Clement - 2012

Exposure to intimate partner violence and
children's psychological adjustment,

cognitive functioning, and social competence:
A review
Author links open overlay panelAnneHungerfordSierra K.WaitAlyssa M.FritzCaroline M.Clements
Show more
https://doi.org/10.1016/j.avb.2012.04.002 Get rights and content
Abstract
Research over the past 30 years has established that exposure to intimate partner
violence poses significant risks to children's adjustment and functioning. It is also
clear, however, that there is considerable variability in children's outcomes, and
research in the past decade has increasingly focused on understanding this variability.
This paper provides a review of recent research that examines relations between
children's exposure to intimate partner violence and their psychological adjustment,
cognitive functioning, and social competence. Emphasis is placed on studies that
examine risk and protective factors for children's functioning in the context of
exposure to intimate partner violence. In addition to highlighting strengths of recent
studies, limitations of existing research and future directions are considered.
Pathogenic SYNGAP1 Mutations Impair
Cognitive Development by Disrupting
Maturation of Dendritic Spine Synapses
Author links open overlay
panelJames P.Clement16MassimilianoAceti16Thomas K.Creson16Emin D.Ozkan1YulinShi3Nicholas J.Reish4Antoine G.Almonte4Brooke H.Miller1Brian J.Wiltgen5Courtney
A.Miller12XiangminXu3GavinRumbaugh1
Show more
https://doi.org/10.1016/j.cell.2012.08.045 Get rights and content

Under an Elsevier user license
open archive
Summary
Mutations that cause intellectual disability (ID) and autism spectrum disorder (ASD)
are commonly found in genes that encode for synaptic proteins. However, it remains
unclear how mutations that disrupt synapse function impact intellectual ability. In
the SYNGAP1 mouse model of ID/ASD, we found that dendritic spine synapses
develop prematurely during the early postnatal period. Premature spine maturation
dramatically enhanced excitability in the developing hippocampus, which
corresponded with the emergence of behavioral abnormalities.
Inducing SYNGAP1 mutations after critical developmental windows closed had
minimal impact on spine synapse function, whereas repairing these pathogenic
mutations in adulthood did not improve behavior and cognition. These data
demonstrate that SynGAP protein acts as a critical developmental repressor of neural
excitability that promotes the development of life-long cognitive abilities. We propose
that the pace of dendritic spine synapse maturation in early life is a critical
determinant of normal intellectual development.
Graphical Abstract
1. Download : Download high-res image (430KB)
2. Download : Download full-size image
Highlights
► Pathogenic SYNGAP1 mutations promote early maturation of hippocampal spine

synapses ► Mutations lead to neonatal hyperactivity of the hippocampal trisynaptic
circuit ► Mutations have greatest impact during the first 3 weeks of development ►
Reversal of mutations in adults does not improve behavior and cognition
 Previous article in issue
 Next article in issue
Introduction
Disruptions to the molecular mechanisms controlling glutamatergic synapse structure
and function are believed to underlie certain neurodevelopmental
disorders of cognition, such as intellectual disability (ID) and autism spectrum
disorder (ASD), which are two disorders that are often codiagnosed in afflicted
children (Bear et al., 2004; Penzes et al., 2011; Ramocki and Zoghbi, 2008; Südhof,
2008). Deleterious mutations in synaptic proteins are linked to these disorders and
many animal models display deficits related to synapse structure and/or function
(Gauthier et al., 2011; Gilman et al., 2011; Guilmatre et al., 2009; Hamdan et al.,
2011a; Hamdan et al., 2011b; Hamdan et al., 2009; Südhof, 2008). However, it
remains largely unknown how synaptic dysfunction resulting from pathogenic
mutations during development impacts circuit function and behavior. This is a
particularly important consideration in ID and ASD because these brain disorders are
often first diagnosed in very young children. Disruption of excitatory/inhibitory (E/I)
balance is emerging as a common neurophysiological phenotype common to many
brain disorders, including ID and ASD (Rubenstein and Merzenich, 2003). Recently,
it was demonstrated that increasing neural excitation is sufficient to disrupt cognition
and sociability (Yizhar et al., 2011). Therefore, genetic mutations that selectively
increase glutamatergic synaptic strength in pyramidal neurons would be expected to
significantly impact E/I balance, information processing, and behavior, particularly
during early postnatal development when GABAergic interneuron systems are still
maturing (Danglot et al., 2006).
Recently, autosomal-dominant de novo mutations in SYNGAP1 that lead to truncation
of the full-length protein were reported as a cause of sporadic ID in ∼4% of screened
cases (Hamdan et al., 2011a; Hamdan et al., 2009; Krepischi et al., 2010). All
identified patients with SYNGAP1 haploinsufficiency have moderate to severe forms of
ID, and several of these patients also have an ASD (Hamdan et al., 2011a; Pinto et al.,
2010). Interestingly, these patients present with nonsyndromic ID, as there are no
physical abnormalities other than those observed in the cognitive/behavioral domain.
Thus, de novo mutations that disrupt SYNGAP1 are highly pathogenic and selectively
impact brain function. Early prevalence data indicate that these mutations are
unexpectedly common (predicted to be >1 million afflicted individuals world-wide
and more prevalent than fragile X syndrome), underscoring the impact
that SYNGAP1 has on cognitive development (Hamdan et al., 2011a; Hamdan et al.,
2011b; Hamdan et al., 2009).
SYNGAP1 encodes a synaptic RasGAP (SynGAP) that is largely localized to dendritic
spines in neocortical pyramidal neurons (Chen et al., 1998; Kim et al., 1998; Zhang
et al., 1999), where it suppresses signaling pathways linked to NMDA
receptor (NMDAR)-mediated synaptic plasticity and AMPA receptor (AMPAR)
membrane insertion (Kim et al., 2005; Krapivinsky et al., 2004; Rumbaugh et al.,
2006). This is a complicated gene with alternative transcriptional start sites and
several alternatively spliced C-terminal exons that result in many possible isoforms of
SynGAP (Chen et al., 1998; Kim et al., 1998). Not surprisingly, the impact of
SynGAP protein expression in neurons is unclear. Both the N and C termini
expression can influence SynGAP protein function, and depending on the variant
expressed, SynGAP can either stimulate (Rumbaugh et al., 2006) or suppress dendritic
spine synapse function (McMahon et al., 2012). In addition, disrupting SynGAP
expression in dissociated hippocampal neurons can enhance dendritic spine function
(Kim et al., 2005; Rumbaugh et al., 2006) or suppress it (Krapivinsky et al., 2004).
Based on these data, it is difficult to predict how inactivating mutations
of SYNGAP1 would impact the development of brain circuits and the cognitive
modalities subserved by them. Regardless, considering that this protein is restricted to
dendritic spines and copy number variation directly impacts cognition, mice that
harbor SYNGAP1 truncating mutations provide an excellent model to study how a
genetic mutation influences synaptic maturation and cognitive development.
Interestingly, adult SynGAP Heterozygous knockout mice (Hets), which model
human SYNGAP1 haploinsufficiency and offer construct validity, are reported to have
normal synaptic transmission and only modest defects in synaptic plasticity (Kim
et al., 2003; Komiyama et al., 2002). Despite the lack of pervasive functional synaptic
defects in adulthood, these animals have profound cognitive abnormalities (Guo et al.,
2009; Komiyama et al., 2002; Muhia et al., 2010). These data suggest that SynGAP’s
role in regulating synapse development may be particularly important to cognitive and
behavioral maturation. However, the role of this critical gene in brain development
remains largely unexplored. Therefore, we hypothesized
that SYNGAP1 haploinsufficiency is particularly disruptive to neonatal dendritic spine
synapse development, which, as a consequence, contributes to deficits in cognition
and behavior.
In this study, we found that a mouse model of human SYNGAP1 haploinsufficiency had
glutamatergic synapses that matured at an accelerated rate during the first few weeks
of neonatal development. Loss of this essential glutamatergic
synapse repressor dramatically disrupted E/I balance in neural networks that support
cognition and behavior and these effects were linked to life-long intellectual
disability. These studies provide a neurophysiological mechanism linking abnormal
glutamatergic synapse maturation during development to enduring abnormalities in
behaviors indicative of neurodevelopmental disorders.
Results
SYNGAP1 Haploinsufficiency Accelerates the Maturation of Hippocampal
Synaptic Function
SynGAP is expressed throughout the forebrain, with particularly high levels in

the hippocampus (Porter et al., 2005). The hippocampus is a
central mediator of cognition and memory because it receives and integrates
information from sensory cortices that is then relayed to associational regions. Indeed,
development of the hippocampus is disrupted in ID and ASD patients (Saitoh et al.,
2001). SynGAP expression in the hippocampus of WT mice peaks around postnatal
day (PND) 14 (Figure 1A), suggesting that this period of brain development may be
vulnerable to the reduced levels of full-length SynGAP protein expressed in Het mice
(Figure 1B). We began to probe for possible hippocampal circuit dysfunction in Het
mice by measuring synaptic transmission in the medial perforant path (MPP) of
the dentate gyrus (DG), the major input pathway into the hippocampus. Synaptic
function was normal at very young ages (∼PND9), but transmission increased
dramatically in Het mice by PND14 (Figures 1C and 1D). Interestingly, synaptic
function was again equivalent between genotypes by PND21 and later (Figures 1E
and 1F), indicating that SynGAP controls the trajectory of synapse maturation during
a particularly critical period (PND10–20) of hippocampal development.

Figure 1. A Restricted Period of Elevated Excitatory Synaptic Transmission in
Developing SynGAP Mutants
(A) SYNGAP1 transcript levels were measured in WT C57/Bl6J mice
by qPCR throughout development. Relative abundance was calculated by normalizing
SynGAP transcript levels to GAPDH levels, which was previously determined to not
change during development.
(B) Hippocampi from WT (n = 3) and Het (n = 3) PND14 mice were extracted and
probed for SynGAP and β-tubulin expression; (ANOVA, F(1,5) = 28.2, p = 0.006).
(C–F) Representative traces of field EPSPs and summary graphs of input-output
relationships from the MPP input into the DGNs measured during different
developmental epochs. Significance was determined with an ANOVA to compare slopes
after linear regression. Number in parenthesis represents number of slices. At least three
animals per genotype per age were used.
Error bars represent SEM.
We next sought to better understand the neurophysiological mechanism responsible

for enhanced synaptic function during development. NMDAR-evoked synaptic
transmission was unchanged in PND14 Het mice (Figure 2A), suggesting that the
elevated synaptic transmission at PND14 was mediated by a postsynaptic increase in
the sensitivity of AMPARs to evoked glutamate release. Consistent with this idea, we
observed a selective increase in the ratio of AMPA/NMDA currents during whole-cell
recordings of DG granule neurons (DGNs) only in PND14 Het mice (Figure 2B). We
found no differences in the rise or decay of these evoked currents at any age tested
(Figure S1 available online). These data also demonstrate that
pathogenic SYNGAP1 mutations cause a premature acquisition of adult levels of
functional AMPARs. We also observed a selective increase in mEPSC amplitude and
frequency in SYNGAP1 Het mice at PND14, which also normalized by PND21
(Figures 2C and 2D). Synaptic disruptions first seen at PND 14 were largely specific
to postsynaptic function because we did not detect changes in MPP release probability
(Figure 2E) or intrinsic spiking of DGNs at this age (Figure 2F). We observed no
changes in resting membrane potential or input resistance at any age tested
(Figure S1). Interestingly, we observed a significant increase in mIPSC frequency and
amplitude in DGNs (Figure 2G). Considering that SYNGAP is not expressed at
inhibitory synapses (Chen et al., 1998; Kim et al., 1998), these data suggest the
intriguing possibility that changes to the inhibitory system represent a compensatory
response to increased excitation caused by elevated postsynaptic dendritic
spine synapse AMPAR function in these neurons (Lau and Murthy, 2012).
Figure 2. Developmental Disruptions to Het Synaptic Transmission Are Caused by
Enhanced Sensitivity of AMPARs to Released Glutamate
(A) Isolated NMDAR-mediated fEPSPs at PND14–16. Number in parenthesis represents
number of slices. At least three animals per genotype per age were used.
(B) Representative traces (left) and summary data of AMPA/NMDA ratios evoked from
mild stimulation of MPP in patch-clamped DGGCs (ANOVA; PND7–9: F1,20 = 0.031, p >
0.05; PND14–16: F1,25 = 13.76, p < 0.01; adult: F1,12 = 0.118, p > 0.05).
(C) Cumulative percentage of mEPSC amplitude from PND9 (n = 800), PND14 (n =
1300), PND21 (n = 500). Note an increase in mEPSC amplitude only at PND14 (p <
0.05; two-sample K-S test).
(D) Summary of cumulative percentage of mEPSC inter-event interval, which is reduced

at PND14 (p < 0.05; two-sample K-S test).
(E) Paired-pulse ratio in WT and SynGAP Hets at PND 14–16 (RMANOVA; F1,23 =
0.898; p > 0.05). Number in parenthesis represents number of slices. At least three
animals per genotype per age were used.
(F) Intrinsic excitability of DGGNs observed by variable current injections into patch-
clamped cells at PND14–16 (RMANOVA; PND8–9; F1,24 = 5.139, p < 0.05; PND14–16:
F1,40 = 2.280, p > 0.05; > 6 weeks: F1,11 = 0.353, p > 0.05; asterisks denote significance
after Bonferroni Post Hoc test, p < 0.05).
(G) Cumulative probability of mIPSC amplitude (p < 0.05, two-sample K-S test) and
frequency (p < 0.05, two-sample K-S test), respectively, from PND14; n = 700.
Error bars represent SEM. See also Figure S1.

Figure S1. Additional Physiological Measures in the SYNGAP1 Haploinsufficient
Animals at Three Developmental Stages, Related to Figure 2
(A and B) Summary of mean rise and decay time kinetics of AMPA- and NMDA-
receptor-mediated currents showing no change in these kinetics measured from different
PND9, PND14 and > 6 weeks (p > 0.05; Student’s t test). Measures derived from cells
patch-clamped and shown in Figure 2B. Resting membrane potential and input resistance
measured across age groups (p > 0.05; Student’s t test). These measures were derived
from neurons recorded and shown in Figure 2B.
SYNGAP1 Haploinsufficiency Disrupts Dendritic Spine Dynamics during the

Second Postnatal Week
In pyramidal neurons, spine structure is tightly correlated with synapse function

(Matsuzaki et al., 2001; Noguchi et al., 2011). Thus, we next sought to determine
whether SYNGAP1 haploinsufficiency disrupted the development of DGN dendritic
spine structure over the same time-course as that observed for synaptic function. At
PND9, SynGAP mutants had normal dendritic spine structure (Figure 3A), but spines
became larger relative to WT by PND14 (Figure 3B). These abnormalities persisted
into adulthood (Figure 3C), which is consistent with the “spine dysfunction” theory
of cognitive disorders (Penzes et al., 2011). The disruption to spine head size altered
the distribution of spine classes in Het mice, resulting in more mushroom-type spines
and fewer stubby spines beginning in the second postnatal week (Figure 3D). We did
not observe differences in spine density (Figure 3E) at any stage of development in
the DG, indicating that synapse density in the hippocampus is not affected
by SYNGAP1 haploinsufficiency at the ages tested. Importantly, we confirmed
that SYNGAP1 haploinsufficiency alters dendritic spine size in early development by
characterizing these structures from internally perfused and fixed Thy1-GFP
SYNGAP1 Hets (Figure S2). Additional structural abnormalities were observed at
PND14. Although dendritic arborization was unchanged in SYNGAP1 Hets (not
shown), we did observe a decrease in the spatial volume occupied by individual DGN
dendritic trees (Figures 3F–3G).
1. Download : Download high-res image (1MB)
Figure 3. Emergence of Abnormal Spine Size and Shape in SYNGAP1 Mutants during the
Second Postnatal Week
(A–C) Representative multiphoton excitation images of dendrites (scale bar = 1 μm)
obtained in live acute brain slices in both WT and SYNGAP1 Hets. Cumulative frequency
curves of spine head diameter in both groups across three stages of development (PND8–
9, WT [n = 687 spines] versus Het [n = 687]; PND14–16, WT [n = 1650] versus Het [n =
1650]; PND60, WT [n = 963] versus Het [n = 963]). K-S test was performed because a
population defined by spine head diameter results in a clear nonnormal distribution. Inset
shows spine diameters from 0.6–0.9 μm.
(D) Graphs depicting the proportion of Mushroom (left), Stubby (middle), and Thin
(right) spines in WT and Het mice at three different developmental stages;
Mushroom: genotype (F(1, 37) = 15.243, p = 0.00039); age (F(2, 37) = 4.1677, p = 0.02332),
Stubby: genotype (F(1, 37) = 13.167, p = 0.00086); age (F(2, 37) = 17.451, p = 0.00000), Thin:
age (F(2, 37) = 52.569, p = 0.00000). Number in parenthesis represents number of slices. At
least three animals per genotype per age were used.
(E) Density of WT (blue) and Het (red) spines at three different developmental time
points were calculated (ANOVA; genotype [F(1, 38) = 0.98887, p = 0.32631]; age [F(2, 38) =
14.048, p = 0.00003]; genotype × age [F(2, 38) = 0.13787, p = 0.87164]).
(F) Representative examples of 3D reconstruction and Sholl ring analysis in dentate
gyrus granular neurons (PND 16).
(G) Histograms showing volumetric and surface extension field of dentate gyrus neurons
in both WT (n = 40 traced neurons from four animals) and Het (n = 40 traced neurons
from four animals) mice; Student t test, ∗p < 0.05.
Values represent means ± SEM. See also Figure S2.
Figure S2. Abnormal Spine Size Detected by Confocal Microscopy Assessment in
Postfixed Tissue, Related to Figure 3
(A) Dentate gyrus photomicrographs and representative confocal microscopy of dendritic
segments (scale bar = 1ɥm) obtained in fixed brain slices in both WT and SynGAP Hets.
(B) Histogram showing spine density detected in both PND 16 groups of mice (Student t
test, p > 0.05); values represent means ± SEM. Cumulative frequency curves of spine
head diameter in both groups [PND 16, WT (n = 1,967 spines) versus Het (n = 1,958
spines), Kolmogorov-Smirnov test (p < 0.0001).
Gradual acquisition of synaptic AMPARs and subsequent functional unsilencing

of glutamatergic inputs is a hallmark of early postnatal development (Kerchner and
Nicoll, 2008). Therefore, premature acquisition of functional AMPARs into synapses,
like that observed in SynGAP Hets, is suggestive of an aberrant acceleration of
normal neurodevelopmental milestones. Therefore, we next investigated the idea that
dendritic spine dynamics in SynGAP Het mice also displayed characteristics of early
maturation. We observed that spines from PND14 DGNs in Het mice were
significantly less motile than WT spines (Figures 4A and 4B). Because spine motility
rates decrease during development (Dunaevsky et al., 1999; Majewska and Sur,
2003), this measure is a mark of synapse maturation. Indeed, spines from young
SynGAP Het mice appeared to have dynamics normally seen in adult animals. Spine
motility rates dropped in WT animals between PND14 and adult (Figure 4B) as
expected (Dunaevsky et al., 1999; Majewska and Sur, 2003). However, motility rates
did not drop in Het mice because they already displayed adult-like motility rates by
the end of the second postnatal week (Figure 4B). Defects in spine motility and
synaptic function in neonatal Het mice were linked to spine signaling
abnormalities. Cofilin signaling regulates spine structure and AMPAR trafficking by
controlling actin dynamics (Gu et al., 2010). Indeed, we observed that Cofilin was
hyperphosphorylated in young SynGAP mutants (Figure S3). These results are
consistent with signaling deficits previously reported in adult SynGAP mice (Carlisle
et al., 2008; Komiyama et al., 2002).
Figure 4. SYNGAP1 Haploinsufficiency Disrupts Developmental Spine Dynamics
(A) Multiphoton excitation images of an individual spine over time taken from acute
slices in WT and Het mice at PND14.
(B) Motility of Het (red) and WT (blue) spines from slices taken at PND14–16 and
PND60 (ANOVA two-way; genotype [F(1,20) = 19.439, p = 0.00027]; age [F(1,20) = 29.338,
p = 0.00003]; interaction [F(1,20) = 9.3201, p = 0.00628]); number in parenthesis represents
number of slices. At least three animals per genotype per age were used.
(C) c1, frames of individual spines in acute slices showing spontaneous spine
head plasticity (SSHP) at PND14–16. c2, Spontaneous spine head plasticity kinetic
curves of WT (n = 36) and Het (n = 10) spine populations demonstrating this
phenomenon at PND14–16 (one-sample t test [population mean = 100], $ = WT
significance,# = Het significance, p < 0.05).
(D) Graph depicting SSHP event probability (probability that any observed spine in the
brain slice would change volume > 50% between 2 successive frames) in WT (blue) and
Het (red) slices at PDN14–16 and PND60; (ANOVA two-way; genotype [F(1,23) = 4.6586,
p = 0.04157]; age [F(1,23) = 5.6275, p = 0.02643]; interaction [F(1,23) = 4.6034, p = 0.04270]);
number in parenthesis represents number of slices. At least three animals per genotype
per age were used.
(E) Spine head volume measurements were made in spines that underwent plasticity
(10 min before observation of >50% spine volume change) and spines that did not display
this behavior (no-SSHP; spine chosen at random and volume measurement chosen at a
randomly selected time point); thus dividing spines into two populations—plastic and not
plastic; ANOVA one-way, (F(3,107) = 6.720, p = 0.0003). Number in parenthesis represents
number of spines analyzed. At least three animals per genotype per age were used.
A Bonferroni post hoc test was applied where appropriate, ∗p < 0.05, ∗∗∗p < 0.001.
Error bars depict SEM. See also Figure S3 and Movie S1.

Figure S3. p-Cofilin Expression in P14 SynGAP WT (Blue) and Het (Red) Mouse
Hippocampal Homogenates, Related to Figure 4
Brains from P14 mice were extracted and hippocampi immediately dissected in ice-cold
PBS followed with homogenization in RIPA buffer containing protease
and phosphatase inhibitor cocktails, frozen, and stored at −80°C. 10 μg of protein were
loaded and run on 12% tris-HCl gels, transferred to PVDF membranes, and probed for
phosphocofilin (1:1,000), total cofilin (1:10,000), and b-tubulin (1:50,000). WT (n = 8)
versus Het (n = 7) p-cofilin expression (one way ANOVA, F(1,13) = 7.42, p = 0.02);
total cofilin expression (one way ANOVA, F(1,13) = 2.17, p = 0.17).
During spine motility experiments, we made the surprising observation that,
regardless of genotype, a subset of PND14 DGN spines displayed a novel form of
structural plasticity defined by a spontaneous increase in head volume (Figure 4C
and Movie S1). As a group, spines that displayed this previously unreported form of
structural plasticity maintained the elevated volume for at least 1 hr. Although the
dynamics of spontaneous spine head enlargement were similar between genotypes
(Figure 4C), the frequency of spontaneous plasticity events was significantly lower in
Het brain slices at PND14 (Figure 4D). The frequency also dramatically decreased
with age in WT, suggesting that this phenomenon might be related to developmental
maturation of glutamatergic synapses in the DG. The frequency of plasticity events in
Hets did not change between PND14 and adult time points (Figure 4D), suggesting
that spines in PND14 Het mice may have already undergone structural plasticity. In
support of this idea, we observed that Het spines that did not display this plasticity
were significantly larger than Het spines that did eventually enlarge (Figure 4E). In
addition, the population of PND14 Het spines that failed to enlarge was also
significantly larger than both populations of WT spines (Figure 4E). These data
suggest that abnormal spine dynamics in early development may account for the
persistent disruption to spine morphology observed in adult SynGAP Hets (Figures
3A and 3B).
SYNGAP1 Haploinsufficiency Alters Hippocampal Information Processing, E/I

Balance, and Memory
We next sought to determine whether accelerated maturation of dendritic spine

synapses in SynGAP Hets leads to altered excitability at the circuit level in the
developing hippocampus. To directly test this idea, we performed laser photolysis of
caged glutamate paired with fast voltage-sensitive dye imaging to monitor signal
propagation throughout the entire hippocampus. Indeed, we found that the dynamics
of signal propagation through the neonatal hippocampus were significantly different
between genotypes (Figures 5A and 5B). Photostimulation-evoked signals originating
in the WT DG were progressively attenuated as they traveled through the trisynaptic
circuit (Figures 5A and 5C and Movie S2). In Het mice, however, signals originating
in the DG were dramatically amplified as they spread through the hippocampus
(Figures 5B and 5C and Movie S2), demonstrating that SYNGAP1 haploinsufficiency
disrupts information processing in the hippocampus. These data also provided direct
evidence that SYNGAP1 inactivating mutations shift the balance of hippocampal
networks toward excitation in early development. Hyperactivity across the Het
hippocampus suggested that synapses in addition to the MPP-DGN pathway would be
abnormally strong. Indeed, we found that synaptic transmission in the Schaeffer
Collateral pathway in area CA1 was also abnormally strong in early development but
not in adult Hets (Figure 5D and Figure S4), indicating that enhanced synaptic
function during early neural development is a common outcome
of SYNGAP1 haploinsufficiency.
1. Download : Download high-res image (1MB)
Figure 5. SYNGAP1 Haploinsufficiency in Young Mice Causes Abnormal Hippocampal
Signal Processing, E/I Imbalance, and Seizures
(A and B) Time series data of voltage-sensitive dye (VSD) imaging of responses to
single-site photostimulation (indicated by the red star) in DG and near-simultaneous,
multisite photostimulation across DG (indicated by the red curve), respectively, from the
same PND16 WT (A) or Het (B) slice. VSD frames were acquired at 2.2 ms/frame, but
are displayed at specific time points. Time progresses from left to right in the row. Color
code is used to indicate VSD signal amplitudes expressed as SD multiples above the
mean baseline. The warmer the color, the stronger the response.
(C) Average response amplitude in SD units for DG, CA3, and CA1 to single-site (left)
and multisite (right) DG photostimulation from WT (n = 6) and Het (n = 7) slices (four
animals from each genotype); ANOVA two-way: Single Site [Genotype (F(1,33) = 20.8, p =
0.00007); Brain Region (F(2,33) = 4.27, p = 0.022); Interaction (F(2,33) = 5.12, p = 0.011)],
Multisite [Genotype (F(1,33) = 13.5, p = 0.00083); Brain Region (F(2,33) = 4.23, p = 0.023);
Interaction (F(2,33) = 7.20, p = 0.0025)]. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.0005 after a Bonferroni
post hoc test.
(D) Representative traces and pooled data of input-output relationship from the Schaffer-
collateral pathway in CA1 in developing and mature SynGAP mice. Significance was
determined by comparison of slopes after linear regression.
(E) Time taken to reach three benchmarks in fluorothyl-induced seizures in PND17 WT
(n = 25) and Het (n = 21) mice [ANOVA; First Clonus (1st C): (F(1,42) = 41.8, p < 0.001),
Tonic-Clonic (TC): [F(1,42) = 46.5, p < 0.001], Tonic Hindlimb Extension (THE): (F(1,42) =
34.0, p < 0.001]). ∗p < 0.001.
(F) Activity levels of PND16 WT (n = 27) and Het (n = 10) mice during an exposure to a
novel open field arena; RMANOVA (F(1,33) = 11.2, p = 0.002).
Error bars depict SEM. See also Movies S2 and S3, Figure S4 and Table S1.
Figure S4. Stimulus Intensity Versus Fiber Volley/EPSP Slope in CA1 of SynGAP Mice,
Related to Figure 5
WT and Het mice at either P14–16 or adult time points were assessed for fiber volley
peak and fEPSP slope after electrical stimulation in CA1 Str. radiatum. There was a clear
increase in excitability in SynGAP Het mice only in early development [PND14–16:
(RMANOVA) FV versus intensity: F(1,48) = 3.36, p > 0.05, fEPSP versus intensity: F(1,48) =
14.46, p < 0.001; Adult: (RMANOVA) FV versus intensity: F(1,10) = 2.47, p > 0.05, fEPSP
versus intensity: F(1,10) = 2.60, p > 0.05].
Hippocampal hyperactivation indicated that SynGAP Het mice may be prone to
seizures, a condition highly comorbid in patients with SYNGAP1 haploinsufficiency
(Hamdan et al., 2011a; Hamdan et al., 2009). Indeed, young SynGAP Het mice had a
reduced fluorothyl-induced seizure threshold (Figure 5E) and were prone
to audiogenic seizures (Table S1 and Movie S3), a phenotype shared with other mouse
models of neurodevelopmental disorders (Musumeci et al., 2000). We next wished to
determine whether behavior was altered in neonatal SynGAP mutants. Although
behavioral analysis is challenging in preweanling mice, we did observe that activity in
the open field arena was much higher in PND14 Hets compared to WT littermates
(Figure 5F). Exploratory behavior in this paradigm is guided by several factors,
including spatial cognition (Dvorkin et al., 2008), and hyperactivity is associated with
developmental hippocampal dysfunction (Daenen et al., 2002). Together, these data
link early maturation of dendritic spine synapses and E/I imbalance to the onset of
behavioral abnormalities in neonatal SynGAP Het mice.
Developmental disruptions in the maturation of hippocampal circuits would be
expected to cause persistent, ongoing deficits in brain function, including memory
encoding (Squire, 1992). Proper DG circuit function is necessary to resolve two
closely overlapping neural representations (Kesner, 2007). Experimentally, contextual
discrimination is highly dependent on DG function (Sahay et al., 2011). Thus, context
discrimination is an ideal paradigm to link synapse dysfunction in the DG to abnormal
adult cognition. To probe for potential context discrimination deficits
in SYNGAP1 haploinsufficiency, we first trained animals in a fear conditioning
paradigm over several days in a unique context (A+). The animals were then exposed
to the original training context (A+), followed by exposure to a slightly different
contextual environment (B−) (Figure 6A). As we reported previously (Guo et al.,
2009), SynGAP Het mice exhibited normal contextual fear memory when compared
to WT littermates (Figure 6B). WT mice were also able to discriminate between the
similar contexts A and B, as they learned to freeze less in context B (Figure 6C).
Consistent with the idea that SynGAP Hets have functional deficits in the dentate
gyrus, Het mice were unable to discriminate between the two contexts over the same
period of time (Figure 6D).
Figure 6. Adult SYNGAP1 Hets Display Learning Deficits in a Task Selective for
the Dentate Gyrus
(A) Schematic depicting context discrimination paradigm.
(B) WT (n = 10) and Het (n = 12) mice in the multiday training paradigm. Both groups
showed a significant and equivalent increase in freezing in context A across sessions
(main effect of session F(9, 180) = 31.7, p < 0.05, no effect of genotype F(1, 20) = 2.08, p > 0.05,
no genotype × session interaction F < 1).
(C) WT mice learned to discriminate the shock context (A+) from the safe environment
(B−) across five sessions (main effect of context F(1,9) = 7.05, p < 0.05, context × session
interaction F(4, 36) = 3.35, p < 0.05).
(D) Hets did not learn to discriminate between the shock context and safe environment
across five sessions (no effect of context F(1, 11) = 1.72, p > 0.05, no context × session
interaction F(4, 44) = 2.13. p > 0.05). ∗p < 0.05.
Error bars depict SEM.
Developmental SYNGAP1 Mutations Lead to Persistent Behavioral

Abnormalities
The results thus far demonstrate that SYNGAP1 mutations responsible for persistent,

life-long intellectual disability disrupt rodent synapse development in circuits that
support cognition. However, it remains unclear whether developmental synapse
disruptions contribute to enduring cognitive and behavioral abnormalities. Therefore,
we next performed a series of studies to link developmental synapse abnormalities to
life-long cognitive disruptions.
In the first set of studies, we sought to test the hypothesis that developing dendritic
spine synapses are particularly sensitive to SYNGAP1 mutations. To test this idea, we
engineered a conditional mouse line that allows for efficient temporal induction of
SYNAGP1 haploinsufficiency. This newly engineered mouse line contained loxP
sites flanking the same exons targeted in our conventional Het mouse. We confirmed
that the inserted LoxP sites were correctly targeted in this mouse line and that Cre
recombinase expression significantly reduced SynGAP protein levels in
SYNGAP1+/fl neurons (Figure S5). We confirmed (Figure S5) a previous report (Pilpel
et al., 2009) that demonstrated AAV8 pseudotyped vector particles drive high levels
of transgene expression within days of injection into the newborn mouse brain,
indicating that it was technically possible to induce haploinsufficiency in the first
week of life. For temporal induction of haploinsufficiency, AAV8 Cre virus particles
were unilaterally injected into the hippocampus of either neonatal or adult
SYNGAP1+/fl mice (Figure 7A). To assess the effect of age-restricted
haploinsufficiency, we recorded DGN AMPA/NMDA ratios from both infected
(SYNGAP1 Haploinsufficiency) or uninfected (SynGAP WT) hemispheres 14 days
after injections. To facilitate the identification of DGNs with haploinsufficiency, we
crossed SYNGAP1 conditional KO mice with Ai9 Cre reporter mice, which express
tdTomato in response to Cre activity. Indeed, 2 weeks after Cre virus injections, we
observed a mosaic expression of tdTomato in neurons throughout the DG (Figure 7B),
confirming that the virus drives active Cre recombinase within 14 days of injection.
As we had found in the conventional Het mice, PND1 virus injections
into SYNGAP1+/fl conditional mice resulted in a robust increase in DGN AMPA/NMDA
ratios (Figure 7C). This effect was most likely caused by altered SynGAP expression
because there was no effect of Cre virus injection in SYNGAP1 +/+ mice (Figure 7C).
We did not observe any other effects on synaptic or neuronal function in this neonatal
haploinsufficiency experiment (data not shown), indicating that a critical role of
SynGAP during development is to control the maturation rate of dendritic spine
synapses. Importantly, these data also demonstrate that pathogenic SYNGAP1
mutations affect synaptic maturation through cell-autonomous mechanisms because
we did not observe TdTomato-positive neurons outside the hippocampus. In the next
experiment, virus was injected unilaterally into adult animals (Figure 7A) to
determine the effect of SYNGAP1 haploinsufficiency in the mature hippocampus. In
contrast to the PND1 injections, there was no effect of Cre expression on
AMPA/NMDA ratio in either the SYNGAP1+/fl or SYNGAP1+/+ mouse lines when
recordings were performed 2 weeks after virus injection (Figure 7D). However, we
did find that adult induction of SYNGAP1 haploinsufficiency increased the intrinsic
excitability of DGNs (Figure S5). This effect was not observed in either PND1 virus-
injected animals (Figure S5) or in conventional adult Hets (Figure 2F), indicating that
this is a cell-autonomous effect specific to adult-induced haploinsufficiency.
Together, these data demonstrate that a critical period of SynGAP protein function
exists in the first 2 weeks of hippocampal development, when this protein plays a key
role in determining the rate of dendritic spine synapse development.

Figure S5. Accompanying Data Supporting Construction and Analysis
of SYNGAP1 Conditional Haploinsufficiency Experiments, Related to Figure 7
(A) Schematic demonstrating the construction of the conditional KO line.
(B) Southern blot from the F2 generation demonstrating that correct targeting of the

3′ LoxP site and the successful deletion of the Neo cassette.
(C) Neurons from heterozygous SynGAP1 conditional KO mice were cultured. SynCre-
Venus AAV particles were added to the cultures at DIV1 to induce expression of Cre in
all plated neurons. Neurons were harvested at DIV10. Protein extracts were probed
by western blot for normalized SynGAP protein expression.
(D) AAV8 Cre virus particles were engineered to contain a biscotroinc cDNA that drove
simultaneous expression of Venus and iCre. The particles were injected into several
homozygous Ai9 PND 0 mouse brains by stereotactic procedures. Animals were fixed
and tissue sections prepared at PND2, 4, 7 and 14 to determine the onset
of transgene expression and Cre activity by scanning the sections for yellow and red
fluorescence, respectively.
(E) Demonstrates that tdTomato expression is very bright and dendritic spines can be
imaged with these reporter mice. F) Mean no. of spikes observed to be normal in PND14
WT TD+/− and Synflox+/− TD+/− (p > 0.05; RM ANOVA, a: F = 0.15, df = 1, b: F = 0.72,
df = 1; c: F = 0.28, df = 1). Mean no. of spikes observed to be normal in adult WT TD+/
−
animals (p > 0.05; RM ANOVA, a: F = 0.15, df = 1, b: F = 0.72, df = 1; c: F = 0.28, df =
1). Mean no. of spikes observed to be elevated to a given stimulus intensity in adult
Synflox+/− TD+/− (RM Anova p < 0.01, F = 16.82, df = 1).
Figure 7. Developing, but Not Adult, Dendritic Spine Synapses Are Cell Autonomously
Suppressed by SynGAP Protein
(A) Schematic depicting the strategy for temporal dissection of
SYNAGAP1 haploinsufficiency on cell-autonomous neuronal properties.
Briefly, SYNGAP1 mice heterozygous for flanking LoxP (SYNGAP1+/fl) sites were crossed
to homozygous Ai9 Cre reporter mice (TD+/+) and resulting offspring were injected with
Cre virus at either PND1 or PND60. Whole-cell patch clamp recordings were carried out
14 days later.
(B) Photos were taken of an acute brain slice at PND14 with a mosaic expression of
TdTomato+ neurons. Red box depicts a neuron that was successfully patched clamped.
(C and D) Mean AMPA/NMDA ratios from either control (tdTomato-negative) or Cre+

(tdTomato-expressing) neurons patch-clamped in the two genotypes at the two
developmental stages (neonatal = p < 0.01; adults = p > 0.05; Student’s t test).
See also Figure S5. Error bars depict SEM.
In the second series of experiments, we sought to determine whether
neonatal SYNGAP1 haploinsufficiency causes enduring cognitive and behavioral
disability. The rationale behind this experiment was that
if SYNGAP1 haploinsufficiency disrupted the organization of brain circuits during
development, then rescue of SynGAP protein in adult mutants would have minimal
positive impact on behavior and cognition. To test this idea, we constructed a novel
mouse line that enabled conditional reversal of SYNGAP1 haploinsufficiency in adult
mice. This mouse line contained a LoxP-STOP-LoxP cassette downstream of exon 5
of the mouse SYNGAP1 gene (Figure S6). This cassette would be expected to cause a
truncation of full-length protein, which is known to inactivate SynGAP (Rumbaugh
et al., 2006). Indeed, all known cases of SYNGAP1 haploinsufficiency result from a
truncation of the full-length protein (Hamdan et al., 2009; Hamdan et al.,
2011a, Hamdan et al., 2011b). Southern blot analysis confirmed that the STOP
cassette was appropriately targeted and that this targeted insertion disrupted
expression of full-length SynGAP (Figure S6). Importantly, behavioral
endophenotyping demonstrated that LoxP-stop Het mice had robust behavioral
abnormalities similar to what we have previously published (Guo et al., 2009) in our
conventional Hets (data not shown). We next confirmed in cell culture experiments
that the expression of Cre recombinase significantly increased SynGAP protein levels
(data not shown), indicating that removal of the STOP cassette could rescue SynGAP
expression in a comprehensive behavioral study of adult mice. To test the effect of
genetic rescue on behavioral and cognitive performance, we crossed
heterozygous SYNGAP1 LoxP-Stop animals with a hemizygous inducible and
ubiquitously-expressing, Cre-ERt2 driver line (Hayashi and McMahon, 2002)
previously shown to effectively rescue gene expression in adult mice (Guy et al.,
2007) after tamoxifen (TMX) administration. The offspring resulting from this cross
fell into four genotypes (Figure 8A), which enabled us to test the effect of the LoxP-
Stop allele while also controlling for the Cre-ERt2 background. At 8 weeks of age, all
animals were then endophenotyped in a minibehavioral battery that tested for the
presence of cognitive and noncognitive behavioral abnormalities. Importantly, these
behaviors were selected due to the ability to test the same animals before and after
genetic rescue. The presence of the LoxP-stop cassette again resulted in behavioral
abnormalities similar to that seen in our conventional SYNGAP1 Hets and the presence
of CRE-ERt2 had minimal impact on the behaviors tested (Figures 8B–8D).
Specifically, both Cre+ and Cre− SYNGAP1 LoxP-Stop Hets exhibited increased time
in the open arm of the elevated plus maze, increased open field activity levels and the
absence of spontaneous alternation in a T-maze. This latter behavior is striking, as it
represents a failure of basic working memory that promotes survival (Lisman, 1999).
Next, animals were injected with TMX to induce Cre-ERt2 activity, which was
expected to reverse SYNGAP1 haploinsufficiency and restore SynGAP protein levels in
these adult animals. One month after reversal, the same animals were again tested in
the behavioral battery. Interestingly, there was no apparent effect of adult SynGAP
rescue in any behaviors tested. In open field and elevated plus maze, Cre-positive
LoxP-Stop Hets continued to show significant behavioral deficits relative to their WT
controls (Figures 8B and 8C). In addition, we compared the performance of each
individual animal before and after rescue in these two tests by calculating difference
scores. There was no significant difference between Cre-positive WT and LoxP-Stop
Het behavior when comparing these difference scores (Figure S6), further supporting
the idea that rescue did not impact behavior in Cre-positive LoxP-Stop mice. Finally,
Cre-positive LoxP-Stop Hets continued to fail the spontaneous alternation tests in
post-TMX trials (Figure 8D), indicating that basic working memory in these mice did
not improve after adult reversal of haploinsufficiency. Importantly, we confirmed by
Southern blot that TMX injections reversed SYNGAP1 haploinsufficiency in adult Cre-
positive LoxP-Stop mice (Figure 8E) and that SynGAP protein expression was
restored in these animals (Figure 8F).
Figure S6. Design and Characterizations of SYNGAP1 Conditional Rescue Mice as Well
as Additional Data Relating to Behavioral Performance of the Mice after Genetic Rescue,
Related to Figure 8
(A) Schematic demonstrating the construction of the conditional rescue (LoxP-Stop) line.
(B) Southern blot from the F1 generation and western blot from F2 generation

demonstrating that the LoxP-flanked Stop cassette was correctly targeted and that this
insertion disrupts expression of full-length SynGAP in mice.
(C) Behavioral difference scores for animals treated with TMX. For open field behavior,
differences scores were calculated by subtracting horizontal distance in the post TMX test
to distances in the Pre-TMX test for each animal. For elevated plus maze, percent open
arm time in the Post TMX test was subtracted from values obtained in the Pre-TMX
test. Students t test. Blue = SYNGAP1 WT; Red = SYNGAP1 l×-st Hets.
Figure 8. Rescuing SynGAP Protein Expression in Adult Mice Has Minimal Impact
on Cognition and Behavior
(A) Experimental scheme—hemizygous male Cre mice were mated with female
heterozygous SYNGAP1 lox stop (rescue) mice to generate four different genotypes:
Cre-/WT, Cre-/lx-st, Cre+/WT, Cre+/lx-st, which were run through a behavioral battery
at 8 weeks, administered TMX for 5 consecutive days, retested in the behavioral battery
1 month later, and brains extracted and prepared for Southern and western blots.
(B) The mice were run for 30 min sessions in a standard open field test before and after
TMX administrations and analyzed for distances traveled. Students t test: pre-
TMX, Cre−,WT (n = 11) versus Het (n = 16); Cre+, WT (n = 11) versus Het (n =
10); post-TMX: Cre−,WT (n = 10) versus Het (n = 15); Cre+, WT (n = 10) versus
Het (n = 10); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.005.
(C) The mice were run in a standard 5 min elevated plus maze test before and after TMX
administrations and analyzed for percent time spent in the open arms of the maze.
Student’s t test: pre-TMX, Cre−,WT (n = 11) versus Het (n = 16); Cre+,WT (n = 11)
versus Het (n = 10); post-TMX: Cre−, WT (n = 10) versus Het (n = 15); Cre+, WT (n =
10) versus Het (n = 10); ∗p < 0.05, ∗∗∗p < 0.01.
(D) The mice were run in a standard automated discrete-trials spontaneous alternation test
three times before and after TMX administrations and analyzed for average percent
alternation. Cre−/WTs and Cre+/WTs alternated significantly above chance (50%) level
before and after TMX administrations, whereas the corresponding het groups did not.
Dashed line represents chance levels of alternation (50%). Student’s one-sample t
test against population mean of 50%: pre-TMX: Cre−, WT (n = 11), Het (n = 16); Cre+,
WT (n = 11), Het (n = 10); post-TMX: Cre−, WT (n = 10) versus Het (n = 15); Cre+, WT
(n = 10) versus Het (n = 10); ∗p < 0.05, ∗∗p < 0.005.
(E) Frontal cortical brain tissue from all four groups of mice was dissected and processed
for Southern blot analysis, which confirmed that TMX excised the LoxP-Stop cassette in
adult Cre-ERt2-positive animals. Four subjects from each group were randomly chosen
for genetic analysis. Lanes with asterisks were loaded with C57/Bl6-positive
control genomic DNA.
(F) Hippocampal tissues from the mice were dissected and processed for western blot
analysis of SynGAP protein levels normalized to β-tubulin after TMX administrations
and behavioral testing (n = 7 per group; t test, p < 0.001).
See also Figure S6. Error bars depict SEM.
Discussion
SYNGAP1 Haploinsufficiency Accelerates the Maturation of Dendritic Spine
Synapses during Neonatal Development
In this study, we report that dendritic spine synapses are profoundly impacted

by SYNGAP1 haploinsufficiency during early postnatal development. This critical
period of robust synaptogenesis and functional synapse maturation is marked by a
steep rise in neural excitability. A major mechanism occurring during these first few
weeks of rodent brain development is synapse unsilencing (Kerchner and Nicoll,
2008). Although many synapse types are morphologically intact and capable of
releasing glutamate, the majority of glutamaterigic postsynapses on excitatory neurons
are not yet functional (Ashby and Isaac, 2011; Isaac et al., 1997; Petralia et al., 1999).
Gradually, these synapses acquire functional AMPARs, driving an increase in neural
circuit excitation. Our data demonstrate that an essential function of SynGAP during
early brain development is to control the gain of excitatory synapses by restricting
AMPAR accumulation apposed to presynaptic release sites, particularly in the phase
of development where glutamatergic synapses gradually acquire AMPARs (e.g., the
first 21 days of rodent development). Mechanistically, SynGAP shapes developmental
synaptic function through its synaptic GAP activity, where it suppresses many
biochemical signaling cascades within dendritic spines that promote growth of
synapses and insertion of AMPARs (Kim et al., 2005; Krapivinsky et al.,
2004; Rumbaugh et al., 2006). This broad action of SynGAP on dendritic spine
signaling arises from its central location in the NMDAR complex (Kennedy et al.,
2005) and its endowment with a promiscuous GAP domain that can regulate a variety
of small G-proteins (Krapivinsky et al., 2004; Pena et al., 2008). However, the role
that SynGAP plays in neurons to regulate dendritic spine synapse function has been
controversial because some studies report that SynGAP is a repressor of these
synapses (Kim et al., 2005; Rumbaugh et al., 2006; Vazquez et al., 2004), whereas
others report that it stimulates them (Krapivinsky et al., 2004; McMahon et al., 2012).
Adding to the confusion, a recent report has demonstrated that SynGAP can enhance
or inhibit dendritic spine synapse function depending on the particular isoform
expressed (McMahon et al., 2012). Although the roles of SynGAP may be complex at
the cellular level, an important advance arising from our current study is the clear
demonstration that SYNAGAP1 inactivating mutations present during
early development have the net effect of derepressing the maturation of dendritic
spine synapse in the hippocampus. Thus, we propose that a core neurophysiological
outcome of human SYNGAP1 haploinsufficiency is developmental hyperexcitability
triggered by early dendritic spine synapse maturation.
The profound increase in glutamatergic synaptic strength caused
by SYNGAP1 haploinsufficiency was only observed in an early period of hippocampal
development. In addition, we observed this transient change in postsynaptic
function at multiple synapses in the hippocampus, indicating that this phenomenon is
widespread across neocortical dendritic spine synapses and is a primary outcome of
pathogenic SYNGAP1 mutations. This effect in Het mice could arise from abnormally
strong synapses that overshoot a predetermined level of function. Alternatively,
because we show that SynGAP is a developmental repressor, it could also be caused
by accelerated synapse development. Our findings support the latter possibility.
Indeed, Het levels of postsynaptic function during the second postnatal week closely
resembled that of adult WT animals, indicating that Het synapses achieve adult levels
of strength earlier than their WT counterparts. This idea was further supported by the
minimal impact of adult-induced SYNGAP1 haploinsufficiency on dendritic spine
synapse function. Dendritic spines were less dynamic in the young Het brain, and
these spines obtained adult levels of motility and plasticity earlier than WT animals.
These findings are consistent with the role of SynGAP as an essential repressive
factor that contributes to the developmental trajectory of glutamatergic synapse
maturation (Kim et al., 2003; Rumbaugh et al., 2006; Vazquez et al., 2004). Our
proposed “accelerated maturation” hypothesis also explains why others have failed to
detect changes in hippocampal synaptic strength in adult SynGAP Het mice (Kim
et al., 2003; Komiyama et al., 2002).
The Impact of Aberrant Dendritic Spine Synapse Maturation on Circuit

Function and Behavior
A major outstanding question in the field of neurodevelopmental disorders is how

developmental disruptions to synapse maturation are translated into abnormal systems
level alterations that impact cognition and behavior. E/I imbalance is a defining
neurophysiological feature of neurodevelopmental disorders (Rubenstein and
Merzenich, 2003) and elevated excitation is sufficient to disrupt cognition and
sociability (Yizhar et al., 2011). We have found that the effects
of SYNGAP1 haploinsufficiency on synapse maturation are translated into striking
changes to E/I balance and hippocampal information processing in the early neonatal
period. These data support a mechanism where premature maturation of glutamatergic
synapses directly shifts the balance of networks toward aberrant excitation. These
circuit-level excitability changes in neonates were accompanied by a reduced seizure
threshold and elevated activity in the open field arena, suggesting that abnormal
synapse maturation is directly altering behavioral performance and cognition.
Our data suggest that the large increase in neonatal hippocampal excitability occurs
through selective loss of the normal repressive action of SynGAP on glutamatergic
synapses in glutamatergic neurons. A selective effect on excitatory synapses during
early development would be expected to produce a particularly profound
hyperexcitation in the hippocampus, a brain region that is already sensitive to
overstimulation due to the high level of recurrent excitation within the trisynaptic
network (Lisman, 1999). Recurrent excitation is balanced by feed forward inhibition.
However, the local GABAergic networks that counteract excitation develop slowly
between PND10–21 (Danglot et al., 2006), contributing to the susceptibility of the
neonatal mammalian brain to seizure (Bender et al., 2004). Thus, the mammalian
brain is ill-equipped to compensate for the enhanced developmental excitability
caused by SYNGAP1 haploinsufficiency. Interestingly, GABAergic synaptic currents
were elevated in DGNs in early development. However, because SynGAP is
selectively localized to excitatory synapses (Chen et al., 1998; Kim et al., 1998), this
effect is likely explained by a homeostatic upregulation of the GABAergic
system caused by elevated network excitation triggered by prematurely developing
spine synapses. Thus, we propose that rapid dendritic spine synapse maturation
in SYNAGAP1 mutants triggers a chain-reaction of compensatory cellular and systems-
level events that may ultimately support organismal survival at the expense of
intellectual development. This hypothesis presents a framework for understanding
how reduced SynGAP expression in the neonate can have such a profound impact on
cognitive development that persists throughout life.
In conclusion, we propose that altered E/I balance in early development, which is a
major outcome of SYNAGP1 haploinsufficiency, directly contributes to cognitive and
behavioral abnormalities observed in this disorder. E/I balance influences the duration
and efficacy of critical period plasticity windows (Hensch, 2004), which permit
refinement of connections that ultimately give rise to cognitive and behavioral
modalities. Due to the pervasive disruption of synapse development and E/I balance in
the neonatal SynGAP Het brain, we believe that critical windows of neural plasticity
prematurely close or perhaps never open in the first place. In support of this
hypothesis, the timing of synapse disruptions seen in Het mice precedes many of the
known critical periods of neocortical development (Hensch, 2004). In addition, we
show that dendritic spines become larger and functionally stronger earlier in
development compared to WT animals. These features are characteristic of stable
synapses that are less likely to be eliminated in vivo (Holtmaat et al., 2005). Most
strikingly, however, SynGAP mutations cause dendritic spines to become less motile
in early development. In fact, spine motility rates in young SynGAP Hets are
indistinguishable from adult WT animals. The precise function of spine motility is
still unknown, but there is strong evidence that it serves to promote initial wiring or
rewiring of neuronal circuits during development (Konur and Yuste, 2004; Majewska
and Sur, 2003; Yuste, 2011). Thus, a mutation that causes excessive developmental
neural excitation, larger and stronger synaptic connections, and reduced spine motility
is highly suggestive of neural networks that are initially miswired and thus resistant to
later phases of experience-dependent refinement. A network with these irregular
features would be expected to have altered windows of cortical development, resulting
in cognitive dysfunction. In support of this idea, rescue of pathogenic SYNGAP1
mutations after critical periods close (e.g., adulthood) did not improve basic
behavioral and cognitive abnormalities seen in the mouse model of the disease,
suggesting that early spine synapse defects contribute to the disorganization of
developing neural circuits that guide these behaviors in adulthood. Future studies will
be necessary to understand precisely how developmental synapse disruptions
influence the organization of neural circuits that govern intellectual and cognitive
development.
Experimental Procedures
For all studies, the experimenter was blind to genotypes. The heterozygous
SynGAP KO mouse line has been described previously (Kim et al., 2003), and all
studies utilized both males and females. The SYNGAP1 conditional KO line and
the SYNGAP1 rescue line are described in the supplemental materials. For behavioral
tests, adult animals were at least 12 weeks of age unless otherwise noted. For
electrophysiological studies, acute brain slices were prepared from PND7–PND9,
PND14–16, PND21–23 and 6- to 9-week-old mice. For input-output studies, slices
were prepared from one WT and one Het pair each day. Whole-cell current/voltage
clamp experiments were made from visually identified DGNs in the molecular layer
with glass microelectrodes with an open-tip resistance of 5–8 MΩ. Two-photon
imaging of DGN dendrites was performed with a multiphoton laser-scanning
microscope (Olympus FV1000MPE-TWIN), equipped with a water
immersion objective lens (ULTRA 25x, numerical aperture 1.05, Olympus) and
FluoView software. Spines were imaged in acute slices from both Het and WT brain
at PND8–9, PND14–16 and PND > 60. Six to nine dendritic segments of ∼20–30 μm
were collected and considered for analysis. Segments were traced and each individual
spine was marked and measured (spine width, length, head diameter). Spontaneous
spine head plasticity was evaluated in terms of relative change in spine volume and
occurrence of probability of events in both Het and WT PND 14–16 and PND > 60
brain slices. We quantified relative changes in spine-head volume by measuring
intensity of the spine head relative to the nonsaturated parent dendrite (background
signal was nominal). For voltage-sensitive dye imaging studies, optical
recording of voltage sensitive dye (VSD) signals was performed by the MiCAM02
system with a sampling rate of 2.2 ms per frame (frame resolution 88 (w) × 60 (h)
pixels). Stimulation was achieved by UV uncaging of MNI-glutamate. Under the 2×
objective, the imaging field covered the area of 2.56 × 2.14 mm2 with a spatial
resolution of 29.2 × 35.8 μm/pixel. Complete methods for each type of experiment,
including all behavioral paradigms and mouse targeting strategies, are documented
in Extended Experimental Procedures.
Extended Experimental Procedures
Extracellular and Whole-Cell Electrophysiological Studies
Preparation of Hippocampal Slices

Acute brain slices were prepared from male or female P7–P9, P14–P16, P21–23 and
6- to 9-week-old SynGAP WT and Het mice. All experimental animals were bred and
maintained in the Animal Resource Center at The Scripps Research Institute. These
mice have been described elsewhere (Guo et al., 2009; Kim et al., 2003). The mice
were sacrificed by cervical dislocation in accordance with the National Institute of
Health Guide for the Care and Use of Laboratory Animals and with protocols approved by
the Scripps Institutional Animal Care and Use Committee. Following decapitation, the
brain was rapidly removed and placed in ice-cold cutting solution, which composed of
(mM): 110 choline-Cl, 25 NaHCO3, 1.25 NaH2PO4, 2.5 KCl, 0.5 CaCl2, 7 MgCl2,
25 Glucose, 11.6 Ascorbic acid, 3.1 Pyruvic acid, equilibrated with 95% O 2 and 5%
CO2. The tissue was then mounted on a Vibrating microtome (Leica VT1200S,
Germany), and 350 μm thick horizontal sections were cut. Following slicing, the
overlying cortex was dissected free from rest of the hippocampus. The slices were
then warmed to 33°C for 30–45 min in standard artificial cerebrospinal fluid (aCSF),
composed of (mM): 124 NaCl, 3 KCl, 24 NaHCO3, 2 CaCl2, 1.25 NaH2PO4, 1 MgSO4,
and 10 D-Glucose, and equilibrated with 95% O2 and 5% CO2. Following this, slices
were maintained in gassed aCSF at room temperature until being transferred to
submerged-type recording chambers of volume ∼1.5 ml. Here the slices were
constantly superfused (2–3 ml/min) with warmed (33°C), gassed aCSF (95% O2 and
5% CO2). All measurements were performed by an experimenter blind to the
experimental conditions.
Extracellular Field Recordings
For input-output studies, slices were prepared from one WT and one Het pair each
day. The experimenter was blind for genotypes. Field EPSPs ( fEPSPs) were elicited
by a concentric bipolar stimulating electrode (Inner dia: 25 μm; outer dia: 125 μm,
FHC,) connected to a constant current isolated stimulator unit (Digitimer, UK). These
stimulating electrodes were placed either at Medial Perforant pathway (MPP) or at
Schaffer-collateral commissural pathway. For dentate gyrus experiments, fEPSPs
were recorded from the middle molecular layer and for CA1 pyramidal cell
experiments, fEPSPs were recorded from stratum radiatum of CA1 area of the
hippocampus. These fEPSPs were recorded with low-resistance (3–5 MΩ) glass
pipette (ID:0.6mm, OD:1.2 mm, Harvard Apparatus) filled with aCSF. Stimulation
frequency was set to 0.1 Hz. Input-output curves were generated by setting a
particular stimulation range of 20–40 μs and by adjusting the stimulus intensity by
20 μA per sweep with increments from 0–300 μA. Paired pulse ratio (PPR) was
assessed with a succession of paired pulses separated by intervals of quarter log units,
with the intervals ranging from 3 to 1000 ms. The paired pulses were delivered every
10 s. The degree of depression (DGGC) or facilitation (CA3-CA1) was determined by
taking the ratio of the initial slope of the second fEPSP over relative to the first
fEPSP. PPR > 1 is considered as paired pulse facilitation.
Whole-Cell Patch Clamp
Whole-cell patch/current clamp experiments were made from visually identified

DGNs in the outer molecular layer located at the transition between upper and lower
blades. Care was taken to only use slices from the same dorsal-ventral region of the
hippocampus. Using these section criteria, we observed very little variability in
intrinsic properties of granule neurons and we did not observe differences in intrinsic
properties between genotypes at P14 (Figure 2E). Therefore, because
intrinsic excitability is correlated with the age of a DGN (Espósito et al., 2005), we
believe that birthdate (age) of DGNs were similar between genotypes. Thus, we
believe similar populations of DGNs were sampled between genotypes at each age.
Glass micro-electrodes with an open-tip resistance of 5–8 MΩ were used. Cells with
series resistance >30 MΩ were discarded from the analysis. The following internal
solution was used to measure the excitatory components (mM): 130 Potassium
Gluconate, 20 KCl, 10 K-HEPES, 0.2 EGTA, 0.3 Na-GTP and 4 Mg-ATP (pH 7.3,
285–290 mOsm). Cells were permitted to follow the resting membrane potentials,
which were corrected post hoc for −14 mV liquid junction potential. To determine
intrinsic cellular properties of DGGC such as resting membrane potential, input
resistance and spike numbers, etc., 500 ms, 50 pA, 9-step hyperpolarizing and
depolarizing current injections were delivered every 10 s. Spike threshold was
calculated by injecting up to 2 nA for 2ms. Cells with resting membrane potentials
>−65 mV were excluded from analysis. AMPAR-mediated currents were evoked by
extracellular stimulation at MPP and by holding the cell at −70 mV in normal aCSF.
NMDAR-mediated currents were then acquired by washing in aCSF containing 0
Mg2+, 5 μM NBQX and 10 μM Bicuculline. AMPA-NMDA ratio was determined by
calculating the ratio of peak amplitude of AMPA and NMDA currents. Synaptic
NMDA current deactivation kinetics were obtained by fitting a double-exponential
function in decay phase of the NMDA current and applying the value in the
equation:τw=[If(If+Is)]∗τf+[IsIf+Is]∗τswhere τw is the weighted Tau, If and Is are the
amplitude of fast and slow current, while τ f and τs are the decay time constants of fast
and slow currents respectively (Rumbaugh and Vicini, 1999).
Miniature EPSCs (mEPSCs) were measured by holding the cells at −70 mV in normal
aCSF and in the presence of 1 μM TTX and 10 μM bicuculline. The average of at
least 100 events from each cell was obtained mEPSC measurement. Any DGGC
recording with a holding current greater than −30 pA or unstable during the course of
the recording was not considered for analysis. To assess miniature inhibitory currents
(mIPSCs), the following internal solution was used (mM): 120 CsCl, 10 K-HEPES,
10 EGTA, 5 QX314-Br, 4 Mg-ATP, 0.3 Na-GTP, 4 MgCl2 (pH 7.3, 285–290 mOsm).
mIPSCs were measured by holding the cells at −70 mV in the presence of 5 μM
NBQX, 100 μM D-AP5 and 1 μm TTX. Averages of 100 events from all the cells
were considered for these analysis. Any cell with a holding current greater than
−30 pA or unstable during the course of the recording was discarded from
measurement. The events were considered mini-EPSCs or -IPSCs if the peak of an
event was >4 pA. This threshold was obtained by calculating the 3X the average
square root of basal noise level of all the cells used for analysis.
Data Acquisition and Storage
All signals were amplified with Multiclamp 700B (Molecular Devices), filtered at 2
KHz, digitized (10–50 KHz) and stored on a personal computer for off-line analysis.
Analog to digital conversion was performed with the Digidata 1440A (Molecular
Devices). Data acquisitions and analyses were performed with pClamp 10.2 software
(Molecular Devices).
Drugs
In all the experiments, drugs were delivered to the slice preparation via the perfusion
system. 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX),
D-2-amino-5-phosphonopentanoate (D-AP5), tetrodotoxin (TTX), bicuculline were all
purchased from Tocris Biosciences. All drugs were aliquoted into small quantities in
stock concentration and stored at −20°C.
Statistics
Statistics were performed with SPSS 13.0. Data are presented as mean ± SEM.
Student’s unpaired t tests or ANOVA were performed to determine the statistical
significance as appropriate. To find statistical difference for the Input-output
relationships, linear regression was performed on the individual slices to determine
the slope of the relationship, and then a one-way ANOVA (genotype) was preformed
on the regression points (Zaman et al., 2000). Example traces are those recorded for
1–2 min around the time-point indicated.
Spine Imaging Studies
Two-Photon Excitation Imaging
Two-photon imaging of DGN dendrites was performed with multiphoton laser

scanning microscopy (Olympus FV1000MPE-TWIN), equipped with a water
immersion objective lens (ULTRA, 25x, numerical aperture 1.05, Olympus) and
Fluoview software (Olympus). Homozygous Thy1-GFPm mice were crossed to
SYNGAP1 Het mice resulting in eGFP expression in a subset of DGNs. The same
slicing method and DGN selection criterion was used as above. To take images of
dendrites, we used a Ti:sapphire laser to excite eGFP and collected emitted photons
with an external nondescanned detector after passing through a 500–550 nm bandpass
filter. For spine density and morphology, we imaged multiple branches emanating
from several DGNs by Z-sectioning through the slice (from 25–75 μm from slice
surface). We then imaged two to three segments per slice in XYZT dimension to
measure spine dynamics (∼20 μm Z stack; 120 min time series; 5 min between
stacks). The imaging parameters used were excitation = 895nm, power at sample =
∼10 mW, pixel dwell time = 2.0 μs, x-y scaling = 0.099 μm/pixel, z scale = 0.87 μm;
no averaging.
Spine Density and Spine Head Diameter

Spines were imaged in acute slices from both Het and WT brain at P8–9, P14–16, and
p > 60 post. Six to nine dendritic segments of ∼20–30 μm in length were collected
and considered for analysis. As segments were traced, each individual spine was
marked and measured (i.e., spine width, length, and head diameter). Only
protuberances with a clear connection of the head of the spine to the dendritic shaft
were counted as a spine. Because no significant difference between secondary and
tertiary branch order in terms of spine density was observed; measurements were
pooled for each slice in order to obtain spine density. All measurements were
performed by an experimenter blind to the experimental conditions. Pictures were
visualized and elaborated with Neurolucida software (MicroBrightField,) and the
protrusions with ≤0.4 μm in head diameter were excluded given that the best-case
resolution of our optical system was ∼0.38 nm (determined by FWHM measurements
of sub-resolution beads excited at 895 and collected with our green external detector).
Spine Motility Analysis
Motility was assessed in both Het and WT brain slices (350 μm) following standard
published procedure (Majewska and Sur, 2003). Briefly, spines were analyzed on two-
dimensional projections containing 24 images after Z stack compression (5 min
between frames). Images were processed and aligned with ImageJ software (NIH). To
compensate for x-y drifting inherent to time series imaging, X-Y-Z-T stacks were
registered with the ImageJ plugin, StackReg. Spine motility was expressed as the
average change in length per unit time (μm/min) and lengths were measured by
tracing a line from the base of the protrusion to its tip, which has the advantage of
being insensitive to drift (Majewska and Sur, 2003).
Spontaneous Spine Head Plasticity
Spontaneous spine head plasticity (SSHP) measurements were taken from the same
recordings as spine motility (see above). Spontaneous plasticity was evaluated in
terms of relative change in spine volume and occurrence of probability of events in
both SynGAP1 Het and WT PND 14–16 brain slices. We measured relative changes in
spine-head volume by measuring intensity of the spine head relative to the
nonsaturated parent dendrite over time (Harvey and Svoboda, 2007). “Spine enlarged
event” (T0’ event) was visually detected and measured by a line-intensity analysis.
The “T 0’ event” intensity detection was normalized to the intensity of the parent
dendritic shaft, yielding a relative spine volume (Harvey and Svoboda, 2007). This
relative volume was then compared to the relative volume of the same spine at other
time points. Only spines that showed ≥50% increase (T = 0 compared to T = −10)
were deemed “enlarged” (Matsuzaki et al., 2004). To derive frequency of plasticity
events, we identified all enlargement events in each slice and then divided by the total
number of spines in the slice.
DGN Sholl Analysis
To evaluate DGN dendritic tree complexity and volume, a computer-based system

(Neurolucida; MicroBrightField) was used to generate three-dimensional neuron
tracings that were subsequently visualized and analyzed with NeuroExplorer
(MicroBrightField). In order to select a neuron certain criteria were followed, such as:
(1) neuron was selected starting from the middle of stack (∼120 μm ± 30 μm) to
ensure the accurate reconstruction of entire neuron; (2) neuron was distinct from other
neurons to allow for identification of branches; (3) neuron was not truncated. For
every reconstructed neuron, an estimate of dendritic complexity of DG granular cells
was obtained with the Sholl Analysis. A 3D Sholl analysis was performed in which
concentric spheres of increasing radius (20 μm increments) were layered around the
cell body until branches were completely enveloped. The total length of branches, the
number of dendritic intersections at each sphere and the dendritic orders were
measured. A total of 80 neurons (n = 10 each animal) were traced by the experimenter
who was blind to genotypes.
Statistics
Results were expressed as mean ± SEM. Differences in spine density, SSHP and
motility were evaluated by means of a two-way ANOVA with genotype (SynGAP1
Het, WT) and Age (PND 8–9; 14–16; > 60) as main factors. Spine head diameter
cumulative frequency analysis was performed with Kolmogorov-Smirnov two-sample
test because spine head diameters showed a clear nonnormal distribution. SSHP
dynamics was assessed with one-sample t test where 4 different time points (T-20’, T-
15’, T 0’ and T +60’) were compared with the reference time point (T-10’; population
mean = 100), in both SynGAP1 Het and Wt PND 14–16. One-way ANOVA was used
to compare normalized spine volume in WT no-SSHP, WT SSHP, HET no-SSHP and
HET SSHP. Post hoc analyses were performed with the Bonferroni protected least
significant differences test.
Immunoblotting
Hippocampi were dissected in ice-cold PBS and immediately homogenized in RIPA

buffer (Cell Signaling Technology, Danvers, MA) containing Phosphatase Inhibitor
Cocktails 2 and 3 (Sigma-Aldrich, St. Louis, MO) and Mini-Complete Protease
Inhibitor Cocktail (Roche Diagnostics), transferred to tubes in dry ice, and stored at
−80°C. Sample protein levels were measured (Pierce BCA Protein Assay Kit, Thermo
Scientific, Rockford, IL), and volumes were adjusted to normalize microgram per
microliter protein content. 10 μg of protein per sample were loaded and separated by
SDS-PAGE on 12% Tris-glycine gels (Mini Protean TGX, BioRad, Hercules, CA),
transferred to PVDF membranes (88518, Thermo Scientific), and processed for
western blot analysis of immunoreactivity to phospho S3 (pS3) cofilin (1:1000;
ab12866; Abcam, Cambridge, MA), cofilin (1:10,000; CF01; Cytoskeleton, Denver,
CO), or anti-β-Tubulin (clone AA2; 05-661; Millipore, Billerica, MA) with
appropriate species-specific secondary antibodies (W4011-rabbit; W4021-mouse;
Promega, Madison, WI) followed by signal amplification and chemiluminescence
detection (SuperSignal West Pico Chemiluminescent Substrate; Thermo Scientic,
Rockford, IL). Blots were developed (Blue Lite Autorad Film-double emulsion med.,
ISC BioExpress, Kaysville, Utah). Levels of immunoreactivity were assessed by
densitometric analysis of films with ImageJ (NIH, Bethesda, MD) as described
previously. Statistical significance was determined by one-way ANOVA or t test.
qPCR of SynGAP Transcript Levels
Wild-type C57BL/6J males and females from The Jackson Labs (Bar Harbour, ME)
were mated, and the females were examined daily for the presence of a postcopulatory
plug. Brain tissue was collected from fetuses on embryonic (E) days 15 and 18, and at
postnatal days (PND) 1, 7, 14, 21, 28, and 60. Group sizes ranged from five to eight
mice per time point. Tissue was collected from both males and females at PND14 and
earlier, and from males only at PND21 and all later time points. Males were used at
later time points to avoid possible transitional regulation caused by estrous cycling.
The tissue was snap-frozen in TRIzol (Invitrogen, Carlsbad, CA) and stored at −80°C.
RNA was extracted with a standard phenol:chloroform process and stored at −80°C.
5 μg RNA from each sample was reverse-transcribed with Superscript III (Invitrogen).
In order to identify an endogenous control that didn’t vary across developmental
stage, 100 ng total cDNA from each sample was assayed for expression of both
Gapdh (4352339E, exon 3, primer-limited) and 18S with Taqman standard
endogenous control assays (Applied Biosystems). Raw Ct values were used as the
output for this analysis. Gapdh showed no significant variation between any
developmental stage, and was therefore selected as the endogenous control for
subsequent qPCR assays. SynGAP expression was measured with an inventoried
Taqman assay from Applied Biosystems (Mm01306135_m1, spans exons 1–2) and
the results were calculated with the ddCt method.
Audiogenic Seizure
Our procedure closely followed methods previously described (Osterweil et al., 2010).
One WT and one SynGAP heterozygous (HET) mouse (P21–25) were placed together
into a 25 x 18 x 15h-cm transparent plastic chamber (Hefty) with clean bedding
equipped with an alarm system (Choice Alert Control Center (45129) and Alarm Siren
(45136) affixed to the inside of the chamber lid with a separate wireless/remote
window/door sensor (45131); Jasco Products Co./General Electric, Oklahoma City,
OK). The sensor was used to trip the alarm two minutes after the mice were
introduced into the chamber. The alarm was stopped 2 min after alarm initiation. The
experiments were video recorded (see Movie S3 for an excerpt). A sound level meter
(Extech 407730; Melrose, MA) measured sound levels of the alarm at 126 dB inside
the container with bedding and lid in place before trials commenced. Wild running,
seizure, and death occurrences were tallied. Wild running consisted of very rapid
running typically around the perimeter of the chamber occurring before onset of a
dramatic clonic-tonic-like seizure characterized by the mouse falling on its side,
stiffening of its body, and repeated cycling of its limbs, followed by extensions of its
arms and legs.
Open Field Test
Naive adult WT and SynGAP het mice were individually introduced into one of four
adjacent open field arenas for 30 min and allowed to explore. Open field arenas
consisted of custom-made clear acrylic boxes (43 × 43 × 32h cm) with opaque white
acrylic siding surrounding each box 45 × 45 × 21.5h cm to prevent distractions from
activities in adjacent boxes. Activity was monitored with CCTV cameras (Panasonic
WV-BP334) feeding into a computer equipped with Ethovision XT (Noldus
Information Technology,) for data acquisition and analysis. A white noise generator
(2325-0144, San Diego Instruments) was set at 65 dB to mask external noises and
provide a constant noise level. Fluorescent linear strip lights placed on each of the
four walls of the behavioral room adjacent to the ceiling provided a lower lighting
(200 lux) environment than ceiling lighting to encourage exploration.
Elevated Plus Maze
A dedicated OFT/Elevated Plus Maze (EPM) room in the Mouse Behavioral Core
containing a black acrylic EPM apparatus (Model ENV-560A, Med Associates, St.
Albans, VT) consisting of two closed arms and two open arms extending from an
open square center area was used to measure anxiety-like or risk-taking behaviors.
The arms of the maze (34.9 × 6 cm) were situated in a plus orientation with the each
of the open arms and each of the closed arms radiating 180 degrees from each other.
Closed arm walls were 19.7 cm high extending from the base of the arm; open arms
had no walls. The entire apparatus was placed in a far corner of the room with a two-
walled construct at the opposite corner. A white plus-shaped corrugated coated
cardboard cut-out was inserted into the floor of the maze arm for tracking dark-
colored mice. Ambient lighting and white noise levels were set at the same levels as
with OFT such that lighting levels within closed arms were half that of the open arms.
One CCTV camera (Panasonic WV-BP 334) was connected to a computer equipped
with tracking software (Ethovision XT 7.1). Mice were individually placed in the
center of the maze at the beginning of each trial. Each mouse was allowed to explore
the maze for 5 min and analyzed for percent time spent in the open arms.
Spontaneous Alternation
A dedicated T-maze room in the Mouse Behavior Core containing four T mazes (Med
Associates) placed in various orientations was used to assess working memory in a
discreet-two-trials Spontaneous Alternation (SA) paradigm. Each maze contained
three arms with walls made opaque including a start box (17.8 × 7.3 cm) at the base of
the start arm (38.1 × 7.3 cm) and adjoined to a central choice area (10.2 × 10.2 cm)
with two choice arms 30.5 × 7.3 cm) radiating 180 degrees from the central choice
area. Automatic guillotine doors were installed at the end of the start arm box and at
the entrances of each of the choice arms. Two of the mazes oriented 180 degrees from
each other were used for all assessments with each mouse tested in a different maze
on three consecutive days before and after TMX injections. Each test consisted of two
free-choice trials separated by a 1 min inter-trial interval (ITI) when the mouse was
confined to the start box. At the commencement of each test, the mouse was placed in
the start box with a guillotine door opening once the animal was detected. Once the
mouse traveled down the start arm and into one of the choice arms that door closed.
The mouse was left in this choice arm for 10 s before being gently scooped up and
returned to the start arm for Trial 2. After the 1 min ITI, the start box door
automatically opened and the mouse was allowed another free-choice trial. If the
mouse entered the opposite arm from that of the first trial, the responses were
recorded as an alternation.
Context Discrimination
The fear conditioning equipment was described previously (Tayler et al., 2011).
Briefly, mice were trained in individual conditioning chambers encased in white
sound-attenuating boxes (Med Associates, St. Albans, VT). Each chamber was
equipped with a speaker in the side wall, a stainless steel grid floor and a drop-pan.
An overhead LED-based light source provided visible broad spectrum white light and
near-infrared light. Video images were recorded via a progressive scan CCD video
camera with a visible light filter that was contained within each chamber and
connected to a computer in the same room. The freezing response was measured with
the automated VideoFreeze system (Med Associates). In context A, visible light was
turned on, a flat grid floor was inserted, and the chambers were cleaned with 95%
ethanol prior to conditioning. In context B, a black plastic triangular tent translucent
to NIR light was placed inside the chamber. A staggered grid floor was inserted and
the chambers were cleaned with Saniwipes (Nice-Pak Products).
During the first 10 training sessions, mice were placed in context A and allowed to
explore for 3 min prior to the delivery of shock (0.5 mA, 2 s). Mice were removed
from the conditioning chamber 1 min after shock. Freezing was measured each day
during the 3 min baseline period. After 10 sessions of conditioning in context A, mice
underwent 5 sessions of discrimination training. Each session consisted of training in
context A (as just described) and a 3 min exposure to context B in the absence of
shock. Mice were exposed to 1 context each day in an alternating fashion (i.e., B, A,
B, A, B, A, B, A, B, A). Freezing was measured during the first three minutes of
exposure to each environment.
Fluorothyl-Induced Seizures
Fluorothyl-induced seizure induction studies were performed as previously described

(Dravid et al., 2007).
Flash Photolysis of Caged Glutamate and Voltage Dye Recordings
Slice Preparation
All animals were handled and experiments were conducted in accordance with
procedures approved by the Institutional Animal Care and Use Committee at the
University of California, Irvine. To prepare living brain slices, animals were deeply
anesthetized with Nembutal (>100 mg/kg, i.p.), rapidly decapitated, and their brains
removed. Hippocampal slices were cut 400 μm thick with a vibratome (VT1200S;
Leica Systems, Germany) in the artificial cerebrospinal fluid (CSF) (in mM: 126
NaCl, 2.5 KCl, 26 NaHCO3, 2 CaCl2, 2 MgCl2, 1.25 NaH2PO4, and 10 glucose) with a
broad-spectrum excitatory amino acid antagonist kynurenic acid (1 mm). Slices were
first incubated in the ACSF for 30 min to 1 hr at 32°C, and after the initial incubation
period, transferred to a chamber containing ACSF with 0.02 mg/ml of an oxonol dye,
NK3630 for the dye staining at room temperature. The slices were stained for 1 hr and
then maintained in regular ACSF before use. Throughout the incubation, staining and
recording, the slices were continuously bubbled with 95% O 2–5% CO2.
Voltage-Sensitive Dye Imaging and Photostimulation
Experiments were performed as previously described (Xu et al., 2010). Briefly, slices
were visualized with an upright microscope (BW51X; Olympus, Tokyo, Japan)
with infrared differential interference contrast optics. Electrophysiological
recordings, photostimulation, and imaging of the slice preparations were done in a
slice perfusion chamber mounted on a motorized stage of the microscope. At low
magnification (2× objective lens), laminar and cytoarchitectonic features of brain
slices were visualized under infrared bright-field transillumination; and the slice
images were acquired by a high resolution digital CCD camera (Retiga 2000, Q-
imaging, Austin, TX). Digitized images from the camera were used for guiding and
registering photostimulation sites in cortical slices.
Stock solution of MNI-caged-l-glutamate (4-methoxy-7-nitroindolinyl-caged l-
glutamate, Tocris Bioscience, Ellisville, MO) was added to 20–25 ml of circulating
ACSF for a concentration of 0.2 mM caged glutamate. Our laser scanning
photostimulation and imaging system was described in detail previously (Xu et al.,
2010). Briefly, a laser unit (model 3501; DPSS Lasers, Santa Clara, CA) was used to
generate 355 nm UV laser for glutamate uncaging. The physical size of laser
excitation was about 200 μm in diameter through the 2× objective. Short durations of
laser flashes (2 ms) were controlled with an electro-optical modulator (i.e., pockels
cell) (Conoptics, Danbury, CT) and a mechanical shutter (Uniblitz; Vincent
Associates, Rochester, NY). Various laser stimulation positions could be achieved
through galvanometers-driven XY scanning mirrors (Cambridge Technology,
Cambridge, MA), as the mirrors and the back aperture of the objective were in
conjugate planes, translating mirror positions into different scanning locations at the
objective lens focal plane. During uncaging, either a single site in DG granule cell
layer was photstimulated (2ms, 20 mW) or 5 sites across the whole DG blade was
scanning near simultaneously within 2 ms to activate DG output circuitry.
Voltage-Sensitive Dye Imaging and Data Analysis
A dual camera port was used to couple the Q-imaging camera and the laser scanning
photostimulation system to a MiCAM02 fast imaging system (SciMedia) for voltage-
sensitive dye imaging. Optical recording of VSD signals was performed by the
MiCAM02 system with a sampling rate of 2.2 ms per frame (frame resolution 88 [w]
× 60 [h] pixels). Under the 2× objective, the imaging field covered the area of 2.56 ×
2.14 mm2 with a spatial resolution of 29.2 × 35.8 μm/pixel. The trials were obtained
every 8 s and the recording periods were 1000 frames for each photostimulation trial.
VSD images were smoothed by convolving images with a Gaussian spatial filter
(kernel size: 5 × 5 pixels; δ size: 1 × 1 pixel) and a Gaussian temporal filter (kernel
size: 3 frames; δ size: 1 frame). VSD signal amplitudes were expressed SD above the
mean baseline signal for display and quantification. The larger values the stronger
responses. Image quantification and measurements were performed with custom-made
Matlab Programs.
As for quantitative analysis of evoked activation in image frames, the mean and
standard deviation of the baseline activity of each pixel across the 50 frames
preceding photostimulation was first calculated, and then activated pixels were
measured. The activated pixel was empirically defined as the pixel with the amplitude
≥ 1 SD above the mean of the corresponding pixel’s amplitude preceding the
stimulation (equivalent to the detectable signal level in the original VSD maps of ΔI/I
%). The activation strength (in the unit of SD numbers) of evoked VSD responses was
based upon measurements of targeted regions such as DG, CA3 and CA1. The
activation size in image frames was quantified based upon the number of activated
pixels. For statistical comparisons between groups, we used the Mann–Whitney U
test.
Generation of Novel SYNGAP1 Mouse Models
Conditional Knockout Line
The conditional SYNGAP1 knockout mouse line was constructed by genOway S.A.
(France). The design was based on our SynGAP conventional KO mouse line (Kim
et al., 2003), so that we could induce a conditional disruption of the SYNAGP1 locus
that mimicked this original mutant mouse. Thus, a targeting construct was prepared
that contained LoxP sites inserted between exon 5/6 (5′ site) and 7/8 (3′ site) of the
mouse SYNAGP1 gene (Figure S6). The 3′ LoxP site was flanked by a Neo selection
cassette, which could be excised at will by expression of Flip recombinase. This
validated targeting construct was electroporated into ES cells (129SvPas) and Neo-
resistant clones were screened by PCR. Both 5′ and 3′ LoxP insertions were confirmed
by Southern blot. Several founder lines were generated by injection of these positive
ES cell clones into C57/bl6 blastocysts. Chimeras were selected for breeding to F1.
The Neo cassette was subsequently removed by breeding of F1 SynGAP1 Flox mice
to Flip-deleter mice in a pure C57/Bl6 background. Neo deletion was confirmed by
PCR. These F2 Neo- SYNGAP1 flox mice were then shipped to Scripps Florida and
the colony was subsequently expanded in the TSFRI ARC.
Conditional Rescue Line, LoxP-Stop Hets
The conditional SYNGAP1 rescue mouse line was constructed by genOway S.A.

(France). The design was based on our SynGAP KO SYNGAP1 mouse line (Kim et al.,
2003), so that this new mouse would mimic our original conventional KO line, but
with the added flexibility of converting these mice back to WT with an inducible form
of Cre recombinase. Thus, a knockin targeting construct was prepared that contained
an artificial exon immediately downstream of exon 5 of the mouse gene (Figure S6).
This artificial exon contained the neomycin resistance gene, a series of stop codons,
and flanking loxP sites. This cassette would be expected to prevent the expression of
full length SynGAP protein, essentially mimicking our convention KO line, but then
expression would be restored in the presence of Cre expression through excision of
the Neo-stop cassette. The validated targeting construct was electroporated into ES
cells (129SvPas) and Neo-resistant clones were first screened by PCR. Correct
targeting of the LoxP-Stop cassette in ES cells was confirmed by Southern blot.
Several founder lines were generated by injection of these positive ES cell clones into
C57/bl6 blastocysts. Chimeras were selected for breeding to F1. F1 mice harboring
the LoxP-Stop cassette were then shipped to Scripps Florida and the colony was
subsequently expanded in the TSFRI ARC.
Tamoxifen Injections
TMX (Sigma T5648, St. Louis, MO) was dissolved into absolute ethanol
(Acros/Fisher Scientific 61510-0010, Pittsburg, PA) (10% of final volume) by
sonication to which corn oil was added for a final TMX dosage of 100 mg/kg,
injectable concentration of 20 mg/ml, and volume of 5 ml/kg. The day after baseline
behaviors were conducted, mice were i.p. administered the TMX solution once a day
for five consecutive days.
Southern Blot Analysis for Tamoxifen Rescue Experiment
Forebrain tissue was rapidly dissected and then snap frozen in liquid nitrogen. Tissue
was then expressed delivered (on dry ice) to genOway S.A (France) for Southern
blotting. The Southern blot strategy is based on an EcoNI digestion of the genomic
DNA and hybridization with a 5′ probe SA-E-A, and leads to the detection of the
following specific 5′ DNA fragments (Figure S6): WT = 5730 bp; LoxP-Stop =
7758 bp; LoxP-Stop excised = 4688 bp. The probe used for hybridization (444 bp)
was amplified with the following primers: 5′ =
AGAATGGGAATCTAAGAGCACTGAGCTGG; 3′ =
ACACACACAGAGCAAGGGCTTGGAC. Specific conditions for the
prehybridization and hybridization included treatments of 4 × SSC, 1% SDS, 0.5%
skimmed milk, 20 mM EDTA, 100 μg/ml herring sperm, at 65°C for 18 hr. This was
then followed by washing two times in 3 × SSC, 1% SDSat at 65°C for 15 min, then
two times 0.5 × SSC, 1% SDSat 65°C for 15 min. Blots were then exposure for 3 days
on BioMax MS films with BioMax intensifying screens.
Conditional Haploinsufficiency Experiments
Virus
Syn-iCre-Venus rAAV plasmid was a generous gift of Dr. Rolph Sprengel. This
construct drives expression of the yellow fluorescent protein, Venus, and the
optimized variant of Cre recombinase, iCre (Tang et al., 2009). The cDNAs are
separated by a T2A ribosomal skipping sequence that results in individual expression
of both proteins (i.e., not a Venus-iCre fusion protein). This plasmid was amplified
and purified and then sent to the Powell Gene Therapy Center at the University of
Florida for packaging in the AAV8 capsid. The resulting viral stock was purified and
concentrated (in PBS) to a titer of ∼1 × 1013 iu/ml.
Injections
PND1 SYNGAP1 Het Flox or WT mice were anesthetised for 3 min in ice and

unilaterally infused with 1 μl of Syn-iCre-Venus rAAV (1 × 1012 iu/ml) with a
neonatal stereotaxic adaptor (Stoelting Model 51625) in conjunction with a Kopf
small animal stereotaxic with the following coordinates relative to lambda for the
purpose of sparse transduction of hippocampal cells: A/P: +1.5; M/L: −1.0; D/V:
−2.0. A 33-gauge needle was used for the infusions at a rate of 0.33 μl/min after
which the needle was left in place for 3 min and pups transferred to a 85–90°C
incubator until active and returned to their respective dam. Brain slices (350 μl) were
cut 14 days after infusions for electrophysiological measurements. Six- to eight-week-
old SYNGAP1 Het Flox or WT mice were anesthetized with isoflurane and infused
with Syn-iCre-Venus rAAV into the right hippocampus with the following
coordinates relative to bregma: A/P: −3.3, M/L: −2.5, D/V: −3.5, −3.0, −2.5. One
microliter infusions were delivered at a rate of 0.1 μl/min into these three separate
sites equally (333 nl per level) with a 33-gauge needle that was left in place 10 min
after infusion.
Electrophysiology
Acute hippocampal brain slices were prepared as mentioned earlier. Cre infected cells
were tdTomato-positive cells, which were identified as red neurons by exciting
tdTomato with green light (X-cite series-120). To measure synaptic strength,
AMPA/NMDA ratio was measured from red (Cre-positive cells) and nonred cells by
whole-cell patch clamp method as mentioned earlier. Nonred cells were patched in
slices derived from the uninfected hemispheres. After the AMPA/NMDA
measurement was complete, high positive pressure was applied to the patch electrode
to make the cell rupture in order to verify that the patched cell was tdTomato positive.

Clement - 2012

Uploaded by

Copyright:

Available Formats

You might also like

Clement - 2012

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Clement - 2012

Uploaded by

Copyright:

Available Formats

Exposure to intimate partner violence and

children's psychological adjustment,

https://doi.org/10.1016/j.avb.2012.04.002 Get rights and content

https://doi.org/10.1016/j.cell.2012.08.045 Get rights and content

► Pathogenic SYNGAP1 mutations promote early maturation of hippocampal spine

SynGAP is expressed throughout the forebrain, with particularly high levels in

1. Download : Download high-res image (657KB)

We next sought to better understand the neurophysiological mechanism responsible

(D) Summary of cumulative percentage of mEPSC inter-event interval, which is reduced

Error bars represent SEM. See also Figure S1.

SYNGAP1 Haploinsufficiency Disrupts Dendritic Spine Dynamics during the

In pyramidal neurons, spine structure is tightly correlated with synapse function

Gradual acquisition of synaptic AMPARs and subsequent functional unsilencing

1. Download : Download high-res image (198KB)

SYNGAP1 Haploinsufficiency Alters Hippocampal Information Processing, E/I

We next sought to determine whether accelerated maturation of dendritic spine

Developmental SYNGAP1 Mutations Lead to Persistent Behavioral

The results thus far demonstrate that SYNGAP1 mutations responsible for persistent,

1. Download : Download high-res image (667KB)

(B) Southern blot from the F2 generation demonstrating that correct targeting of the

(C and D) Mean AMPA/NMDA ratios from either control (tdTomato-negative) or Cre+

(B) Southern blot from the F1 generation and western blot from F2 generation

In this study, we report that dendritic spine synapses are profoundly impacted

The Impact of Aberrant Dendritic Spine Synapse Maturation on Circuit

A major outstanding question in the field of neurodevelopmental disorders is how

Extracellular and Whole-Cell Electrophysiological Studies

Preparation of Hippocampal Slices

Extracellular Field Recordings

Whole-Cell Patch Clamp

Whole-cell patch/current clamp experiments were made from visually identified

Data Acquisition and Storage

Spine Imaging Studies

Two-Photon Excitation Imaging

Two-photon imaging of DGN dendrites was performed with multiphoton laser

Spine Density and Spine Head Diameter

Spine Motility Analysis

Spontaneous Spine Head Plasticity

DGN Sholl Analysis

To evaluate DGN dendritic tree complexity and volume, a computer-based system

Hippocampi were dissected in ice-cold PBS and immediately homogenized in RIPA

qPCR of SynGAP Transcript Levels

Open Field Test

Elevated Plus Maze

Fluorothyl-induced seizure induction studies were performed as previously described

Flash Photolysis of Caged Glutamate and Voltage Dye Recordings

Voltage-Sensitive Dye Imaging and Photostimulation

Generation of Novel SYNGAP1 Mouse Models

Conditional Knockout Line

Conditional Rescue Line, LoxP-Stop Hets

The conditional SYNGAP1 rescue mouse line was constructed by genOway S.A.

Southern Blot Analysis for Tamoxifen Rescue Experiment

Conditional Haploinsufficiency Experiments

PND1 SYNGAP1 Het Flox or WT mice were anesthetised for 3 min in ice and

You might also like