organism transfers/transforms energy to its surroundings, the disorder that an individuals’ contribution to the
increases, thus increases entropy. disorder in surrounding is not obviously felt,
but as a group it is. Use the idea of having
lots of people inside the room compared to
Free Energy an individual inside the room.
• Energy that can do work under cellular conditions The teacher must take note that there is
• Gibbs free energy is the energy in the system that can perform work when temperature and unstoppable trend towards randomization
pressure are uniform throughout the system: ∆G = ∆H – T∆S of the universe as a whole.
• Also known as free energy change
∆G = ∆H – T∆S, where ∆H is enthalpy (total
• Measure of system’s instability (trend: tendency to change to a more stable state) energy), T is absolute temperature and ∆S is
• Increase in G: UNSTABLE i.e. concentrated dye the change in entropy.
• Decrease in G: STABLE i.e. dye dispersed in water
• In chemical reactions: as reaction precedes equilibrium, the free energy of reactants and products If it is possible to show the concentrated
dye experiment (diffusion of dye in water), it
decreases (decreases free energy). If products will be removed free energy will increase
will be a big help. But before asking the
• When systems reach maximum stability, the system reaches the state of equilibrium. If equilibrium is students to do it, make sure that you
reached there is NO WORK. In chemical reactions proceeding equilibrium NO NET CHANGE in the prepare questions that will be answered to
relative concentration of reactants and products. lead the students in the discussion of free
energy.
Equilibrium and Metabolism It will be really helpful if you use the example
of an isolated/closed hydroelectric system
• Equilibrium = NO WORK. This usually happened in isolated systems that reach equilibrium. and an open hydroelectric system. A closed
• A cell that reaches the state of equilibrium is DEAD hydroelectric dam will reach equilibrium
• A normal cell is not in equilibrium, because its products are not accumulated within its system, while the open hydroelectric system will not
since the overspill will be used by another
INSTEAD the products becomes a reactant in the next step.
system. You may also think of other
examples that are parallel to the
hydroelectric system example.
104
You may also use the dye diffusion
experiment that you did in explaining the
isolated hydroelectric system as example.
Add a drop of concentrated dye to a glass
of water. Since it is a closed hydroelectric
system, the procedure stops there, where
the dye already reached the state of
equilibrium
Adenosine Triphosphate (ATP) • Mediates most energy coupling
• Structure composed of: sugar ribose, nitrogen base adenine and a chain of 3-phosphate groups in cells
• Powers cellular work
• 3 main kinds of work of a cell: chemical work, transport work and mechanical work. These are Teacher Tip:
possible through energy coupling, where the cells use and exergonic process to drive an The multistep hydroelectric system can be
endergonic reactions. explained through the dye diffusion
• chemical work: synthesis of polymers from monomers (pushing of endergonic reactions) experiment by using more than one glass or
water. You may show this by having the
• transport work: pumping of substances across membranes (against the direction of spontaneous
concentrated dye dropped to the first glass.
movement) Describe how the dye decreases free
• mechanical work: beating of cilia, contraction of muscles energy and how it becomes more stable by
• also used to make RNA (since ATP is used as one of the nucleoside triphosphate) diffusing. But this doesn’t end with this set
up, get another dropper and obtain a
sample of the colored water from glass 1
ACTIVITY: Calamansi Relay ala ATP cycle then drop it into the clear water in glass 2.
This way you are showing that the dye that
Materials: Calamansi, plastic spoons (30)
had decreased its free energy and improved
to be more stable can still undergo
spontaneous change. Then repeat the
In an oval (if there is any in your area) or a lot where students can play the relay
procedure from glass 1 to glass 2 for the
divide the class into 3 groups (10 members per group) assuming that there are 30 succeeding glasses. With this, you were able
students in a class. Define who’s going to be number 1-10 (refer to the figure to show that a multi-step open hydroelectric
below). At your mark they will start the relay. Student 1 must be able to successfully system will not reach equilibrium because
the product becomes the reactant for the
pass the calamansi (calamansi on a plastic spoon bitten by student 1) to the
next reaction.
students 2’s plastic spoon (must be bitten). The student’s hand must be at their back,
NO USING OF HANDS. If the calamansi falls from the spoon the student has to go Teacher tip:
The phosphate bonds of the ATP must not
back to his/her starting point before proceeding in passing the calamansi to the next
be termed as high-energy phosphate
player. The group that will finish first will be the winner. The winner will be awarded bonds. The bonds of the phosphate groups
with bonus points. of the ATP are not strong bonds but
instead, the reactants (ATP and water)
possess high energy compared to the
Do the game before discussing the ATP hydrolysis and ATP cycle. Make sure that you read the game product.
mechanics and do the adjustments to fit your classes. At the end of the activity discuss how it is related
to ATP hydrolysis and ATP cycle.
• Calamansi: water (for hydrolysis)
• Students: phosphates that is cleaved
• Students exerting effort to reach the other end: energy releasing process to allow ADP + P to Hydrolysis of ATP
produce ATP (phosphorylation) • process of breaking down bonds
• Bonus/incentive for the winner: energy between the phosphate groups
• 2 groups: ATP and ADP • this happens when a water
molecule breaks the terminal
phosphate bond
• HOPO32-, abbreviated P I leaves ATP Teacher Tip
• Forming Adenosine diphosphate (ADP) As for supplementary resource, you may
• Energy is released. This comes from the chemical change of the system state of lower free energy look for videos that clearly explains the
and NOT from the phosphate bonds. hydrolysis of ATP and the ATP Cycle. You
may ask your students to view it before the
• Hydrolysis relases so much energy because of the lnegative charges of the phosphate groups. class (HW) or have it shown in class as you
These charges are crowded together and their mutual repulsion contributes to the instability of that discuss it.
region of the ATP. The energy equivalent of the triphosphate tail of ATP is compared to a
Teacher Tip
Look for videos showing the 3 cellular work
powered by ATP. For the students to
appreciate these processes more and for
them to clearly see that its really happening
in living systems.
compressed spring.
106
How the Hydrolysis of ATP Perform Work
• Proof that ATP releases heat: in a test set up, the hydrolysis of ATP releases energy in the form of heat in the surrounding water.
• Most of the time when an animal is exposed in a cold environment, the reaction of the body is through shivering. In this reaction of the
organism, shivering uses ATP during muscle contraction to warm the body. Since it will also be a disadvantage for organisms to generate
heat during ATP hydrolysis, in order to maintin the living conditions inside the cell, the energy released during ATP hydrolysis is used by
proteins to perform work: chemical, transport and mechanical
• Hydrolysis of ATP leads to change in the shape of protein and in its ability to bind to another molecule. Phosphorylation (ADP to
ATP) and dephosphorylation (ATP to ADP) promote crucial protein shape changes during important cellular process
The Regeneration of ATP
• ATP is a renewable it can be regenerated by the addition of phosphate to ADP
• Catabolism (exergonic) provides the free energy to phosphorylate ADP.
• ATP formation is not spontaneous, so there is a need to use free energy for the process to work.
• ATP cycle is the shuttling of inorganic phosphate and energy.
• It couples the cell’s energy yielding processes (exergonic) to energy consuming process (endergonic)
• ATP regeneration happens very fast (10M molecules of ATP used ad regenerated per second)
• If ATP could not be regenerated by phosphorylation of ADP, HUMANS would use nearly their body weight in ATP each day.
108
PRACTICE (10 MINS)
A. “Hugot-lines”. Create “hugot-lines” based on the laws of transformation of energy. Ask your
students to create 3 “hugot-lines” per law under the transformation of energy. The student must give
justification for each “hugot-line” they’ll create. Make sure that the “hugot-lines” are in tune with the
scientific concepts of the law of thermodynamics.
B. ATP in everyday life. Ask your students to make an analogy relating the concepts under ATP (ATP
cycle, ATP hydrolysis, How ATP allows organisms to do work) or the relevance of ATP in our lives. After
listing the analogies or the relevance of ATP in our lives, ask the students to write their reflection/
realization regarding the topic.
110
General Biology 1
Energy Transformation 240 MINS
Pt.1
Content Standard LESSON OUTLINE
The learners demonstrate an understanding of photosynthesis. Introduction Assess prior knowledge through a class
Learning Competency 10 activity on word clustering
The learners explain the importance of chlorophyll and other Motivation Laboratory activity on separating plant
pigments
50 pigments through paper
(STEM_BIO11/12 – IIa-j-3)
chromatography
Specific Learning Outcomes Instruction Discussion on chlorophyll, 120
At the end of the lesson, the learners shall be able to: / Delivery photoexcitation of chlorophyll, and
• separate and identify the different pigments present in plants the photosystem
through a
simple paper chromatography
experiment
Practice Formative assessment through summary
20 reporting
• discuss the role of pigments in photosynthesis
• illustrate how chlorophyll absorbs and transforms light Enrichment Answering of critical thinking questions
energy 20
• define and describe a photosystem
Evaluation Short quiz on topics discussed in the
20 lesson
Mate
rials
• laboratory materials and supplies for the
chromatography experiment (i.e., chromatography or
filter paper, glassware, acetone/solvent, spinach leaf,
coleus leaf, coin, pencil, aluminum foil, ruler, and
coffee stirrer)
•
pris
m
Resou
rces
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition.
Pp.92
– 98. Belmont, California: Brooks/Cole-Tomson Learning.
INTRODUCTION (10 MINS) dissolved substances). The
1. Assess the learners’ prior knowledge of the topic by facilitating a class activity on clustering or solvent will move up the paper
word through capillary action carrying
webbing. Write the word CHLOROPHYLL on the board. This will serve as the ‘nucleus with it the dissolved substances.
word’. These substances will be carried
2. Ask the learners to think of words or images associated with the ‘nucleus word’ and let them along at different rates because
write the words or sketch the images around the ‘nucleus word’.
they are not equally soluble in the
3. Encircle each word or image and draw a line from each item to the ‘nucleus word’. solvent and they will be attracted
4. Ask the learners to write how each word or image is related to the ‘nucleus word’ in different degrees to the paper.
CHLOROPHYLL
and have them write the relation above or below the line that you drew.
5. Ask the learners to summarize the word web formed by the class. Provide the learners with a
6. After the summary, present the following questions to the class: copy of the instructions for the
• Why are chlorophyll and other plant pigments important? activity. Guide them as they
• How do chlorophyll and other plant pigments help in carrying out perform the experiment.
photosynthesis?
112
These essential questions shall help the learners focus in finding the correct responses.
Posing essential questions at the start of a lesson helps stimulate thoughts, promotes inquiry, and motivates the learners
to find and formulate ways to be able to come up with the correct responses.
Teacher Tip:
Use the following guidelines in performing
the laboratory activity:
• Make sure that the learners have knowledge of safety practices in the laboratory.
• Let the learners work in groups in order to smoothly carry out the experiment.
• Prepare the materials a day before the activity.
Extracting Plant Pigments through Chromatography
114
Light, as it encounters an object, is either reflected, transmitted, or absorbed. Visible light, with a absorbed by pigments of
wavelength of 380–750nm, is the segment in the entire range of electromagnetic spectrum that is most
important to life on earth. It is detected as various colors by the human eye. The color that is not
objects is transmitted or reflected and that is the color of the object that we see. Teacher Tip:
Encourage participation from the students
while discussing these concepts.
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Figure'1:!The!Electromagnetic!Spectrum!
Pigments are the means by which plants capture sun’s energy to be used in photosynthesis.
However, since each pigment absorbs only a narrow range of wavelength, there is usually a need to
produce several kinds of pigments of different colors to capture more of sun’s energy.
Chlorophyll
Chlorophyll is the greenish pigment found in the thylakoid membrane inside the chloroplast of a plant
cell. The figure below shows the location and structure of a chloroplast.
Chlorophyll absorbs blue and red light while it transmits and reflects green light. This is why leaves Other pigments in the chloroplast
appear green. play the part of accessory pigments.
These pigments can absorb light
and transfer the energy to
There are several kinds of chlorophyll. Among these, chlorophyll a plays the most important role in
chlorophyll a. One of these
photosynthesis. It directly participates in converting solar energy to chemical energy.
accessory pigments is chlorophyll b.
Some carotenoids also contribute
energy to chlorophyll a. Other
carotenoids, however, serve as protection for chlorophyll by dissipating excessive energy that will Teacher tip
otherwise be destructive to chlorophyll. For this part, you may ask some learners to
volunteer to show the location of
chlorophyll in a leaf of a plant. They may
Structure of chlorophyll do this through drawings or sketches in the
board.
• Head—a flat hydrophilic head called porphyrin ring. It has a magnesium atom at its center. Different
chlorophylls differ on the side groups attached to the porphyrin.
• Tail—a lipid-soluble hydrocarbon tail.
116
Teacher tip
Reiterate the importance of the formation
of photosystem. The formation of the
photosystem prevents the excited electrons
from going back to the ground state, thus
preventing the loss of energy which is
essential for photosynthesis to occur.
Photosystem
A photosystem is an aggregate of pigments and proteins in the thylakoid membrane responsible for
the absorption of photons and the transfer of energy and electrons. It is composed of:
• Light-harvesting complex— is also called the ‘antenna’ complex and is consisted of several different
pigments (chlorophyll a, chlorophyll b, and carotenoids) bounded with proteins. When a pigment
molecule absorbs a photon, energy is passed on from one pigment molecule to another pigment
molecule until the energy reaches the reaction center.
• Photosystem II—was discovered later after the discovery of Photosystem I, but functions first in the
light reaction of photosynthesis. The chlorophyll a in the reaction-center of Photosystem II
effectively absorbs light with a wavelength of 680nm and thus called P680.
• Photosystem I—was discovered first. Its reaction-center has a chlorophyll a called P700 because it is
effective in absorbing light with a wavelength of 700nm.
118
EVALUATION (20 MINS)
Give the students a short quiz to assess their understanding of the topics discussed in the lesson.
You may formulate other questions that can gauge their learning.
M
a
t
e
r
i
a
l
s
• samples and photos of plant products
(e.g. fruits and vegetables)
• materials for the role-playing activity (e.g.
tennis balls or soft balls, lids, and labels)
R
e
s
o
u
r
c
e
s
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp.
190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003 ). Biology: Concepts and Applications
5th edition. Pp.98
- 100. Belmont, California: Brooks/Cole-Tomson
Learning.
1
2
0
INTRODUCTION (20 MINS) Ask learners to make
1. Communicate the learning competencies and learning outcomes of this lesson to the conclusions on the role
class. played by plants in
2. Give the learners enough time to research on the definition and description of the converting the sun’s energy
following keywords: to a form of energy that the
• light reactions human body can use.Using a
• noncyclic electron flow pencil, draw a base line that
• cyclic electron flow is 2cm from the bottom of
• plastoquinone (Pq) the paper strip. Be careful in
• plastocyanin (Pc) handling the
• ATP chromatography paper as oil
• photophosphorylation from the human skin can
• ferredoxin alter the results. Lift the
• NADP+ paper only by its sides and
• NADPH be careful not to touch its
• chemiosmosis front.
Ask the learners to identify which among the reactants is/are used in the light reactions and
the Calvin cycle.
Show an image of the light reactions similar to the one shown in Figure 2 below:
Teacher Tip:
Using a diagram showing an overview
You may the students to write on the board
of photosynthesis, have the students
the chemical reaction for photosynthesis.
figure out differences between the two
stages
involved.
From the image or diagram of the light reactions, ask the learners to identify the key players
involved in the process.
Teacher Tip:
You may review the concept of redox reaction in this part.
In an oxidation reaction, a molecule loses one or more electrons and becomes more positively charged.
In a reduction reaction, a molecule gains one or more electrons and becomes more negatively charged.
Oxidation and reduction reactions are most often paired, resulting to a redox reaction. As a molecule is oxidized,
the molecule that accepts the electrons is reduced.
Teacher Tip:
Integrate the First Law of Thermodynamics which states that energy can be transferred or transformed from one
form into another but cannot be created nor destroyed. Ask the students how the First Law of Thermodynamics
is applied in Photosynthesis. Ask the learners to cite specific events in the process that illustrates the law.
2. The electron in this pair of chlorophyll a is raised to an excited state and is transferred to the
primary electron acceptor. P680 loses its electron and becomes positively charged (P680+).
3. The positively charged molecule attracts electrons from a water molecule, resulting to the splitting
up of H20 into two electrons, two hydrogen ions (H+), and an oxygen atom with the provision of
light energy. The oxygen atom immediately combines with another oxygen atom to form an oxygen
molecule (O2) which is then released outside the leaf through the stomata.
4. The excited electrons are then passed on from the primary electron acceptor to the electron carrier
molecules through the electron transport chain until they reach Photosystem I. The electron carrier
molecules involved here are plastoquinone (Pq), a cytochrome complex, and plastocyanin (Pc).
5. At each transfer, the electrons release small amounts of energy. This energy is used to pump
hydrogen ions across the membrane. The splitting up of water molecules results to an uneven
distribution of hydrogen ions in the stroma and the lumen. The H+ ions tries to equalize their
distribution by moving from the lumen to the stroma through the aid of a membrane protein called
ATP synthase. This is referred to as chemiosmosis. The movement of hydrogen ions through the
ATP synthase channel triggers the synthesis of ATP from ADP. The ATP contains high-energy
phosphate bonds.
6. Meanwhile, photon is also absorbed and energy is passed on from one pigment molecule to
another until the energy reaches the reaction center complex of Photosystem I. The energy excites
the electron present in the pair of P700 chlorophyll a located here. The excited electron is then
transferred to a primary electron acceptor, making the P700 positively charged and now seeking
electrons to fill up the missing ones. This is filled up by the electrons from Photosystem II that are
passed on through the electron transport chain.
7. The photo-excited electron from the primary electron acceptor of Photosystem I enters another
electron transfer chain, passing the electron to an iron-containing protein called ferredoxin (Fd).
8. An enzyme, the NADP+ reductase, then transfers the electron to NADP+ and stabilizes it by adding
a proton (H+) to form NADPH. NADPH is then released to the stroma and becomes part of the
Calvin Cycle.
1
2
6
ENRICHMENT (60 MINS) 3. Then, ask the pairs to share
their responses to the whole
Think-Pair-Share
class. Pair: Look for a partner
1. First, instruct the learners to determine what event/s in the light reactions they consider
and discuss your answers.
to be the
most significant
to humans.
2. Next, ask the learners to look for a partner and share their response.
Teacher tip be answered as a quiz. The quiz
You may also opt to formulate questions to may be done individually or in
pairs.
M
a
t
e
r
i
a
l
s
• materials for making three-dimensional
models of the Calvin Cycle (e.g., clay,
Styrofoam balls, beads, and art
materials)
R
e
s
o
u
r
c
e
s
(1) Reece JB, U. L. (2010). Campbell Biology 10th.
San Francisco(CA): Pearson Benjamin
Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications
5th edition.
Belmont, California: Brooks/Cole-Tomson Learning.
1
2
8
INTRODUCTION (10 MINS) Teacher tip
1. Present the learning competency and learning outcomes for this lesson. Let the learners provide the
2. Describe the significant events of the Calvin cycle. overview or description of the Calvin
cycle.
3. Review the basic features of the Calvin cycle.
You may refer to the equation of
photosynthesis in introducing the
The Calvin Cycle topic.
2. Explain to the learners that these terms are the key players in the Calvin cycle that they need to
familiarize themselves with.
3. Instruct the learners to research the meaning and description of the molecules
involved in Calvin cycle.
INSTRUCTION/DELIVERY (60 MINS)
Give a lecture-discussion on Calvin cycle.
Reduction
• A phosphate group (from ATP) is then attached to each 3-phosphoglycerate by an enzyme,
forming 1,3-phosphoglycerate.
• NADPH swoops in and reduces 1,3-biphosphogycerate to G3P.
• For every six G3Ps produced by the Calvin Cycle, five are recycled to regenerate three
molecules of RuBP. Only one G3P leaves the cycle to be packaged for use by the cell.
• It will take two molecules of G3P to make one molecule of glucose.
• The ADP and NADP+ that is formed during the Calvin Cycle will be transported back to the
thylakoid membrane and will enter the light reactions. Here, they will be ‘recharged’ with
energy and become ATP and NADPH.
130
Regeneration of RuBP
• Five molecules of G3P undergo a series of complex enzymatic reactions to form three molecules of RuBP. This costs the cell another
three molecules of AT, but also provides another set of RuBP to continue the cycle.
132
General Biology 1
Energy Transformation - 360 MINS
Cellular
Respiration (Part 1 of 3) LESSON
OUTLINE
Content Standard Introduction As part of understanding by design, engage
The learners demonstrate an understanding of cellular respiration. 5
the students in learning
Learning Competencies exploring and firming up.
The learners:
Motivation To extend and refine your students’
• Differentiate aerobic from anaerobic respiration (STEM_BIO11/12- 10
IIa-j-6) understanding on energy
• Describe the role of oxygen in cellular respiration and describe transformation, you may ask them
pathways of electron flow in the absence of oxygen regarding the function and
(STEM_BIO11/12-IIa-j-10) structure of the mitochondrion
Instructi A series of activities with directions are
on/ 15
Specific Learning Deliver indicated below.
Outcomes y
Practice Post guide questions
At the end of this lesson, the students must be able to;
240
1. determine the functional definition of cellular respiration;
2. compare fermentation with anaerobic and aerobic respiration;
3. explain how cells can produce ATP in the presence or absence of Enrichment Answer the modified true or false, make a
oxygen; 60 graphic organizer on aerobic and
4. identify the metabolic pathways where aerobic respiration aerobic respiration and accomplish the
specifically occurs; and Venn diagram
5. explain how the lack of oxygen in the body results in eventual Evaluation Answer the multiple-choice questions and a
death of an organism. 30 diagram that shows a comparison
among fermentation, aerobic and
anaerobic
respiration
R
e
s
o
u
r
c
e
s
• Enger, Eldon D. et. al., (2012). Concepts in Biology
14th Edition. USA: McGraw-Hill
• Mader, Sylvia S. (2010). Biology 10th Edition. USA:
McGraw-Hill
• Mader, Sylvia S. (2013). Biology 11th Edition. USA:
McGraw-Hill
• Reece, Jane B. et al., (2011). Campbell Biology 9th
Edition. San
Francisco USA: Pearson Education, Inc.
• Solomon, Eldra P. et al., (2008). Biology 8th Edition.
China: Thomson
B
r
o
o
k
s
/
C
o
l
e
INTRODUCTION (5 MINS)
As part of learning exploration, let your students define cellular respiration. You may also ask students to describe process happening when
they respire using their respiratory system then connect this process of respiration to what is happening inside the cell (cellular respiration).
Cellular respiration by technical definition includes both aerobic and anaerobic respiration processes. But today cellular respiration is often used
to refer to aerobic processes.
134
Teacher tip
Teacher Tip:
Courtesy: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill
(Retrieved August 13, 2015.)
PROCEDURE
1. To extend and refine your students’ knowledge on cellular respiration, tell them to do the sample
graphic organizer below.
2. Fill-out the table and distinguish how the two types of respiration are alike and different. Then tell
them to write their conclusion based on the similarities and differences they have listed.
3. You may form three groups for this activity. Each group has to present the output(s) to the class
using any kind of visual learning materials.
Comparing Graphic Organizer
How alike?
How different?
136
AEROBIC RESPIRATION ANAEROBIC RESPIRATION
How alike?
Both undergo glycolysis in the cytoplasm of the cell
Both undergo substrate-level phosphorylation and oxidative phosphorylation and chemiosmosis in producing ATP molecules
Both split the 6-carbon glucose into two molecules of pyruvate, the three-carbon molecule
Both involve a series of enzyme-controlled reactions that take place in the cytoplasm
Both use NAD+ (nicotinamide adenine dinucleotide), a redox coenzyme that accepts two electrons plus a hydrogen (H+) that becomes NADH
Both performed by eukaryotic and prokaryotic cells
AEROBIC RESPIRATION ANAEROBIC RESPIRATION
How different?
Maximum yield of 36 to 38 ATP molecules per glucose Maximum yield of 2 ATP molecules per glucose for obligate anaerobes
Complete breakdown of glucose to carbon dioxide and water with the use of Partial degradation of glucose without the use of oxygen (obligate
oxygen anaerobes)
Multiple metabolic pathways Single metabolic pathway (in fermentation)
Pyruvate proceeds to acetyl formation in the mitochondrion Pyruvate is broken down to ethanol and carbon dioxide or lactate (in
fermentation)
The presence of enough oxygen in the cell makes the cell perform its job Cause burning sensation in the muscle during strenuous exercise
smoothly without burning sensation (in fermentation)
More efficient in harvesting energy from glucose with estimated 39% energy Less efficient in harvesting energy from glucose with 2% energy efficiency
efficiency (36-38 ATP) in eukaryotic organisms but much higher ATP (for obligate anaerobes)
production (38 to 40 ATP) in prokaryotic organisms
Outputs are carbon dioxide, water and ATP Outputs are lactate, alcohol and carbon dioxide (in fermentation); but
reduced inorganic compound in anaerobic respiration
Products produce are for biochemical cycling and for the cellular processes Produce numerous products with economic and industrial importance
that require energy through fermentation
Slow glucose breakdown Rapid breakdown of glucose
Electrons in NADH are transferred to electron transport chain Electrons in NADH are transferred to electron transport chain; but in
fermentation electrons in NADH are transferred to organic molecule
Mechanism of ATP synthesis is by substrate-level and oxidative Mechanism of ATP synthesis is by substrate-level and oxidative
phosphorylation/chemiosmosis phosphorylation/chemiosmosis; but in fermentation substrate-
level phosphorylation only during glycolysis
O2 is the final electron acceptor of the electron transport system In anaerobic respiration, inorganic substances like NO 3 - or SO 42- are
the final acceptor of the electron transport system; but in
fermentation, there is no electron acceptor because it has no
electron transport system.
Brain cells in the human body can only live aerobically. They die if Some organisms like yeasts (eukaryotic), many bacteria (prokaryotic)
molecular oxygen is absent. and the human muscle cells (eukaryotic) can make enough ATP to
survive in facultative anaerobes (can live in the absence or presence
of oxygen). But under anaerobic conditions lactic acid fermentation
occurs. A facultative anaerobe needs to consume the nutrient at a
much faster rate when doing the fermentation or anaerobic process.
Summary and/or Conclusion
Aerobic respiration requires molecular oxygen to happen in the cells of most eukaryotes and prokaryotes. Here, nutrients are split into a series
of enzyme-controlled reactions producing an estimated 36 to 38 ATP per glucose complete breakdown. Molecular oxygen is the final
acceptor of the low-energy level electron at the end of the electron transport system that results in the production of water. In anaerobic
respiration on the other hand does not require oxygen in splitting nutrients. Some prokaryotes that live in oxygen-free environments such as
water logged soil, in ponds where water does not flow, and in the intestines of animals transfer glucose to NADH and then pass the electrons
down the electron transport chain that is joined to ATP synthesis by chemiosmosis. Nitrate and sulfate are the final acceptors of electrons. The
end products are carbon dioxide, reduced inorganic substances and ATP. In fermentation (as type of anaerobic respiration) there is no
electron acceptor because it has no electron transport chain. Its products are either alcohol (and carbon dioxide) or lactate.
Note: Clarify how many minutes should be allotted for this activity
ETC: A Metaphor
PROCEDURE
1. To describe how the electron transport system performs its function along the cristae (folds) of the mitochondrion, the students will prepare
the following materials: coloring materials, Manila paper(s), color papers, markers, pencil, and ruler.
2. The learners will make an analogy or a metaphor on how the electrons are being passed on to electron transport chain that result in the
release of water.
3. In their drawing, they have to illustrate the participation of NADH, FADH2, hydrogen proton ion, electrons and oxygen along the electron
transport system. Review your students that the simultaneous cooperation of these carrier molecules and hydrogen atoms are being used to
run ATP production by chemiosmosis. They have to show that ATP and water are two of the products of ETC.
138
4. To facilitate their understanding, you can give them metaphoric examples such as bucket relay for ETC and a stair. A sample illustration is
given below for your reference.
5. Form four groups for this activity. You may form rubric for this part focusing on appropriateness of illustration with all key ideas and
elements are put together correctly.
Stair image courtesy of: Mader, Sylvia S. (2013). Biology 10th Edition. USA: McGraw-Hill (Retrieved August 15, 2015.)
Directions: The pictures below describe the pathways of electron in the absence of oxygen. Analyze it by arranging the seven metabolic
pathways from numbers 1 to 7 provided for you in the opposite table. The same procedure is followed in another table for fermentation with
numbers 1 to 6.
Images courtesy of: Mader, Sylvia S. (2013). Biology 11th Edition. USA: McGraw-Hill (Retrieved August 17, 2015.)
140
Metabolic Pathways Outside the Mitochondria: Glycolysis Metabolic Pathways Outside the Mitochondria: Glycolysis
(Note: This is not sequenced.) (Note: Arrange the pathways in order from 1 to 7.)
Metabolic Pathways Outside the mitochondria: Metabolic Pathways Outside the Mitochondria:
Fermentation (Note: This is not sequenced.) Fermentation (Note: Arrange the pathways in order from
1 to 6.)
G3P is oxidized as NAD+ receives high energy-electrons
coming from the hydrogen atoms of C6H12O6.
NAD+ is “freed” to return to the glycolytic pathway to
pick up more electrons.
Two ATP molecules are used to start glycolysis.
Suggested Answers:
1. NAD+ accepts electrons and delivers them to the ETS. Pyruvate is the product of glycolysis. It is converted to acetyl-CoA and transferred to
the Krebs cycle. Oxygen is the final electron acceptor of the ETS and combines with hydrogen to form water. ATP is used in glycolysis to get
the process going but ultimately it is the most valuable molecule produced by aerobic respiration. All parts of aerobic respiration result in a
net yield of ATP.
2. Oxygen molecule is the final acceptor of electrons from ETC. It receives the low energy electron from the last of the carriers (that is,
cytochrome oxidase). After receiving electrons, the oxygen molecule combines with hydrogen ions, and water is formed.
3. The members of the chain in sequence are the following: NADH-Q reductase, coenzyme Q, cytochrome reductase, cytochrome c,
cytochrome oxidase. These are the members of the chain which accept high-energy level electrons which they pass from one molecule to
another.
4. The cristae contain the chain members (carrier molecules and protein complexes, ATP synthase complex and ATP channel protein (bulk of
ATP is produced by chemiosmosis).
5. The complexes of the ETC use the released energy to pump these hydrogen ions from the matrix into the intermembrane space of
mitochondria.
6. If you want to earn, you really need to invest, and therefore you need a capital of some amount. During the energy-investment step, 2 ATPs
are used to split glucose into 2 pyruvate molecules. The split of glucose produces a gross of 4 ATPs and 2 NADH. 4 ATP- 2 ATP = 2 ATP net
in the glycolysis.
7. Prokaryotic organisms do not have mitochondria. These organisms use a slightly different way to perform the Krebs cycle and ETC that
results in slightly more ATP than is produced by eukaryotic organisms.
142
8. The electron transport chain consists of a series of molecules which accept electrons and transfer them from one molecule to another. As
electron is passed on along the series, energy is released to run ATP production. As this happens, protons are pumped from one location to
another in the mitochondrion. Protons begin to build up in their new location. This creates a chemical gradient producing a bulk of ATP by
chemiosmosis. These ATP molecules can be used by the cell to do work.
9. Glucose G3P BPG 3PG PEP pyruvate
10. ATP can still be produced without oxygen. This can be done through anaerobic fermentation. A net of 2 ATP molecules are produced
during glycolysis. Glucose proceeds through the glycolysis pathway, producing pyruvate. This process “frees” NAD+ and it returns to the
glycolytic pathway to up more electrons to become NADH again.
Main function
Site of Reaction
Production of ATP
Sustainability
Production of lactic acid
Oxygen requirement
Recycling of NADH
Participating cells
Suggested Answers:
Main function Production of ATP from food such as Production of ATP without the use of oxygen
carbohydrate, lipid and protein
Site of Reaction Cytoplasm and mitochondrion Cytoplasm
Production of ATP 36 to 38 ATP per glucose molecule 2 ATP per glucose molecule
Sustainability Long-term Short-term
Production of lactic acid Does not produce Produces
Oxygen requirement Yes No
Recycling of NADH Through the electron transport system In lactic acid fermentation (i.e., muscle cells;
in alcohol fermentation (pyruvate is
converted to carbon dioxide and ethanol)
Participating cells Most cells Yeast, other fungi, prokaryotes, muscle cells
144
Directions: Compare aerobic and anaerobic respiration by accomplishing the Venn diagram below.
Directions: Compare fermentation with anaerobic and aerobic respiration by analyzing the diagram below.
Diagram courtesy of: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill (Retrieved August 13, 2015)
1. What are the three kinds of enzyme-controlled reactions so that the chemical-bond energy from a certain nutrient is released to the cell in
the form of ATP?
2. What are the hydrogen electron acceptors for aerobic and anaerobic respiration as well as in fermentation?
3. These are the by-products of aerobic respiration that are considered low-energy molecules.
4. What are the outputs produced by anaerobic respiration? What about in fermentation?
5. What are two general metabolic mechanisms by which certain cells can oxidize organic fuel and generate ATP without the use of oxygen?
146
Suggested Answers:
1. Aerobic respiration, anaerobic respiration, and fermentation
2. aerobic respiration — molecular oxygen, anaerobic respiration — nitrate or sulfate, fermentation – pyruvate
3. Water and carbon dioxide
4. Anaerobic respiration—ATP, water reduced acceptor (nitrate or sulfate), fermentation, ATP, carbon dioxide, alcohol or lactate
5. Anaerobic respiration and fermentation
Directions: This is a multiple-choice task. Encircle the letter of the correct answer.
3. The positively charged hydrogen ions that are released from the glucose during cellular respiration eventually
combine with ion to form
a. another hydrogen, a gas
b. a carbon, carbon dioxide
c. an oxygen, water
d. a pyruvic acid, lactic acid
4. The Krebs cycle (also known as citric acid cycle or tricarboxylic acid) and ETC are biochemical pathways
performed in which eukaryotic organelle?
a. nucleus
b. ribosome
c. chloroplast
d. mitochondrion
5. Anaerobic pathways that oxidize glucose to generate ATP energy by using an organic molecule as the ultimate
hydrogen acceptor are called
a. fermentation.
b. reduction.
c. Krebs cycle.
d. Electron pumps
6. When skeletal muscle cells function anaerobically, they accumulate the compound , which
causes muscle soreness.
a. pyruvic acid
b. malic acid
c. carbon dioxide
d. lactic acid
7. Each molecule of fat can release of ATP, compared with a molecule of glucose.
a. smaller amounts
b. the same amount
c. larger amount
d. only twice the amount.
148
8. In complete accounting of all ATPs produced in aerobic respiration, there a total of ATPs:
from the ETC, from glycolysis, and from the Krebs cycle.
a. 36, 32, 2, 2
b. 38, 34, 2, 2
c. 36, 30, 2, 4
d. 38, 30, 4, 4
9. The chemical activities that remove electrons from glucose result in the glucose being
a. reduced.
b. oxidized.
c. phosphorylated.
d. hydrolyzed.
10. Which of the following is NOT true of the citric acid cycle? The citric acid cycle
a. includes the preparatory reaction
b. produces ATP by substrate-level ATP synthesis
c. occurs in the mitochondria
d. is a metabolic pathway, as is glycolysis
Suggested Answers:
of 3) Motivation
and products of cellular respiration
150 http://highered.mheducation.com/sites/0073403466/student_view0/
chapter7/image_powerpoint.html
http://highered.mheducation.com/sites/0073525502/student_view0/
chapter7/index.html
INTRODUCTION (5 MINS)
Communicate to the class the learning competencies. Then go over the reactants and You may ask them the following
products of questions:
cellular respiration.
1. How many molecules of ADP as reactant are needed to produce about 38 molecules
Teacher tip
of ATP for eukaryotic organisms?
Emphasize that both prokaryotic and
2. Which groups in the cellular respiration equation go in? eukaryotic organisms need food in
3. Which groups are released? order to get the energy needed to
adapt to many things in the
environment and to perform bodily
Suggested Answers: processes such as growth, repair,
1. About 36 to 38 ADP molecules (NOTE: This number is just a ratio. Some biology authors reproduction, maintenance of
homeostasis, etc.
say there are 30, 32 or 34 ADP (or ATP) molecules depending on the shuttle used to
transport the electrons and on the kind of species.)
2. Groups that go in: carbohydrate and molecular oxygen
3. Groups that are released: carbon dioxide, water and energy (ATP)
NOTE: Cellular respiration is one of the more difficult topics in biology. To capture the
general picture of the topic, students have to be encouraged to read and re-read the key
concept, write and re-write, outline and re-outline, draw and re-draw, and to recite orally if
they want the ideas to sink in their system. Patience and steadfastness are important virtues
that should be included as you study this concept.
1. If one of the students who ate would pay to the cashier a bill in US dollar, would the
cashier accept the money as a form of payment for the food ordered?
Suggested Answers:
1. No
2. Encash the 1000-peso cheque first at
the bank.
3. Convert the US dollar bill to
Philippine Peso and encash the 1000-
peso bill cheque at the bank.
4. ATP or Adenosine Triphosphate, a
form of nucleic acid
2. If one of the students ate combo meal and the amount of the food eaten is P49.00 and 1000-peso money cheque
he gave out to the cashier, what do
you think the cashier would ask to the student? (Assuming that the student is the first
5. The complex food molecules are
customer of the day).
broken down by digestion into
3. What should the students do (one with a US dollar bill and one with a 1000-peso money simpler substances that are absorbed
cheque) to make their money more functional? by the body through the bloodstream.
4. Just like the US dollar bill and the 1000-peso money cheque, the glucose (carbohydrate) These food molecules will then be
transported to all their cells. Breaking
in the food that we eat is a principal high-energy molecule that has to be digested into down of food is a catabolic process
smaller molecules in order to release the high energy molecule that is highly recognized that converts the energy in the
by the cell. What do you call chemical bonds of nutrients to
this molecule that serves as the “energy currency of the cell”? chemical energy stored in ATP that
occur inside the cells of these
5. After this group of students ate the food at their school canteen, how do they obtain students. This process in known as
energy from these food (protein, carbohydrate, fat) molecules? cellular respiration.
Process the answers of the students related to the US dollar bill. Give the relationship of NOTE: The US dollar currency is not
directly used in everyday transaction. It
this analogy to the current topic.
has to be converted into usable form
such as the Philippine money.
INSTRUCTION/DELIVERY (250 MINS)
Cellular respiration is different from
Activity 1: 3-D Mitochondrion Model organismic respiration. The latter
1. Let your class form triad. Give a model color picture of a mitochondrion that will refers to the exchange of gases such
as oxygen and carbon dioxide with
serve as their guide for the 3-D mitochondrion. Print color pictures of a
the environment by living organisms,
mitochondrion and give one to each group. particularly animals with special
2. To make a 3-D model of a mitochondrion, prepare the following materials: Old organs such as lungs and gills, for gas
newspapers, metal wires, starch (serves as paste), vinegar, acrylic paint, and paintbrush. exchange.)
3. The sizes of the 3-D model mitochondrion are: Length — 24 inches, width — 14 inches,
height — 8 inches. Teacher Tip
4. From the metal wire, mold a mitochondrion based on the sizes given. The Inform the groups of students one week
prior to this topic to give way to the
cristae of the mitochondrion can be formed through the metal wire.
preparation and designing of a 3-D
5. Prepare a mixture for the starch (this will serve as your paste) as follows: 2 cups water, 2 model
cups starch, of a mitochondrion. You may form three
1 cup vinegar. Mix the materials together under normal fire for 3-5 minutes. groups. Give each group a model color
picture of a mitochondrion that will
6. With the old newspapers collected from the students’ neighbors, tell your students
serve as
to wet the newspapers with paste and glue them on to the metal wire. their template for the 3-D.
7. Let the model dry up before they paint the 3-D model mitochondrionProvide expected
answers to the table
152
Activity 2: Drawing, Coloring and Labeling
1. Inform your students to bring the following materials: Oslo paper (or long bond
paper), coloring materials, pencil and a ballpen. Teacher tip
For the drawing, coloring and labeling
2. Let them draw and color, and label the model picture of a mitochondrion below. of the parts of a mitochondrion, you
3. The rubric for the drawing and coloring is given to help in the objective scoring of may print the picture in color and post
the output coming from your students. it on the board for everyone to see.
4. The students will proceed to labeling. There are 10 blanks to be filled-in.
5. Then proceed to discussion by giving them processing questions.
Contrast and intensity Shows exceptional artistic Shows generally acceptable Shows generally vague
of drawing and skillful color contrast; artistic and skillful color color contrasts; and
and meaningful color contrasts; and meaningful indiscernible sense of
concentration color concentration color concentration
Blending of colors Color mix is exceptionally Color mix is generally Color mix needs
creative, appropriate and creative, appropriate and improvement
meaningful meaningful
Neatness Completely free from Almost free from mess Too messy
mess
Model Picture of a Mitochondrion
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole
(Retrieved July 20, 2015)
Suggested Rubrics
During this stage, glucose (the six-carbon molecule) is split into two
molecules of pyruvate (which contains three carbons). A net of two ATP
molecules is produced by substrate-level phosphorylation during glycolysis.
In addition, there are four hydrogen atoms are removed and are used to
produce two NADH (an electron-carrier molecule that enters mitochondrion
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole (Retrieved August 2, 2015)
STAGE 2:
This is what happens:
STAGE 3:
156
STAGE 4:
Activity 4: Watch Summary Video for Aerobic Respiration (If materials are available)
Directions: With the help of your instructional materials (e.g. in tarpaulin form, PowerPoint Presentation or even simple pictures that are visually
attractive and accurate) ask the following processing questions. Allow the pictures and the boardwalk to speak to your students.
Processing Questions:
1. How many metabolic pathways are present in aerobic respiration?
2. Where in the cell part does glycolysis take place? What about the formation of Acetyl CoA, Krebs cycle and the electron transport chain and
chemiosmosis?
3. How many reduced NADH molecules are produced after the glucose has been completely broken down to ATP? And what stage of the
aerobic respiration is glucose completely broken down to carbon dioxide?
4. As glucose is split in the cytosol of the cell, is there a release of carbon dioxide as by-product of the reaction?
5. What molecule accepts the hydrogen atoms at the end of electron transport chain?
6. What is the major goal of NADH and FADH2 in aerobic respiration?
7. Why do you think the cell needs to digest glucose or any other nutrients such as protein and fats?
8. Among the metabolic pathways of cellular respiration, which phase is the major contributor of ATP?
9. What happens to pyruvate if oxygen is not available in the cell?
10. How many acetyl-CoAs are produced from each glucose molecule?
Suggested Answers:
1. Three metabolic pathways
2. Glycolysis takes place in the cytoplasm or cytosol; formation of acetyl CoA, Krebs cycle, ETC and chemiosmosis all take place in the
mitochondrion
3. 10 NADH molecules; glucose is completely broken down carbon dioxide at the Krebs cycle
4. No
5. Oxygen molecule
6. The goal of NADH and FADH2 is to transport the electrons coming from the hydrogen atoms (in glucose) to the electron transport chain
7. The cell has to digest glucose, fat, and protein in order to convert them into usable form of energy molecule called adenosine triphosphate.
This ATP is the only molecule that is recognized by the cell for all of its cellular activities.
8. Among the metabolic pathways in aerobic respiration, the electron transport chain (or oxidative phosphorylation) makes about 90 per cent
of ATP per glucose molecule.
9. The pyruvate will not proceed to the formation of acetyl CoA. The pyruvate will become lactic acid in animal and alcohol in plant.
10. Two
158
ENRICHMENT (90 MINS) PART I: Jigsaw Activity
Directions: Read the procedures below on how the jigsaw and expert groups are formed. Procedure:
1. Form a group having four members. Each student-member in the group will be assigned to a
Teacher tip
certain phase of cellular respiration (1. glycolysis, 2. preparatory reaction, 3. citric acid cycle, • Encourage each member to ask
4.electron transport chain). Each group will be called “jigsaw group”. question(s) for clarifications.
• Provide cellular respiration handouts/
2. Each group will be given handouts (with texts and pictures/diagrams—samples of these pictures are
diagrams for each group to discuss.
shown below) with the help of its leader and distribute them to his/her group mates. The handouts • For this part, provide a rubric for the
contain information about cellular respiration. Other helpful tools such as biology textbook, Internet presentation that each group has to
can be used to facilitate their learning of the topic. make.
• Writing the definitions of the terms can
3. All the members in each group will be given enough time to read over their assigned topic for them help your students better understand
to become familiar with it. the concept.
4. From the “jigsaw group” previously formed, the so-called “expert group” will then be formed. • Glycolysis – means “sugar-
splitting” that occurs in the
Those assigned in glycolysis from each group will be grouped as “expert group” in glycolysis. The
cytosol of the cell. It does not
same procedure will be done to preparatory reaction, citric acid cycle and electron transport chain require oxygen to breakdown
— “expert groups” will be formed from these remaining topics. glucose into pyruvate.
• Krebs cycle – completes the
5. These “expert groups” will be given enough time to discuss the main points of their assigned topic
metabolic breakdown of glucose
and to rehearse for the presentation. to carbon dioxide and produces
6. After a certain amount of time, each student from the “expert group” will go back to his/her 2 ATP.
• Oxidative phosphorylation – a
“jigsaw group”.
process occurring in
7. Each member from the “jigsaw group” will this time begin to present his/her topic to the whole mitochondria and accounts for
class. majority of the ATP production.
• Electron Transport Chain –
contains the chain members
(carrier and protein complexes,
ATP synthase complex and ATP
channel protein. These
membrane proteins shuttle
electrons during the redox
reactions. The electrons will be
used to produce ATP by
chemiosmosis.
• NADH and FADH2 – these are
electron acceptor molecules that
contain high-energy electrons.
They transport the electrons to
ETC to produce many more
ATPs by oxidative
phosphorylations.
• ATP synthase – is an enzyme
that is responsible for the great
production of ATPs. This happens
when it uses the energy coming
from H+ ions to
bind ADP and phosphate group
together to produce ATP.
Teacher Tip
The diagram on the left shows the total
energy produced from the complete
breakdown of glucose by aerobic
respiration.
160
PART II
People Hunt
1. Prepare four sets of paper strips. Set A contains the four stages of cellular respiration. Set B contains the summary for each stage. Set C
contains starting materials for each stage. Set D contains end products for each stage.
2. Twelve students will be asked to volunteer. Randomly, each of these volunteers will be given strips of paper
(NOTE: tell them not to read yet the information written on the strip of paper).
3.Student-volunteers will be asked to scatter around the room. After this, instruct them that there are four stages of cellular respiration (please
refer back to the procedure number 1). The student-volunteers will be given time to find their group mates correctly for each specific stage
based on the paper strip(s) they are holding.
4. Tell each group for each stage to line up at the four corners of the room (north, south, east, west side of the room) and check if each
member has found their group mates correctly.
1. Glycolysis (in cytosol) Series of reactions in which glucose is degraded to pyruvate; net Glucose, ATP, NAD+, Pi Pyruvate, ATP, NADH
profit of 2 ATPs; hydrogen atoms are transferred to carriers; can
proceed anaerobically
2. Formation of acetyl CoA Pyruvate is degraded and combined with coenzyme A to form Pyruvate, coenzyme A, Acetyl CoA, CO2,
(in mitochondria) acetyl CoA; hydrogen atoms are transferred to carriers; CO2 is NAD+ NADH
released
3. Citric acid cycle (in Series of reactions in which the acetyl portion of acetyl CoA is Acetyl CoA, H2O, NAD+, CO2, NADH, FADH2,
mitochondria) degraded to CO2; hydrogen atoms are transferred to carriers; ATP FAD, ADP, Pi ATP
is synthesized
4. Electron transport and Chain of several electron transport molecules; electrons are passed NADH, FADH2, O2, ADP, Pi ATP, H2O, NAD+, FAD
chemiosmosis (in along chain; released energy is used to form a proton gradient; ATP
mitochondria) is synthesized as protons diffuse down the gradient; oxygen is final
electron acceptor
Applying Knowledge of Biochemical Pathways
As scientists have developed a better understanding of the processes of aerobic cellular respiration and anaerobic cellular respiration, several
practical applications of this knowledge have developed:
• Although for centuries people have fermented beverages such as beer and wine, they have often plagued by sour products that were
undrinkable. Once people understood that there were yeasts that produce alcohol under anaerobic conditions and bacteria that converted
alcohol to acetic acid under aerobic conditions, it was a simple task to prevent acetic acid production by preventing oxygen from getting to
the fermenting mixture.
• When it was discovered that the bacterium that causes gas gangrene uses anaerobic respiration and is, in fact, poisoned by the presence of
oxygen, various oxygen therapies were developed to help cure patients with gangrene. Some persons with gangrene are placed in
hyperbaric chambers, with high oxygen levels under high pressure. In other patients, only the affected part of the body is enclosed. Under
such conditions, the gangrene-causing bacteria die or are inhibited.
• Spoilage, or putrefaction, is the anaerobic respiration of proteins with the release of nitrogen and sulfur-containing organic compounds as
products. Protein fermentation by the bacterium Clostridium produces foul-smelling chemicals such as putrescine, cadavarine, hydrogen
sulfide, and methyl mercaptan. Clostridium perfringens and C. sporogenes are the two anaerobic bacteria associated with the disease gas
gangrene. A gangrenous wound is a foul-smelling infection resulting from the fermentation activities of those two bacteria.
• Because many disease-causing organisms are prokaryotic and have somewhat different pathways and enzymes than do eukaryotic
organisms, it is possible to develop molecules, antibiotics that selectively interfere with the enzymes of prokaryotes without affecting
eukaryotes, such as us humans.
• When physicians recognized that the breakdown of fats releases ketone bodies, they were able to diagnose diseases such as diabetes and
anorexia more easily, because people with these illnesses have bad breath.
• In starvation and severe diabetes mellitus, the body does not metabolize sugars properly, and it shifts to using fats as its main source of
energy. When this occurs, the Krebs cycle is unable to perform as efficiently and the acetyl CoA does not move into the mitochondria. It
accumulates in the blood. To handle this problem, the liver converts acetyl CoA to ketone bodies (e.g., acetoacetic acid). As ketone bodies
accumulate in the blood, the pH decreases and the person experiences ketosis, or ketoacidosis, with symptoms such as an increased
breathing rate; in untreated cases, it can lead to depression of the central nervous system, coma, and death.
Adapted from: Enger, Eldon D. et al., Concepts in Biology 14th edition. USA: McGraw-Hill
162
EVALUATION (60 MINS)
Directions: Complete the tables below by filling-in the necessary information for aerobic respiration. Table 1: Inputs and
Teacher tip
Table 1 Suggested Answers:
Outputs of Glycosis
Glycolysis outputs:
• 2 pyruvate
• 2 NADH
Glycosis
• 2 ADP
• 4 ATP total
Inputs Outputs
• 2 ATP net gain
1. Glucose 1
Table 2 Suggested Answers: Citric
2. 2 NAD+ 2
End Products
G: Pyruvate, ATP, NADH
F: Acetyl CoA, CO2, NADH K:
CO2, NADH, FADH2, ATP E:
ATP, H2O, NAD+, FAD
164
3) Motivation
questions for the students to think about
MOTIVATION (5 MINS)
Show a metabolic pool concept to the class and ask the following questions:
1. What are the three kinds of food that provide the building blocks for the cells, and that all can
provide energy?
2. What are the basic metabolic pathways organisms use to extract energy from carbohydrates in
aerobic respiration? What about for proteins and fats? Are the pathways the same or not?
3. To which pathway do glycerol and fatty acids of fat enter?
Suggested Answers:
1. Carbohydrates, proteins, and fats.
2. Glycolysis, Krebs cycle, electron transport chain—for carbohydrates, proteins and fats. The
metabolic pathways for these three kinds of food are the same except that for proteins and fats,
there are additional steps to get fats and proteins ready to enter the specific pathway as shown in
the diagram.
3. Glycerol enters glycolysis; fatty acids enter preparatory reaction.
166
INSTRUCTION/DELIVERY (15 MINS)
Directions: Tabulate and explain the advantages and disadvantages of fermentation, anaerobic respiration and aerobic respiration. Show their
similarities and differences.
Procedure:
1. Form five groups. Each group has an assigned topic to work on. The following groups are as follows:
• GROUP 1: To work on the differences among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can
as long as the description written fits for the particular organism.
• GROUP 2: To work on the similarities among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can
as long as the description written fits for the particular organism.
• GROUP 3: To work on and explain the advantages and disadvantages of aerobic respiration.
• GROUP 4: To work on and explain the advantages and disadvantages of anaerobic respiration.
• GROUP 5: To work on and explain the advantages and disadvantages of fermentation.
2. Show to the class a sample table on how you want them to display, outline and report the information to the whole class.
3. Tell them to prepare Manila papers, marker, or any visual materials.
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Differences Similarity
Suggested Answers:
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Table 2: Activity: Advantages and Disadvantages of Aerobic Respiration, Anaerobic Respiration and Fermentation
Differences Similarity
Directions: Compare aerobic respiration, anaerobic respiration and fermentation in terms of the following factors
listed in the first column.
170
Suggested Answers:
172
Modified Natural Fermentation Method
ENRICHMENT (5 MINS)
Teacher Tip:
Activity Title: Vinegar Making This can be done at home as group
assignment. Just give your students
precautionary measures. Instructions can be
Materials needed: given for five minutes. Tell them to
document their output and submit it via
YouTube or Facebook.
9 cups of coconut water, 2 cups of brown sugar, ½ teaspoon yeast, 2 clean cheesecloth, transparent
Vinegar is a sour-tasting condiment and
bottles for transferring the mixture, gas stove, rubber bands, cooking pan, funnel, 2 cups of mother
preservative. It can be prepared by two
vinegar, jar(s) spoon for mixing successive microbial processes. The first
phase is done through alcoholic
fermentation by a eukaryotic organism
Procedure: called yeast. The second phase is by
oxidation of alcohol by a prokaryotic
organism called Acetobacter aceti. This
SET A: Preparation and alcoholic fermentation bacterium is responsible for converting the
1. Using cheesecloth, filter the coconut water and place it a clean cooking pan. Then add 2 cups of alcohol in wine to acetic acid or vinegar.
Since coconut is abundant in our country,
brown sugar. Mix thoroughly using a spoon until the sugar crystals are dissolved completely.
use this example to show the principle of
2. Heat the mixture at low fire for 20 minutes. As you do this, do not cover the cooking pan and do fermentation process involving
not boil the mixture. After 20 minutes, let the mixture cool for 30 minutes to 1 hour. microorganisms and the series of reactions
that take place as coconut water is
3. Add ½ teaspoon of yeast. Mix very well. Afterwards, transfer the mixture to clean transparent converted into vinegar.
174
4. bottle(s). Cover the bottle(s) with cheesecloth. The small pores in the cheesecloth will allow the gas from inside the bottle to exit.
5. Place the mixture in a safe place to allow the process of fermentation.
Note: From the day you added yeasts to the mixture you will observe alcoholic fermentation that is characterized by the release of bubbles. The
bubbles indicate the presence of carbon dioxide. When bubbles no longer appear in the mixture, then alcoholic fermentation has ceased
already. The formation of bubbles will be observed for approximately one week. To ferment means to break the sugar in the absence of oxygen.
After one week, transfer the mixture to a jar. Then add 2 cups of mother vinegar to a jar. Cover the jar with cheesecloth to allow oxygen to enter
into the jar. Place the jar in a safe place. Wait for one month to allow acetous fermentation.
Directions: Compare and explain aerobic respiration, anaerobic respiration and fermentation in terms of the following:
1. Immediate fate of electron transfer
2. Terminal electron acceptor of electron transport chain
3. Reduced product(s) formed
4. Mechanism of ATP synthesis
Tabulate your answers. Then give at least three advantages and at one disadvantage for aerobic respiration, anaerobic respiration and
fermentation.
General Biology 1 120 MINS
Resources
Specific Learning Outcome Shown/presented on the different parts of the Teaching
At the end of the lesson, the learners shall be able to compute the number of Guide
ATPs needed or gained in photosynthesis and respiration
176
INTRODUCTION (30 MINS)
Clearly communicate learning competencies and objectives. At the end of the session, the learners shall be able to compute the number of
ATPs needed or gained in photosynthesis and respiration. Also, allow the readers to connect and/or review prerequisite knowledge. Review
structure of ATP (Adenosine Triphosphate) and how it is used as the energy currency of the cell.
During PHOTOSYNTHESIS:
• Energy from sunlight is harvested and used to drive the synthesis of glucose from CO2 and H2O. By converting the energy of sunlight to a
usable form of potential chemical energy, photosynthesis is the ultimate source of metabolic energy for all biological systems.
• Photosynthesis takes place in two distinct stages.
(A) In the light reactions, energy from sunlight drives the synthesis of ATP and NADPH, coupled to the formation of O2 from H2O.
(B) In the dark reactions (named because they do not require sunlight), the ATP and NADPH produced by the light reactions drive
glucose synthesis.
• In eukaryotic cells, both the light and dark reactions of photosynthesis occur within chloroplasts—the light reactions in the thylakoid
membrane and the dark reactions within the stroma.
Reactants C6H12O6 and 6O2 6O2 and 12H2O and light energy
Requirement of sunlight Sunlight not required; cellular respiration occurs at Can occur only in presence of sunlight
all times.
Chemical Equation (formula) 6O2 + C6H12O6 --> 6CO2 +6H2O + ATP (energy) 6CO2 + 12H2O + light --> C6H12O6 + 6O2 + 6H20
Process Production of ATP via oxidation of organic sugar The production of organic carbon (glucose and
compounds. [1] glycolosis: breaking down of starch) from inorganic carbon (carbon dioxide) with
sugars; occurs in cytoplasm [2] Krebs Cycle: occurs the use of ATP and NADPH produced in the light
in mitochondria; requires energy [3] Electron dependent reaction
Transport Chain-- in mitochondria; converts O2 to
water.
Fate of oxygen and carbon dioxide Oxygen is absorbed and carbon dioxide is Carbon dioxide is absorbed and oxygen is
released. released.
Energy required or released? Releases energy in a step wise manner as ATP Requires energy
molecules
Main function Breakdown of food. Energy release. Production of food. Energy Capture.
Chemical reaction Glucose is broken down into water and carbon Carbon dioxide and water combine in presence of
dioxide (and energy). sunlight to produce glucose and oxygen.
Stages 4 stages: Glycolysis, Linking Reaction (pyruvate 2 stages: The light dependent reaction, light
oxidation), Krebs cycle, Electron Transport Chain independent reaction. (AKA light cycle & calvin
(oxidative phosphorylation). cycle)
What powers ATP synthase H+ proton gradient across the inner mitochondria H+ gradient across thylakoid membrane into
membrane into matrix. High H+ concentration in stroma. High H+ concentration in the thylakoid
the intermembrane space. lumen
Products 6CO2 and 6H20 and energy(ATP) C6H12O6 (or G3P) and 6O2 and 6H2O
Cellular Respiration Photosynthesis
What pumps protons across the membrane Electron transport chain. Electrochemical gradient Electron transport chain
creates energy that the protons use to flow
passively synthesizing ATP.
Occurs in which organisms? Occurs in all living organisms (plants and animals). Occurs in plants, protista (algae), and some
bacteria.
Catalyst - A substance that increases the rate of No catalyst is required for respiration reaction. Reaction takes places in presence of chlorophyll.
a chemical reaction
High electron potential energy From breaking bonds From light photons.
MOTIVATION (5 MINS)
Teacher asks students “Why study photosynthesis and cellular respiration?”
Photosynthesis - Lead discussion into the importance of
1. Photosynthesis in selection of plants/trees for reforestation, agriculture and biodiversity conservation. (http://bioenergy.asu.edu/photosyn/
study.html)
2. Cellular Respiration in food production (pretzels, beer, soy sauce, pickles, vinegar, yeast-risen bread, or any other product that requires
fermentation or microbial breakdown of compounds in food), athletics (sports nutrition and event-specific training) and others.
INSTRUCTION/DELIVERY/PRACTICE (60 MINS)
Lecture on Photosynthesis and ATP Production
ATP is formed by the addition of a phosphate group to a molecule of adenosine diphosphate (ADP); or to state it in chemical terms, by the
phosphorylation of ADP. This reaction requires a substantial input of energy, much of which is captured in the bond that links the added
phosphate group to ADP. Because light energy powers this reaction in the chloroplasts, the production of ATP during photosynthesis is referred
to as photophosphorylation.
The light reaction uses the energy from photons to create ATP and NADPH, which are both forms of chemical energy used in the dark reaction
(=Calvin Cycle). Calvin Cycle, through a series of chemical reactions, takes the carbon from carbon dioxide and turns it into glucose, which is a
sugar that cells use as energy.
Carbon dioxide is a fully oxidized molecule. What that means is basically it does not have a lot of chemical energy. The Calvin Cycle turns
carbon dioxide into the much more reduced molecule, glucose, which has much more energy.
Where ATP comes into play is that it functions as a reduced molecule that provides the chemical energy that transforms the carbons in the
carbon dioxide molecules into progressively more reduced molecules until you get glucose. Thus, ATP is used to power the change from 3-
phosphoglycerate to 1,3-bisphosphoglycerate, which is then turned into 2 glyceraldehyde 3-phosphate (G3P) molecules with NADPH (an
energy source similar to ATP). One of these G3P molecules gets turned into glucose. The other one is transformed by ATP into ribulose
bisphosphate (RuBP), which then picks up carbon dioxide and the cycle begins again.
Substrate-level phosphorylation – is the formation of ATP by the direct transfer of a PO3 group to ADP.
(Source: https://quizlet.com/11951424/metabolism-final-exam-flash-cards/)
Oxidative phosphorylation – is the process that explains how molecules of FADH2 and NADH are used to make ATP. The term “oxidative” is
used because oxygen accepts an electron while the gradient made by the movement of electrons powers the creation ATP.
(Source: http://www.dbriers.com/tutorials/2012/04/substrate-level-vs-oxidative-phosphorylation/)
Other references that can be used: https://online.science.psu.edu/biol110_sandbox_8862/node/8924
http://www.neshaminy.k12.pa.us/Page/20741
180
Review Stages of Cellular Metabolism and the products produced at each stage (ATP by substrate level phosphorylation, CO2, NADH and
FADH2)
Stage of Cellular Metabolism Substrate-Level Phosphorylation Oxidative Phosphorylation through ETC Total
Glycolysis 2 2 4-6 2
Pyruvate Grooming 0 2 6
(Decarboxylation of Pyruvate)(x2)3
Subtotal 4 28-30 4
SUMMARY TABLE – Number of ATP molecules formed from 1 molecule of glucose
The amount of ATP produced is estimated from the number of protons than passes through the inner mitochondrial membrane (via the electron
acceptors of the electron transport chain (ETC) and the number of ATP produced by ATP Synthase.
1. Assumption = Each NADH will generate 3 ATPs while FADHs will generate 2 ATPs.
2. The number of ATP produced depends on the acceptor that receives the hydrogen ions and electrons from the NADH formed during
glycolysis in the cytoplasm.
3. Glycolysis results in formation of 2 molecules of pyruvic acid/pyruvate thus values are multiplied by 2.
Glycolysis
Pyruvate Processing/
Grooming
Citric Acid Cycle
Oxidative
Phosphorylation
Practice Questions
(Available at the following sites: Students are asked to watch a video and answer questions after watching the video).
Photosynthetic Electron Transport and ATP Synthesis
• https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/photosynthetic_electron_transport_and_atp_synthesis.html
182
Calvin Cycle
• https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/calvin_cycle.html
RUBRICS/ASSESSMENT GUIDE
The learners shall be Student participation Student was able to Student was able to Student was able to (1) Student was not able
able to describe the (During lecture) answer the question answer the question answer the question but to answer the question.
following: without referring to his/her without referring to his/ read from his/her notes. (2) Student read from
notes plus the follow-up her notes; Was not able notes of his/her
Compute the number
question. to answer follow up classmate..
of ATPs needed or
question.
gained in
photosynthesis and Student participation Students in the team Student listened to the Student was a passive Student was interested
respiration (During Practice) equally contributed to the discussion but participant and in other matters not
discussion and the contribution to the team contribution was related to the exercise.
answering of the table was lesser than the minimal.
provided other members
Examination Obtained 90-100% correct Obtained 70-80.99% Obtained 50-69.99% Obtained percentile
answers in the exam correct answers in the correct answers in the <50% correct answers in
exam exam the exam
Biographical Notes
FLORENCIA G. CLAVERIA, Ph.D. DAWN T. CRISOLOGO
Team Leader Team Leader
Ms. Dawn Crisologo is a Special Science Teacher at the
Dr. Florencia G. Claveria is the current Chair of the CHED Philippine Science High School-Main Campus in Diliman, Quezon
Technical Panel for Biology and Molecular Biology. She is also City and specializes in advanced topics in Ecology, Evolution and
member of the Commission’s Technical Panel for Math and Biodiversity, Anatomy, Physiology, and Methods in Science and
Science. She is currently Vice Chancellor for Academics, Technology Research. She is a member of the Asian Association
Research, and Operations at the De La Salle Araneta University. of Biology Educators, Wildlife Conservation Society of the
Philippines, and Biology Teachers Association of the Philippines.
She is a full professor at the De La Salle University-Manila Her works are included in The Philippine BIOTA Journal and
where she served as Dean of the College of Science for 6 three editions of the Science Blast textbook. Ms. Crisologo is
academic years. Dr Claveria finished her doctorate in Biological currently finishing her master’s in Environmental Science at the
Sciences at the University of Cincinnati, through a Fulbright-Hays University of the Philippines Diliman. She completed her
grant. She completed her master’s in Zoology at the Ghen State bachelor’s degree in Biology at the same university.
University, through a grant from the Government of Belgium. She
earned her bachelor’s degree in Biology at St. Louis University. CHUCKIE FER CALSADO
Her written scholarly works include contributions to academic Writer
publications such as the Philippine Textbook of Medical Mr. Chuckie Fer Calsado is Special Science Teacher IV at
Parasitology, Journal of Protozoology Research, and The Journal the Philippine Science High School Main Campus where he has
of Veterinary Medical Science. been teaching for 8 years. He is a member of biological
organisations like the Biology Teachers Association of the
Philippines, the Asian Association for Biology Education, and
Concerned Artists of the Philippines among many others. He has
published academic papers such as Implication of Students’
Cognitive Style, Personal Demographics, Values and Decision
Making in Environmental Education and the Role of Education in
the Prevention of Child Trafficking in Nepal. Mr. Calsado
finished his Master’s in Bioethics at the Monash University
and his bachelor’s degree in Biology at the University of the
Philippines DIliman.
184
AILEEN C. DELA CRUZ JANET S. ESTACION, Ph.D.
Writer Writer
Ms. Aileen Dela Cruz has been serving as the Science Dr. Janet Estacion is current Officer-in-Charge at the
Research Analyst at the Philippine Science High School - Main Institute of Marine and Environmental Science in Silliman Unive
Campus since 2004. Her academic interests range from rsity where she has been teaching for 30 years now. She headed
microbiology, food safety and nutrition, and laboratory safety and researches on marine conservation and the recovery of reefs. Her
she has been involved in trainings and conferences on the same scholarly works appeared on different publications such as the
fields of study. Her published scholarly works include series of Philippine Science Letters and the Silliman Journal. Dr. Estacion
textbooks on 21st Century Learning. Ms. Dela Cruz earned her earned her doctorate degree in Zoology at the James Cook
bachelor’s degree in Biology at the University of the Philippines University of North Queensland. She completed her master’s
Baguio. degree in Marine Biology at the University of the Philippines
Diliman and her bachelor’s degree in Biology at the Silliman
DOREEN D. DOMINGO, PH.D. University.
Writer
Dr. Doreen D. Domingo is a Professor at the Mariano MARY JANE C. FLORES, Ph.D.
Marcos State University where she teaches both in the graduate Writer
and undergraduate levels. She is currently the Chief of Alumni
Relations for the university. Dr. Domingo finished her doctorate in Dr. Mary Jane C. Flores is Assistant Professor 3 at the
Biology (magna cum laude) at St. Louis University through a College of Science in the De La Salle University where she has
research grant from CHED and the Microbial Forensics and been teaching for 20 years now. Her published works include
Biodefense Laboratory, Indiana University. She completed her researches on parasitology, climatology, and community
Doctor of Education on Educational Management, her master’s nutrition. Dr Flores has conducted and attended seminars on
degree in Education major in Biology, and her bachelor’s degree Biology in the country and abroad, including the Training on
in Biology at the Mariano Marcos State University. Dr. Domingo’s Biological Control at the US Department of Agriculture-
scholarly works were published on the International Referred Agricultural Research Service and Congress meetings on
Journal and the National Referred Journal. Parasitology. She is a two-time recipient of the Don Ramon J.
Araneta Chair in Ecology among other citations. Dr. Flores
earned her Doctorate, Master’s, and Bachelor’s degrees
in Biology at the De La Salle University.
JUSTIN RAY M. GUCE JOHN DONNIE RAMOS, Ph.D.
Writer Technical Editor
Mr. Justin Ray Guce is a Special Science Teacher I at the
Philippine Science High School Main Campus in DIliman, Quezon Dr. John Donnie Ramos is a Member of CHED’s Technical
City where he teaches for 9 years. He has served as a Trainer of Panel for Biology and Microbiology and Board Member of the
student representatives for Science Olympiad competitions and Philippine Society for Biochemistry and Molecular Biology. He is
has delivered presentations in a number of Biology workshops currently the Dean of the College of Science at the University of
and conventions. Mr Guce is a member of the Wildlife Santo Tomas where he teaches molecular biology, immunology
Conservation Society of the Philippines and the Biology Teachers and genetics, and allergology. Dr. Ramos completed
Association of the Philippines. Mr Guce is currently finishing his his doctorate in Molecular Biology at the National University of
master’s in Biology Education at the University of the Philippines Singapore. He finished his master’s degree in Biological Sciences
Diliman where he also graduated his bachelor’s degree in at the University of Santo Tomas and his bachelor’s degree in
Biology. Biology at the Philippine Normal University. Dr. Ramos
is recipient of the NAST-TWAS Prize for Young Scientist in the
Philippines in 2010, and Outstanding Young Scientist by the
NOLASCO H. SABLAN National Academy of Science and Technology in 2005.
Writer
Mr. Nolasco Sablan is Teacher III at the Parada National JOY R. JIMENA
High School and is a DepEd teacher for 11 years now. He has Copyreader
worked as resource speaker, trainer, and writer for different
institutions in the education sector, including the Ateneo de Ms. Joy Jimena is currently Planning Officer II at the
Manila University, Metrobank Foundation Inc., and the Information Management Bureau of the Department of Social
Department of Education. Mr. Nolasco Sablan earned his Welfare and Development. She also previously worked with other
master’s degree in Biology Education at the Ateneo de Manila government agencies such as the Department of National
University and completed his bachelor’s degree in Education Defense and Philippine Commission on Women, and Social
major in General Science at the Philippine Normal University. Security System. Ms. Jimena graduated at the University of the
Philippines Diliman with a degree in Public Administration.
186
RENAN U. ORTIZ
Illustrator
Mr. Renan Ortiz is a teacher and visual artist who has
collaborated in local and international art exhibitions such as the
SENSORIUM at the Ayala Museum, Populus in Singapore,
Censorship_2013 Move On Asia in South Korea, and the Triumph
of Philippine Art in New Jersey, USA. Mr. Ortiz’s solo exhibitions
include versereverse at the Republikha Art Gallery. He first
completed his bachelor’s degree in Political Science at the
University of the Philippines Manila before finishing his bachelor’s
degree in Fine Arts major in Painting at the University of the
Philippines Diliman. Mr. Ortiz is an awardee of the Cultural
Center of the Philippines’ CCP Thirteen Artists Awards in 2012.
DANIELA LOUISE B. GO
Illustrator
Ms Daniela Louise Go is a freelance illustrator and graphic
designer, specializing on graphic design, brand and campaign
design, and copywriting. She has worked as illustrator for Stache
Magazine, Philippine Daily Inquirer, and Summit Media Digital.
Ms Go is a member of organisations such as the UP Graphic and
UP Grail in which she also served as designer and illustrator. Her
works have been part of art exhibitions including Freshly Brewed,
Wanton Hypermaterialism, and Syntheses 2014: Graduate
Exhibit. Ms. Go graduated her bachelor’s degree in Fine Arts
Major in Visual Communication at the University of the Philippine
Diliman.