Bisphenol A but not Bisphenol S affects microRNAs during bovine (Bos Taurus) oocyte

maturation and early embryo development

Reem Sabry1, Angela C. Saleh1, Leanne Stalker1, Mimi Nguyen1, Jonathan LaMarre1, and Laura A. Favetta1
1
Reproductive Health and Biotechnology Laboratory, Department of Biomedical Sciences, Ontario Veterinary
College, University of Guelph, 50 Stone Rd E, Guelph, ON, N1G 2W1, Canada

Corresponding Authors: Reem Sabry (rsabry@uoguelph.ca), Laura A. Favetta (lfavetta@uoguelph.ca)

Highlights

1. Bos Taurus oocytes exposed to BPA/BPS in vitro at physiologically relevant doses

2. miR-21, -155, and -34c showed significant dysregulation in BPA-treated oocytes
3. BPS had no effect on any miRNA examined
4. BPA and BPS showed no effect on miRNA expression in embryos

Abstract

Bisphenol A (BPA) and its alternative, bisphenol S (BPS), are widespread endocrine disrupting compounds

linked in several studies to poor female fertility. Sufficient oocyte competence and subsequent embryo development

is highly dependent on oocyte maturation, an intricate process that is vulnerable to BPA. These effects as well as the

effects of its analog, BPS, have not been fully elucidated. While many detrimental effects on fertility and

development are probably due to changes in canonical gene expression, emerging evidence suggests that small

noncoding RNA, including microRNAs (miRNA), may be key participants. The aim of this work was to test the

hypothesis that abnormal expression of key miRNAs during oocyte maturation and embryo development occurs

following BPA and BPS exposure during maturation. Using qPCR, primary and mature forms of miR-21, -155,

-34c, -146a were quantified in an in vitro bovine model of matured cumulus-oocyte complexes, fertilized embryos,

and cultured cumulus cells after exposure to BPA or BPS at the LOAEL dose (0.05 mg/mL). Expression of miR-21

and miR -155 were markedly increased (P=0.02, 0.04) and miR-34c was decreased (P=0.01), after BPA treatment,

while miR-146a expression remained stable. BPS had no effect on levels of any miRNA examined, suggesting BPS

may not exert its actions through these miRNAs. Overall, this study indicates that BPA effects are likely miRNA

specific rather than a global effect on miRNA synthesis and processing mechanisms and that its analog, BPS, does

not possess the same properties required to interfere with these miRNAs during bovine oocyte maturation.

Keywords: Endocrine Disrupting Compounds (EDCs); bisphenol A; bisphenol S; bovine, oocytes; embryos;
epigenetics; microRNAs

1
 1. Introduction

Over the past several decades, the rise in industrialization was accompanied by intensification of industrial

pollutants’ leaching into the environment and, in turn, build-up of human and animal exposure to toxic chemicals.

Endocrine Disrupting Compounds (EDCs) have the ability to interfere with cellular pathways, particularly hormonal

pathways that regulate reproductive processes, and are linked to adverse health effects (Alavian-Ghavanini &

Ruegg, 2018). The most well-known EDC that is under scrutiny for its widespread use, chronic exposure, and

numerous adverse effects is a common plasticizer, known as Bisphenol A (BPA). BPA is a synthetic estrogen

agonist used to manufacture everyday products, is detected in animals and humans in almost every system, organ,

tissue, and cell, and is linked to destructive consequences in female fertility, such as diseases and cancers (Sajiki et

al., 2004, Ferris et al., 2016; Cao et al., 2018). BPA has been linked to increased primordial follicle recruitment,

decreased number of viable oocytes, and decreased antral follicular growth reviewed in Gore et al., 2015. Our group

has reported poor oocyte and embryo quality with lower cleavage and blastocyst rates as well as alterations in

chromosome alignment, sex ratios, spindle formation, apoptosis levels, and gene expression in response to BPA

treatment of in vitro produced bovine oocytes (Ferris et al., 2015; 2016). The accumulating evidence of BPA’s

disrupting effects led to limitations on the industrial uses of BPA and initiated use of possible alternatives, including

Bisphenol S (BPS). The widespread use of BPS along with subsequent incremental exposure, introduces the

growing need of investigating the similarities, in terms of mechanistic pathways and effects, to its predecessor, BPA.

The detection of BPA and BPS in bovine and human oocyte follicular fluid potentially implicates them in the

detrimental effects observed during oocyte maturation and embryo development (Ferris et al., 2016; Chao et al.,

2018).

One family of small noncoding RNA, known as microRNAs (miRNAs), are crucial post transcriptional

epigenetic regulators involved in virtually every biological system (Pais et al., 2011). In particular, the female

reproductive system is regulated by critical events where oocytes exist in a continuously developing environment

with rapidly refined gene expression levels. This provides the developing embryo with the necessary transcripts,

proteins, and nutrients at the appropriate stages of development (Coticchio et al., 2015). This unique fine-tuning of

expression suggests that regulation pathways can occur post transcriptionally, possibly through microRNAs.

Folliculogenesis, oogenesis, oocyte maturation, fertilization, zygotic cleavage, degrading maternal transcript,

implantation, and more are events that involve differential expression of unique miRNAs (Tscherner et al., 2014;

2
Gilchrist et al., 2016). These events are particularly vulnerable to disruption by environmental factors due to their

highly complex and interconnected nature.

MicroRNAs are primarily generated through a multi-step processing pathway. Briefly, they are first

transcribed into primary miRNAs (pri-miRNA) by RNA polymerase II (RNA Pol II) then processed by the complex,

DGCR8/DROSHA into precursor miRNAs (pre-miRNAs) before being exported to the cytoplasm via Exportin-5

(Ketting et al., 2011). In the cytoplasm, pre-miRNAs are cleaved by Dicer and loaded onto an Argonaute protein to

form the RNA induced silencing complex (RISC), which binds to target messenger RNA (mRNA) and most

commonly represses translation (Ketting et al., 2011). Our group has identified and characterized several miRNAs

involved in female fertility in the bovine model; including miR-21, -155, -34, and -146a, that show differential

expression in bovine ovaries and oocytes compared to somatic cells (Tscherner et al., 2014; Gilchrist et al., 2016).

microRNA-21 (miR-21) is one major miRNA studied in mammalian reproduction due to its high expression in

reproductive tissues especially in bovine oocytes and cumulus cells (Yerushalmi et al., 2018). miR-21 knockdown

studies in pigs and mice induce disruptions in meiotic maturation, cumulus cells apoptosis, and embryo

developmental arrest at the 4-8 cell stage (Han et al., 2017). miR-155 is speculated to play a role in the embryonic

genome activation (EGA) (Gilchrist et al., 2016). The miR-34 family is a group of miRNAs implicated in bovine

reproduction with roles in gametogenesis and early embryo development, such as cell cycle progression and

proliferation (Navarro et al., 2015). For this study, only miR-34c was investigated as it was previously stably

expressed in bovine oocytes (Tscherner et al., 2014). Lastly, miR-146a is enriched and stably expressed in bovine

oocytes and embryos with reported increases in expression induced by cellular stress. This implicates a potential role

in assisting oocytes and embryos adapt to stressful conditions (Xie et al., 2018).

There is evidence that EDCs are capable of exerting their effects through altering epigenetic mechanisms

including miRNA expression (Singh et al., 2012; Jacobs et al., 2017; Huang et al., 2019). However, there is a gap in

the current literature with respect to the effects of the specific EDC, BPA, on individual miRNA expression in the

context of oocyte maturation and embryo development as well as adequate comparative research to its widespread

analog, BPS. Consequently, this study explored alternative bisphenols’ mechanisms of action to better assess the

observed negative outcomes on early development, hence fertility. We tested the hypothesis that BPA and/or BPS

alter expression of specific key microRNAs (miR-21, -34c, -155, -146a) during in vitro bovine oocyte maturation

and early embryo development.

3
2. Materials & Methods

2.1 Cumulus oocyte complex (COC) collection, in vitro maturation, and treatment exposure

Bovine ovaries (Bos Taurus) were collected from a local abattoir (Cargill Meat Solutions, Guelph, ON,

Canada). Ovaries were transported at a temperature between 34-36°C and washed with sterile saline solution. COCs

were aspirated from follicles using vacuum pump and collected into a tube containing 1 mL of oocyte collection

media comprised of 1M HEPES-buffered Ham's F-10 media (Sigma-Aldrich) supplemented with 2% steer serum

(Cansera), Heparin (2 IU/mL) (Sigma-Aldrich), Sodium Bicarbonate, and Penicillin/Streptomycin (1%) (Gibco).

COCs were placed in groups of 40 under mineral oil (Sigma-Aldrich) in 80 μL drops of in vitro HEPES buffered

TCM199 (Sigma-Aldrich) maturation media (S-IVM) containing 2% steer serum and sodium pyruvate (Sigma-

Aldrich) and supplemented with 10 μL LH (1 μg/mL-NIH), 12.6 μL FSH (0.5 μg/mL-Follitropin V), 10 μL

Estradiol (1 μg/mL-Sigma-Aldrich), and 800 μL Fetal Bovine Serum (FBS) (10%-Gibco). Treatment groups were

prepared as follows: 2.5 mL of S-IVM (Control), 2.5 μL of 0.1% ethanol in 2.5 mL S-IVM (Vehicle), 2.5 L of

BPA (Sigma-Aldrich) dissolved in 0.1% ethanol in 2.5 mL S-IVM (BPA-0.05 mg/mL), and 2.5 L of BPS (Sigma-

Aldrich) dissolved in 0.1% ethanol in 2.5 mL S-IVM (BPS-0.05 mg/mL). COCs were matured for 24 hours in a

humidified atmosphere at 38.5°C and 5% CO2. After 24 h, 40 COCs were either frozen in liquid nitrogen, denuded

and frozen separately, or fertilized. After maturation and prior to collection, cells from the different groups were

imaged using an EVOS - Digital Inverted Microscope provided in the Reproductive Health and Biotechnology Lab

(RHBL) at the OVC, University of Guelph, Guelph, ON, CA.

2.2 In vitro embryo production and assessments of developmental parameters

After 24 hours of maturation, in vitro COCs were washed and fertilized in groups of 20 under oil in 80 μL

drops of fertilization media supplemented with 20 μg/mL heparin sodium salt (Sigma-Aldrich), and 0.96 μg/mL

albumin from bovine serum (BSA) (Sigma-Aldrich). All COCs in this study were fertilized using frozen-thawed

Bos taurus semen (Semex, Guelph, ON) from the same bull to minimize potential sources of variation. The best

quality spermatozoa were selected using a swim up method and COCs were fertilized at a concentration of 1 x10^6

sperm cells/mL/drop. 18 hours post fertilization, presumptive zygotes (PZ) were stripped using mechanical

disruption via a micropipette and cultured in 30 μL drops of Synthetic Oviduct Fluid (Caisson Labs) supplemented

with 15% BSA, 88.6 μg/mL sodium pyruvate, 2% non-essential amino acids (Sigma-Aldrich), 1% essential amino

acids (Sigma-Aldrich), 0.5% gentamicin (Sigma-Aldrich), and 2% serum while incubated at 38.5°C in 5% O2. Early

4
embryos were collected at three developmental stages: pools of 40 2-4 cell stage embryos collected at 45 hours post

fertilization, pools of 20 8-16 cell stage embryos collected at 80 hours post fertilization, and pools of 5 blastocysts

collected at day-8 post fertilization. Lastly, cleavage and blastocyst rates were calculated 48 hours and 8 days,

respectively, post fertilization by determining the number of cleaved zygotes and blastocyst formed against the total

number of oocytes fertilized.

2.3 Cumulus cell collection and cell culture

COCs were aspirated from follicles using the same methods as above. Approximately 100-200 COCs were

stripped of their cumulus cells using mechanical disruptions via a micropipette. Cumulus cells were placed in 15 mL

conical tubes containing 8 mL of 1X Dulbecco's Modified Eagle Medium (DMEM) (Gibco), glutamine (2 mM)

(Sigma-Aldrich) and penicillin/streptomycin (1%). Cells were resuspended in DMEM supplemented with 20% FBS,

plated on a T25 flask (Corning), and cultured at 38.5°C in 5% CO2 for 6-7 days with media replacement every 48

hours until no empty patches are observed. At 100% confluency, the cells were passaged twice, split at passage 2

into 4 flasks using DMEM +10% FBS, and incubated. After 12 hours, the cells were serum restricted with DMEM

supplemented with 0.1% FBS. 12 hours post serum restriction, flasks were randomly assigned to a group and treated

using the same doses and groups as above, but under different media conditions: DMEM + 0.1% FBS (Control),

0.1% ethanol in DMEM + 0.1% FBS (Vehicle), BPA in DMEM + 0.1% FBS (BPA-0.05 mg/mL), and BPS in

DMEM + 0.1% FBS (BPS-0.05 mg/mL). 24 hours after treatment, cells were trypsinized, washed in PBS/PVA,

counted, and collected in liquid nitrogen. After treatment and prior to collection, cells from the different groups were

imaged using an EVOS - Digital Inverted Microscope in the Reproductive Health and Biotechnology Lab (RHBL)

at the OVC, University of Guelph, Guelph, ON, CA.

2.4 Cell count and viability assay

All cells were counted using the Bio-Rad TC10 Automated Cell Counter with disposable counting slides.

Cell counts were measured using the trypan exclusion assay; equal parts of cell suspension were combined with

trypan blue (Gibco). Cells were mixed, pipetted on both sides of an automated cell slide counter, and counted within

5 minutes due to the toxicity of trypan blue. All counts were performed on each replicate in duplicates then

averaged. A WST-1 assay was employed to assess viability, proliferation, and cytotoxicity. Cumulus cells were

plated onto 96 well plates at a density of 5000 cells/well in DMEM + 10% FBS and allowed to adhere for 12 h.

Cells were then serum restricted using DMEM supplemented with 0.1% FBS. 12 h post serum restriction, cells were

5
treated using the same doses and groups as above for 24 h. Viability was measured at three time points to determine

the effects of both serum restricting and bisphenol treatment on cell survival. 10 L of viability reagent, WST-1

(Roche) was added to cells before serum restricting, after serum restricting (also represents “before treatment”

viability), and lastly, after 24 h after treatment. Absorbance was measured at an optical density of 450 nm using a

Universal Microplate Reader EL800 (Bio-Tek Instruments, Inc.) after a 4 h incubation. Wells containing media but

no cells were included as a blank in order to correct absorbances against background readings of base levels. All

readings were performed on at least three biological replicates in technical triplicates then averaged.

2.5 Cumulus Cell Marker

In order to confirm the identities of cells in culture, Passage 0 cells were brought to confluence then snap

frozen for RNA extraction. mRNA was reverse transcribed then quantified using qPCR with gene specific primers to

quantify genes exclusively expressed in cumulus cells. Follicle Stimulating Hormone Receptor (FSHR) was used as

a cumulus cell marker and 17α-monooxygenase (CYP17A1) was used as a thecal cell marker (Liu et al., 2015),

taking into account the potential for minor theca cell growth within our in vitro culture. Expression was normalized

against GAPDH and PPIA followed by statistical analysis to determine the proportion of cumulus cells to theca

cells.

2.6 RNA isolation and cDNA synthesis

Total RNA (containing mRNA, primary, and mature miRNAs) was isolated using the miRNeasy Micro Kit

(Qiagen, Toronto, ON) according to the manufacturer's protocol. RNA was isolated from three biological replicates

consisting of pools of 40 COCs, 40 denuded oocytes and their corresponding cumulus cells, 40 2-4 cell stage

embryos, 20 8-16 cell stage embryos, 5 day-8 blastocysts, as well as from in vitro cultured cumulus cells. RNA

concentration and quality were measured by Nanodrop 2000c (Thermo Scientific). Primary miRNAs (300 ng for

COCs and 1 μg for cumulus cells) and mature miRNAs (1 μg for COCs and 0.5 μg for cumulus cells) were reverse

transcribed (RT) using qScript complementary DNA (cDNA) Supermix (Quantabio) and qScript microRNA cDNA

Synthesis kit (Quantabio), respectively. All RTs were performed using a T100 Thermal Cycler (BioRad,

Mississauga, ON). It is important to note that for denuded oocytes and early embryos, with RNA levels too low to

quantify, an identical number of cells per group was used to appropriately compare RNA expression amongst

treatments. RNA was extracted from 40 oocytes, 40 2-4 cells, 20 8-16 cells, and 5 day-8 blastocysts. For miRNAs, 7

6
μL of RNA from each group was used for reverse transcription since RNA expression in oocytes and embryos are

too low for quantification. The cDNA was diluted at a 1:4 ratio to provide enough volume for qPCR amplification.

2.7 Quantitative qPCR and Reference Gene Selection

pri-miRNAs and miRNAs expression levels of a minimum of three biological replicates comprising of four

treatment groups were quantified via Quantitative real-time PCR (qPCR) using a CFX96 Touch Real-Time PCR

Detection System (BioRad). mRNA and pri-miRNAs were amplified using SsoFast EvaGreen supermix (Biorad)

while mature miRNAs were amplified using PerfeCTa SYBR Green supermix (Quantabio). Reproducible detection

of miRNAs could not be achieved using the SsoFast EvaGreen supermix. 3 ng (1.5 ng/mL) of both pri-miRNA and

miRNA cDNA template was used for oocytes and embryos. 6 ng (3 ng/mL) of pri-miRNA cDNA template as well

as 3 ng (1.5 ng/mL) of miRNA cDNA template were used for in vitro cultured cumulus cells. All primers used in

this study were tested using standard curves via qPCR. Efficiencies were calculated and only values between 90%-

110% were accepted. Gene expression was calculated using the efficiency-corrected method (ΔΔCt). Primer

sequences and efficiencies can be found in Table 1 and Table 2. A minimum of two reference genes were used for

each data set. In bovine oocytes, Tyrosine 3- monooxygenase/tryptophan 5-monooxygenase activation protein zeta

(YWHAZ) and Beta-actin (ACTB) were used to normalize expression of pri-miRNAs as they were previously shown

to be stable reference genes according to the geNorm algorithm (Vandesompele et al., 2002). In bovine embryos,

YWHAZ and ACTB were also used to normalize pri-miRNA in 8-6 cell stage embryos and blastocysts whereas

YWHAZ and peptidylprolyl isomerase A (PPIA) were used for 2-4 cell stage embryos as these were found to be the

most stable genes using the geNorm algorithm within the qbase software. For in vitro cultured cumulus cells,

geNorm analysis revealed Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and peptidylprolyl isomerase A

(PPIA) as the two most stable reference genes and were used to normalize expression of pri-miRNAs. Also using

geNorm, reference stability was analyzed for mature miRNAs. Overall, miRNA expression was normalized to miR-

191 and miR-106a in oocytes and in in vitro cultured cumulus cells. miR-191, miR-103a, and miR-93 were used to

normalize expression in embryos. All quantification was run on at least three biological replicates in technical

triplicates.

7
 Table 1: MicroRNA primers for qPCR
MicroRNA Primer ID Accession # Sequence (5’ -3’) E (%) Source
miR-191 hsa-miR-191-5p MIMAT0000440 AACGGAATCCCAAAAGCAG 99.7
miR-106a hsa-miR-106a-5p MIMAT0000103 CGCCAAAAGTGCTTACAGTGC 92.4
hsa-miR-103a-2- Hooper, 2018
miR-103a 5p MIMAT0009196 CTTCTTTACAGTGCTGCCTTGA 96
miR-93 hsa-miR-93-5p MIMAT0000093 AAAGTGCTGTTCGTGCAGGT 100.7
miR-21 bta-miR-21-5p MIMAT0003528 TAGCTTATCAGACTGATGTTGACT 96.7 Gu et al., 2007
miR-34c bta-miR-34c MIMAT0003854 AGGCAGTGTAGTTAGCTGATTGC 99.6 Guan et al., 2017
hsa-miR-155-5p Lawless et al.,
miR-155 MIMAT0000646 TGCTAATCGTGATAGGGGTAAA 100 2014
miR-146a bta-miR-146a MIMAT0009236 TGAGAACTGAATTCCATAGGTTG 100.2 Wang et al., 2017
U6 RNU6 NR_002752.1 GCAAATTCGTGAAGCGTTCC 95.5
miR-16 hsa-miR-16-5p MIMAT0000069 CGCCATAGCAGCACGTAAAT NA Hooper, 2018
Let7a hsa-let-7a-5p MIMAT0000062 CCGAGCTGAGGTAGTAGGTTGTATA NA
Table 2: Pri-miRNA and mRNA primers for qPCR
Produc
Gene
Gene Name t size Accession # Primer Sequence sets (5’ -3’) E (%) Source
Symbol
(bp)
Tyrosine 3- monooxygenase/tryptophan
F: GCATCCCACAGACTATTTCC Sharma,
YWHAZ 5-monooxygenase activation protein 120 NM_174814.2 100.3
R: GCAAAGACAATGACAGACCA 2016
zeta
F: CCTTCCTGGGCATGGAATCCT Tscherner,
ACTB Beta-actin 186 NM_173979.3 97
R: TCTTCATTGTGCTGGGTGCC 2017
Glyceraldehyde-3-phosphate NM_001034034. F: TTCCTGGTACGACAATGAATTTG Ferris et al.,
GAPDH 153 99.8
dehydrogenase 2 R: GGAGATGGGGCAGGACTC 2016
F: TCTTGTCCATGGCAAATGCTG Sharma,
PPIA peptidylprolyl isomerase A 111 NM_178320.2 99.8
R: TTTCACCTTGCCAAAGTACCAC 2016
MF966934 F: ATGGCTGTACCACCTTGTCG Tscherner,
Pri-miR-21 primary-miR-21 192 100.1
MF966935 R: GTGCCACTAGACCTAAGGACC 2017
Pri-miR- F: TTGGCGAGGAGGATTGGAA Tscherner
primary-miR-34c NA MI0005068 NA
34c R: TCCCAAATCTTTTTACCTGGCCG et al., 2014
Pri-miR- F: GTGGGCTGTGTGCTGTTAATG Gilchrist et
primary-miR-155 113 MI0009752 98.1
155 R: TGGTTCCATGTGAATGCGTG al., 2016
F: GACCCTGATGCCTTCCAGA Hatzirodos
FSHR Follicle Stimulating Hormone Receptor 74 NM_174061 100.1
R: TGGCAAGTGCTTAATACCTGTGTT et al., 2015
F: ACCATCAGAGAAGTGCTCCGAA Hatzirodos
CYP17A1 17α-monooxygenase 115 NM_174304 99.6
R: CCACAACGTCTGTGCCTTTGT et al., 2015
2.9 Statistical analysis

GraphPad Prism 6 and SPSS statistics software were used to analyze the statistical difference amongst the

treatment groups. Each data set was tested for normality using Kolmogorov-Smirnov and Shapiro Wilk tests.

Normally distributed data sets were analyzed using One-way Analysis of Variance (ANOVA) and not normally

distributed data sets were analyzed using Kruskal-Wallis test. Differences at a two-tailed p-value<0.05 were

considered statistically significant. Data sets with a statistically significant p value were then subjected to Tukey’s

post-hoc test in order to compare differences between each treatment group. Data shown represent the mean +/-

standard error of the mean (SEM).

8
3. Results

3.1 Oocyte Morphology and Developmental Rates

The control and vehicle-treated COCs demonstrated similar morphology, with expanded cumulus cells,

while BPA-treated COCs were small and dark without any evident cumulus cells expansion (Fig. 1). BPS-treated

COCs showed slightly more cumulus cell expansion than the BPA group, however expansion remained much lower

than observed in the control and vehicle groups. Cleavage rates were calculated (Fig. 2). For control, vehicle, and

BPS groups these were not significantly different, with average rates of 76%, 71%, and 68%, respectively. However,

a significant difference (p<0.0001) was observed for the BPA-treated oocytes, with an average cleavage rate of

31%. Similar patterns were observed with blastocyst rates: control (19%), vehicle (13.6%), BPS (15.25%), and a

significant decrease (P=0.007) in the BPA group (4.4%).

Figure 1 - Oocyte morphology after 22-24 hours maturation. Control shows oocytes in IVM media alone,
vehicle shows oocytes treated with 0.1% ethanol, and BPA or BPS show oocytes treated at 0.05 mg/mL. Images
were taken using the ThermoScientific EVOS digital inverted microscope. Scale bar = 1000 m.

Figure 2 - Developmental Rates. A) Cleavage rates calculated 48 hours post fertilization and B) blastocyst rates
calculated at day-8 post fertilization. Oocytes were treated during maturation with 0.05 mg/mL BPA or BPS, 0.1%
ethanol, and control IVM media for 22-24 hours. Bars represent +/- SEM at P<0.05. (*) indicates a statistical
significance. **** P<0.000, ** P=0.007.

9
3.2 Cumulus cell morphology and cell viability

Control and vehicle-treated cumulus cell cultures showed similar polygonal morphology with regular

dimensions. BPA-treated cumulus cells appeared altered in cell morphology that were more flattened with elongated

dimensions (Fig. 3). The BPS group also showed slight flattening and elongation of cell morphology. Using trypan

blue exclusion, only the number of live cells were counted to determine cell survival. Control, vehicle, and BPS

groups had similar live cell counts, while a significant decrease (p<0.0001) in live cell counts was observed for the

BPA-treated cells (Supplemental Fig. 1). Cell viability, measured through a WST assay, showed a similar pattern

where serum restriction significantly reduced (p<0.0001) cell viability by approximately half (Supplemental Fig. 2).

Additionally, treatment did not affect cell viability in the control, vehicle, and BPS groups but was significantly

reduced (P=0.006) in the BPA group (Supplemental Fig. 2).

Figure 3 - Cumulus cell morphology after 24 hours treatment. Control shows cells in DMEM + 0.1% FBS alone,
vehicle shows cells treated with 0.1% ethanol, and BPA or BPS show cells treated at 0.05 mg/mL. Images were
taken using the ThermoScientific EVOS digital inverted microscope. Scale bar = 1000 m.

3.3 Cumulus cell marker expression

In order to verify the identity of the isolated cells we assessed the expression of FSHR, a cumulus cell

marker, and CYP17A1, a thecal cell marker (Gebremedhn et al., 2015) in the cultured cells. Expression was

quantified and normalized against GAPDH and PPIA. Relative qPCR expression revealed high and low levels of

FSHR and CYP17A1, respectively; suggesting that the cultured cells are primarily composed of cumulus cells

(Supplemental Fig. 3).

3.4 MicroRNA expression in BPA/BPS treated oocytes

miR-21 was shown to be significantly increased in COCs (P=0.02) and in cumulus cells (P=0.01) in response to

BPA treatment during oocyte maturation (Fig. 4A/G). This increase was not observed in denuded oocytes (Fig. 4D).

10
miR-34c expression was not significantly changed in either COCs or denuded oocytes (Fig. 4B/E) yet was

significantly decreased in cumulus cells (P=0.02) in response to BPA treatment (Fig. 4H). miR-155 expression was

significantly increased by BPA treatment, but only in denuded oocytes (P=0.04) (Fig. 4F) and remained unchanged

in COCs and cumulus cells (Fig. 4C/I). miR-146a expression was not significantly changed in any of the samples in

response to BPA (data not shown). Lastly, no significant changes were observed in the expression of any of the four

miRNAs in response to BPS treatment during oocyte maturation. In order to further analyze the effects of BPA and

BPS on the expression of these miRNAs, the expression of their precursors (primary miRNAs) was quantified (Fig.

5). Pri-miR-21 was also shown to be significantly increased in COCs (P=0.05) and in denuded oocytes (P=0.03) in

response to BPA treatment during oocyte maturation (Fig. 5A/B). In contrast to its mature counterpart, this increased

was not observed in cumulus cells (Fig. 5C). We were not able to consistently obtain reproducible quantification of

pri-miR-34c; this was expected since previous literature report that the primary form of miR-34c is undetectable in

bovine oocytes (Tscherner et al., 2014). Consistent with the expression of its mature counterpart, pri-miR-155

displayed a trend towards increased expression, but surprisingly only in BPA-treated denuded oocytes (P=0.07)

(Fig. 5E) and remained unchanged in COCs and cumulus cells (Fig.5D/F). Interestingly, reproducible signals for pri-

miR-155 were consistently observed in BPA-treated oocytes yet difficult to acquire in the control, vehicle, and BPS

groups. Due to the absence of significant differences in miR-146a in any group, pri-miR-146a was removed from

this study. Lastly, no significant changes were observed in the expression of either primary miRNA in response to

BPS treatment during oocyte maturation.

Figure 4 - miRNA expression in COCs, oocytes, and cumulus cells. miR-21 (A,D,G) significantly increased in
COCs (A) and in Cumulus Cells (G). miR-34c (B,E,H)significantly decreased in cumulus cells (H). miR-155
(C,F,I) significantly increased in oocytes (F). All samples originated from COCs matured with 0.05 mg/mL BPA or
BPS, 0.1% ethanol, and control IVM media for 22-24 hours. (*) indicates a statistical significance of p<0.05. Bars
represent +/- SEM at P<0.05.

11
Figure 5 - Primary miRNA expression in oocytes. pri-miR-21 (A, B, C) was increased in BPA-treated A) COCs
and B) denuded oocytes but not in C) cumulus cells. Pri-miR-155 (D, E, F) was unaffected in D) COCs, E) denuded
oocytes, and F) Cumulus cells. (*) indicates a statistical significance of p<0.05. Bars represent +/- SEM at P<0.05.

3.5 MicroRNA expression in BPA/BPS treated embryos

To determine the effects of BPA and BPS on miRNA expression in the period around the maternal to

embryonic genome transition (MET), three developmental stages were examined: before the MET (2-4 cell stage),

during the MET (8-16 cell stage), and after the MET (Day-8 Blastocysts).. The majority of the results indicate no

significant differences in microRNA expression in response to BPA or BPS treatment of zygotes at the 2-4 cell stage

and the day-8 blastocyst stage (Supplemental Fig. 4,5). The one exception to this was observed in the altered

expression of miR-34c in 8-16 cell stage embryos. miR-34c was significantly increased in 8-16 cell stage embryos

(P=0.01) that originated from oocytes treated with BPA during maturation (Fig. 6B). Similar to the oocytes, no

significant changes were observed in the expression of any of the four miRNAs in response to BPS treatment. Both

pri-miR-21 and pri-miR-155 remained unaffected in 2-4 cell and 8-16 cell embryos from oocytes treated with BPA

or BPS (Supplemental Fig. 6). No consistently expressed pri-miRNAs were detectable at these stages which was not

surprising as transcriptional activity is known to be extremely low in this developmental window (De La Fuente et

al., 2004)

12
Figure 6 - miRNA expression in 8-16 cell stage embryos. A) miR-21 (n=5) B) miR-34c and C) miR-155 (n=3)
expression in 8-16 cell stage embryos from oocytes matured with 0.05 mg/mL BPA or BPS, 0.1% ethanol, and
control IVM media for 22-24 hours. (*) indicates a statistical significance of p<0.05. Bars represent +/- SEM at
P<0.05.

3.6 MicroRNA expression in cultured cumulus cells treated with BPA/BPS

miR-21 and miR-155 expression was shown to be significantly increased in cumulus cells (P=0.04) in

response to BPA treatment (Fig. 7A/C). This increase was not observed in response to BPS treatment. miR-34c and

miR-146a were not significantly altered in either BPA or BPS -treated cumulus cells (data not shown). Pri-miR-34c

and pri-miR-146a were also excluded from this study due to lack of detection and lack of significant changes,

respectively. Pri-miR-21 showed no significant changes in expression after BPA and BPS treatment (Fig. 7B). In

accordance with its mature counterpart, pri-miR-155 was significantly overexpressed in BPA-treated cumulus cells

(P=0.02) and remained unchanged in BPS-treated cumulus cells (Fig. 7D).

13
Figure 7 – Primary and mature miRNA expression in cultured Cumulus Cells. miR-21 (A) and pri-miR-21 (B)
as well as miR-155 (C) and pri-miR-155 (D) expression in serum restricted cumulus cells treated with 0.05 mg/mL
BPA or BPS, 0.1% ethanol, and control DMEM media for 24 hours. (*) indicates a statistical significance of p<0.05.
Bars represent +/- SEM at P<0.05.

4. Discussion

The present study identifies dynamic changes in miRNA expression after BPA or BPS exposure at the

current reported LOAEL dose (0.05 mg/mL), a relevant experimental dose previously determined by our group

through a dose dependant study on bovine developmental parameters (Saleh & Favetta, 2019), during a critical

window of development: oocyte maturation. This study is strengthened by the use of an environmentally and

physiologically relevant dose level, the use of validated methods for miRNA analysis, and sufficient statistical

power.

Morphological assessments of in vitro matured COCs (IVM) indicate that both BPA and BPS severely and

moderately disrupted cumulus cell expansion, respectively, compared to the control and vehicle groups. This is

supported by the literature, where BPA and BPS induced disruptions of pig oocytes expansion and was an initial

indicator of poor oocyte competence (Nevoral et al., 2015; Zalmanova et al., 2017; Park et al., 2018). Furthermore,

developmental rates were significantly decreased in BPA-treated oocytes with lower cleavage and blastocyst rates

14
and unexpectedly, BPS-treated oocytes exhibited rates similar to the control and vehicle. One plausible reason is the

theory that BPA-induced cell stress can lead to irregular early embryo development (Takai et al., 2001), which has

been associated with abnormalities in embryonic developmental competence (Burruel et al., 2014). Lack of observed

effects of BPS exposure on the developmental rates do not necessarily mean there are no underlying effects on

development.

Bovine cumulus cell lines treated with BPA or BPS also exhibited extensive changes in cell morphology

with larger flatter cytoplasm and an increase in thin cytoplasmic extensions. The significance of changes in cell

shape after EDC exposure remains to be confirmed, however, previous studies have clearly documented a

correlation between cell shape and function in granulosa cells (Lawrence et al., 1979; Hue et al., 2001; Da Silva-

Buttkus et al., 2008). Furthermore, BPA treatment at the LOAEL dose effectively suppressed the survival of

cumulus cells (Supplemental Fig. 2) also reported by Xu et al. (2002) in murine granulosa cells. This decrease in

survival is likely the result of increased apoptosis, since this is one adverse effect of BPA previously observed by

our group: Ferris et al. described a significant increase in apoptotic rates in bovine oocytes exposed to BPA (Ferris

et al., 2016).

Growing evidence of miRNA roles in reproduction (Assou et al., 2013) along with reports of BPA altering

microRNA expression, provided the rationale to investigate the possible link between alterations in miRNAs and

BPA effects on development. To test this, four microRNAs of interest (miR-21, -155, -34c, and -146a) were

investigated and quantified in bovine COCs, oocytes, cumulus cells, embryos, and in vitro cultured cumulus cells

exposed to BPA or BPS.

miR-21 is highly expressed in bovine oocytes and cumulus cells and is generally recognized as an

antiapoptotic factor that plays an important role in cell survival by inhibiting apoptotic genes (Zhang et al., 2013).

Our current finding that BPA increases miR-21, an antiapoptotic gene does not align with previous data showing a

BPA-dependent increase in the expression of bovine apoptotic genes in oocytes and embryos (Ferris et al., 2016).

However, it may reflect unsuccessful cellular responses to suppress apoptosis that have been induced by BPA

through other pathways. Induction of apoptotic genes in response to BPA is not likely sufficiently modulated by

miR-21 to counteract the cellular mechanisms that drive increased apoptosis.

BPA-induced increases of an antiapoptotic gene that is stably expressed and plays roles in cell survival

might seem counterintuitive, however, other potential factors must be considered. Firstly, apoptosis is necessary in

15
certain instances for a cell to prevent tumor growth and for embryo survival by removing damaged cells (Betts &

King, 2001). Secondly, studies have reported that irregularly high expression of miR-21 is correlated with poor

fertility, poor ovarian response, and inflammatory diseases (Carletti et al., 2010; Han et al., 2017). Additionally,

cattle with abnormally high levels of miR-21 have larger atretic follicles (Carletti et al., 2010; Han et al., 2017).

Atretic follicles must undergo apoptosis for normal development: previous studies show that BPA exposure is

correlated with an increase in atretic follicle numbers (Gore et al., 2015). Thus, this study suggests a direct effect of

BPA on female fertility potentially regulated by miRNAs; BPA-induced increase in miR-21 may focally (within

specific follicles) contribute to the increased atretic phenotype observed in BPA-treated follicles. A study by

Tilghman et al. (2012) found increased expression of miR-21 after BPA exposure to cells lacking ERα receptor.

This suggests that miR-21 overexpression in BPA-treated oocytes can occur in an ERα-independent manner.

The differential expression of miR-21 compared to its primary form is also a relevant observation that

further supports the intricacy of miRNA regulation: both forms were significantly increased in BPA-treated COCs.

The primary form was overexpressed in BPA-treated oocytes, while the mature form was overexpressed in BPA-

treated cumulus cells. Both mature and primary microRNAs are among the molecules that are potentially

transported to the oocyte during maturation, allowing us to further understand the movement of miRNAs between

cells (Macaulay et al., 2016; Tscherner et al., 2017). Previous work by Tscherner (2017), showed induced pri-miR-

21 expression in cumulus cells in the first 7 hours of oocyte maturation with the mature form induced later at 24

hours maturation. It was speculated that pri-miR-21 is mainly transcribed in the cumulus cells and may be

transported to the oocyte in both primary and mature forms (Tscherner, 2017). Taking this into account, our findings

suggest that initial treatment with BPA at 0 hours of maturation may contribute to increased expression of pri-miR-

21 in both the cumulus cells and oocytes. Over the course of maturation, a significant fraction of the primary forms

in the cumulus cells can either be processed or transported to the oocyte. This might explain elevated mature miR-21

in BPA-treated cumulus cells, as well as elevated pri-miR-21 in BPA-treated oocytes. miR-21 overexpression was

also observed in the in vitro cultured (IVC) cumulus cell model. This was expected since miR-21 is implicated in

folliculogenesis, not just oocyte maturation, and was increased in the in vitro matured (IVM) model.

The exact mechanisms by which BPA-induced miR-21 expression contribute to reproductive abnormalities

is not well understood. One possibility is through promoting proliferation, migration, and invasion by regulating and

inhibiting the tumor suppressor gene, PTEN (Meng et al., 2007). Deletion of PTEN resulted in prominent tumor

16
growth and inhibiting miR-21 resulted in complete tumor regression (Meng et al., 2007). Concurrently,

supplementing cells with PTEN reversed the effects of miR-21 confirming it as a direct target (Meng et al., 2007).

These observations, in addition to our data, suggest that the increase in miR-21 might contribute to a decrease in

PTEN and the subsequent development of reproductive cancers that have been associated with BPA exposure.

The other microRNAs investigated in this study include the mature form of miR-34c, which was

significantly decreased after BPA treatment in cumulus cells. Knockdown experiments by others have revealed

changes in the expression of known downstream targets including antiapoptotic gene B-cell lymphoma 2 (Bcl-2) in

zebrafish oocytes (Soni et al., 2013) and murine testes (Liang et al., 2012). In mouse zygotes, miR-34c inhibition

and subsequent Bcl-2 overexpression prevented the first cleavage event (Liu et al., 2012). In light of this, it may be

reasonable to conclude that the reduced cleavage observed in BPA-treated groups could be attributed, in part, to

miR-34c decrease and subsequent changes in its targets. miR-34c was the only miRNA that was significantly

changed in embryos at the 8 - 16 cell stage after BPA treatment. miR-34c not only plays an important role during

oocyte maturation but has also been shown to be involved in embryonic development, including, but not limited to,

neuronal migration and cortical morphogenesis (Veno et al., 2017). Therefore, aberrant miR-34c expression in

embryos, specifically during the embryonic genome activation, may contribute to abnormal embryo development.

miR-155 exhibits a progressive increase in expression with a marked induction at the 8 - 16 cell stage in

bovine embryos and may play important roles in degrading maternal transcripts during the embryonic genome

activation (Gilchrist et al., 2016). Our data suggest that BPA enhances the induction of pri-miR-155 transcription

resulting in premature expression at inappropriate developmental stages contributing to poor fertility. Our data also

show increased expression of the mature form in BPA-treated oocytes with increased abundance of predecessors as

a possible contributing factor to increased miRNA processing. The significant increase in both pri-miR-155 and

miR-155 in BPA-treated IVC cumulus cells, combined with increased expression in BPA-treated IVM oocytes is

highly suggestive of active transport of miR-155 from the cumulus cells to the oocytes during maturation. This

supports the roles and regulation of miR-155 described in the literature and further strengthens the possible roles of

miR-155 as an important regulator of oocyte maturation.

MicroRNA-146a was the only miRNA that remained unaffected in all sample types (COCs, oocytes,

cumulus cells) in response to both BPA and BPS treatment during oocyte maturation. The lack of bisphenols’ effect

on miRNA146a is of significant interest, supporting our idea that the effects of BPA on microRNAs are unlikely a

17
global effect that alters all microRNAs, but rather are miRNA specific. This is supported by no reported effect of

BPA on microRNA processing enzymes, Drosha and Dicer (Veiga Lopez et al., 2013). BPA is likely primarily

interfering with individual microRNAs at the transcriptional level with minor effects on miRNA processing (Veiga

Lopez et al., 2013; Tilghman et al., 2012; Avissar-Whiting et al., 2010).

The absence of any change in miRNA expression following BPS exposure suggests that the effects reported

on oocyte maturation in response to this BPA analog are not likely to be mediated through miRNA interactions. This

is interesting because here we show potential epigenetic networks (miRNAs) that may be BPS-resistant, supporting

to some extent its use as an alternative to BPA in manufacturing use. However, these data are not sufficient to

declare BPS as a ‘safer’ alternative. In addition, there is literature reporting negative effects on female reproduction

induced by BPS in a pig experimental model (Zalmanova et al., 2017). In the present studies, no significant changes

were observed in the expression of any of the four miRNAs in response to BPS treatment in oocytes or COCs,

adding to the divergence between the two bisphenols within the scope of this research. Furthermore, our study

observed no changes in cell count and microRNA expression for all genes in BPS-treated cumulus cells. Despite the

lack of differences in cell counts between BPS-treated cells and controls, the gross observation of reduced flask

confluency and/or slower growth rate suggests that BPS also has some effect on cell viability. The unchanged cell

counts are not in agreement with the visual observation of confluency. One plausible explanation for this is the

possibility of stratified culture growth versus a single monolayer present in culture (Hendriks et al., 2006). This

would imply that true cell numbers could be higher than they appear under a microscope. Another explanation is that

BPS simply reduces cell proliferation instead of inducing cell death, as its predecessor, BPS. There are several

studies indicating that bisphenols can reduce cell proliferation resulting in a reduction in confluency (Kidani et al.,

2017). Alternatively, cell counts do complement the effects observed in the IVM developmental rates. In a recent

study by Campen et al. (2019), an identical result of no effect of BPS on cell count of in vitro cultured bovine

granulosa cells was reported. Despite this, interference of BPS with another aspect of development, the alteration of

estradiol synthesis was noted (Campen et al., 2019).

In this study we conclude that BPS could be mediating its effects through other microRNAs, other non-

coding RNAs, other epigenetic mechanisms, or independent of direct epigenetic alterations. Research on BPS is still

in its infancy: the exact mechanisms of action of BPS remain to be elucidated and additional research is required

before an appropriate decision is made on the safety of this chemical compared to its analog, BPA.

18
 5. Conclusions

This study identifies a number of significant changes in miRNA expression in BPA-treated oocytes and

cumulus cells in vitro. The mechanisms behind the observed BPA-induced changes in miRNA levels and the direct

consequences of those changes remain potentially fruitful areas of future study. We observed that BPA can

differentially alter miRNA levels and that these changes are miRNA- specific, cell-specific, and stage-specific. BPA

can potentially act through ER-dependent pathways, which could explain, in part, the transcriptional differences

observed. Alternatively, differences in the levels of miRNAs and their precursors suggest modes of action for BPA

that are independent of transcription. This raises additional questions such as how BPA is affecting the transcription

machinery versus the processing machinery and how this contributes to the magnitude of the observed effects.

The many potential specific cellular consequences of changes in miRNA expression reported here are not

likely to be easily elucidated, since miRNAs do not regulate expression in an ‘all-or-nothing’ manner, but rather

participate in fine-tuning translation levels to adjust expression requirements of a cell at a particular moment or in a

specific state. This suggests that both BPA-induced alterations in miRNA levels and subsequent miRNA-mediated

effects could be differently regulated over a range of activity (and concentration) levels as opposed to simply

exhibiting increased or decreased expression. Both BPA and microRNAs are likely exerting subtle effects in order to

regulate expression; which supports the possibility that BPA may in fact act, in part, through microRNA-mediated

pathways.

6. Conflict of Interest

The authors declare they have no conflicts of interest that could have influenced the work reported in this paper.

7. Acknowledgments:

The authors wish to thank Dr. Monica Antenos, Elizabeth St. John, Ed Reyes, and Allison MacKay for excellent

technical assistance, the Thomas Koch lab for permitting the use of the EVOS digital inverted microscope, and all

the members of the Reproductive Health and Biotechnology Laboratory (University of Guelph) for helpful

discussions. The authors also wish to thank statistician, Nada Hafez, for helpful guidance for running statistical

analysis. This work was supported by the Natural Sciences and Engineering Research Council of Canada (NSERC)

[Grant #401511, 2019], the Ontario Veterinary College (OVC) Scholarship and an Ontario Graduate Scholarship

(OGS) and the Department of Biomedical Sciences at the University of Guelph.

19
References

1. Pais, H., Moxon, S., Dalmay, T., & Moulton, V. (2011). Small RNA discovery and
characterisation in eukaryotes using high-throughput approaches. Advances in Experimental
Medicine and Biology, 722, 239-254. doi:10.1007/978-1-4614-0332-6_16 [doi]
2. Coticchio, G., Dal Canto, M., Mignini Renzini, M., Guglielmo, M. C., Brambillasca, F., Turchi,
D., . . . Fadini, R. (2015). Oocyte maturation: Gamete-somatic cells interactions, meiotic
resumption, cytoskeletal dynamics and cytoplasmic reorganization. Human Reproduction
Update, 21(4), 427-454. doi:10.1093/humupd/dmv011
3. Tscherner, A., Gilchrist, G., Smith, N., Blondin, P., Gillis, D., & LaMarre, J. (2014). MicroRNA-
34 family expression in bovine gametes and preimplantation embryos. Reproductive Biology and
Endocrinology, 12(1), 85. doi:10.1186/1477-7827-12-85
4. Gilchrist, G. C., Tscherner, A., Nalpathamkalam, T., Merico, D., & LaMarre, J. (2016).
MicroRNA expression during bovine oocyte maturation and fertilization. International Journal
of Molecular Sciences, 17(3), 396; 396-396. doi:10.3390/ijms17030396
5. Ketting, R. F. (2011). microRNA biogenesis and function: An overview. Advances in
Experimental Medicine and Biology, 700, 1-14. doi:10.1007/978-1-4419-7823-3_1 [doi]
6. Yerushalmi, G. M., Salmon-Divon, M., Ophir, L., Yung, Y., Baum, M., Coticchio, G., . . .
Hourvitz, A. (2018). Characterization of the miRNA regulators of the human ovulatory cascade.
Scientific Reports, 8(1), 15605; 15605-15605. doi:10.1038/s41598-018-33807-y
7. Han, X., Xue, R., Yuan, H. J., Wang, T. Y., Lin, J., Zhang, J. (2017) MicroRNA-21 plays a
pivotal role in the oocyte-secreted factor-induced suppression of cumulus cell apoptosis. Biol
Reprod. 96(6):1167-80.
8. Navarro, F., & Lieberman, J. (2015). miR-34 and p53: New insights into a complex functional
relationship. PloS One, 10(7), e0132767-e0132767. doi:10.1371/journal.pone.0132767
9. Xie, Y., Chu, A., Feng, Y., Chen, L., Shao, Y., Luo, Q., Deng, X., Wu, M., Chi, X., and Chen, Y.
(2018). MicroRNA-146a: A comprehensive indicator of inflammation and oxidative stress status
induced in the brain of chronic T2DM rats. Frontiers in Pharmacology, 9, 478-478.
doi:10.3389/fphar.2018.00478
10. Alavian-Ghavanini, A., & Ruegg, J. (2018). Understanding epigenetic effects of endocrine
disrupting chemicals: From mechanisms to novel test methods. Basic & Clinical Pharmacology &
Toxicology, 122(1), 38-45. doi:10.1111/bcpt.12878
11. Singh, S., & Li, S. S. (2012). Epigenetic effects of environmental chemicals bisphenol A and
phthalates. International Journal of Molecular Sciences, 13(8), 10143-10153.
doi:10.3390/ijms130810143 [doi]
12. Jacobs, M.N., Marczylo, E.L., Guerrero-Bosagna, C., and Ruegg, J. (2017) Marked for
Life:Epigenetic Effects of Endocrine Disrupting Chemicals. Annual Review of Environment and
Resources. 42: 105-160.
13. Huang, W., Zhao, C., Zhong, H., Zhang, S., Xia, Y., & Cai, Z. (2019). Bisphenol S induced
epigenetic and transcriptional changes in human breast cancer cell line MCF-7. Environmental
Pollution (Barking, Essex : 1987), 246, 697-703. doi:S0269-7491(18)34257-X [pii]
14. Sajiki, J., Yonekubo, J. (2004) Leaching of bisphenol A (BPA) from polycarbonate plastic to
water containing amino acids and its degradation by radical oxygen species. Chemosphere.
55(6):861-7.
15. Ferris, J., Mahboubi, K., MacLusky, N., King, W. A., & Favetta, L. A. (2016). BPA exposure
during in vitro oocyte maturation results in dose-dependent alterations to embryo development
rates, apoptosis rate, sex ratio and gene expression. Reproductive Toxicology (Elmsford, N.Y.)
16. Ferris, J., Favetta, L. A., & King, W. A. (2015). Bisphenol A exposure during oocyte maturation
in vitro results in spindle abnormalities and chromosome misalignment in bos
taurus. Cytogenetic and Genome Research, 145(1), 50-58. doi:10.1159/000381321 [doi]

20
 17. Cao, Y., Qu, X., Ming, Z., Yao, Y., and Zhang, Y. (2018) The correlation between exposure to
BPA and the decrease of the ovarian reserve. Int J Clin Exp Pathol. 11: 3375 - 3382. 2018
18. Gore, A. C., Chappell, V. A., Fenton, S. E., Flaws, J. A., Nadal, A., Prins, G. S., . . . Zoeller, R. T.
(2015). EDC-2: The endocrine society's second scientific statement on endocrine-disrupting
chemicals. Endocrine Reviews, 36(6), E1-E150. doi:10.1210/er.2015-1010 [doi]

19. Liu, X., Qiao, P., Jiang, A., Jiang, J., Han, H., Wang, L., & Ren, C. (2015). Paracrine regulation
of steroidogenesis in theca cells by granulosa cells derived from mouse preantral follicles.
BioMed Research International, 2015, 925691-925691. doi:10.1155/2015/925691
20. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., & Speleman,
F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging
of multiple internal control genes. Genome Biology, 3(7), research0034.1. doi:10.1186/gb-2002-
3-7-research0034
21. Gebremedhn, S., Salilew-Wondim, D., Ahmad, I., Sahadevan, S., Hossain, M. M., Hoelker,
M., . . . Tesfaye, D. (2015). MicroRNA expression profile in bovine granulosa cells of
preovulatory dominant and subordinate follicles during the late follicular phase of the estrous
cycle. PloS One, 10(5), e0125912-e0125912. doi:10.1371/journal.pone.0125912
22. De La Fuente, R., Viveiros, M. M., Burns, K. H., Adashi, E. Y., Matzuk, M. M., & Eppig, J. J.
(2004). Major chromatin remodeling in the germinal vesicle (GV) of mammalian oocytes is
dispensable for global transcriptional silencing but required for centromeric heterochromatin
function. Developmental Biology, 275(2), 447-458. doi:S0012-1606(04)00584-6 [pii]

23. Zalmanova, T., Hoskova, K., Nevoral, J., Adamkova, K., Kott, T., Sulc, M., . . . Petr, J. (2017).
Bisphenol S negatively affects the meotic maturation of pig oocytes. Scientific Reports, 7(1), 485-
017-00570-5. doi:10.1038/s41598-017-00570-5 [doi]
24. Park, H., Park, S., Kim, J., Yang, S., Kim, M., Jegal, H., . . . Koo, D. (2018). Melatonin improves
oocyte maturation and mitochondrial functions by reducing bisphenol A-derived superoxide in
porcine oocytes in vitro. International Journal of Molecular Sciences, 19(11), 3422.
doi:10.3390/ijms19113422
25. Nevoral, J., Orsák, M., Klein, P., Petr, J., Dvořáková, M., Weingartová, I., . . . JÃlek, F.
(2015). Cumulus cell expansion, its role in oocyte biology and perspectives of measurement: A
review. Scientia Agriculturae Bohemica, 45(4), 212-225. doi:https://doi.org/10.1515/sab-2015-
0002
26. Takai, Y., Tsutsumi, O., Ikezuki, Y., Kamei, Y., Osuga, Y., Yano, T., & Taketan, Y. (2001).
Preimplantation exposure to bisphenol A advances postnatal development. Reproductive
Toxicology (Elmsford, N.Y.), 15(1), 71-74. doi:S0890623800001192 [pii]
27. Burruel, V., Klooster, K., Barker, C. M., Pera, R. R., & Meyers, S. (2014). Abnormal early
cleavage events predict early embryo demise: Sperm oxidative stress and early abnormal
cleavage. Scientific Reports, 4, 6598. Retrieved from https://doi.org/10.1038/srep06598
28. Assou, S., Al-edani, T., Haouzi, D., Philippe, N., Lecellier, C. H., Piquemal, D., Commes, T., Ait
Ahmed, O., Dechaud, H., and Hamamah, S. (2013). MicroRNAs: New candidates for the
regulation of the human cumulus-oocyte complex. Human Reproduction (Oxford, England),
28(11), 3038-3049. doi:10.1093/humrep/det321 [doi]
29. Zhang, J., Ji, X., Zhou, D., Li, Y., Lin, J., Liu, J., . . . Cui, S. (2013). miR-143 is critical for the
formation of primordial follicles in mice. Frontiers in Bioscience (Landmark Edition), 18, 588-
597. doi:4122 [pii]
30. Avissar-Whiting, M., Veiga, K., Uhl, K., Maccani, M., Gagne, L., Moen, E., & Marsit, C. J.
(2010). Bisphenol A exposure leads to specific MicroRNA alterations in placental cells.
Reproductive Toxicology (Elmsford, N.Y.), 29(4), 401-406. doi:10.1016/j.reprotox.2010.04.004

21
 31. Tilghman, S. L., Bratton, M. R., Segar, H. C., Martin, E. C., Rhodes, L. V., Li, M., . . . Burow, M.
E. (2012). Endocrine disruptor regulation of microRNA expression in breast carcinoma cells.
PloS One, 7(3), e32754. doi:10.1371/journal.pone.0032754 [doi]
32. Betts, D. H., & King, W. A. (2001). Genetic regulation of embryo death and senescence.
Theriogenology, 55(1), 171-191. doi:S0093-691X(00)00453-2 [pii]
33. Carletti, M. Z., Fiedler, S. D. and Christenson, L. K. (2010). MicroRNA 21 blocks apoptosis in
mouse periovulatory granulosa cells. Biol Reprod 83, 286-295.
34. Macaulay, A. D., Gilbert, I., Scantland, S., Fournier, E., Ashkar, F., Bastien, A., . . . Robert, C.
(2016). Cumulus cell transcripts transit to the bovine oocyte in preparation for maturation.
Biology of Reproduction, 94(1), 16. doi:10.1095/biolreprod.114.127571 [doi]
35. Tscherner, A. (2017). MicroRNA Expression and Regulation in the Cumulus-Oocyte Complex
and Preimplantation Embryo (Doctoral dissertation). Retrieved from The Atrium Dissertations
and Theses database.
36. Soni, K., Choudhary, A., Patowary, A., Singh, A. R., Bhatia, S., Sivasubbu, S., . . . Pillai, B.
(2013). miR-34 is maternally inherited in drosophila melanogaster and danio rerio. Nucleic Acids
Research, 41(8), 4470-4480. doi:10.1093/nar/gkt139 [doi]
37. Liang, X., Zhou, D., Wei, C., Luo, H., Liu, J., Fu, R. and Cui, S. (2012). MicroRNA-34c
enhances murine male germ cell apoptosis through targeting ATF1. PLoS One 7,e33861.
38. Liu, W., Pang, R. T. K., Chiu, P. C. N., Wong, B. P. C., Lao, K., Lee, K., & Yeung, W. S. B.
(2012). Sperm-borne microRNA-34c is required for the first cleavage division in mouse.
Proceedings of the National Academy of Sciences of the United States of America, 109(2), 490-
494. doi:10.1073/pnas.1110368109
39. Peretz, J., Craig, Z. R., & Flaws, J. A. (2012). Bisphenol A inhibits follicle growth and induces
atresia in cultured mouse antral follicles independently of the genomic estrogenic pathway.
Biology of Reproduction, 87(3), 63; 63-63. doi:10.1095/biolreprod.112.101899
40. Veno, M. T., Veno, S. T., Rehberg, K., van Asperen, J. V., Clausen, B. H., Holm, I. E., . . .
Kjems, J. (2017). Cortical morphogenesis during embryonic development is regulated by miR-
34c and miR-204. Frontiers in Molecular Neuroscience, 10, 31. doi:10.3389/fnmol.2017.00031
[doi]
41. Lawrence, T. S., Ginzberg, R. D., Gilula, N. B., & Beers, W. H. (1979). Hormonally induced cell
shape changes in cultured rat ovarian granulosa cells. The Journal of Cell Biology, 80(1), 21-36.
doi:10.1083/jcb.80.1.21 [doi]
42. Hue, I., Renard, J. P., & Viebahn, C. (2001). Brachyury is expressed in gastrulating bovine
embryos well ahead of implantation. Development Genes and Evolution, 211(3), 157-159.
43. Da Silva-Buttkus, P., Jayasooriya, G. S., Mora, J. M., Mobberley, M., Ryder, T. A., Baithun,
M., . . . Hardy, K. (2008). Effect of cell shape and packing density on granulosa cell proliferation
and formation of multiple layers during early follicle development in the ovary. Journal of Cell
Science, 121(Pt 23), 3890-3900. doi:10.1242/jcs.036400 [doi]
44. Xu, J., Osuga, Y., Yano, T., Morita, Y., Tang, X., Fujiwara, T., . . . Tsutsumi, O. (2002).
Bisphenol A induces apoptosis and G2-to-M arrest of ovarian granulosa cells. Biochemical and
Biophysical Research Communications, 292(2), 456-462. doi:10.1006/bbrc.2002.6644 [doi]
45. Meng, F., Henson, R., Wehbe-Janek, H., Ghoshal, K., Jacob, S. T., & Patel, T. (2007).
MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular
cancer. Gastroenterology, 133(2), 647-658. doi:S0016-5085(07)01002-5 [pii]
46. Hendriks, J., Riesle, J., & Vanblitterswijk, C. A. (2006). Effect of stratified culture compared to
confluent culture in monolayer on proliferation and differentiation of human articular
chondrocytes. Tissue Engineering, 12(9), 2397-2405. doi:10.1089/ten.2006.12.2397 [doi]
47. Campen, ,K.A., Lavallee, ,M., & Combelles, C. (2019) The impact of bisphenol S (BPS) on
bovine granulosa and thecal cells. Reprod Domest Anim 53 (2): 450-457. Doi: 10.1111/rda.13130

22
 48. Chao, H.H., Zhang, X.F., Chen, B., Pan, B., Zhang, L.J,, Li, L., et al. (2012) Bisphenol A
exposure modifies methylation of imprinted genes in mouse oocytes via the estrogen receptor
signaling pathway. Histochem Cell Biol. 137(2):249-59.
49. Hatzirodos, N., Hummitzsch, K., Irving-Rodgers, H. F., & Rodgers, R. J. (2015). Transcriptome
comparisons identify new cell markers for theca interna and granulosa cells from small and large
antral ovarian follicles. PloS One, 10(3), e0119800. doi:10.1371/journal.pone.0119800 [doi]

50. Kidani, T., Yasuda, R., Miyawaki, J., Oshima, Y., Miura, H., & Masuno, H. (2017). Bisphenol A
inhibits cell proliferation and reduces the motile potential of murine LM8 osteosarcoma
cells. Anticancer Research, 37(4), 1711-1722. doi:37/4/1711 [pii]

51. Veiga-Lopez, A., Luense, L. J., Christenson, L. K., & Padmanabhan, V. (2013). Developmental
programming: Gestational bisphenol-A treatment alters trajectory of fetal ovarian gene
expression. Endocrinology, 154(5), 1873-1884. doi:10.1210/en.2012-2129
52. Wang, X. P., Luoreng, Z. M., Zan, L. S., Li, F., & Li, N. (2017). Bovine miR-146a regulates
inflammatory cytokines of bovine mammary epithelial cells via targeting the TRAF6
gene. Journal of Dairy Science, 100(9), 7648-7658. doi:S0022-0302(17)30638-0 [pii]
53. Lawless, N., Vegh, P., O'Farrelly, C., & Lynn, D. J. (2014). The role of microRNAs in bovine
infection and immunity. Frontiers in Immunology, 5, 611-611. doi:10.3389/fimmu.2014.00611
54. Guan, J., Long, K., Ma, J., Zhang, J., He, D., Jin, L., . . . Luo, X. (2017). Comparative analysis of
the microRNA transcriptome between yak and cattle provides insight into high-altitude
adaptation. Peerj, 5, e3959-e3959. doi:10.7717/peerj.3959
55. Gu, Z., Eleswarapu, S., & Jiang, H. (2007). Identification and characterization of microRNAs
from the bovine adipose tissue and mammary gland. FEBS Letters, 581(5), 981-988. doi:S0014-
5793(07)00131-7 [pii]
56. Hooper, A. L. (2018). MicroRNA Regulation of Ovarian Angiogenesis and Folliculogenesis in
Bovine Cystic Ovarian Disease (Master’s thesis). Retrieved from The Atrium.
57. Sharma, J. (2016). Role of Hippo Signaling Pathway in Bovine Preimplantation Embryo
Development (Master’s thesis). Retrieved from The Atrium.
58. Saleh, A., & Favetta, L. (2019). 159 effect of bisphenol A and bisphenol S on AMH and AMHR mRNA
expression during in vitro bovine oocyte maturation and early embryo development. Reproduction,
Fertility and Development, 31(1), 204-205. Retrieved from https://doi.org/10.1071/RDv31n1Ab159

23