Proceedings The 6th Ibc - Rev 2.compressed - 2

ISBN : 978-602-14235-6-1
PROCEEDINGS
THE 6th INDONESIAN
BIOTECHNOLOGY CONFERENCE
“ENHANCING INDUSTRIAL COMPETITIVENESS
THROUGH BIOTECHNOLOGY INOVATION”
SURAKARTA, 6 - 7 SEPTEMBER 2016
EDITORS:
Prof. Dr. Ir. Ahmad Yunus, M.S
Prof. Dr.-ing. Misri Gozan, M. Tech., IPM
Prof. Dr. Ir. Edi Purwanto, M.Sc
Prof. Dr. Ir. Djoko Purnomo, M.P
Prof. Dr. Ekowati Chasanah
Dr. Siswa Setyahadi
Dono Indarto, dr. M. Biotech., STt., P.hD.
Dr. Ir. Amalia T. Sakya, M.Phill
Organized by : Published by :
Faculty of Agriculture
Universitas Sebelas Maret
February, 2017
In collaboration with :
PROCEEDINGS
The 6th Indonesian Biotechnology Conference
Surakarta, 6-7 September 2016
ISBN : 978-602-14235-6-1
PROCEEDINGS
THE 6th INDONESIAN BIOTECHNOLOGY CONFERENCE
ENHANCING INDUSTRIAL COMPETITIVENESS THROUGH
BIOTECHNOLOGY INOVATION
6 - 7 SEPTEMBER 2016
UNIVERSITAS SEBELAS MARET
SURAKARTA
EDITORS:
Prof. Dr. Ir. Ahmad Yunus, M.S
Prof. Dr.-ing. Misri Gozan, M. Tech., IPM
Prof. Dr. Ir. Edi Purwanto, M.Sc
Prof. Dr. Ir. Djoko Purnomo, M.P
Prof. Dr. Ekowati Chasanah
Dr. Siswa Setyahadi
Dono Indarto, dr. M. Biotech., STt., P.hD.
Dr. Ir. Amalia T. Sakya, M.Phill
DESIGN & LAYOUT:

The 6th IBC Organizing Committee
Published by :
Faculty of Agriculture, Universitas Sebelas Maret
Jl. Ir. Sutami No. 36 A. Kotak Pos 4 Slouns 57126. Kentingan, Surakarta.
Telp/Fax : (0271) 637457. Website : http:// fp.uns.ac.id
Conference website : http:// ibc.uns.ac.id
February, 2017
COPYRIGHT :
All right of the papers in this book are reserved to the individual authors, and all right of the other parts to
conference committee. No part of this publication may be reproduced in any form or by any means,
electronically or mechanically, or other wish without the prior permission the copyright owners. The
author is fully responsible for the content of their papers.
ii
PROCEEDINGS
PREFACE
First of all we would like said thanks to God who has given us blessing and
guidance so that all activities The 6th Indonesian Biotechnology Conference conducted
successfully and proceeding preparation was done without any obstacle. The 6th
Indonesian Biotechnology Conference with “Enhancing Industrial Competitiveness
Through Biotechnology Inovations” theme have several discussion topics, i.e.:
Agriculture and Forestry; Health and Medical; Energy and Environment; Marine and
Fisheries; Industrial and Bioscience Engineering.
We expect research articles from this conference proceeding could develope
Agriculture, Medicine, Energy, Environment, Marine and Fisheries fields in the near
future. All research articles in this proceeding has ISBN labels. The conference was
successfully organized by Universitas Sebelas Maret, Indonesian Biotechnology
Consortium (KBI) and sponsoship partners (PT. Fajar Mas Murni, PT. MERCK, PT.
ITS Indonesia, Croplife, PT. Dexa Laboratories of Biomolecular System and PT.
Diagindo). The committee was very gratefull for your support and assistance.
We wish to express our gratitude to all invited speakers, participant, steering and
organizing committee for full cooperation and contribution to this conference. Finally
we hope through this conference, we could put the best biotechnology innovations for
the prosperity of future communities.
The 6th IBC Chairman
Prof. Dr. Ir. Ahmad Yunus, M.S.
iii
PROCEEDINGS
ORGANIZING COMMITTEE
Chairman : Prof. Dr. Ir. Ahmad Yunus, M.S
Vice Chairman: 1. Dr. Siswa Setyahadi 3. Prof. Dr. Ir. Samanhudi, M.S
2. Prof. Misri Gozan 4. dr. Paramasari Dirgahayu, Ph.D
Secretary : 1. Dr. Ir. Amalia T Sakya, M.Phil
2. Dr. Ir. Tania Surya Utami, M.T
Treasurer : 1. Dr. Ir. Sri Hartati, M.P
2. Dra. Sih Parmiyatni
Secretariat :
1. Prof. Dr. Ir. Sulanjari, M.S 6. Dr. Tri Muji Ermayanti
2. Prof. Dr. Ir. Nandariyah, M.S 7. Dr. Ir. Suleman
3. Dr. Ari Susilowati, SSi., M.Si 8. Hartono Cahyo
4. Dr. Agr. Sigit Prastowo, M.S 9. Heni Prihutami, SH
5. Dr. Agr. Muhammad Cahyadi, M. Biotech
Funding :
1. Dr. Ir. Endang Yuniastuti, M.Si 6. Muryanto
2. Yawarsa Halim 7. Herry Kristanto
3. Elisabeth Maria, M.Si 8. Woro Umayi, S.SI, M.Si
4. Sara Wijayanti, S.Si 9. dr. Dian Nugroho
5. Sigit Sadewo, S.Si, M.M
Scientific Board :
Agriculture and Food Science :
 Prof. Dr.Ir.Bambang Pujiasmanto, M.S  Dr. Sc. Agr. Adi Ratriyanto
 Prof. Dr. Ir. Djoko Pumomo, M.P.  Dr. Aris Winaya
 Prof. Dr. Ir. Edi Purwanto, M.Sc.  Prof. Dr. Suharsono, DEA
 Dr. Saptowo J Pardal  Dr. Ir. Syarif Husen, M.P.
 Dr. Danar Praseptiangga, S.Tp. M.Sc.  Dr. Karden Mulya
 Ir. Supyani, M.P., M.Agr, Ph.D
Maritime Affairs & Fisheries :
 Dr. Ekowati Chasanah
Energy:
 Dr. Hadiyanto  Prof.Dr.Yanni Sudiyani
 Dr. Roy Nendroko
Industry and Environment :
 Ir. Setiarti Sukotjo, M.Sc  Dr.rer. nat. Abu Amar
Program and Publication :
 Dr. Widodo Hadi Saputro  Dr. Agr. Muhammad Cahyadi, M
 Ir. Hayati Minarsih, M.Sc., Ph.D Biotech
 Prof. Dr. Ir. Samanhudi, MS  Dr. Ahmad D. Setiawan
 Dr. Danar Praseptiangga, S.TP. M.Sc.  Dr. Tarwadi
Food and Beverage :
 Dr. Sri Hartati, M.P  Drg. Risya Chilmiyati
Logistic and Transportation
 Dr. Danar Praseptiangga, S.TP, M.Sc.
Field Trip :
 Prof. Dr. Ir. Sulanjari, M.S  Dr. Setyo F Sri Rahardjo
 Dr. Ari Susilowati, S.Si., M.Si
Documentation :
 Suratno,S.Pd
iv
PROCEEDINGS
CONFERENCE SCHEDULE
DAY – I, SEPTEMBER 6th, 2016
TIME EVENT SPEAKER

08.00 - 08.20 Registration
08.20 – 09.15 Opening Ceremony
Welcoming Dance
Report from Chairman of Organizing Prof. Dr. Ahmad Yunus,
Committee M.S.
Opening Speech from Director of Prof. Dr. -Ing. Misri
Indonesian Biotechnology Consortium Gozan, M.Tech., IPM
Opening Remarks from Universitas Prof. Dr. Ravik Karsidi,
Sebelas Maret Rector M.S.
09.15 - 09.45 Keynote Speaker
Prof. Bambang Prasetya
(Director of Indonesian National Standardization Agency)
09.45-10.15 Press Conference, Coffee Break and Poster Session
10.15-12.10 Plenary Session 1 : Agricultural Moderator : Prof. Dr.
Biotechnology Sony Suharsono
10.15-10.40 Sugarcane research at guangxi university Prof. Baoshan Chen
(Guangxi University,
China)
10.40-11.00 Molecular physiology of acid soil Prof. Hiroyuki Koyama
resistance of arabidopsis and its (Gifu University, Japan)
application for molecular breeding and
plant-diagnostics for improving
productivity of crops in acid soil
11.00-11.30 Talen and crispr-cas9 genome editing
technology for gene element Dr. Inez H.S Loedin
replacement, targeted insertion of (IRRI, Phillipine)
trangenes and gene knockout in rice
11.30-11.50 Molecular breeding marker assisted Dr. Enrique Ritter
selection (mas) systems in oil palm (NEIKER Tecnalia,
Spain)
11.50-12.10 Discussion session
12.10 - 12.40 Lunch Symposium PT. Fajar Mas Murni
12.40 - 13.25 Lunch break
13.25 - 14.40 Plenary Sesson 2 : Medical Moderator : Dr. Siswa
Biotechnology Setyahadi
13.25-13.50 Assisted reproductive technology as a Dr. Mulyoto Pangestu
new emerging health service in ASEAN (Monash University,
Australia)
13.50-14.15 Cell line development of human Dr. Adi Santosa
erythropoietin (Research Center for
Biotechnology, LIPI,
Indonesia)
v
PROCEEDINGS
14.15-14.40 Marine organism as a source of natural Prof. Dr. Taifo

sunscreen and anti aging compound Mahmud (Oregon State
University, USA)
14.40-14.50 DISCUSSION
14.50-15.00 Coffee break and poster session
15.00-15.50 Parallel session 1
Room 1 Room 2
(Agriculture Biotechnology) (Medical Biotechnology)
Moderator : Prof. Dr. Edi Purwanto Moderator : Dr. Dono Indarto
Muh Restu, Astuti, Efficiency of Basuki Supartono Toxicity test of human
Mukt, Siti Halimah simple sequence cd34+ stem cells
Larekeng repeats (ssr) (preliminary study) in
markers in sprague dawley rats
estimating genetic
diversity of jabon
merah
(anthocepallus
macrophillus)
Siti Halimah Larekeng, Genetic diversity Suryaningtyas Pomela (pomegranate
Muh Restu, Gusmiaty, sulawesi ebony Margi Utami, derived ellagic acid): a
Yuni Fitri C revealed by Mila Ulfia, natural sodium glucose
microsatellite Aninditya Verinda co-transporter 2
markers in area in Putrinadia, Rafi inhibitor for type 2
situ conservation Amanda Rezkia diabetes treatment
Amradani and
Dono Indarto
Gusmiaty , Muh Restu, Pollen dispersal Basuki Supartono, Study case : treatment
Mirza A Arsyad , Siti distances of a Prita diabetic foot ulcer with
Halimah Larekeng vulnerable tropical kusumaningsih, peripheral blood
tree, ebony Meriza Agtrin mononuclear stem cells
(Diospyros
celebica bakh.), in
education forest of
hasanuddin
university
Miftahudin, Eka Indah Silencing an Kamelia Tulus Anti-obesity effect of
Umaiyah, Windarti aluminum Hardiwati, Yanti, curcuminoid cider in
Wahyuningtiyas, Tatik tolerance candidate Bibiana Widiati high-cholesterol-fed rats
Chikmawati gene in rice using Lay
RNAi
Sony Suhandono Research on Basuki Supartono The expression analysis
elongation factor 1 of tgf-β1, igf, and fgf on
alpha promoter superficial and deep
from cassava osteochondral defects of
(Manihot knee (preliminary study)
esculenta carntz.) in sprague dawley rats
vi
PROCEEDINGS
Seni Kurnia Senjaya, Genetic Yanti, Wilson Effect of sugar palm

Utut engineering of Aldridge fruit for treatment of
WidyastutiSuharsono, potato (Solanum acne vulgaris
Sony Suharsono tuberosum l.) Cv.
Jala ipam for
resistance to
bacterial diseases
Hayati Minarsih, Faniar, Isolation and Yoseph Toni Silico study on
Riza A Putranto, Dian M cloning of dhn Wijaya, Yanti, Adi flavonoids from Dlitoria
Amanah and Sony encoding gene Yulandi ternatea as anti-
Suhandono from Saccharum inflammatory
officinarum l. therapeutics
Sholeh Avivi, I Gusta Cassava (Manihot Decky Joesiana Structure refinement and
Dimas Satyalowa, Didik esculenta crantz) Indrani, Eny phase composition of
Pudji Restanto, Tri Agus tolerance screening Kusrini, Wisnu Ari hydroxyapatites for
Siswoyo, Sigit on wetness using Adi scaffolds for tissue
Soeparjono, Sri Hartatik, morphological, engineering applications
Achmad Subagio physiological and
protein markers
Suharsono, Hadijah Genetic Decky Joesiana Preparation Of
Nadeak & Utut engineering of Indrani, Fajar Chitosan/Collagen
Widyastuti potato (Solanum Lukitowati, Yoki Blend Membranes For
tuberosum l.) Yulizar Wound Dressings: Ftir
Cultivar nooksack Spectroscopy Study And
by using hd3a Mechanical Properties
gene
Istiana Prihatini and Preliminary study Neng Herawati, Overproduction,
AYPBC. Widyatmoko of genetic diversity Andri Wardiana, characterization and
of andalas (Morus Syaipul Bahri, antiproliferative activity
macroura) Ratih Asmana determination of no
Ningrum affinity tag recombinant
human interferon alpha-
2a produced in pichia
pastoris
A. Farhanah, Utut Genetic Ratih Asmana Comparing the
Widyastuti, Suharsono transformation of Ningrum, Andri expression of open
potato (Solanum Wardiana, Syaipul reading frame encoding
tuberosum l.) Cv. Bahri, Neng human interferon
Jala ipam by Herawati alpha2a-human serum
mmpma gene albumin fusion protein
encoding for in three different strains
plasma membrane of methilotropic yeast
h+-atpase pichia pastoris
16.30 - 16.40 DISCUSSION
16.40 – 18.00 Parallel session 2
Room 1 Room 2
(Agriculture Biotechnology) (Medical and Microbial Biotechnology)
Moderator : Ir. Supyani, M.S, M.Agr, Ph.D Moderator : Dr. Tarwadi
vii
PROCEEDINGS
Saptowo J. Pardal, Molecular and Ana Indrayati, Collagen deposition and

Suharsono, Utut phenotypic Debbie S. cellular viability in uva-
Widyastuti, Y.U. analysis of Retnoningrum, irradiated fibroblasts
Anggraito transgenic soybean Sukmadjaja cells 3t3 treated by
lines tolerance to Asyarie, Tri recombinant hybrid
acid soil in bio Suciati superoxide dismutase
safety containment
Rizka Tamania Saptari, Rejuvenation of Fajar Lukitowati, Water uptake of
Imron Riyadi & long term culture Decky Joesiana chitosan/collagen blend
Sumaryono of embryogenic Indrani membranes for wound
callus of sago palm dressings with gamma-
(Metroxylon sago ray irradiations exposed
rottb.): effect of to water
coconut water and
sucrose in liquid
medium
Didik Pudji Restanto, The micro Arizah
Gene cloning encoding
Sigit Supardjono and propagation Kusumawati, Sri
Budi Kriswanto strategy of Kartika Wijaya, omp31-sod brucella into
Phalaenopsis sp Ulfatul Husnaa, ppic9k vector in
orchid by somatic Yana Rubiyana, escherichia coli
embryogenesis Adi Santoso
AYPBC Widyatmoko, Genetic diversity Baitha Screening and
ILG. Nurtjahjaningsih of Aquilaria Palanggatan chitinolytic activity
malaccensis in Maggadani, Siswa evaluation of nine
west kalimantan Setyahadi, dan indigenous bacteria
dan south Harmita isolate
kalimantan based
on rapd markers
ILG. Nurtjahjaningsih, Microsatellites Nuur Faridatun Optimization of
AYPBC. Widyatmoko diversity of Acacia Hasanah, Deden R chitinase production
and Anto Rimbawanto mangium in a Waltam, Dewi from Bacillus
seedling seed Nandyawati , licheniformis
orchard: Siswa Setyahadi,
implications for Djamil, Farah
tree improvement Nabila
strategies
Riza Arief Putranto, Differential gene Agustina Ika Comparison of
Indra Syaputra, Asmini expression in oil Susanti, Tan Tjie immunomodulatory
Budiani palm varieties Jan, Merry properties from three
susceptible and Vidianti, Jap Lucy, different Indonesian
tolerant to Lisza, Reinhard local isolates of lactic
Ganoderma Pinontoan acid bacteria
Bambang Sugiharto, Development of Martha Purnami Phylogenetic analysis of
Nurmalasari, Hardian mosaic virus Wulanjati, Nastiti Newcastle Disease
Susilo Adhy, Parawita resistant sugarcane Wijayanti, Aris Virus (NDV) from
Dewanti using pathogen- Haryanto Indonesian isolates
derived resistance based on dna sequence
and rna of fusion (f) protein
interference encoding gene
technology
viii
PROCEEDINGS
Denia Apriliani Rahman, Techno economic Apon Zaenal Construction of

Jabosar Ronggur, Misri evaluation of Mustopa, Rifqiyah recombinant hepatitis b
Gozan integrated levulinic Nur Umami, core antigen (hbcag) in
acid plant design Hidayah Lactococcus lactis
based on oil palm Murtiyaningsih,
empty fruit Ratih Asmana
bunches (opefb) Ningrum, Wien
Kusharyoto,
Hasim
18.00 - 19.00 PREPARATION FOR GALA DINER
19.00 - 21.00 GALA DINNER IN SURAKARTA CITY HALL
DAY – II, SEPTEMBER 7th, 2016

TIME EVENT SPEAKER
08.00-08.30 Registration
Plenary Session 3 : Marine Biotechnology Moderator : Dr.
08.30-09.55
and Bioenergy Ekowati Chasanah
Raymond R. Tjandrawinata
08.30-08.55
(PT. Dexa )
Investigating the biosynthetic pathways of Dr. Rer. Nat.
pharmacologically relevant natural products in Agustinus R. Uria
08.55-09.20
the uncultured microbiome of the marine (Marine and R&D,
sponge Theonellas winhoei Indonesia)
Mun Keat Chong,
PhD (PT Merck
09.20-09.45 Role of merck in biofuel industry
Chemicals dan Life
Sciences)
09.55-10.15 Coffee break and Poster Session
Plenary Session 4 : Agriculture Moderator : Dr.
10.15-12.15
Biotechnology Hayati Minarsih
Prof. Suranto, M.Sc.,
Mutations of the coat protein of Johnsongrass
Ph.D (Universitas
10.15-10.40 mosaic potyvirus in determining the infectivity
Sebelas Maret,
in krish sorghum
Indonesia)
Prof. I.G.P
Molecular mechanism of citrus greening diease Wiryawan (Udayana
10.40-11.05
(huang ong ing) by liberobacter asiaticum University,
Indonesia)
Wild watermelon and jatropha : molecular Prof Kinya Akashi
11.05-11.30 biology, breeding and utilization of xerophytes (Tottori University,
in the arid regions Japan)
11.30-11.55 Dr. Xu Jian Long (Shenzen Genomic Institut, China)
12.15-13.00 Lunch break
13.00 – 15.30 Parallel session 1
ix
PROCEEDINGS
Room 1 Room 2
(Agriculture and Industrial Biotechnology) (Marine, Vetereniary, and Microbiology
Moderator : Dr. Danar Praseptiangga, S.TP., Biotechnology)
M.Sc. Moderator : Dr. Sigit Prastowo, M.S
Bambang Exploration of some Muhammad Nursid, Cytotoxicity of

Suryotomo, rice varieties (Oryza Nurrahmi Dewi emestrin b from
Samanhudi, sativa) on the Fajarningsih, and marine derived
Suwarto, Ahmad contaminated batik Ekowati Chasanah fungus Emericella
Yunus waste nidulans
Ahmad Fauzantoro, Production of Sherly Ridhowati The cytotoxic effects
Amirah Amatullah, biopesticide from and antioxidant
Misri Gozan tobacco leaves activities of sea
(Nicotiana tabacum) cucumber (Stichopus
with digestion and variegatus) flour
reflux extractions sources in Indonesia
Muji Rahayu, Molecular Pujoyuwono Ethanolic
Samanhudi, Ahmad identification of Martosuyono, Gesty fermentation
Yunus Dan Dwi Calophyllum Aulia Ningrum efficiency of
Harjoko inophyllum in several seaweed solid waste
areas at Indonesia hydrolysates by
Saccharomyces
cerevisiae
Saidatul Idiyah, Bradyrhizobium Teguh Budipitojo, Structure and
Hartawati And Amir japonicum plasmid Elvinkan Ruth, Fitri mucopolysaccaride
Syarifudin characterization from Wulandari, Guntari type of major
agroforestry system Titik Mulyani, Yuda salivary glands of
Heru Fibrianto the sunda porcupines
(Hystrix javanica)
Amalia T Sakya, Mineral content and Widagdo Sri Temporary recovery
Muji Rahayu And antioxidant of tomato Nugroho, Dwi Liliek of pancreatic β-
Heri Widiyanto fruit under drought Kusindarta, Heru cellsin type 2
stress inoculated with Susetya, Ida Fitriana, diabetes mellitus
Mychoriza Tri Wahyu induced
Pangestiningsih, mesenchymal stem
Yuda Heru Fibrianto, cell-conditioned
Sri Gustari, Teguh medium
Budipitojo
Teguh Budipitojo, Gastrin-releasing
Motoki Sasaki, peptide receptor
13.35 - 13.45
Guntarititik Mulyani, (GRPR) in the
DISCUSSION
Daisuke Kondoh, bovine uterus and
and Nobuo Kitamura placenta
Edi Purwanto, Genetic diversity of
Endang Yuniastuti, local cultivated of
Meyriza Ayu Hatari boyolali black rice 13.42 - 13.52
based on DISCUSSION
morphological
characters
x
PROCEEDINGS
Risky Azlia Edrina, Determination of mass Yusro Nuri Fawzya, Microbial

Misri Gozan, transfer coefficient of Dewi Seswita Zilda, transglutaminase of
Yuswan Muharam nicotine solid liquid Seprianto, Hana Streptomyces sp.
extraction with ethanol Nurulllita Prestisia, From Indonesian:
solvent in packed bed Puspita Lisdiyanti screening and
extractor and Noerkasanah production in several
media
Dwi Harjoko and Efectivity of soaking Seprianto, Cloning of a
Yuni Kusniyawati period of arenga fiber Suharsono1, Dewi S. transglutaminase
and coconut Zilda, Yusro N. gene from an
endosperm to growth Fawzya, Pupita Indonesian
and yield in hidroponic Lisdiyanti3 Agustinus Streptomyces strain
substrates of tomato R. Uria
Choiroel Anam, Exploration potential Lisa Charisa Wijaya, Examination of

Danar of marine red Charles, Marcelia crispr/cas system
Praseptiangga, macroalgae from the Sugata, Jap Lucy, type ii-a in
Ahmad Yunus, southern coast of java Agustina Ika Susanti, Streptococcus
Ekowati Chasanah, island, gunung kidul Tan Tjie Jan thermophilus isolated
Nurrahmi Dewi regency, yogyakarta, from local dairy
Fajarningsih Indonesia as source of product
lectins
Feraliana, Sony Cloning and activity
Suhandono, Maelita assay of sucrose
Ramdan Moes isomerase
14.30 – 14.40 rekombinant from
DISCUSSION Klebsiella
pneumoniae in
Escherichia coli bl21
(de3)
Ginasesharita Microbial
Hardiyanti, Rita desalination cell
Arbianti, Tania using tempe
Surya Utami wastewater as
substrate with
varying phosphate
buffer concentration
and pH
Dewi Seswita Zilda, Purification of
Lia Siti microbial
Nur’amaliyah, Nisa transglutaminase
Rachmania Mubarik, produce by
Yusro Nuri Fawzya Streptomyces sp.
Strain tta 02 sds
14/lu
Etri Dian Kamila, Microbial
Tania Surya Utami desalination cell with
and Rita Arbianti leachate and sodium
percarbonate as
naturally buffering
electrolytes
xi
PROCEEDINGS
14.50 – 15.10
DISCUSSION
15.20 – 15.30 CLOSING REMARKS
DAY – III, SEPTEMBER 8th, 2016

TIME EVENT
08.00 - 09.00 Trip to Research and Development Center of Medicinal Plants and
Traditional Medicine (B2PTOOT, Tawangmangu, Karanganyar)
09.00 - 11.00 Activity in Research and Development Center of Medicinal Plants and
Traditional Medicine (BP2TOOT, Tawangmangu, Karanganyar)
11.00 – 12.00 Trip to Kasunanan Palace Surakarta
12.00 - 13.30 Activity in Kasunanan Palace Surakarta
14.00 Back to the hotel
xii
PROCEEDINGS
TABLE OF CONTENTS
Preface ...................................................................................................... iii
Organizing Committee............................................................................ iv
Conference Schedule ............................................................................... v
Table of contents .................................................................................... xiii
Invited Speaker Papers
1. Overview of Role Of Quality Infrastucture to Strengthening of Innovation
[Bambang Prasetya] .............................................................................................. 1
2. Mutations of The Coat Protein of Johnsongrass Mosaic Potyvirus In
Determiningthe Infectivity in Krish Sorghum [Suranto] ................................. 19
3. Molecular Physiology of Acid Soil Resistance of Arabidopsis and its
Application for Molecular Breeding and Plant-Diagnostics for Improving
Productivity of Crops in Acid Soil [Hiroyuki Koyama] .................................... 39
4. Molecular Breeding & Marker Assisted Selection (MAS) Systems in Oil
Palm [Enrique Ritter] ........................................................................................... 54
5. Cell Line Development of Human Erythropoietin [Adi Santoso] ................... 76
6. Wild Watermelon and Jatropha:Molecular Biology, Breeding and
Utilization of Xerophytes in The Arid Regions [Kinya Akashi] ...................... 97
7. Investigating The Biosynthetic Pathways of Phamacologically Relevant
Natural Products in The Uncultured Microbiome of The Marine Sponge
Theonellas Winhoei [Agustinus R. Uria and Jorn Piel ] ...................................... 129
8. Sugarcane Research at Guangxi University [Baoshan Chen] .......................... 147
9. Assisted Reproductive Technology as a New Emerging Health Service in
Asean [Mulyoto Pangestu] ................................................................................... 168
10. Roles Of Merck In Biofuel Industry [Chong Mun Keat] .................................. 177
xiii
PROCEEDINGS
Presenter Papers
Topic Field: Agriculture And Forestry Biotechnology ....................... 192
1. Efficiency of Simple Sequence Repeats (SSR) Markers in Estimating
Genetic Diversity of Jabon Merah (Anthocepallus macrophillus) [Restu,
Muhammad, Gusmiaty, Larekeng, Siti Halimah] ................................................. 193
2. Genetic Diversity of Sulawesi Ebony in in Situ Conservation Area
Revealed By Microsatellite Markers [Larekeng, Siti Halimah, Restu,
Muhammad, Gusmiaty, Yuni Fitri Cahyaningsih] ............................................... 199
3. Pollen Dispersal Distances of a Vulnerable Tropical Tree, Ebony
(Diospyros celebica Bakh.), in Experimental Forest of Hasanuddin
University [Gusmiaty , Restu, Muhammad, Arsyad, Mirza Arsiaty, Ikhsan La
Husen, Larekeng, Siti Halimah]............................................................................ 206
4. Cassava (Manihot esculenta Crantz) Tolerance Screening on Wetness
Using Morphological, Physiological and Protein Markers [Sholeh Avivi*, I
Gusta Dimas Satyalowa, Didik Pudji Restanto, Tri Agus Siswoyo, Sigit
Soeparjono, Sri Hartatik, Achmad Subagio]......................................................... 214
5. Rejuvenation of Long Term Culture of Embryogenic Callus of Sago Palm
(Metroxylon sago Rottb.): Effect of Coconut Water and Sucrose in Liquid
Medium [Rizka Tamania Saptari, Imron Riyadi, Sumaryono] ............................ 222
6. The Micro Propagation Strategy of Phalaenopsis sp Orchid by Somatic
Embryogenesis [Didik Pudji Restanto, SigitSupardjono and Budi Kriswanto] . 229
7. Differential Gene Expression in Oil Palm Varieties Susceptible and
Tolerant to Ganoderma [Riza Arief Putranto, Indra Syaputra, Asmini
Budiani] ................................................................................................................. 233
8. Impact of Batik Industry Waste on Several Rice Varieties (Oryza Satival.)
[B. Suryotomo, Samanhudi, Suwarto, A. Yunus] ................................................. 244
9. Production of Biopesticide from Tobacco Leaves (Nicotiana tabacum) With
Digestion and Reflux Extractions [Ahmad Fauzantoro, Amirah Amatullah
Dalimunthe, Misri Gozan] .................................................................................... 250
10. Bradyrhizobium japonicum Plasmid Characterization from Agroforestry
System [S. Idiyah, Hartawati, N.Z. Lutfiyah, and M.P. Mberu] .......................... 255
11. Nutrient Content and Antioxidant of Tomato Under Drought Stress
Inoculated with Mychorrhiza [Amalia T Sakya, Muji Rahayu and Heri
Widiyanto] ............................................................................................................ 259
12. Genetic Diversity of Rice (Oryza sativa) Local Cultivated of Boyolali Black
Rice Based on Morphological Characters [Edi Purwanto, Endang Yuniastuti,
Meyriza Ayu Hatari] ............................................................................................. 265
13. Exploration of Potential Marine Red Macroalgae from the Southern Coast
of Java Island, Gunung Kidul Regency, Yogyakarta, Indonesia as Source
of Lectins [Choiroel Anam, Danar Praseptiangga, Ahmad Yunus, Ekowati
Chasanah, Nurrahmi Dewi Fajarningsih].............................................................. 273
xiv
PROCEEDINGS
14. Efectivity of Soaking Period of Arenga Fiber And Coconut Water to

Growth and Yield in Hidroponic Substrates of Tomato [Dwi Harjoko,
Samanhudi, W.S. Dewi, and B. Pujiasmantoi] .................................................... 279
15. Multiplication Curcuma Xanthorrhiza Roxb. In Vitro [Dyah Utami,
Samanhudi, Sumijati] ............................................................................................ 285
16. Coconut Water and Banana Extracts Used for Multiplication Shoots of
Curcuma Xanthorrhiza In Vitro [Nur Andini, Samanhudi, Ahmad Yunus] ...... 291
17. Effect of Polyethylene Glycol Concentrations on Growth and Proline
Content of Tacca Leontopetaloides Shoots Cultured In Vitro [Andri Fadillah
Martin*, Betalini Widhi Hapsari, Rudiyanto, and Tri Muji Ermayanti] .............. 299
18. In Vitro Multiplication of Turmeric (Curcuma Domestica Val.) Axillary
Shoot Using BAP and NAA [Ayudya Kartika Sari, Pratignja Sunu, Ahmad
Yunus, Samanhudi] ............................................................................................... 305
19. Isolation And Purification Of Protoplast From Leaves Mesophyll Of Tacca
Leontopetaloides To Establish Protoplast Culture And Fusion [Dyah Retno
Wulandari*, Andri Fadillah Martin, Tri Muji Ermayanti] .................................... 310
20. Multiplication of Red Ginger In Vitro Using BAP and NAA [Dwi Fajar
Sidhiq, Ahmad Yunus, Bambang Pujiasmanto].................................................... 315
21. Performance of Mentik Wangi Rice Generation M1 From The Results of
Gamma Ray Irradiation [Raden Dirgory Kuneng Brokusumojo, Ahmad
Yunus, and Sri Hartati] ......................................................................................... 323
22. Performance of Pandan Wangi Rice Generation M1 From The Results of
Gamma Ray Irradiation [Rachmad Nurcahyono, Ahmad Yunus, and
Nandariyah] ........................................................................................................... 333
23. Performance of Rojolele Rice Generation M1 From The Results of
Gamma Ray Irradiation [Adi Prabu Mahardhika, Ahmad Yunus, and
Nandariyah] ........................................................................................................... 341
24. RAPD Markers Screening for Genetic Diversity Analysis of Pterocarpus
indicus Wild [Purnamila Sulistyawati, Anto Rimbawanto, AYPBC
Widyatmoko] ........................................................................................................ 349
25. Influence of 2,4-D and Coconut Water on Callus Induction and Shoot
Multiplication of Artemisia Annua L. In Vitro [Noorita Retno Ning Tyas,
Ahmad Yunus, Samanhudi] .................................................................................. 354
26. Optimizing of Auxin and Cytokinin for in Vitro Shoot and Root Induction,
Multiplication and Mini-Tuber Seed Production of Potato Cultivar
”Granola Kembang” [Misbah Ruhiyat, Syarif Husen, Nurina Farahiyah] ........ 363
27. Identification of Arbuscular Mycorrhizae Fungi Associated with Rauvolfia
Serpentina (L.) Benth. Ex Kurz from Several Areas in Java-Indonesia
[Sulandjari, Widyatmani Sih Dewi, Endang Yuniastuti] ...................................... 367
28. The Effects Of Substrate And Nutrition On Chili (Capsicum annuum)
Hydroponic [Dwi Harjoko, Samanhudi, W.S. Dewi, and Bambang
Pujiasmanto] ...................................................................................................... 371
xv
PROCEEDINGS
29. Genetic Analysis Of Orchid Hybrids (Dendrobium) With Random

Amplified Polymorphic DNA (RAPD) [Agus Budiyono , Sri Hartati, Ongko
Cahyono] ............................................................................................................... 379
30. Characterization of Salak (Salacca Zalacca (Gaertner (Voss)) Based on
Chromosome, Stomata and Molecular [Nandariyah] ....................................... 383
31. Growth for Orchid Hybrids Coelogyne asperata X Coelogyne pandurata
with NAA and Organic Matter in Vitro [Sri Hartati, Erika Maharani] ............ 386
32. Growth and Biological Efficiency of White Oyster Mushroom (Pleurotus
Sp.) [Erny Ishartati, Syarif Husen dan Sukardi] ................................................... 392
33. Screening and Characterization of Cellulase Enzyme in Sweet Orange
(Citrus sinensis) Juice Clarification [Esti Widowati, Rohula Utami, Edhi
Nurhartadi, Restio Rahadyan Megawiranto Putro] ............................................... 397
Topic Field: Industrial Biotechnology .................................................. 404
34. Determination of Mass Transfer Coefficient of Nicotine Solid Liquid
Extraction with Ethanol Solvent in Packed Bed Extractor [Risky Azlia
Edrina, Misri Gozan*, Yuswan Muharam] ........................................................... 405
Topic Field: Medical Biotechnology ...................................................... 414

35. Toxicity Test of Human CD34+ Stem Cells in Sprague Dawley Rats
(Preliminary Study) [Basuki Supartono] ........................................................... 415
36. Pomela (Pomegranate Derived Ellagic Acid): A Natural Sodium Glucose
Co-Transporter 2 Inhibitor For Type 2diabetes Treatment [Suryaningtyas
Margi Utami, Mila Ulfia, Aninditya Verinda Putrinadia, Rafi Amanda Rezkia
Amradani and Dono Indarto] ............................................................................... 422
37. Healing of Diabetic Foot Ulcer Using Autologous Peripheral
Bloodmononuclear Stem Cells (Study Case) [Basuki Supartono, Prita
Kusumaningsih, Muzayyana Sakinah] ................................................................. 428
38. The Expression Analysis of TGF-Β1, IGF, and FGF on Superficial and
Deep Osteochondral Defects of Knee Joint in Sprague Dawley
Rats(Preliminary Study) [Basuki Supartono] .................................................... 433
39. Gene Cloning Encoding OMP 31-SOD Proteins of Brucella Into pPIC9K
Vector Using Escherichia Coli host System [Arizah Kusumawati, Sri Kartika
Wijaya, Ulfatul Husnaa, Yana Rubiyana, Adi Santoso] ...................................... 439
40. Antibiotic Susceptibility Evaluation of Bacillus Amyloliquefaciens Isolated
from Local Pig Gastrointestinal Tract as Potentially Probiotic Candidate
[Jap Lucy, Johannes Nicolaus Wibisana, Tan Steven Ryan Susanto, and
Reinhard Pinontoan] ............................................................................................. 445
41. Optimization of Blue Sepharose Affinity Chromatography Conditions for
Recombinant Human Erythropoietin (rhuEPO) Purification [Yana
Rubiyana, Adi Santoso, Endah Puji Septisetyani, and Fathia Maulida] .............. 450
xvi
PROCEEDINGS
42. The Comparison of Batch and Column Based Affinity Chromatography

in Recombinant Human Erythropoietin (rhEPO) Purification [Popi Hadi
Wisnuwardhani, Yana Rubiyana ,Endah Puji Septisetyani, and Adi Santoso] .... 454
43. Effect of Lysine And Histidine Residues on Nanoparticle Formation of
Palmitoyl-Based Lipopeptide as Transfection Reagent for Non-Viral Gene
Delivery Vehicle [Tarwadi*, Jalal A. Jazayeri, and Colin W. Pouton] ............... 460
Topic Field: Microbiology Biotechnology............................................. 471

44. Optimization Of Chitinase Production From Bacillus Sp WS 4F [Nuur
Faridatun Hasanah, Deden R Waltam, Siswa Setyahadi, Dewi Nandyawati,
Djamil, Farah Nabila] .......................................................................................... 472
45. Comparison of Immunomodulatory Properties from Three Different
Indonesian Local Isolates of Lactic Acid Bacteria [Agustina Ika Susanti,
Tan Tjie Jan, Merry Vidianti, Jap Lucy, Lisza1, Lulu Florencia, Christy,
Reinhard Pinontoan] ............................................................................................ 478
46. Examination of Crispr/Cas System Type Ii-A in Streptococcus
thermophilus Isolated from Local Dairy Product [Lisa Charisa Wijaya,
Charles, Marcelia Sugata, Jap Lucy, Agustina Ika Susanti, and Tan Tjie Jan] ... 484
47. Cloning and Activity Assay of Rekombinant Sucrose Isomerase Klebsiella
pneumoniae in Escherichia coli Bl21 (DE3) [Feraliana, Sony Suhandono,
Tati Kristianti, Maelita Ramdani Moeis] ............................................................. 491
48. Microbial Desalination Cell Using Tempe Wastewater as Substrate with
Varying Phosphate Buffer Concentration and Salinity [Ginasesharita
Hardiyanti, Rita Arbianti, Tania Surya Utami, Heri Hermansyah] ..................... 496
49. Microbial Desalination Cell with Leachate and Sodium
Percarbonateasnaturally Buffering Electrolytes [Etri Dian Kamila, Tania
Surya Utami, Rita Arbianti, Heri Hermansyah]................................................... 503
Topic Field: Marine and Vetereniary Biotechnology .......................... 508

50. Structure and Mucopolysaccaride Type of Major Salivary Glands of The
Sunda Porcupines (Hystrix Javanica) [Teguh Budipitojo*, Elvinkan Ruth,
Fitri Wulandari, Guntari Titik Mulyani, Yuda Heru Fibrianto] .......................... 509
51. Temporary Recovery of Pancreatic Β-Cellsin Type 2 Diabetes Mellitus
Induced Mesenchymal Stem Cell-Conditioned Medium [Widagdo Sri
Nugroho*, Dwi Liliek Kusindarta, Heru Susetya, Ida Fitriana, Tri Wahyu
Pangestiningsih, Yuda Heru Fibrianto, Sri Gustari, Teguh Budipitojo].............. 515
52. Gastrin-Releasing Peptide Receptor (GRPR) in The Bovine Uterus and
Placenta [Teguh Budipitojo, Motoki Sasaki, Guntari Titik Mulyani, Daisuke
Kondoh, and Nobuo Kitamura] ........................................................................... 520
53. Cytotoxicity and Apoptosis Induction of Emestrin B From Marine
Derived Fungus Emericella Nidulans [Muhammad Nursid and Nurrahmi
Dewi Fajarningsih] .............................................................................................. 528
xvii
PROCEEDINGS
OVERVIEW OF ROLE OF QUALITY INFRASTUCTURE TO

STRENGTHENING OF INNOVATION
Bambang Prasetya
Page | 1
PROCEEDINGS
Page | 2
PROCEEDINGS
Page | 3
PROCEEDINGS
Page | 4
PROCEEDINGS
Page | 5
PROCEEDINGS
Page | 6
PROCEEDINGS
Page | 7
PROCEEDINGS
Page | 8
PROCEEDINGS
Page | 9
PROCEEDINGS
Page | 10
PROCEEDINGS
Page | 11
PROCEEDINGS
Page | 12
PROCEEDINGS
Page | 13
PROCEEDINGS
Page | 14
PROCEEDINGS
Page | 15
PROCEEDINGS
Page | 16
PROCEEDINGS
Page | 17
PROCEEDINGS
Page | 18
PROCEEDINGS
MUTATIONS OF THE COAT PROTEIN OF

JOHNSONGRASS MOSAIC POTYVIRUS IN DETERMINING
THE INFECTIVITY IN KRISH SORGHUM
Suranto
Page | 19
PROCEEDINGS
Page | 20
PROCEEDINGS
Page | 21
PROCEEDINGS
Page | 22
PROCEEDINGS
Page | 23
PROCEEDINGS
Page | 24
PROCEEDINGS
Page | 25
PROCEEDINGS
Page | 26
PROCEEDINGS
Page | 27
PROCEEDINGS
Page | 28
PROCEEDINGS
Page | 29
PROCEEDINGS
Page | 30
PROCEEDINGS
Page | 31
PROCEEDINGS
Page | 32
PROCEEDINGS
Page | 33
PROCEEDINGS
Page | 34
PROCEEDINGS
Page | 35
PROCEEDINGS
Page | 36
PROCEEDINGS
Page | 37
PROCEEDINGS
Page | 38
PROCEEDINGS
MOLECULAR PHYSIOLOGY OF ACID SOIL RESISTANCE OF

ARABIDOPSIS AND ITS APPLICATION FOR MOLECULAR
BREEDING AND PLANT-DIAGNOSTICS FOR IMPROVING
PRODUCTIVITY OF CROPS IN ACID SOIL
Hiroyuki Koyama
Page | 39
PROCEEDINGS
Page | 40
PROCEEDINGS
Page | 41
PROCEEDINGS
Page | 42
PROCEEDINGS
Page | 43
PROCEEDINGS
Page | 44
PROCEEDINGS
Page | 45
PROCEEDINGS
Page | 46
PROCEEDINGS
Page | 47
PROCEEDINGS
Page | 48
PROCEEDINGS
Page | 49
PROCEEDINGS
Page | 50
PROCEEDINGS
Page | 51
PROCEEDINGS
Page | 52
PROCEEDINGS
Page | 53
PROCEEDINGS
Page | 54
PROCEEDINGS
Page | 55
PROCEEDINGS
MOLECULAR BREEDING & MARKER ASSISTED SELECTION

(MAS) SYSTEMS IN OIL PALM
Enrique Ritter
Page | 56
PROCEEDINGS
Page | 57
PROCEEDINGS
Page | 58
PROCEEDINGS
Page | 59
PROCEEDINGS
Page | 60
PROCEEDINGS
Page | 61
PROCEEDINGS
Page | 62
PROCEEDINGS
Page | 63
PROCEEDINGS
Page | 64
PROCEEDINGS
Page | 65
PROCEEDINGS
Page | 66
PROCEEDINGS
Page | 67
PROCEEDINGS
Page | 68
PROCEEDINGS
Page | 69
PROCEEDINGS
Page | 70
PROCEEDINGS
Page | 71
PROCEEDINGS
Page | 72
PROCEEDINGS
Page | 73
PROCEEDINGS
Page | 74
PROCEEDINGS
Page | 75
PROCEEDINGS
CELL LINE DEVELOPMENT OF HUMAN ERYTHROPOIETIN
Adi Santoso Ph.D
Page | 76
PROCEEDINGS
Page | 77
PROCEEDINGS
Page | 78
PROCEEDINGS
Page | 79
PROCEEDINGS
Page | 80
PROCEEDINGS
Page | 81
PROCEEDINGS
Page | 82
PROCEEDINGS
Page | 83
PROCEEDINGS
Page | 84
PROCEEDINGS
Page | 85
PROCEEDINGS
Page | 86
PROCEEDINGS
Page | 87
PROCEEDINGS
Page | 88
PROCEEDINGS
Page | 89
PROCEEDINGS
Page | 90
PROCEEDINGS
Page | 91
PROCEEDINGS
Page | 92
PROCEEDINGS
Page | 93
PROCEEDINGS
Page | 94
PROCEEDINGS
Page | 95
PROCEEDINGS
Page | 96
PROCEEDINGS
WILD WATERMELON AND JATROPHA:

MOLECULAR BIOLOGY, BREEDING AND UTILIZATION OF
XEROPHYTES IN THE ARID REGIONS
Kinya Akashi
Page | 97
PROCEEDINGS
Page | 98
PROCEEDINGS
Page | 99
PROCEEDINGS
Page | 100
PROCEEDINGS
Page | 101
PROCEEDINGS
Page | 102
PROCEEDINGS
Page | 103
PROCEEDINGS
Page | 104
PROCEEDINGS
Page | 105
PROCEEDINGS
Page | 106
PROCEEDINGS
Page | 107
PROCEEDINGS
Page | 108
PROCEEDINGS
Page | 109
PROCEEDINGS
Page | 110
PROCEEDINGS
Page | 111
PROCEEDINGS
Page | 112
PROCEEDINGS
Page | 113
PROCEEDINGS
Page | 114
PROCEEDINGS
Page | 115
PROCEEDINGS
Page | 116
PROCEEDINGS
Page | 117
PROCEEDINGS
Page | 118
PROCEEDINGS
Page | 119
PROCEEDINGS
Page | 120
PROCEEDINGS
Page | 121
PROCEEDINGS
Page | 122
PROCEEDINGS
Page | 123
PROCEEDINGS
Page | 124
PROCEEDINGS
Page | 125
PROCEEDINGS
Page | 126
PROCEEDINGS
Page | 127
PROCEEDINGS
Page | 128
PROCEEDINGS
INVESTIGATING THE BIOSYNTHETIC PATHWAYS OF

PHAMACOLOGICALLY RELEVANT NATURAL PRODUCTS IN
THE UNCULTURED MICROBIOME OF THE MARINE SPONGE
THEONELLAS WINHOEI
Agustinus R. Uria1 dan Jorn Piel2
Page | 129
PROCEEDINGS
Page | 130
PROCEEDINGS
Page | 131
PROCEEDINGS
Page | 132
PROCEEDINGS
Page | 133
PROCEEDINGS
Page | 134
PROCEEDINGS
Page | 135
PROCEEDINGS
Page | 136
PROCEEDINGS
Page | 137
PROCEEDINGS
Page | 138
PROCEEDINGS
Page | 139
PROCEEDINGS
Page | 140
PROCEEDINGS
Page | 141
PROCEEDINGS
Page | 142
PROCEEDINGS
Page | 143
PROCEEDINGS
Page | 144
PROCEEDINGS
Page | 145
PROCEEDINGS
Page | 146
PROCEEDINGS
SUGARCANE RESEARCH AT GUANGXI UNIVERSITY
Baoshan Chen
Page | 147
PROCEEDINGS
Page | 148
PROCEEDINGS
Page | 149
PROCEEDINGS
Page | 150
PROCEEDINGS
Page | 151
PROCEEDINGS
Page | 152
PROCEEDINGS
Page | 153
PROCEEDINGS
Page | 154
PROCEEDINGS
Page | 155
PROCEEDINGS
Page | 156
PROCEEDINGS
Page | 157
PROCEEDINGS
Page | 158
PROCEEDINGS
Page | 159
PROCEEDINGS
Page | 160
PROCEEDINGS
Page | 161
PROCEEDINGS
Page | 162
PROCEEDINGS
Page | 163
PROCEEDINGS
Page | 164
PROCEEDINGS
Page | 165
PROCEEDINGS
Page | 166
PROCEEDINGS
Page | 167
PROCEEDINGS
ASSISTED REPRODUCTIVE TECHNOLOGY AS A NEW

EMERGING HEALTH SERVICE IN ASEAN
Mulyoto Pangestu
Page | 168
PROCEEDINGS
Page | 169
PROCEEDINGS
Page | 170
PROCEEDINGS
Page | 171
PROCEEDINGS
Page | 172
PROCEEDINGS
Page | 173
PROCEEDINGS
Page | 174
PROCEEDINGS
Page | 175
PROCEEDINGS
Page | 176
PROCEEDINGS
ROLES OF MERCK IN BIOFUEL INDUSTRY
Baoshan Chen
Page | 177
PROCEEDINGS
Page | 178
PROCEEDINGS
Page | 179
PROCEEDINGS
Page | 180
PROCEEDINGS
Page | 181
PROCEEDINGS
Page | 182
PROCEEDINGS
Page | 183
PROCEEDINGS
Page | 184
PROCEEDINGS
Page | 185
PROCEEDINGS
Page | 186
PROCEEDINGS
Page | 187
PROCEEDINGS
Page | 188
PROCEEDINGS
Page | 189
PROCEEDINGS
Page | 190
PROCEEDINGS
Page | 191
PROCEEDINGS
TOPIC FIELD: AGRICULTURE AND

FORESTRY BIOTECHNOLOGY
Page | 192
PROCEEDINGS
EFFICIENCY OF SIMPLE SEQUENCE REPEATS (SSR)

MARKERS IN ESTIMATING GENETIC DIVERSITY OF JABON
MERAH (ANTHOCEPALLUS MACROPHILLUS)
Restu, Muhammad 1, Gusmiaty1, Larekeng, Siti Halimah1*

1
Biotechnology and Tree Breeding Laboratory, Faculty of Forestry, Hasanuddin University, Makassar,
Indonesia
Email: sitih5h.82@gmail.com
Abstract
Jabon merah (Anthocepallus macrophillus) is a tropical timber tree which has high economical value.
Molecular breeding strategies using microsatellite markers have never been initiated before. Breeding
programs are needed to protect genetic diversity as well as genetic improvement. Molecular aspects are
commonly related with protocol for DNA preparation and molecular markers which are important, thus it
will speed up the breeding program and conservation. The findings of this study to find out SSR primers
indicating high level of polymorphisms on Jabon Merah. This study was conducted to evaluate the ability
of ten SSR markers in differentiating twelve genotype of through SSR banding pattern of PCR and
electrophoregram results. Based on electrophoregram visuals, four primers could amplify most of the
genotype used in this study. This preliminary study could provide important information for breeding
program in endemic trees.
Keywords:Band patterns, Jabon Merah, Molecular breeding, Polymorphisms, SSR marker
1. Introduction selection strategies are needed to support the

availability of superior seedlings.
Jabon merah (Anthocephalusmacrophyllus The process of conventional breeding
Roxb.) belongs to the Rubiaceae family, which is programs which commonly take longer time for
one of potential endemic trees to Indonesia, genetic improvement is the main obstacle for
particularly in eastern Indonesia (Sulawesi and increasing forestry productivities in Indonesia. To
Maluku). It is categorized as a pioneer-type species resolve this issue, molecular techniques and
(having fast-growing) and having high economical markers have been developed and applied in the
value to be cultivated in either natural or industrial selection strategies at first development stage of
forests. This species can also be developed in Jabon merah. Molecular markers provide DNA
critical land and as conservation tree in watershed profiles from tree varieties that will be protected.
areas due to its high absorbing and retaining water The usage of molecular markers for germplasm
ability. Jabon merah has been used as plywood, characterizations appears to be the fastest, most
construction timber, pulp, fiberboard, particle effective, accurate and unbiased from
board [1-2], traditional herb [3] as well as anti- environmental effects [6].
microbial [4] and anti-bacterial agents [5]. Molecular marker technique is one of
One of the efforts to increase Jabon merah alternatives that can be used to overcome such
productivity in order to ensure the sustainability of difficulties [7]. The data obtained from molecular
raw materials in Indonesia is by encouraging the marker analysis can be linked with other data sets
development of industrial forests of Jabon merah. and stored in the DNA fingerprint database.
Implementation of this program requires the Construction of DNA fingerprint database for
availability of high quality seeds and seedlings. identifications and discriminations of some tree
For that reason, the accurate informations varieties have been done before [8]. Molecular
regarding Jabon merah germplasm that will be marker analysisgive faster, more effective and
cultivated in industrial forest areas and breeding accurate results compare to morphological
Page | 193
PROCEEDINGS
identification. Identifications using molecular 2. Methods

markers can be done at early stage (seed stage), do
not damage plant growth (require less sample) and Time and location of research
are not affected by environmental factors [8].
Jabon merah has been rarely investigated in The research activities were conducted at
either genetic population or genetic conservation Biotechnolgy and Tree Breeding Laboratory,
aspects. Population distributions in some habitats Faculty of Forestry, Hasanuddin University, in
(provenances) affect genetic diversity. Different July 2015.
provenance regions also show different genetic
diversity between provenances. Development of
DNA molecular analysis using molecular markers, Genetic materials
such as microsatellite marker, have been widely
applied for characterizing genetic variation and As many as twelve individual trees of Jabon
relationship in a genus, species, cultivar, accession, merah were randomly selected, and then one leaf
as well. Microsatellite marker loci have been from each tree was harvested and used as DNA
reported in forensic identification, disease source. The collected leaf samples were then
diagnosis and identification, genetic population wrapped using plastic clip and stored in freezer set
study, bottlenecks effect and biological at -200C until needed.
conservation. It has also been used to observe the
changes in population, fragmentation effect, DNA extraction and microsatellite
interaction in different populations and marker loci analysis
identification of new-formed population [9].
Microsatellite markers have been DNA extraction was done using Genomic DNA
intensively used in genetic study since they are Mini Plant (Geneaid) kit protocol. Ten evaluated
abundant across genomes, show high levels of microsatellite marker loci were selected from the
polymorphism and variability (more alleles in loci) genus Coffea belonging to the family Rubiaceae.
and are co-dominant nature with known genomic These primers were chosen because of no
location. Therefore, microsatellite markers are microsatellite primer has been reported from the
useful tools that present high reproducibility and genus Anthocephalus. Thus we decided to utilize
accuracy used in distinguishing genotypes, testing primers from the same family (Rubiaceae). The
seed purity, mapping gene as well as providing microsatellite marker loci are described in Table 1.
efficient tool for selection strategy, genetic
population study and genetic diversity analysis. DNA amplification
Numerous published studies have broadly used
this approach, for instance, genetic diversity DNA amplification was done using
analysis and characterization in coconut and teak 96well-PCR (SensoquestThermocycler,Germany).
[10-11], mating system and study of xenia effect in Amplifications were conducted using the
Kopyor coconut [12-13]. However, the following steps : one cycle of pre-amplification at
informations about microsatellite marker usage to 94°C for 180 seconds, 35 cycles of amplification
support breeding and genetic conservation steps at 94 °C for 30 seconds (template
programs in Jabon merah have never been reported denaturation), annealing temperature using ± 50C
before. from the given melting temperature (Table 1) for
The objective of this research was to 30 seconds (primer annealing), and 72 °C for 60
determine the appropriate SSR marker loci that seconds (primer extension), and one cycle of final
could specifically identify Jabon merah by primer extension at 72 °C for 300 seconds.
screening ten microsatellite primers for The generated SSR markers were
recommendation approach in genetic diversity separated using 3% Super Fine Resolution (SFR)
analysis. Through this research, we would like to agarose using TAE 1x buffer at 100 Volt for 90
develop an approach using Simple Sequence minutes [14].
Repeat (SSR) method that able to amplify DNA of
Jabon merah and produce strong and clear
polymorphic-band PCR products. The findings of 3. Results and Discussion
this study should beneficial to Jabon merah
breeders, especially in shortening the time required DNA amplification using ten evaluated
for molecular breeding programs, seed purity microsatellite primers showed seven of ten primer
evaluations and DNA fingerprinting analysis. pairs were able to amplify Jabon merah DNA.
These seven primers consisted of two primers
Page | 194
PROCEEDINGS
producing monomorphic band patterns and one nucleotide primer pairs may turn out to have
primer generating smear and unclear bands. amplified products (positive primer) and, other
Therefore, only four remaining microsatellite than that, not all positive primer pairs yield good
markers that successfully amplified strong and polymorphic DNA fragments[15]. Results of
clear polymorphic bands were used for further primers screening using ten microsatellite markers
analysis in genetic diversity of Jabon merah (Table exhibited that there were four primer pairs that
1; Figure 1). could be well amplified and generate polymorphic
Primer screening is required to obtain alleles of Jabon merahDNA. Those primers are
strong and clear polymorphic-band pattern of PCR presented in Table 2. Moreover, two primer pairs
products by selecting random primers that can which produced monomorphic bands were primer
produce amplification products, as not all tested M329 and M333.
Table 1. Primer Name, Repeat Motif and Primer Sequence (5′ to 3′) of Ten Microsatellite Marker
Loci FromRubiaceae Family Used in Primer Screening
No. Locus Accession Repeat motif Primer (5'-3')

no.
1. M302 AM408775 (GT)9 F: CAAAAGTAAATAAACGATGGACGA
R: AAGAGGTAAAAATCAAATCCCAAG
2. M306 AM408777 (TG)9(AG)7 F: CTCGTTTGTGCTCTTTTTG
R: TTTGTTAGTTTCTCTCCACCA
3. M309 AM408738 (GT)9 F: AGCAACATTTCCCAGTCAA
R: GACCGCAATTTTCTTGTTTC
4. M321 AM408748 (GT)8 F: TCGATTGGTTTTGCATACATCT
R: GCCAAGATAATGGTTGTGTGG
5. M325 AM408751 (A)5GGGC(A)6 F: ATTACTCTGCTTCGTTTGAC
R: CAGTTGCCTGAGATTGAC
6. M326 AM408752 (GA)8 F: GCTTTCTTGCCTTTCTTTTCC
R: CATCCACTTACCTCTCCCAAA
7. M327 AM231546 (GT)9 F: GGCTCAAAATCACCCTTTGT
R: CTAGGATCGTGGCAGAAGAAG
8. M328a AM408753 (AT)6(GT)8 F: CACCTTTTGAGTTTTGAGTTGG
R: AAAATAAACCCCCTTCGTTCA
9. M329 AM231547 (GT)10 F: ACTCAGACAAACCCTTCAAC
R: GATGTTTTGCATCTATTTGG
10. M333 AM408757 (AT)9(GT)8 F: AACGGGTGGTCTCATTTTATC
R: TTTCTTGTAGTGGTTTTGTCTCC
Page | 195
PROCEEDINGS
Table 2.Locus name, accession number, annealing temperature and fragment characteristic of ten
microsatellitemarker loci of Jabon merah
No Locus Accession no. Annealing Fragment Characteristics

Temperature
1. M302 AM408775 51.7 Not amplification
2. M306 AM408777 54.5 Fragment are clear and easy to be scoring
3. M309 AM408738 55 Fragment are clear and easy to be scoring
4. M321 AM408748 58.5 Fragment are clear and easy to be scoring
5. M325 AM408751 50.5 Not amplification
6. M326 AM408752 58 Fragment are clear and easy to be scoring
7 M327 AM231546 54.2 Not amplification
8 M328a AM408753 52.4 Fragment are not clear
9 M329 AM231547 50 Monomorphic
10 M333 AM408757 53 Monomorphic
A polymorphic primer (shown in Figure 1) unbalanced mixture between DNA solution and
is primer that can distinguish between individuals other solutions (primer and PCR mix solutions),
by detecting alleles in an evaluated population. less DNA extracted from leaf samples, or DNA
Primer pairs are categorized as polymorphic wasted during extraction process. Another cause is
primers if they can detect the variations in alleles the contamination of DNA by protein, RNA,
at least 1%. In addition, the usable polymorphic phenol or organic compounds. To do the molecular
primers for genetic diversity are primers that genetic analysis, high purity and concentration of
produce strong and clear polymorphic band pattern DNA are required, but DNA extracted from plant
of PCR DNA products. It is important to be able to tissues with high level of DNA purity is often
reliably identify the polymorphic primers in order difficult to achieve. Moreover, the presence of
to avoid miscoring of alleles resulting errors in the primers which can not amplify any DNA sequence
analysis. Furthermore, the other remaining primer can be induced by unmatched primer pairs with
pairs which generated either unclear or smear DNA sequence used as DNA template and
bands were not selected since they could not be unsuccessful annealing process that lead to
scored. However, to eliminate technical errors like unamplified DNA. The SSR marker loci are di-,
miscoring, all samples were run at least twice tri- or tetra- nucleotide repeats (at least 15
usingmore specific annealing temperaturesin PCR nucleotides in length) that dispersed throughout the
process. For instance, the smear bands amplified genome. Primers are needed for the initial DNA
by primer M328a are displayed in Figure 2. These amplification in PCR procces. Acquaah [16]
such results need to be repeated for annealing previously reported that the PCR processes using
temperatures optimization and then validated by SSR marker loci do not require large amount of
Qiaxcel fragment analysis for more specific base- DNA (approximately 50-5000 µg of DNA), hence,
pair differences. do not influence subsequent analysis. It is proved
The disappeared band pattern can be caused by the emergence of SSR band pattern shown at
either by less DNA volume used in PCR process, agarose and polyacrylamid gels.
Page | 196
PROCEEDINGS
Figure 1. An example of polymorphic band pattern of 12 DNA samples amplified by microsatellite

primer M306
Figure 2. An example of unclear and smear band pattern of 12 DNA samples amplified by
microsatellite primerM328a
The results showed only 4 primer pairs (40%) that more microsatellite primer pairs are needed to
could amplify strong, clear and polimorphic bands amplify the Jabon merah DNA.
at the 12 tested random samples of Jabon merah Amplification of SSR markers in Jabon
DNA. This observation revealed low number of merah is an initial step for various molecular
polymorphic primers compared to that of reported genomic researches using specific primers.
by Larekeng et al [17] in Ebony (53%) or when Microsatellite markers have been widely applied in
compared to Nurtjahjaningsih et al[18] in Shorea many molecular analysis studies, such as, genetic
(100%). They stated that 100% of microsatellite analysis within and between populations, stability
primers from Shorea curtisii could amplify DNA analysis in clonal plants derived from in vitro
of four other Shorea species (Shorea gysbertsiana, somatic embryogenesis, parents and progeny
Shorea macrophylla, Shorea stenoptera, dan arrays and pollen dispersal analysis. Alcalá et
Shorea pinanga. it indicated that the success in al.[20] previously used eight microsatellite primer
amplifying plants DNA sequence affected the pairs to evaluate genetic structure and diversity of
results of primers screening in both studies. Every Mahagony (Swietenia macrophylla) in Mexicos‘
individuals has different DNA sequences. As every forest ecosystem. Marum et al. [21] also reported
species possesses unique and spesific DNA using seven microsatellite marker loci for
sequences [19]. Prompted by this findings, we note analyzing genetic stability in Pine (Pinus pinaster)
derived from somatic embryogenesis. Another
Page | 197
PROCEEDINGS
previous study by Prabha et al. [22] investigated natural forest using microsatellite primers.
mating system and gene flow analysis of Teak in
Although the number of primer pairs that [9] S. Gulcu, S. Celik, Af. J. Biotech. 8/18 (2009)
amplified polymorphic bands is still low, the 4387-4394.
findings of this study may have been the first
report of using microsatellite marker loci from [10] Larekeng 2016 S.H. Larekeng, N. A‘ida, Y.F.
different genus in the same family for amplifying Cahyaningsih, Gusmiaty, M. Restu, Pros.
Jabon merah DNA. It can also be quite informative Sem. Nas. Silvi. IV (to be published)
considering Jabon merah as endemic tree to
Sulawesi [11] K. Pradeep, R. Manimekalai, R. Kumari, Int.
J. Plant. Breed. Genet. 5/1 (2011) 34-43.
4. Conclusions
Microsatellite marker loci from Rubiaceae [12] I. Maskromo, S.H. Larekeng, N. Hengky,
family could be used for obtaining molecular data Sudarsono, Emirates. J. Food. Agr. 28/9
of Jabon merah. Based on visualizing alleles, four (2016)644-652.
of ten evaluated microsatellite marker loci were
selected as recommended primer pairs. These [13] S.H. Larekeng, I. Maskromo, A. Purwito,
primer pairs can be usedlater in amplifying all N.A. Mattjik, S. Sudarsono, CORD 31/1
Jabon merah DNA samples for genetic diversity (2015) 46-60.
analysis.
[14] Y.T. Seng, R. Singh, Q.Z.Faridah, S.G. Tan,
References S.S.R.S.Alwee. Genet. Mol. Resch. 12/3
(2013) 2360-2367.
[1] I. Soerianegara,P.C.M. Jansen, E. Westphal,
and R.H.M.J. Lemmens (Eds)Plant Resources [15] Yunanto, Thesis, Institut Pertanian Bogor,
of South-East Asia (PROSEA) 5-1 Timber Indonesia, 2010.
Trees: Major Commercials Timbers. Bogor.
[16] Acquaah, Principles of Plant Genetic and
[2] K. Kartawinata, J. Trop. Forest Sci. 7/1 (1994) Breeding. Blackwell Publishing, Oxford, UK,
76-86. 2007, 569p
[3] S. Mondal, G.K. Dash, S. Acharyya, J Phar. [17] Larekeng, Siti Halimah, Gusmiaty, (to be
Resrc. 2/26 (2009) 113-1136. published).
[4] S. Acharyya, D.S. Rathore, H.K.S. Kumar, N. [18] I.L.G. Nurtjahjaningsih, A.Y.P.B.C.
Panda, Int. J. Resch. Pharn. Biomed. Sci. 2/1 Widyatmoko, P. Sulistyawati, A.
(2011) 297-300. Rimbawanto. J. Pem. Tan. Hut. 6/1 (2012) 1-
8.
[5] R.P. Mishra, L. Siddique, Asian J. Plant. Sci
Resch. 1/2 (2011) 1-7. [19] I.L.G. Nurtjahjaningsih.J. Pem. Tan. Hut. 4/1
(2010) 25-35.
[6] S. Gao, J. Wang, Z. Zhang, G. Dong, J. Guo,
Crop. Past. Sci. 63/1 (2012) 87-94. [20] R.E. Alcalá,H. Salazar, G. Gutiérrez-
Granados, L.K. Snook. J Trop. Forst.
[7] J. Ni, P.M. Colowit,D.J. Mackill. Crop Sci. 26/1(2014) 142-152.
42(2002) 601.
[21] L. Marum, M. Rocheta, J. Maroco, M.M.
[8] E.M.Septiningsih, T.J. Santoso, D.W. Oliveira, C.Miguel. Plant. Cell. Rep. 28.
Utami,N.l. Hidayatun. Kum. Mak. Sem. (2009) 673–682.
HasilPenel. BB-Biogen (2004) 140-151.
[22] S.S. Prabha, E.P. Indira, P.N. Nair. Curr. Sci.
101/9(2011)1213-1219
Page | 198
PROCEEDINGS
GENETIC DIVERSITY OF SULAWESI EBONY IN IN SITU

CONSERVATION AREA REVEALED BY MICROSATELLITE
MARKERS
Larekeng, Siti Halimah1*, Restu, Muhammad1, Gusmiaty1,

Yuni Fitri Cahyaningsih 1
1
Indonesia
Abstract
Ebony (Diospyros celebica. Bakh) is an endemic tree to Sulawesi. Excessive exploitation and slow
growing, causing Ebony is currently categorized as ―vulnerable‖ species. Genetic diversity analyses are
needed in conservation and breeding programs to prevent extiction in a species. This study was aimed to
determine the genetic diversity of Ebony at tree and seedling stages in Amaro protected forest, Barru,
South Sulawesi. As many as 58 individuals Ebony consisted of 32 individuals in tree stage and 28
individuals in seedling stage, were analyzed using SSR marker loci. Data analysis was carried out by
GeneAlex ver 6.5 software, whereas clustering dendrogram were generated using DARwin ver 6.0
software. Results of analysis showed tree and seedling stages had the number of alleles ranging from two
to four alleles with an average allele number of 3,4. There were seven private alleles which were observed
in populations, 2 alleles at tree stage and 5 alleles at seedling stage. The genetic variation at tree and
seedling stages was 1%, whilst variation among individuals was 9%. The observed heterozigosity (Ho)
was 0.39. There were three main clusters in these populations and 90% of individuals were placed into
clusters 1 and 2.
Keywords: Ebony, genetic diversity, seedling stage, SSR marker, tree stage.
1. Introduction Genetic diversity can be analyzed using

moleular marker technique as the useful tool in
Populations of tree species in natural forest identifying the genotype of an individual. The
are the ―storehouse‖ of genetic resources and applications of molecular biotechnology (DNA,
always available to use as long as no negative protein and enzyme) not only are used in seedling
interference occurs in natural population, and thus, propagation and plant breeding, but also in genetic
the existence of genetic resources may be assured. purity evaluation. By electrophoresis method, the
The pressures on genetic resources have been genetic evaluation may be more accurate and
increasing as the result of forest fires, the logging easier in identifying plant variety [1]. Various
practices only on good phenotypic character trees approaches using molecular markers have been
and the limited individual number of adult trees in previously applied for evaluating plant variety,
a population inducing genetic erosion due to such as microsatellite markers (also known as
selfing pollination events in individuals. If genetic simple sequence repeats/SSR). Microsatellite
materials used in preparing future plant materials markers are superior to other dominant markers
have low quality, then it can be ensured that the since having high polymorphism level, co-
quality of progeny will also decrease. Otherwise, if dominant nature, high accuracy, abundant across
genetic materials are prepared from seed orchard genomes and following Mendelian genetics [2].
with high quality seeds, then it may increase the Numerous studies using SSR marker loci
progeny productivity because of possessing higher have been published before. The availability of
genetic quality. molecular markers have facilitated genetic
Page | 199
PROCEEDINGS
diversity analysis Mondini et al [3]; Park et al [4] Microsatellite analysis

as well as pollen dispersal analysis in various plant
species which had been difficult to do previously. Seventeen loci pairs of Persimmon
Analysis of pollen dispersal assisted by molecular (Diospyros kaki) were initially screened using
markers provide opportunity for direct identifying twelve random samples of Ebony DNA for
candidate male parent of evaluated progeny. This evaluating their ability to amplify polymorphic
approach has been widely used in some annual band [13]. Only four loci pairs produced clear and
plants, such as Pinus flexilis [5], Quercus garryana strong polymorphic bands. These loci were then
[6], and Dwart Kopyor coconut [7]. It has also selected for statistical analysis. PCR reaction
been used in genetic diversity analysis of mixtures were carried out with total volume of
Mangoosteen[8] and characterization and 12.5 µL, containing 6.25 µL of PCR ready mix
transferability of Rubber [9]. (Kappa 2G fast), 3 µL of ddH2O, 1.25 µL of each
Ebony (Diospyros celebica Bakh) is one of locus (forward and reverseprimers) and 2 µL of
endemic tropical trees to central and north template DNA.
Sulawesi. It has currently been listed as vulnerable PCR amplifications were performed
species by the IUCN red List of Threatened initially in gradient to test the best annealing
Species 1998: e.T33203A9765120 [10]. Previous temperaturesbySensoquestthermocycler
reports by Restu [11] noted that the level of (Germany),with following steps: initial
genetic diversity of four Sulawesi Ebony denaturation at 95°C for 180 seconds, followed by
provenances are lower than other forest tree 35 cycles at 95°C for 30 seconds, annealing
species due to higher selfing pollination events in temperatures at ± 5°Cfrom the given melting
those populations. A low individual number in a temperature (Table 1) for 50 seconds, extention at
population resulting higher chance of selfing- 72°C for 60 seconds, and one cycle of final
pollination events that leads to the reduced extension at 72°C for 300 seconds. DNA
survival and fertility of offspring of amplification for the genetic analysis was
related individuals (inbreeding depression). To conducted under the same amplification condition
avoid inbreeding depression in Ebony, the that previously mentioned, but using optimum
information regarding genetic diversity of this annealing temperature of each locus.
species is needed for designing effective Amplification products were separated
conservation and breeding strategies. byhorizontal electrophoresis on 3% Super Fine
The objective of this study was to evaluate Resolution (SFR) gels using TBE (1×) buffer at
genetic diversity of Ebony using microsatellite 150 V for 90 minutes[14]. A 100-bp DNA ladder
marker loci. The findings of this research should was used as a reference for sizing in the obtained
be useful for conservationists and breeders in order fragments. Gels were then visualized with Gel Doc
to accelerate molecular breeding selection, assess (Biostep Gel Documentation System).
seed purity and develop DNA fingerprinting.
Data analysis
2. Methods
The data were in band patterns amplified by
Plant material and dna extraction a certain microsatellite locus. Those bands were
interpreted into genotype data. Number of alleles
Total of 58 leaf samples from two life (Na), number of effective alleles (Ne), observed
stages (tree and seedling stages) were used to heterozygosity (Ho), expected heterozygosity (He)
investigate the genetic diversity of natural forest of and Polymorphic Information Content (PIC) for
ebony in Barru, South Sulawesi, Indonesia. Leaf each locus. The Analysis of Molecular Variance
samples were collected from 32 trees and 26 (AMOVA) were analyzed using GeneAlex 6.5
seedlings. The collected samples were then stored software [15]. Clustering was done by DARWin
at -200C until DNA extraction. DNA was extracted 6.0 software using Neighbor Joining (NJ) method
using CTAB method reported by Sambrook and [16]. The Polymorphic Information Content
Russel [12] with minor modifications by (PIC)values of an l-allele locus were calculated
Larekeng[7]. DNA extraction products were then using online program and the equation is presented
qualified on 1% agarose gel electrophoresis using below, where Pi and Pj are the population
mixture solution of DNA (2µL)and loading dye frequency of the ith and jth allele [17].
(1µL). The used running buffer was TBE buffer
(1x) at 150 V for 30 minutes. Agarose gels were
then visualized by GelDoc (Biostep Gel
Documentation System).
Page | 200
PROCEEDINGS
3. Result and Discussion (locus8917DC591591). Average PIC was 0,37.

The Na, Ne, Ho, He, and PIC of Ebony in trees
Genetic diversity in tree stage stage using four microsatellite marker loci are
given in Table 2.Individuals from tree stage were
Only four microsatellite marker loci clustered by Neighbor Joining (NJ) method (Figure
produced clear and polymorphic bands. These loci 1). The individuals were clustered into tree main
were 1430DC588341, 8917DC591591, groups. They weregrouped evenly in each cluster.
9004DC591297,and ssrDK29DQ097497. The Total Na was 14 alleles with an average of
number of alleles (Na) at each locus varied from 2 3,5. Average Ne was 2,01 with a range from 1,37
(locus 8917DC 591591) to 4 (locus (locus 9004DC591297) to
1430DC588341 and 9004DC591297). The total Na 3.04(locus1430DC588341). The Ho value for
was 13 alleles with an average of 3,25. Average locus9004DC591297, locus1430DC588341 and
number of effective alleles (Ne) was 2,01. The locusssrDK29DQ097497 were 0,31, 0,96 and 0,
highest Ne was 2,99 observed using respectively. Average Ho was 0,42. He value for
locus1430DC588341 and that of lowest one was each loci was 0,27(locus9004DC591297), 0,67
1,06 for 8917DC591591. (locus1430DC588341)and 0
The observed heterozygosity (Ho) value (locusssrDK29DQ097497), respectively, with an
ranged from 0,06 (locus 8917DC 591591) to 0,97 average of 0,45. Average PIC was 0,42 with a
(locus 1430DC588341).Average Ho was 0,38. range from 0,25 (locus9004DC591297) to
Average expected heterozigosity (He) was 0,41 0,62(locus1430DC588341) (Tabel 3).The
with a range from 0,06 (locus8917DC 591591) to individuals from seedling stage were distributed
0.67 (locus1430DC588341). The highest PIC into four main clusters. All individuals in this stage
value was 0,61generated by locus were clustered in 5 cluster. The B2.1 was the only
1430DC588341,while the lowest one was 0,06 one individual that clustered in cluster 2 (Figure 1)
Table 1.Locus name and sequence from Persimmon used for DNA amplification.
Locus name/ Tm Allele size

No Repeat motif Locus sequence (5’-3’) o
genbank accession no ( C) (bp)
1 1430DC588341 (GAG)5 F: TCA GTA AAG CTG CGG GCA TC 56 190 –250
R: ACG GTT CTC CTG ATC CTC ACG
8 8917DC591591 (AT)10 F: ACA CGT TCA GTA CCA GGA GGG A 55 166 –197
R: AGT ACC ACA AAC CAC CAG TGG
9 9004DC591297 (GCAGGA)3 F: GCC ACA AAC TTC ACA GAG GAC C 55 251 –272
R: AGG CGA GTG CGA GTA AGA CGA A
16 ssrDK29DQ097497 (CCTTT)8 F: ATCATGAGATCAGAGCCGTC 53 112 –152
R: CACGTTAACGTTACGGAACA
Table 2.Numberof alleles (Na), number of effective alleles (Ne), observed

heterozygosity(Ho),expected heterozygosity (He) and PolymorphicInformation Content (PIC) of
Ebony in tree stage using four microsatellite loci
No Locus Name Na Ne Ho He PIC

1 1430DC588341 4 2.99 0.97 0.67 0.61
2 8917DC591591 2 1.06 0.06 0.06 0.06
3 9004DC591297 4 1.39 0.31 0.28 0.27
4 ssrDK29DQ097497 3 261 0.16 0.62 0.55
Average 3.25 2.01 0.38 0.41 0.37
Page | 201
PROCEEDINGS
Table 3.Number of alleles (Na), number of effective alleles (Ne), observedheterozygosity(Ho),

expected heterozygosity (He) and Polymorphic Information Content (PIC) ofEbony in seedling
stage using four microsatellite loci
No Locus Name Na Ne Ho He PIC

1 1430DC588341 4 3.04 0.96 0.67 0.62
2 8917DC 591591 4 1.56 0.42 0.36 0.33
3 9004DC591297 3 1.37 0.31 0.27 0.25
4 ssrDK29DQ097497 3 2.05 0 0.51 0.46
Average 3.5 2.00 0.42 0.45 0.42
Table 4. Number of private alleles of individuals Ebony based on four microsatellite marker loci
No Individual name Stage Number of private Locus of private allele

allele
1 B9 Trees 1 9004DC591297
2 B14 Trees 1 9004DC591297
3 B1.1 Seedling 1 8917DC 591591
4 B1.4 Seedling 1 8917DC 591591
5 B2.6 Seedling 1 8917DC 591591
6 B29.3 Seedling 1 8917DC 591591
7 B29.4 Seedling 1 8917DC 591591
B14
B9
B16
B3
B24
B4
B15
B5
B7
B22
B19
B10
B21
B1 B29
B30
B31
B28
B13
B23
B32 B27
B17
B25
B26
B12
B11
B6
B20
B2
B8
B18
0 0.1
Figure 1. Clustering of individuals Ebony in tree stage based on four microsatellite marker loci
using NJ method.
Page | 202
PROCEEDINGS
B29.4
B1.4
B1.3 B2.6
B29.2
B3.2
B2.4
B2.5
B2.1
B1.5
B15.1
B29.1
B23.1
B6.2
B6.1
B8.1
B2.2
B29.3 B29.5 B24.1

B24.2
B15.2
B19.2
B19.1
B3.1
B1.1
0 0.1
Figure 2. Clustering of individuals Ebony in seedling stage based on four microsatellite marker loci
using NJ method.
Genetic diversity in tree and seedling to 2,00. In addition, ssrDK29DQ097497 locus

stages produced 0 of Ho in seedling stage. It indicated
that all individuals in seedling stage have
The evaluated individuals in tree and homozygote alleles.
seedling stages had private alleles. Private allele is The average PIC value in this study was 0.4.
an allele that only found in a certain individual or This result was higher compared to that of reported
population. Private alleles in tree stage were by Hao et al [18] in white Birch
observed in seven individuals using locus (Betulaplatyphylla) was 0.30, yet lower than the
8917DC591591 and 9004DC591297. Numbers of finding by Verhaegen et al [19] in Teak
private alleles that were owned in tree and seedling (Tectonagrandis) was 0.49.This observed PIC
stages are presented in Table 4.Results showed that value indicated that those evaluated loci were quite
individuals in both stages were distributed in five informative for determining genetic diversity in
main groups and did not group according to their evaluated individuals. This was in accordance with
own stage (Fig 4). Bostein et al.[20], who stated that PIC values are
Results of the molecular variation analysis grouping into three classes, which each class
(AMOVA) showed that the variation among stages indicates highly informative (PIC>0.5),
were 1% with FST value 0,01. The variation among intermediate informative 5.0<PIC<0.25 and low
individuals in the both stages was 9% and F IT informative (PIC<0.25).
value was 0.1.Variation within individuals within The highest PIC was found using
stages was 90%, while FIS value was 0,09. 1430DC588341locus in the both stages and that of
the lowest was obtained from 8917DC591591
locus (tree stage) and 9004DC591297 locus
Discussion (seedling stage). Both locus pairs resulted private
alleles. 8917DC591591 locus showed only one
The results of genetic diversity analysis in private allele in both stages, whereas
evaluated stages showed that there were the 9004DC591297 locus produced two private alleles
increase numbers in Na, Ho, He and PIC value, in five individuals in seedling stage. Private allele
except for Ne value. Ne value declined from 2.01
Page | 203
PROCEEDINGS
is an allele that is only observed in a certain frequency of allele. The higher frequency of allele
individuals or population. The presence of private observed in an evaluated population sample, the
allele might cause its frequency of occurrence in higher PIV value will be obtained. DeVicenteand
both primars become low, and thus, PIC values of Fulton [21] previously stated that PIC value is
those locuss were also low. PIC value presents the determined by the frequency of allele.
ability of each evaluated locus for detecting
B29.3
B3
B14 B5
B9 B29.4
B1.4
B29.2
B16
B29.5 B15
B7
B24.1
B24.2B24
B4
B29
B23
B1.5
B15.1
B13
B23.1
B29.1
B32
B19
B1
B2.1
B17
B26
B12
B25
B11
B27
B10 B15.2
B2.2 B6.1
B8.1
B6.2
B22 B30B31
B28
B19.2
B19.1
B2.4
B2.5
B6
B20
B2
B18
B21
B3.1 B8 B2.6 B3.2
B1.3
B1.1
0 0.2
Figure 4. Clustering of individuals Ebony in Tree and Seedling Stages based on four microsatellite
loci using NJ method
Average of Ho was 0.40. The Ho value in seedling indicates low differentiation, 0.05 < FST < 0.15
stage was 0.42 and that of in tree stage was 0.38. indicates moderate differentiation, and FST> 0.15
There PIC values were almost similar to previous indicate high level of differentiation [26].
study by Alcala et al. [22], 0.41 of PIC value.The
obtained Ho values in this study were higher than 4. Conclusions
that of reported by Alcantara et al. [23] in Teak
and Hao et al. [17] in White Birch, 0.28 and 0.26, The analysis of genetic diversity in both tree and
respectively. However, these Ho values were lower seedling stages showed the number of alleles
than PIC value of Mahagony (0,51) that ranged from 2-4 alleles, while mean of alleles
investigated by Cespedes et al.[24]. Ho values of number was 3.4. There were a total of seven
this study were categorized as intermediate private alleles in both populations that consisted of
(0<H0<1) [25]. 2 alleles in tree stage and 5 alleles in seedling
The analysis of AMOVA presented the stages, respectively. Genetic variation in these
differentiation of genetic variation between both populations was 1% and variation among
stages was 1%. Variation within individuals in individuals was 9%. There were three main
same stage was 90%, and it indicated the highest clusters and 90% of individuals were distributed in
variation was within individuals in the same stage. cluster 1 and 2.
The F-value observed in this study was
classified into low variation group, yet F IT was into
moderate variation. F-value ranges from 0 to 1. 0
indicates no differentiation in variation and 1
means complete differentiation. 0<F ST<0.05
Page | 204
PROCEEDINGS
Reference Genetic Diversity of Cultivated Tropical

Plants, Enfield, Science Publishers,
[1] I.W. Mulsanti, Thesis, Institut Pertanian Bogor, Montpellier, 2003, p.43 - 76.
Indonesia, 2011.
[17] S. Nagy, P. Poczai, I. Cernak, A.M Gorji, G.
[2] Yunanto, Thesis, Institut Pertanian Bogor, Hegedus, J. Taller. Biochem. Genet. 50
Indonesia, 2010. (2012) 670-672.
[3] L. Mondini, A. Noorani, M.A. Pagnota,Rev. [18] W. Hao, S. Wang, H. Liu, B. Zhou, X. Wang,
Diver. J. 1(2009) 19-35. T. Jiang, Plos One. 10/4 (2015) 1-14.
[4] Y.J. Park, J.K. Lee, N.S. King,J. Mol. 14(2009) [19] D. Verhaegen, I.J. Fofana, Z.A. Logossa, D.
4546-4569. Ofori, Tree Genet. Genom. 6 (2010) 717-733.
[5] W.S.F. Schuster, J.B. Mitoon, Heredity. 84 [20] D. Bostein, R.L. White, M. Skolnick, R.W.
(2000) 348-361. Davis, Am. J. Hum. Genet. 32 (1980) 314-
331.
[6] T.D. Marsico, J.H. Jessica, J. Romero-
Saverson, J. Bio. Geogr. 36/5 (2009) 929- [21] C. DeVicente, T. Fulton. Molecular Marker
941. Learning Modules, vol 1, IPGRI, New York.
[7].H. Larekeng, Ph.D Thesis, Institut Pertanian [22] R.E. Alcalá, H. Salazar, G Gutiérrez-
Bogor, Indonesia, 2015. Granados, L.K. Snook, J. Trop. Forst. Scie.
26/1 (2014) 142.
[8]D.D. Matra, R. Purwanto, E. Santosa, 2010,
unpublished [23] B.K. Alcantara, E.A. Veasey, Revista Arvore
Vicosa-MG. 37/4 (2013) 747-758.
[9] F. Y, B.H. Wang, S. P. Feng, J.Y. Wang, W.G.
Li, Y.T. Wu, Plant Cell. Rep. 30 (2011) 335- [24] M. Cespedes, M.V. Gutierrez, N.M.
344. Holbrook, O.J. Rocha, Mol. Ecol. 12 (2003)
3201.
[10] [xx] Word Conservation Monitoring Centre,
1998. [25] K. Weising, H. Nybon, K. Wolff, G. Kahl,
http://dx.doi.org/10.2305/IUCN.UK.1998.RL DNA Fingerprinting in Plants: Principles,
TS.T33203A9765120.en. Downloaded on 22 Methods, and Aplications, CRC Press Taylor
September 2015. & Francis Group, Amerika Serikat, 2005.
[11] M. Restu, Natur Indon. 1/1 (2007) 1. [26] A. Sethuraman, PhD Thesis, Iowa State
University, Iowa, 2013
[12] J. Sambrook, D.W. Russell, Molekular
Cloning a Laboratory Manual. 3rd ed. Cold
Spring Harbor Laboratory Press, New York,
2001.
[13] Y. Liang, H Weijuan, S. Peng, L. Jinjun, W.

Tana, L. Fangdong, J. Fu,Scient Hort 186
(2015) 180-189.
[14] Y.T. Seng, R. Singh, Q.Z. Faridah, S.G. Tan,

S.S.R. Alwee, Genet. Mol. Research. 12/3
(2013) 2360-2367
[15] R. Peakall, P.E. Smouse, Mol. Ecol. Notes. 6

(2006) 288-295.
[16] X. Perrier, A. Flori, F. Bonnot, in: P. Hamon,

M. Seguin, X. Perrier, J.C. Glaszmann, (Ed.),
Page | 205
PROCEEDINGS
POLLEN DISPERSAL DISTANCES OF A VULNERABLE

TROPICAL TREE, EBONY (Diospyros celebica Bakh.), IN
EXPERIMENTAL FOREST OF HASANUDDIN UNIVERSITY
Gusmiaty1 , Restu, Muhammad 1, Arsyad, Mirza Arsiaty 1, Ikhsan La Husen 1,2,
Larekeng, Siti Halimah1*
1
Indonesia
2
Undergraduate Student, Faculty of Forestry, Hasanuddin University, Makassar, Indonesia
Abstract
Ebony (Diosphyros celebica Bakh) is endemic tropical tree to central and northern Sulawesi and is
currently categorized as ―vulnerable‖ species according to the IUCN. Availability of molecular marker
capable of studying how far the pollens can be transferred to female recipient trees, which be able to
provide important information for breeding program and preventing inbreeding depression at low
population level of Ebony. In this present study, we investigated the pollen dispersal distances of 95
Ebony trees in Experimental Forest of Hasanuddin University, Maros, South Sulawesi using three
polymorphic Simple Sequence Repeat (SSR) marker loci. All trees were firstly mapped with GPS
coordinates, and then genotyped using three SSR marker loci: 1430DC588341, 8917DC591591 and
mDp17EF567410. Parentage analysis was conducted using CERVUS version 2.0 software. Results of the
analysis indicated the highest polymorphic allele was obtained from mDp 17EF 567410 locus, eight
alleles. Three evaluated markers were effective for assigning candidate male parents to all evaluated
seedlings. The donated pollens could come from male parents in any directions in a range of at least 0
(selfing) up to 127 m apart from the evaluated female recipients. According to progenies analysis, female
parent of Ebony is a dominantly outcrossing pollination species. There is no specific direction of donated
pollen movement from assigned donor parents to the female ones. Moreover, insect pollinators may have
played an important role in Ebony pollination.
Keywords:Cervus analysis, Diospyros celebica Bakh, parentage analysis, pollen dispersal distance,
Simple Sequence Repeat.
1. Introduction Ebony individuals in those provenances showed a

trend of increasing the level of homozygosity or
Ebony is a valuable endemic tree to selfing pollinate. Lower individual number in a
Sulawesi having high commercial value with an population, higher level of selfing pollinations will
estimated sale value up to USD 6.000 per m³. The be occurred and lead to inbreeding depression. In
high demand of Ebony wood as raw material order to prevent it, the knowledge of mating
without being accompanied by silvicultural system of this species can be useful in estimating
management as well as its low growing nature can distances of pollen transfer between male and
jeopardize the sustained of Ebony populations and female parents and also designing effective
lead to the extinction of this species [1]. According conservation strategies.
to the IUCN Red List of Threatened Species 1998: Lately, the progress in development of
e.T33203A9765120, Ebony is categorized as DNA based markers for pollen dispersal studies
vulnerable species [2]. Previous study by Restu [3] has enhanced our understanding in mating system
revealed that genetic diversity of five Ebony of any species and allowed researchers to explore
provenances in South Sulawesi were low the advanced studies in mating system and
compared to other forest trees. He also stated that predicting pollinator types through DNA
Page | 206
PROCEEDINGS
molecular approaches. Moreover, availability of with height approximately 20 m. All trees which
molecular markers may be capable to identify were selected as candidate male parents were then
genotype of parents and their progeny and estimate labeled and plotted in the map of adult (parent)
level of selfing and outcrossing in a certain individuals generated by Garmin Map Source GPS
population [4]. Evaluating pollen dispersal in mapping software. Total number of sample trees
various plant species usually use an approach was as many as 95 individuals.
based on the parent-progeny genotype [5]. Such
evaluation may be investigated using co-dominant Collection of leaf sample
molecular marker loci, for instance, Single
Nucleotide Polymorphism (SNP) and Simple Three adult Ebony were selected as female
Sequence Repeats or Microsatellite (SSR). parents in pollen dispersal distances analysis that
Microsatellite markers have been determined by tree distribution in study site. At
intensively used in genetic study since they are co- least three to seven progeny seedlings were picked
dominant nature, abundant across genomes, having from each female parent tree. Two leaves were
high polymorphism rate and more sensitive harvested from each progeny seedling and then
(requiring less DNA template in PCR used as source of progeny DNA sample. Trees
amplification) [6]. Numerous analysis of pollen located around the female parents were assigned to
dispersal using microsatellite markers were be the candidate male parents or pollen donors.
previously reported, in coconut [7], Dinizia excelsa
[8], Pinus densiflora [9] and Shorea laprosula DNA isolation
[10]. However, there is no such study available in
Ebony stand that has been evaluated before, hence, All leaf samples were isolated using CTAB
it is important to investigate the distances of pollen (Cetyl Trimethyl Ammonium Bromide) method
dispersal in order to study the level of gamete [11], modified by Larekeng et al, [12]. PCR
exchange between individuals in Ebony amplification was performed using the touchdown-
population. The objective of this study was to PCR Sensoquest Thermocycler (Germany) with
estimate the distances of pollen transfer between total volume of 12.5 µL, containing 2 µl of
male and female parents. By this research, we template DNA, 1.25 µL of each prime pair
would like to present important informations to (forward and reverse primers), 6.25 µL of PCR
encourage other research groups in supporting mix (KAPA 2G Fast Biosystem) and 3 µL of
breeding and genetic conservation programs in ddH2O. The PCR amplification cycles were
Ebony. conducted under the following steps : one cycle of
initial denaturation at 94 ºC for 60 seconds, 35
2. Materials and Methods amplification cycles at 94 ºC for 15 seconds
(template denaturation), 51 - 55 ºC (different
Time and location of research temperature for each primer pair) for 50 seconds
(primer annealing), 72 ºC for 60 seconds (primer
The research was conducted in October elongation) and a final extension at 72 ºC for 15
up to November 2015. Sample collection was done minutes. The PCR products were then separated on
at experimental forest of Hasanuddin University, 1% Super Fine Resolution (SFR) agarose in TAE
District of Maros, South Sulawesi. Molecular buffer (1×) at 150 V in 60 minutes[13] stained
analysis activities were carried out at with GelRed (Biotium, Hayward, CA).
Biotechnology and Tree Breeding Laboratory, Seventeen microsatellite marker loci of
Faculty of Forestry, Hasanuddin University. Map Persimmon (Diospyros kaki) reported by Liang et
of Ebony trees distribution in experimental forest al. [14] were initially used in primers screening.
of Hasanuddin University is presented in Figure 1. Primer screening is an effective method to obtain a
strong and clear polymorphic-band PCR product.
Selection of Sample Tree and Parent Only three polymorphic primer pairs were
Arrays observed and then used in this study (data not
shown). Those polymorphic primer pairs were
The selection of sample trees in the study primer 1430DC588341, 8917DC591591
site was conducted by purposive random sampling. andmDp17EF567410.
A tree was firstly chosen and then used as
benchmark tree for assigning other sample trees. Data analysis
Population of Ebony trees in this provenance has
high tree density with variation in height and Identification of pollen donor (male parent)
diameter. Tree diameter ranges from 15 to 30 cm was done by analyzing the genotype of progeny
Page | 207
PROCEEDINGS
and the respective female parent versus the to 8 alleles for each evaluated primer/locus with
genotype of all adult trees in the selected samples. mean number of alleles was 6 alleles. Primer
Molecular analysis was done using Parentage mDp17EF567410 generated the highest alleles
Analysis CERVUS ver. 2.0 software [15]. The number (8 alleles). Primer 1430DC588341 and
outputs of CERVUS ver. 2.0 presented frequency 8917DC591591 obtained same number of alleles
of alleles, PIC value, heterozygosity and (5 alleles). Number of alleles, PIC value, Number
homozygosity. It was then continued by simulation of heterozygote and homozygote individuals, and
and Parentage analysis data. Simulation was heterozygosity are depicted in Table 2.
conducted to determine the threshold level for Primer 1430DC588341 showed the highest
confidence interval of 80% (relax) and 95% (strict) homozygote alleles. As many as 139of164
levels before the final parentage analysis steps. individuals had homozygote alleles. It also
Results of parentage analysis showed candidate produced the lowest heterozygote alleles (only 25
male parents with the marks of (*) 95% of individuals having heterozygote alleles). On other
confidence level, (+) 80% of confidence level and hand, Primer 8917DC591591 produced the lowest
(-) <80% of confidence level, respectively. The homozygote alleles (99 individuals), yet had
genotype of progeny with known female parent highest heterozygote alleles (63 individuals)
was compared to all adult trees that set as Mean observed heterozygosity (Ho) using
candidate male parents. The identity of male parent three microsatellite loci was 0.256. The highest Ho
was determined based on all parent with plus LOD was found using primer 8917DC591591 (0.396),
(Likelihood Of Distances) method. Results of whereas the lowestone was produced by primer
analysis were used as the basis for assigning 1430DC588341 (0.152). Mean of expected
certain male parent or pollen donor of a progeny. heterozygosity (He) was 0,59. The highest He
The distances of pollen transfer were observed by primer 8917DC591591 was 0.721,
measured by Garmin Map Source GPS mapping and that of the lowest produced by primer
software ver. 76C5x. Distances between known mDp17EF567410 was 0.203.
female and assigned male parent were also Mean PIC value for all marker loci was
calculated using the same software. Distances and 0.47. Highest PIC value obtained by primer
positions of both male and female parents could 8917DC591591 was 0.668, whilst the lowest PIC
then used to illustrate pollen dispersal pattern in value found using primer mDp17EF567410 was
study site. 0.195. The mean PIC value generated by three
evaluated SSR marker loci was 0.47. It was lower
3. Result and Discussion than that of reported by Ebi [16] in Agathis
philippinensis.
Genotyping of parent and progeny The PIC values represents that all evaluated
arrays SSR marker loci could be effectively used for
investigating parentage analysis of Ebony in
As many as 94 adults ebony were analyzed experimental forest of Hasanuddin University
in parentage analysis and three of them were provenance. The similar finding also reported by
assigned as female parents as well as candidate Larekeng [7], that SSR and SNP marker loci are
male parents. Parentage analysis was done using effective to analyze mating system and suppose the
three polymorphic microsatellitemarker loci (from distance of pollen dispersal in coconut. Austerlitz
previous primer screening). An example of et al [5] previously used SSR markers to estimate
polymorphic band pattern in 12 Ebony DNA the pollen dispersal curve. Rilya [17] also reported
amplified by primer Dp17EF567410 is presented pollen dispersal analysis of Ebony in Barru
in Figure 2. provenance.
PCR amplification using three
microsatellite marker loci produced as many as 5
Page | 208
PROCEEDINGS
Male parent
Female parent
Figure 1. Map of study site with the distribution of Ebony trees in experimental forest of
Hasanuddin University, Maros, South Sulawesi. The marks indicate the position of ( ) male parent
and ( ) female parent, respectively.
Figure 2. Polymorphic band pattern of 12 Ebony DNA generated by microsatellite locus 8917
D591591. M:100 bp DNA 1adder marker, number 1-12: Ebony DNA.
Page | 209
PROCEEDINGS
Table 2. Number of alleles, Number of heterozygote and homozygote individuals, observed

heterozygosity (Ho), expected heterozygosity (He) and Polymorphic Information Content (PIC) of
Ebony in each evaluated locus
Number of
Locus Number of Number
Heterozygote Homozygote PIC
Name Individual of Alleles Ho He
individual Individual
1430
164 5 25 139 0.152 0.605 0.555
DC588341
8917
164 5 65 99 0.396 0.721 0.668
DC591591
mDp17
164 8 36 128 0.220 0.203 0.195
EF567410
Rata - rata 164 6 42 122 0.256 0.509 0.472
The observed mean PIC value showed that Figure 3 illustrates that female parent PE7
the evaluated primer pairs were quite informative received donated pollens from assigned male
for detecting genetic variation. Bostein et al [18] parents PE17, PE59 and PE94 and located at 49 m,
previously noted that PIC values are grouping into 51 m and 127 m, respectively, from the female
three classes, which each class indicates highly recipient PE7. These data indicted that insect
informative (PIC>0.5), intermediate informative pollinators may play an important role in Ebony
5.0<PIC<0.25, low informative (PIC<0.25), as pollination due to the existence of long-distance
well. From three evaluated marker loci, primer pollination events.
8917DC591591 was the highly informative primer The female parent PE27 having six
with > 0.5 of PIC value.While primer evaluated progeny seedlings received donated
mDp17EF567410 was the low informative primer pollens from assigned male parent PE69 and PE27
with <0.25 of PIC value. are presented in Figure 4. Figure 4 exhibits the
Heterozygosity value was ranged from distance of pollen travel between the assigned
0.203-0.721. It indicated that the level of male parent PE69 to female recipient PE27 was 93
heterozygosity in the evaluated population was m. Female parent PE27 also received pollen donor
categorized intermediate to high [19]. It was from the same tree (self-pollinate).
assumed due to highly outcrossing pollination The female parent PE54 possessing nine
events in this population of Ebony. This finding evaluated progeny seedlings received pollens
was supported by Hardianti [20], who assessed the donor from the assigned male parents PE5, PE9,
proportions of selfing and outcrossing of Ebony in PE27, PE55 and PE65 (Figure 5). Figure 5 shows
experimental forest of Hasanuddin University. She the female parent PE54 received pollens donor
reported that as many as 80% of Ebony individuals from PE5, PE9, PE27, PE55 and PE65 that located
in that provenance did outcrossing pollination. at 21 m, 77 m, 70 m, 8 m and 39 m, respectively,
apart from the evaluated female PE54. The
The distance of pollen dispersal analysis donated pollen could come from assigned male
parents in any directions relative to the female
Pollens transfer from assigned male parent positions and indicate that insects pollinator
parents to selected female parents were determined may involve in Ebony pollination.
based on their GPS positions. Figure 3, 4 and 5 The distances of donated pollens transfer
show the assigned male parent positions to the from the assigned male parents to the evaluated
female recipients. Distances of pollination analysis female parents are presented in Figure 6. The
at three evaluated female parent showed that distance of pollen travel between assigned male to
pollen donors not only from different assigned female parents as measured in this evaluation
male parents (outcrossing-pollinate) but also from ranged from 0-127 m. Maximum distance ofpollen
the same tree (self-pollinate). The female parent travel in this study was as far as 127 m apart from
PE17 with five progeny seedlings received donated the evaluated female recipient.
pollens from three assigned male parents(PE17,
PE59 and PE94) are illustrated in Figure 3.
Page | 210
PROCEEDINGS
Male parent
Female parent
Figure 3. Pattern of pollen dispersal female parent PE7 inferred from parentage analysis. The
marks indicate the position of ( ) male parent and ( ) female parent, respectively.
Male parent
Female parent
Page | 211
PROCEEDINGS
Male parent
Female parent
Figure 6. Distances of pollens donor from the assigned male parents to the female recipients.
Pollen dispersal pattern of Ebony in pollinator, whereas that of the farther was assisted
experimental forest of Hasanuddin University by insect pollinator.
showed the farthest pollen travel was 127 m (two Parentage analysis by Nurtjahjaningsih [22]
pollens) and the shortest was 0 m or selfing showed that almost all contributed male parents
pollination (four pollens). Larekeng [7] previously were located far from female recipients. This is
stated that the farthest pollen travel in Kopyor similar to our findings. Moreover, the finding
coconuts in South Lampung was 63 m. It might be observed by Rily [17] showed that the farther
caused by the site study location which was distance of pollen dispersal in Lasitae Provenance
coconut private plantation. Our study site is larger in Barru (lowland area) was 268 m and much
(forest) than reported by Larekeng [7] causing further compared to our study. The different results
pollens may have travelled much in both studies should be associated with the tree
farther.According to Boer [21], the shorter distance density in the population. Population in Lasitae
of pollen travel is probably assisted by wind Provenance has low tree density with longer
Page | 212
PROCEEDINGS
spacing between individuals, hence, either insects [9] C. Lian, H. Miwa, T. Hogetsu, Heredity. 87
or other pollinators may potentially aid and (2001) 88-98.
promote long-distance dispersal of pollens.
[10] Y. Fukue, T. Kado, S.S. Lee, K.K.S. Ng, N.
4. Conclusions Muhammad, Y. Tsumara, J. Plant Resrch.
120/3 (2007) 413-420.
Molecular analysis using three
microsatellite marker loci were able to generate [11] J. Sambrook, D.W. Russell, Molekular
polymorphic alleles in the evaluated Ebony DNA. Cloning a Laboratory Manual. 3rd ed. Cold
Primer mDP17EF567410 observed the highest Spring Harbor Laboratory Press, New York,
number of alleles (8 alleles). This finding also 2001.
indicated Ebony is not always self-pollinated, but
also outcrossing-pollinated. In Ebony of [12] S.H. Larekeng, M. Ismail, A. Purwito, N.A.
experimental forest of Hasanuddin university Mattjik, S. Sudarsono, CORD. 31/1 (2015)
provenance, the donated pollens could come from 46-60.
pollen donor in the range of 0-127 m apart from
the evaluated female parents. In addition, insect [13] Y.T. Seng, R. Singh, Q.Z. Faridah, S.G. Tan,
pollinators may have played an important role in S.S.R. Alwee, Genet. Mol. Research. 12/3
long distance pollen dispersal in Ebony. (2013) 2360-2367
[14] Y.W.H.P. Liang, J.L. Sun, T. Wuyun, F. Li, J.

References Fu.Scientia. Hort. 186 (2015) 180–189.
[1] I.M. Taufik, Struktur Pengusaha Hutan Eboni [15] T.C. Marshall. Cervus Ver. 2.0, University of
(Diospyros celebica Bakh) di Sulawesi Edinburgh,UK.
Selatan, 1989.
[16] Ebi, Undergraduate Thesis, Faculty of
[2] Word Conservation Monitoring Centre, Forestry, Univesitas Hasanuddin, Indonesia,
1998.http://dx.doi.org/10.2305/IUCN.UK.19 2015.
98.RLTS.T33203A9765120.en. Downloaded
on 22 September 2015. [17] B. Rilya. , Undergraduate Thesis, Faculty of
Forestry, Univesitas Hasanuddin, Indonesia,
[3] M. Restu. Natur Indon. 1/1 (2007) 1. 2016
[4] M. Milleron, U.L. De-Heredia, L. Zaida, P. [18] D.R.L. Botstein, M. White, Skolnick, R.W.
Ramon, D. Aikaterini, A. Jesus, G. Luis , N. Davis, Am. J. Hum. Genet. 32 (1980) 314-
Nikos, Plant.Ecol. 213 (2012) 1715-1728. 331.
[5] F. Austerlitz, C.W. Dick, E.K Klein, S.O. [19] M. Na‘iem, Training Course On Basic Forest
Muratorio, P.E. Smouse, V.L. Sork, Genetic : Characteristic of Forest Genetic
Mol.Ecol. 13 (2004) 937-954. Variation, Faculty of Forestry, Universitas
Gajah Mada, 2000, unpublished.
[6] K. Semagn, A. Bjornstad, M.N. Ndjiondjop,
Af. J. Biotech. 5 (2006) 2540-2568. [20] A. Hardianti, Undergraduate Thesis, Faculty
of Forestry, Univesitas Hasanuddin,
[7] S.H. Larekeng, Ph.D Thesis, Institut Pertanian Indonesia, 2016.
Bogor, Indonesia, 2015.
[21] D. Boer, Ph.D Thesis, Institut Pertanian
[8] C.W.G. Dick, F. Austerlits.Mol. Ecol.12 (2003) Bogor, Indonesia, 2007.
753-764
[22] I.L.G. Nurtjahjaningsih, Sem. Nas. Biotek.
Hut. Pros. (2012) 91 – 108.
Page | 213
PROCEEDINGS
CASSAVA (MANIHOT ESCULENTA CRANTZ) TOLERANCE

SCREENING ON WETNESS USING MORPHOLOGICAL,
PHYSIOLOGICAL AND PROTEIN MARKERS
Sholeh Avivi1, 2*, I Gusta Dimas Satyalowa1, Didik Pudji Restanto1,2, Tri Agus
Siswoyo1,2, Sigit Soeparjono1, Sri Hartatik1, Achmad Subagio2
1
Jember University, Agronomy Department, Post Graduate Program, Agriculture Faculty, Jember, 68121,
East-Java, Indonesia
2Jember University, Center for Development Advance Sciences and Technology (CDAST), Jember,
68121,
East-Java, Indonesia
E-mail: *Correspondence Author: savivi.faperta@unej.ac.id
Abstract
Wet land including on the marginal land. The land can be suffered by wet throughout the year as
marshland, land tides on the beach or can form from land affected by heavy rainfall in a long time. Thus,
in the future will be required plants that tolerance and produce the harvest from wet land. The objectives
of study were (1) to identify cassava variety that tolerant of wet, (2) to know the character of morphology,
physiology, and protein of clone cassava after tested with wet treatment. The research uses random design
factorials consisting of two factors and three replication. The first factor was, 20 cassava varieties (V1-
V20) collected from 20 cassava farmers in Indonesia. The second factor was field capacity consisting of
C1=100% and C2 = 150% field capacity (FC). The result showed that every variety give different
response after wet treatment. Wet treatment on cassava significantly increase parameter of plant height,
number of leaves, level of green leaves, and stem diameter. Clone by best wet tolerance indicated by
variety number 13, 14 and 17. While most susceptible to wet indicated by varieties code of 2, 6, and 8.
Cassava‘s protein with molecule weight of 66,2 KDa appear thicker in tolerant plant after receiving
treatment of 150% field capacity and appearing thinner (even not appear at all) in intolerant plant on wet.
Keywords: cassava varieties, wet, protein band
1. Introduction extension. Agricultural extension done by means

of land use marginal. Marginal land in water stress
Indonesia is an agraris country that most of land consisting of land water shortage and land
the country people are farming and rely on with a surplus water as tidal land, marsh land, and
agriculture. The population of the fastest growing the land often exposed to flood. An area of land
have seized the use of farm land for the benefit of marsh in Indonesia estimated 33.393.570 acres
non-farming, as a result farm land became much consisting of 20.096.800 acres (60,2%) tidal land
smaller and agricultural product decreased and 13.296.770 acres (39,8%) marsh land non tidal
(Moniaga [1]). Consequently, country trying to (lebak) (Anon [3]).
import some commodities as cassava to provide Water stress can cause anaerobic conditions
for its inhabitants. In accumulated, on January- in the rooting area and reduce gas interchange
april 2016, total of Indonesia cassava import has between the ground and air. The availability of O2
achieved 7.266 tons $1,2 million dollars. Higher for the roots of plants and micro-organisms in the
than the same period last year on 2015, namely soil becoming more limited. The air in the soil
28,4 tons of us $6.802 (Jefriando [2]). finally will be encouraged out and inhibit the rate
The Indonesian government has overcome of diffusion, due to limited supplies of O2 around
this import by means of intensification and rooting. This can decrease leaves water potential
Page | 214
PROCEEDINGS
resulting in close stomata and wither leaves 1200 ml; C2 volume watering water 150% field
(Ashraf and Harris [4]). Excess water in plants can capacity = 150/100 x 1200 ml = 1800 ml.
damage growth. Declining oxygen resulted in Protein Extraction. This extraction uses 0.5
energy for the cells that causes metabolic activities grams sample leaves crushed use mortar with a
and energy production. By this condition, plant mixture of quarsa sand. Then sample that already
made changes morphology, anatomy, physiology crushed mixed with a buffer phosphate by
and biochemical to adapting to the environment comparison heavy sample and a buffer 1:3. The
were fearing the worst (Tetsushi and Karim [5]). next step protein solution in eppendorf was
Today, still has not been any variety of Indonesian centrifuged 10,000 rpm for 10 minutes and taken
cassava which survive of wet stress. This research its supernatant. Levels of a protein determined
want to found the varieties cassava that tolerant to with the Bradford methods. As many as 5 µl
wet stress. protein solution mixed with 45 µl aquades and
solution Bradford 950 µl. Solution in vortex until
2. Methods homogeneous. Absorbent solution measured with a
wavelength 595 nm. Standard solutions of protein
Experiments undertaken in Jember, in a site used was BSA solution by concentration of the 0
of green house and laboratory analysis of the µg/µl, 2 µg/µl, 5 µg /µl, 10 µg/µl, 15 µg/µl, 20
Agriculture Faculty of Jember University. The µg/µl. Analysis pattern ribbon protein leaves SDS
materials and instrument used in this experiment is PAGE. First , make separating gel 12%: Aquades
20 varieties of cassava (the variety number 1 3.35 ml, 1.5 M Tris-Cl, pH 8.8 2.5 ml, 10% SDS
through 20 derived from various regions in 0.1 ml , Acrylamide/bis (30% T, 2.7% C) 4.0 ml,
Indonesia), chart colored leaves research IRRI 10% ammonium persulfate 50 µl (0.05%) ,
agriculture agency, leaf porometer, digital TEMED 5 µl (0.05%). Next, prepared 10 ml
refractometer, clorophyllmeter (SPAD-502 stacking gel solution monomers (4% T , 2.7% C)
Minolta), MINI-PAM, spectrophotometer, by mixing matter: Aquades 6.1 ml , 0.5 M Tris-Cl,
electrophoresis and tools that deals with pH 6.8 2.5 ml, stock akrilamid solution (30% T)
maintenance plants and the harvest. This research 1.3 ml, 10% SDS 0.1 ml. Dispose of air absorb in
using factorials random design group, with 2 monomers solution with a vacuum in about 15
factors and 3 times of replication. The first is minutes.
varieties (V) consisting 20 varieties namely V1 to Next, include separating gel in
V20. The second factor is high flooding (c) electrophoresis plate to get to the limit of
consisting of 2 field capacity namely: C1 (the separating gel. And then add aquades gel average
water 100% field capacity) and C2 (the water and avoid the presence of oxygen. Then let the gel
150% field capacity). The difference between left about 30 minutes until polymerization. Then
treatments tested with Duncan Multiple Range threw aquades after separating gel polymer. After
Test (DMRT) with confidence 5%. Observation that include comb slowly into plate (do not formed
was done in the agronomy, physiology, and protein bubbles). And let it left about 30 minutes until the
band character closely related to wet resistant polymerization after being polymer gel, combs
(Begum et al. [6]). released from gel slowly and move gel slowly into
Watering various field capacity (FC) tanks electrophoresis. Next dissolving into each
condition on media. Watering performed when sample of a buffer (0,06 M Tris-Cl, pH 6,8, 2%
shoots after planted in a media after wind dried to SDS, 10% Glycerol, 0,25% Bromophenol Blue):
14 kg. After was done of sprinkling with the Aquades 4,8 ml, 0,5 M Tris-Cl, pH 6,8 1.2 ml,
volume of water in accordance with different 10% SDS 2,0 ml, Glycerol 1,0 ml, 0,5%
treatment that is 100% and 150% field capacity. Bromphenol Blue (w/v water) 0,5 ml. the process
To know the volume of water has reached field of dissolving/dilution sample done by comparison
capacity by weighing heavily early media after 1:4. Then heats sample to 950 C temperature for
wind dried (14 kg). Then flushing with water until about 4 minutes.
the media in polybag not trickling down under the Assemble a series of instrument
surface. The volume of water that added to the electrophoresis. Fill a reservoir up and down with
condition were 1200 ml (condition is established a buffer electrodes (0.025 M Tris, 0.192 M
as the condition 100% field capacity). Next Glycine, 0.1% (w/v) SDS, pH 8.3 (0.3 grams Tris
counting how much the volume of water that Base, 1.4 grams Glycine , 1 ml 10% SDS/100 ml a
splashed in a media until it reaches the condition buffer the electrodes). Admit sample into well by
field capacity. Determination of the volume of 1µg /well. Then connecting a tool with power
watering water as follows: C1 volume watering supply and running gel in voltage 200 volt for 45
water 100% field capacity = 100/100 x 1200 ml = minutes or up samples has reached that part of the
Page | 215
PROCEEDINGS
base gel. After the electrophoresis completed, by test Duncan‘s Multiple Range Test (DMRT) on
continued to take off homemade instrument 5% standard.
electrophoresis, release gel and do staining
(staining dye) in a gel with use Comassie Blue R- 3. Results and Discussion
250. Staining done by making solution dye: 0.1%
Comassie Blue R-250 (w/v) in 40% methanol Any plant having different water needs,
(w/v), 10% acetic acids (v/v). Filter dye solution similarly of the cassava plant. Even any kind of
after homogenized, next to soak the gel in dye plant varieties of cassava show different response
solution for 30 minutes. After that distaining also against water stress. This shows that every
process by using 40% methanol, 10% acetic acids. plant having a limiting factor and tolerance power
Do the distaining process to be clear gel, next to environment (Solichatun et al. [7]). The result
replace distaining solution with a solution of acetic of the observation can be seen on Table 1a & 1b
acid glacial 10%. After that the results shows the morphology and physiology character of
photographed and scanned using scanner. 20 different varieties of cassava. The characters
Variable observation used in this that can determine tolerance plants to water stress
experiment includes: plant height, number of indicated by variable plant height, number of
leaves, colored leaves, heavy fresh plants, diameter leaves, chart colored leaves, diameter of the stem
of the stem, roots volume, conductivity of stomata, and the chlorophyll content and all significant
sugar content (brix), chlorophyll content, the rate impact on varieties tested. The highest score on the
of photosynthesis, protein analysis. Observation variables of higher plants and number of leaves
against the root of was also made of a heavy found in clone code 19 with the 129,2 cm and 26
wetness and heavy dried root (without fingerprint). compared to other varieties.
The real difference between treatments analyzed
Table 1a. The Morphological and Physiological Characters on the 20 Cassava Varieties
Number of Colored Diameter of the

Varieties Plant Height (cm)
Leaves Leaves Stem (cm)
1 102.6 abcdefg 12 bc 4 abc 1.2 Abcdef
2 114.9 Abcd 17 abc 3 c 1.1 Bcdef
3 70.0 Efg 14 abc 4 a 1.1 Abcdef
4 65.0 G 11 bc 3 abc 1.2 Abcdef
5 110.0 abcde 18 abc 4 ab 1.4 Abc
6 81.8 bcdefg 9 c 4 abc 1.2 Abcdef
7 121.1 Ab 14 abc 3 abc 1.3 Abcdef
8 79.2 Cdefg 12 bc 3 abc 1.1 Bcdef
9 80.4 bcdefg 15 abc 3 abc 1.2 Abcdef
10 92.7 abcdefg 23 ab 4 abc 1.3 Abcde
11 119.2 abc 15 abc 3 abc 1.3 Abcd
12 97.7 abcdefg 17 abc 3 abc 1.2 Abcdef
13 109.3 abcdef 12 bc 4 abc 1.3 Abcde
14 101.3 abcdefg 16 abc 4 abc 1.4 A
15 90.1 abcdefg 20 abc 4 abc 1.2 Abcdef
16 81.0 bcdefg 9 c 4 abc 1.0 F
17 99.6 abcdefg 13 bc 4 abc 1.4 Ab
18 80.1 cdefg 14 abc 3 abc 1.1 Bcdef
19 129.2 a 26 a 4 abc 1.2 Abcdef
20 92.2 abcdefg 12 bc 4 abc 1.2 Abcdef
Note: The same letters on the same column shows that markedly similar according to test DMRT 5%
Varieties hold wet (150% field capacity) indicated by variety with the code 14, 13 and 17.
can be seen in Table 2. The value of varieties with Variety does not hold in wet (150% field capacity)
the highest value of fresh root weight are 601,47 can be seen in Table 2. The values of the lowest
grams (variety 14), 390.36 grams (variety 13) and root volume are 37,26 grams (variety 8), 51,66
378,14 grams (variety 17).While the highest value grams (variety 6) and 53,41 grams (variety 2).
of the volume root 480 mls (variety 17), 350 mls While the value varieties with the lowest value of
(variety 14) and 300 mls (variety 5). Thus best the fresh weight of roots are mls (20 variety 16),
response selection variety which retains its wet mls (50 variety 15) and 70 mls (variety 18). Thus
Page | 216
PROCEEDINGS
most varieties do not hold in wet indicated by leaves, green color leaves level, and diameter of
varieties with the code 8, 6 and 2. Table 3 the stem. Field capacity 150% have high value
indicates the influence of the availability of water plant (123,36 cm), number of leaves (25), chart
on the growth of the cassava plant. Wetness colored leaves (4) and diameter of the stem (1,34
treatment in cassava raise plants height, number of cm) higher than the control 100% field capacity.
Table 1b. The Morphological and Physiological Characters on the 20 Cassava Varieties
Heavy Heavy Heavy

Chlorophyll Root
Varieties Fresh Fresh Fresh
Content Volume Brix (%)
Roots Stem Leaves
(µmol/m2) (ml)
(gram) (gram) (gram)
1 39.2 bcde 72.4 195.2 25.9 123.3 0.9
2 43.7 abcde 42.5 161.0 20.0 64.3 0.5
3 43.5 abcde 56.7 137.5 45.9 88.3 0.7
4 42.7 abcde 116.8 100.4 57.0 174.3 1.3
5 46.8 abcde 169.0 160.8 71.0 161.3 1.6
6 45.5 abcde 62.5 163.3 54.5 99.7 1.5
7 43.7 abcde 110.0 133.3 52.0 119.0 0.9
8 50.8 ab 36.9 133.1 42.5 83.3 0.5
9 41.9 abcde 65.2 119.0 38.0 100.0 1.0
10 47.8 abcd 169.4 155.5 69.4 153.3 0.7
11 41.3 abcde 198.3 255.7 107.8 173.3 0.0
12 49.2 abc 168.9 172.8 68.7 141.7 0.4
13 41.0 abcde 205.6 308.8 37.7 140.0 0.2
14 42.6 abcde 284.1 390.7 57.4 223.3 0.0
15 47.3 abcde 93.4 182.5 54.4 83.3 0.1
16 40.2 abcde 63.5 130.4 83.7 30.0 0.2
17 38.9 bcde 177.0 273.6 50.1 193.3 0.1
18 35.9 de 80.7 115.0 40.0 56.7 0.1
19 52.7 a 77.5 248.8 51.1 51.7 0.1
20 46.4 abcde 76.9 213.3 64.2 58.3 0.1
Electrophoresis on the results of a gel Figure 2. Pattern a protein band on variety with
polyakrilamid on tape protein pattern cassava code 2, 5 and 8 shows band formed seemed the
leaves with treatment 100% of the water the feild most thin and the possibility of degraded because
capacity shown in Figure 1. As for the content in all moleculars weight do not appear in figure.
marker used the lysozyme protein (14,4 kDa), β- Corresponding in Table 2 wetness resistant
lactoglobulin (18,4 kda), REase Bsp981 (25,0 varieties (150% field capacity) can be seen best
kDa), lactate dehydrogenase (35,0 kDa), selection response of wetness resistant variety
Ovalbumin (45,0 kda), Bovine serum albumin indicated by variety with code 14 in which variety
(66,2 kDa) and β–galactosidase (116,0 kDa). The has thickness a protein band on molecular weight
results of electrophoresis in polyacrilamid gel 66,2 kDa. Expected this protein band influenced
about pattern protein bands leaves cassava with variable plants height because variety height with
water treatment 150% field capacity shown in code 14 was higher value than the other varieties.
Page | 217
PROCEEDINGS
Table 2. Comparison of 100% and 150% field capacity treatment for 20 varieties cassava on Fresh
root weight and Root Volume
Fresh root weight Root Volume

Varieties (gram) (ml)
FC FC FC FC
100% 150% 100% 150%
1 31.42 123.11 120 100
2 22.41 53.41 57 86
3 32.21 84.37 40 135
4 112.56 181.48 157 230
5 185.69 212.56 86 300
6 93.43 51.66 83 120
7 53.26 212.14 107 130
8 41.25 37.26 50 110
9 42.79 111.25 50 100
10 114.56 281.42 150 200
11 101.46 311.26 250 150
12 162.34 302.51 200 125
13 164.15 390.36 50 280
14 191.51 601.47 230 350
15 62.43 156.26 150 50
16 91.42 69.74 20 20
17 51.47 378.14 50 480
18 95.61 104.56 90 70
19 68.11 142.65 20 125
20 39.64 148.51 25 140
The difference response of cassava (Li et al. [9]. Chlorophyll synthesized in leaves
varieties to water stress which are useful to catch the light of the sun which
numbers are different for each species. Which
Some genotipe of plants capable of affects the chlorophyll synthesis is light, sugar or
adapting to the environment water stress through carbohydrate, water, temperature, genetic factors,
adaptation using physiological and genetic disturbances such as elements of the N, Mg, Fe,
mechanisms. All varieties indicating the nature of Mn, Cu, Zn, S and O (Hendriyani and Setiari [10].
genotip and different phenotype. The properties of The radiant energy will be transferred to the center
is in line with character each variety. Growth and reaction fotosistem I and II which is the occurrence
development an organism supported by the of light energy change into the chemical energy (Li
interaction of genes and environment influence it. et al. [9]). Two mechanisms involved in the
The genes that several of each variety expressed in formation of chlorophyll complex protein is the
various character too. According to Matasci et al. new chlorophyll distribution synthesized and
[8] the visibility of a phenotype of hanging from redistribution of chlorophyll existing. Chlorophyll
the nature and relations between genotip and b is the result of biosynthesis of chlorophyll a and
environment. play an important role in reorganization fotosistem
Chlorophyll is a component of a main for adaptation to the quality and the intensity of
chloroplast and chlorophyll content relatively light. Therefore loss of chlorophyll a and b have a
positively correlate with the rate of photosynthesis negative influence on efficiency photosynthesis
(van der Mescht et al. [11]).
Table 3. Effect of wet stress treatment on several parameters
Field capacity Plants height Number of Leaves Stem diameter

(FC) (cm) leaves color (cm)
FC 100% 95.71 b 12 b 3 b 1.16 b
FC 150% 123.36 a 25 a 4 a 1.34 a
Page | 218
PROCEEDINGS
plant depending on genotype, environmental

conditions, the growing phase when the wetness
happened, the long of wetness, the depth of
wetness, and the water movement on lands, and the
plant growth (Tetsushi and Karim [5]; Susilawati,
et al. [12], Islam MS et al. [13]). The higher of
wetness that occurred during active growth phase
will influence to the weight of the sugarcane stem
and reduced the production in line with an increase
in the wetness (Islam MS et al. [13]). Wetness
could decrease plant height and leaves number
(Avivi, et al. [14]).
According to Glaz, et al. [15] the
reduction of the production as 8.3% on nine
cultivars of sugarcane after treatment high wetness
-15 cm. The increase in wetness time in generative
phase significantly decrease the capacity of plants
Figure 1 The proteins band on cassava leaves survive, the quantity of a crop life, the plant high
on 100% field capacity (upper) and and the number of branches of chili plant
150% field capacity (bottom). Note: (Susilawati, et al. [12]). Jagadisha [16] reported
M = marker and varieties 1-20 that a decline in growth parameters as high of
encode by numbers. plant, the number of green leaves, the broad leaf
index, the chlorophyll content and the total
production dry weight after wetness treatment.
Chlorophyll content can be used as an Begum et al. [6] reported that wetness decrease the
indicator of being credible to evaluate an green leaves of seven clone of sugarcane while the
imbalance metabolism between photosynthesis and number of leaves yellowing increase (Malik and
producing stuff at the time of water shortage (Li et Tomer [17]; Tetsushi & Karim [5]).
al. [9]). In Table 1 shown on the variables of the Some physiological characters that
highest variable colored leaves chart shown on changed after wetness stress were: (1) the decrease
codes variety 3 with a value of 4 which means dark of transpiration, (2) the decrease of photosynthesis
green. The growth of plants which is good and but the stomata conductance increased, (3) the
offer high yields requires supply nitrogen enough. decrease of growth, (4) the respiration to be higher.
If the supply of N is not enough then looked the The effect of wetness stress to respiration depends
growth of an organ and the whole plants that do on varieties and physiology phase of plant, The
not normally like symptoms from chlorosis that young phase growing plants are getting worse the
looked at leaves. Leaves turn paler, yellowing of stress effect (5) change the metabolic processes
the and in the condition of a lack of N become from aerobic to be anaerobic, (6) the nutrients
dead. absorption by the roots declining (Malik and
The difference in plant height value, Tomer [17]; Tetsushi & Karim [5]). Also reported
number of leaves, chart colored leaves and that wetness could change the morphology,
diameter of the stem able to illustrate one of the anatomy, physiology, and biochemistry of plant.
types tolerance of the existence of wetness (Table The damage due to the wetness stress influenced
3). Basically growth is the balance between the by several factors, those are high of wetness, the
carbons in photosynthesis and found in respiration. duration or long wetness, and the speed of water
The variables is an indicator growth pertaining to flow (Tetsushi & Karim [17]). The crops character
the availability of water and nutrient element that tolerance to wetness stress present in Table 1.
especially nitrogen in land. The wetness stress on root will lower the
amount of available oxygen. The decrease in
The changed characters of plant after oxygen under optimal level, called hypoxia. This is
wet stress. the most common form of wetness stress and
occurs when the roots were submerged in water
Generally flooding stress will cause a but the shoot remain in the atmosphere (Parent et.
decline in morphological character growth, the al. [18]). The maximum number of dissolved
decline in the production and even death. The loss oxygen when wetness happened only 3% compare
of crops production due to the wetness stress on with normal air. That condition caused the change
Page | 219
PROCEEDINGS
of respiration from aerobic to fermentation [2] M.Jefriando.

anaerobic that induces glycolysis and fermentation http://finance.detik.com/read/2016/05/17/071
genes (Dat et al. [19]). 213/3211959/4.2016.
Direct consequences from hypoxia is
ATP's reduction as a result of reduced availability [3] Anon. Pusdatainfo Rawa & Pesisir, dan
of O2. Oxygen plays a role in produce energy for Universitas Sriwijaya. http://www.Pusdata-
the cells so the presence or absence of oxygen rawa.or.id/wpcon-
determine the metabolic activity and the tent/uploads/2010/01/LWMTL.pdf. 2006.
production of energy. Oxygen serves as electron
acceptor in oxidative phosphorylation line that [4] M.Ashraf, P.J.C. Harris. Photosynthetica. II 51
produces ATP, the major source of energy to cell (2013) 163.
metabolism, to regenerate NAD as cofactor of
NADH (Dennis, et. al., [20]). The increase of [5] H.Tetsushi, M.A. Karim. South Pacific
glycolytic flux in line with production of NAD+ Studies. I 28(2007) 9.
by pyruphate fermentation become ethanol through
[6] M.K. Begum, M.A.S. Miah, M.S. Islam, M.A.
pyruphate decarboxylase and alcohol
Hossain, M.R. Alam. Studies on
dehydrogenase (ADH).
morphological characters for selecting flood
Then ethanol diffuses out of the cell into
stress tolerant clones. Pakistan Sugar Journal.
external environment reduce reserves carbon of
I 23 (2008) 1.
plants. Hence, the metabolism of pyruvic become
alanine provide an alternative product, including 2- [7] Solichatun, Anggarwulan, Endang, dan M.
oxoglutarate that can be change to succinic, Widya. Biofarmasi.II 3 (2005) 47.
through a cycle of TCA by Succinate CoA ligase
(SCS). This process give additional ATP per [8] M.C.D. Matasci, M. Lachmann, C.T.
sucrose molecule. NADH oxidation in a Bergstrom. Evolutionary Ecology Research,
mitochondria matrix guaranteed by the reduction 10 (2008) 493.
of oxaloacetate through the opposite of TCA
reaction cycle who catalyzed by malic [9] R.Li, P. Guo, M. Baum, S. Grando, S.
dehydrogenase. Malic then converted into fumaric Ceccarelli. Agricultural Sciences in China.X
and succinic that can be carried out from a hypoxia 5 (2006) 751.
tissue to the aeration tissue (Bailey-Serres, et. al.
[21]). [10] I.S. Hendriyani, N. Setiari. Sains &
Matematika.III 17 (2009) 145.
4. Conclusion
[11] A.Van Der Mescht, J.A. de Ronde, F.T.
Based on the research done can be concluded that Rossouw. South African Journal of
response best selection varieties hold wet indicated Science.V9(1999) 407.
by varieties with code 14, 13 and 17. While the
most variety does not hold wet indicated by [12] S. Susilawati, R.A. Suwignyo, M. Munandar,
varieties with code 8, 6 and 2. Potein cassava with M. Hasmeda. JLSO.I 1(2012) 22.
molecular weight 66,2 kDa appear more thick on
condition excess water. [13] M.S. Islam, M.A.S. Miah, M.K. Begum, M.R.
Alam, M.S. Arefin. World Journal of
Acknowledgement Agricultural Sciences. IV 7 (2011) 504.
[14] S.Avivi, S. Soeparjono, Slameto, R.A.

This research was supported by 1. LPDP project.
Ramadhan. Agriculture and Agricultural
Number of Contract: PRJ-1964/LPDP/2015
(chemical assistance of research). 2. Postgraduate Science Procedia, 9 (2016) 31.
Project Grant no contract [15] B. Glaz, D.R. Morris, S.H. Daroub. Crop Sci.
187AE/UN25.3.1/LT/2016 (funds assistance 44 (2004) 1633. [19] J.F. Dat, N. Capelli, H.
research in the field). Folzer, P. Bourgeade, P.Badot. Plant
Physiology and Biochemistry. 42 (2004) 273.
References
[16] S. Jagadish, J. Cairns, R. Lafitte, T. Wheeler,
[1] Moniaga, Vicky R.B. ASE. II 7(2011) 61. A. Price, P. Craufurd. Crop Sci. 50 (2010)
1633. 10.2135/cropsci2009.09.0516.
Page | 220
PROCEEDINGS
[17] S.S. Malik, B.S. Tomer. Indian Sugar. 53 K.P. Ismon, A.G. Good, W.J. Peacock.
(2003) 585. Journal of Experimental Botany. CCCXLII
51 (2000) 89.
[18] C.N. Parent, Capelli, A. Berger, M.
Crèvecoeur, J.F. Dat. I 2(2008) 20. [21] J.Bailey-Serres, T. Fukao, D.I.J. Gibbs, M. J.
Holdsworth, S.C. Lee, F. Licausi, P.Perata,
[20] E.S. Dennis, R. Dolferus, M. Ellis, M. L.A.C.J. Voesenek, J.T. van Dongen.Trends
Rahman, Y. Wu, F.U. Hoeren, A. Grover, in Plant Science.III 17 (2012).
Page | 221
PROCEEDINGS
REJUVENATION OF LONG-TERM CULTURE OF

EMBRYOGENIC CALLUS OF SAGO PALM (METROXYLON
SAGO ROTTB.) : EFFECT OF COCONUT WATER AND SUCROSE
IN A LIQUID MEDIUM
Rizka Tamania Saptari1, Imron Riyadi1, Sumaryono1
1
Indonesian Research Institute for Biotechnology and Bioindustry, Jalan Taman Kencana No.1, Bogor
16128, Indonesia
E-mail : rizkatamania@iribb.org
Abstract
Sago palm (Metroxylon sago Rottb.) is one of carbohydrate-producing plants, grown especially in
eastern Indonesia. Mass propagation of sago palm can be done by tissue culture to produce high quality
clonal planting materials. Tissue culture of sago has been done successfully by somatic embryogenesis.
The availability of embryogenic callus is important in somatic embryogenesis. Therefore, callus
subcultures must be done repeatedly to secure the availability of callus as stocks. However, repeated
subcultures reduce proliferation rate of callus and their ability to form somatic embryos, so that they need
to be rejuvenated. Here we reported the efficient method to rejuvenate embryogenic callus using liquid
culture. The purpose of this study was to determine the effect of coconut water and sucrose on the growth
and development of long-term culture of embryogenic callus of sago. Calli of sago from sucker's tip
meristem culture which have had 31 times of subcultures were used as explants. The calli (0.3 g) were
cultured in liquid cultures treated with various concentration of coconut water 0%; 5%; 10%; and 20%,
and sucrose at 10 g/L; 20 g/L; and 30 g/L. The result showed that the development of callus in liquid
cultures after 8 weeks was the best at 5% coconut water and 30 g/L sucrose, which had better growth,
higher biomass weight (4.7 g/flask), and higher number of somatic embryos (19 globular embryos, 1
elongated embryo, 1 scutelar embryo, and 1 coleoptelar embryo).
Keywords : Sago palm, embryogenic callus, rejuvenation, sucrose, coconut water
1. Introduction form new clusters. Another vegetative propagation

for sago palm is by a tissue culture, which is useful
Sago palm (Metroxylon sagu Rottb.) is a palm for a large scale clonal seedlings production.
tree grown mostly in the hot humid tropics of Tissue culture of sago palm was successfully
South-East Asia and Oceania. Sago palm is one of established through somatic embryogenesis
the most productive carbohydrate-producing method [4, 5]. Steps in somatic embryogenesis are
plants. Its trunk contains high amount of starch, up initiation of embryogenic callus, proliferation of
to 300 kg dry starch/plant [1]. Some regions in embryogenic callus, expression of somatic
Indonesia, such as Maluku, Siberut Island, and embryos, and maturation and germination of
Papua cultivate this plant as a major staple food for somatic embryos.
daily consumption [2]. Many kind of dishes can be Embryogenic callus is initiated using 2,4-D and
made from sago starch. Moreover, the starch also kinetin on Murashige and Skoog modification
can be used for the production of bioethanol [1, 3]. (MMS) solid medium [4]. After that, the
Propagation of sago palm can be conducted concentration of 2,4-D is gradually reduced for
generatively by seeds or vegetatively by suckers. callus proliferation. Finally, somatic embryos are
Suckers mostly grow from the lowest leaf axils on induced from embryogenic callus after several
the 4-5 years old plants. Suckers will start new subcultures [5]. The availability of embryogenic
trunk formation close to the original trunk. Suckers callus is important for somatic embryos
can also be separated from the original trunk to production. Therefore, subcultures of embryogenic
Page | 222
PROCEEDINGS
callus must be done repeatedly to secure its was measured to 0,3 g and then inoculated to
availability. However, repeated subcultures reduce MMS liquid medium supplemented with coconut
proliferation rate of these long-term callus cultures water (0% (v/v), 5%, 10%, and 20%) and sucrose
and their ability to form somatic embryos. This is (10 g/L (w/v), 20 g/L, and 30 g/L). Before used,
probably caused by the saturation of the callus the media were adjusted to pH 5.7, poured 20 ml
cells to the exposure of hormones for a very long into Erlenmeyer flask, and then sterilized on
time. Rejuvenation of long-term callus is needed to autoclave at 1 kg/cm3 and 121oC for 20 min.
restore callus capacity to proliferate and produce Erlenmeyer flasks were placed on a shaker at 80
somatic embryos. rpm. The cultures were incubated in the dim light
Rejuvenation of long-term callus culture can be room with 26 ± 1oC of temperature. As a control,
conducted by using substances which can absorb callus was continuously subcultured on the solid
the accumulation of hormones in callus cells such media as the standard method.
as coconut water, active charcoal, or free hormone The cultures were subcultured after 4 weeks into
liquid medium. Previously reported that the new media with the same composition, and then
addition of coconut water in the in vitro culture re-incubated until 8 weeks. The colour of callus
could maintain the freshness of explant cells two was observed and callus growth was estimated
times longer than in the medium without coconut every week using CVS (Callus Volume after
water [6]. Coconut water is widely used in tissue Sedimentation) method. After 8 weeks of culture,
culture industry due to its various chemical callus fresh biomass was weighed and the number
compositions such as sugars, vitamins, minerals, of somatic embryos at different developmental
amino acids, and phytohormones [7]. One of main stages formed was counted.
components in coconut water is cytokinin. It is A completely randomized design was
found that cytokinins have an anti-aging function, used for this experiment. Every treatment has four
which may delay cells senescence [8, 9]. replications. Observation data were subjected to
Furthermore, vitamins and other micronutrients in analysis of variance (ANOVA), and means were
coconut water have an antioxidant effect which compared by Duncan‘s Multiple Range Test
prevents cells damage [10]. Beside using cells (DMRT), which differences at p ≤ 0.05 considered
damage protection substances like coconut water, to be significant. Analysis was conducted using
the use of sucrose on the right concentration could SPSS Statistics programme.
improve callus growth [11]. Sucrose in the in vitro
medium caused osmotic stress which improved 3. Results and Discussion
cell turgor and callus biomass [11, 12]. However,
high amount of sucrose may inhibit cells growth, Callus volume in liquid culture
especially when the nutrition is limited [11].
Because of that it is important to determine the Results showed that callus volume in the liquid
optimum concentration of sucrose used for every culture increased significantly from the first week
explant. Moreover, the cells growth could also be to third week. After that, the growth began to slow
improved by the application of liquid culture for a down (Figure 1) so it needed to be subcultured in
large scale seedlings production [13-15]. the fourth week. The callus was transferred to the
The purpose of this experiment was to determine new media with the same composition as before.
the effect of coconut water and sucrose in a liquid After subculture, callus growth started to increase
culture to rejuvenate sago palm embryogenic again. After six weeks, callus growth varied ineach
callus which had undergone long-term repeated treatment (Figure 1). The best callus growth until
subcultures, in order to increase callus seven weeks was from the treatment of 10%
proliferation rate and its capability to produce coconut water and 30 g/L sucrose, followed by the
somatic embryos. treatment of 5% coconut water and 30 g/L sucrose.
The use of 30 g/L sucrose in the liquid culture
2. Methods generally increased callus volume until seven
weeks. While the effect of coconut water varied,
Embryogenic callus of sago palm derived from depending on the concentration of sucrose used.
shoot tip culture was used as an explant. The calli Previously reported that the use of sucrose in the
have been continuously subcultured every 4 weeks culture medium induced cell metabolism towards
for 31 times on the MMS solid medium [4] undifferentiated division, therefore sucrose was
supplemented with 20 g/L sucrose, 1 mg/L 2,4-D, better used on the callus proliferation stage [16].
0,1 mg/L kinetin, and 1 g/L active charcoal. Callus
Page | 223
PROCEEDINGS
Figure 1. Effect of coconut water and sucrose in a liquid medium on the growth of sago palm long-
term embryogenic callus for 8 weeks.
Callus biomass deficiency of oxygen [18]. Moreover, because of

the rapid metabolism of the cells in the liquid
Callus fresh biomass was weighed after eight culture, led to the accumulation of toxic gases
weeks culture. The treatment of 20 g/L sucrose and which accelerated browning [19]. To prevent that,
5% coconut water had the highest fresh biomass subculture should be done before the callus growth
weight, 5.24 g (Table 1). While treatments of 30 declining.
g/L sucrose in all concentrations of coconut water It also showed that callus biomass increased with
in liquid media had the higher fresh biomass the increase of sucrose supplemented to the media
weight significantly than controls on solid media. (Table 1). These findings also support previous
In the liquid culture, nutrients were more easily report on a callus culture of Catharanthus roseus
absorbed by the explant cells [15, 17]. While in the [20]. Sucrose improved cells metabolism. The
solid culture there was a gradient of nutrients higher concentration of sucrose in certain limits
absorbed by the explant cells. However, explants increased metabolites accumulation in cells which
in the liquid culture were more susceptible to related to the cells biomass [21].
browning than on the solid culture because of the
Page | 224
PROCEEDINGS
Table 1. Effect of coconut water and sucrose on callus fresh biomass after 8 weeks of culture
Callus fresh biomass weight (g)

Concentration Concentration of coconut water Solid media
of sucrose 0% 5% 10% 20% (control)
)
10 g/L 1.96 bc* 2.07 bc 3.33 abc 3.52 abc
20 g/L 3.44 abc 5.24 a 3.75 abc 4.37 a 1.79 c
30 g/L 4.55 a 4.70 a 4.93 a 4.07 ab

*) Means followed by the same letters are not significantly different according to Duncan's multiple range
test at P = 0.05.
Sucrose is the most widely used sugar in plant sources in the cell metabolism as well as
tissue culture. Sucrose is easier to be absorbed by maintaining osmotic pressures in the culture [11,
plant cells compared to other sugars [22]. 21]. The 30 g/L sucrose supplemented media were
Moreover, sucrose could enhance callus the optimum treatment to increase cells biomass,
proliferation comparing to fructose, glucose, and while the higher concentrations inhibited the
maltose [16]. Sucrose contributed as carbon growth because of the high osmotic pressure [11].
Somatic embryo formation
Figure 2. Effect of coconut water and sucrose on the formation of somatic embryos after 8 weeks of
culture.
In liquid culture, pro-embryos were In this experiment, most of somatic embryos

formed after three weeks of culture and had formed were in globular stage. The treatment with
continued to develop into globular embryos after 5% coconut water and 30 g/L sucrose showed the
four or five weeks. However, on solid culture the highest rate of somatic embryo initiation compared
growth of embryogenic callus was slightly slower, to other treatments (Figure 2). This treatment could
where pro-embryos were formed after five weeks also initiate embryo development until globular,
and continued to develop into globular embryos elongated, scutelar, and coleoptelar stages (Figure
after six weeks. 3 & Figure 4).
Page | 225
PROCEEDINGS
However, other treatments such as 10% embryogenesis [7], while cytokinin was reported
coconut water with 20 g/L sucrose, and 20% to contribute in the cell division, as well as to keep
coconut water and 20 g/L sucrose also initiated the cells alive due to environmental stresses [8, 9].
more somatic embryos compared to the control, The use of coconut water in plant tissue culture
confirming that the ratio balance between coconut media could enhance cells proliferation without
water and sucrose was very important for the inducing mutation as occurred in the use of 2,4-D
development of somatic embryos. For example, in [7]. Moreover, ABA content in coconut water was
somatic embryo initiation of Kalopanax reported to increase somatic embryo formation in
septemlobus, 2-10% coconut water with 30 g/L rubber tree (Hevea brassiliensis)[25, 26]. The
and 50 g/L sucrose positively enhanced somatic application of exogenous ABA could induce
embryo formation [23]. Our result suggested that embryos development until globular stage [26],
5% coconut water with 30g/L sucrose was the which was quite similar to our results where the
optimum treatment to enhance the formation of majority of embryos formed were in the globular
sago palm somatic embryos. stage.
The use of sucrose in the medium is to maintain
the osmotic pressure which is a factor affected
somatic embryo induction [11]. The right amount
of sucrose is needed to create osmotic pressures
suitable to induce the initiation of somatic
embryos. In Schisandra chinensis plant, the
optimal treatment to induce somatic embryos
formation was with 20 g/L sucrose [27].
Meanwhile, Betula pendula Roth. needed 28 g/L
sucrose to induce somatic embryos in the highest
rate [28]. Our results showed that 30g/L was the
optimal sucrose concentration to induce the highest
rate of somatic embryos formation from a long-
term callus culture of sago palm.
Figure 3. Somatic embryos formed in the 4. Conclusion

treatment of 5% coconut water and 30 g/L
sucrose in liquid media. The use of coconut water and sucrose in a liquid
culture of long-term embryogenic callus of sago
palm could increase its proliferation and
regeneration. The best treatment for the
rejuvenation was 5% of coconut water and 30 g/L
of sucrose which had better growth, higher
biomass weight (4.7 g/flask), and higher number of
somatic embryos (19 globular embryos, 1
elongated embryo, 1 scutelar embryo, and 1
coleoptelar embryo).
References
Figure 4. The stage of somatic embryos : (a) [1] Ehara H. Potency of sago palm as
globular embryo, (b) elongated embryo, (c) carbohydrate resource for strengthening food
scutelar embryo, (d) coleoptelar embryo. security program. Indonesian Journal of
Agronomy. 2009;37(3):209-19.
Coconut water contains several phytohormones [2] Ehara H, Susanto S, Mizota C, Hirose S,
such as auxin (IAA and NAA), cytokinin (BA, Matsuno T. Sago palm (Metroxylon sagu,
kinetin, zeatin), gibberelin, and absicic acid (ABA) Arecaceae) production in the eastern
[24]. Moreover, coconut water also contains archipelago of Indonesia: Variation in
anorganic ions and vitamins, which could enhance morphological characteristics and pith dry-
the growth and metabolism of plant cells if used in matter yield. Economic Botany.
plant culture medium [7]. IAA in the coconut 2000;54(2):197-206.
water was already studied to have positive effects
on the plant tissue developments such as in
Page | 226
PROCEEDINGS
[3] Awg-Adeni DS, Bujang KB, Hassan MA, [13] Hvoslef-Eide AK, C. Munster, P.H.
Abd-Aziz S. Recovery of Glucose from Heyerdahl, R. Lyngved, and O.A.S. Olsen.
Residual Starch of Sago Hampas for Liquid culture system for plant propagation.
Bioethanol Production. Biomed Research Acta Hort. 2003;625:173-85.
International. 2013.
[14] Etienne H, E. Dechamp, D. Barry-Etienne,
[4] Tahardi JS, N. F. Sianipar & I. Riyadi. and B. Bertrand. Bioreactors in coffee
Somatic embryogenesis in sago palm micropropagation. Braz J Plant Physiol.
(Metroxylon sagu Rottb.). Tokyo-Japan: 2006;18(1):45-54.
Universal Academy Press; 2002.
[15] Jones MPA, Yi ZJ, Murch SJ, Saxena PK.
[5] Riyadi I, J. S. Tahardi & Sumaryono The Thidiazuron-induced regeneration of
development of somatic embryos of sago Echinacea purpurea L.: Micropropagation in
palm (Metroxylon sagu Rottb.) on solid solid and liquid culture systems. Plant Cell
media. Menara Perkebunan. 2005;73(2):35- Reports. 2007;26(1):13-9.
43.
[16] Blanc G, Lardet L, Martin A, Jacob JL,
[6] Nasib A, Ali K, Khan S. An Optimized and Carron MP. Differential carbohydrate
Improved Method for the in Vitro metabolism conducts morphogenesis in
Propagation of Kiwifruit (Actinidia embryogenic callus of Hevea brasiliensis
Deliciosa) Using Coconut Water. Pakistan (Mull. Arg.). Journal of Experimental
Journal of Botany. 2008;40(6):2355-60. Botany. 2002;53(373):1453-62.
[7] Yong JWH, Ge LY, Ng YF, Tan SN. The [17] Ziv M. Bioreactor technology for plant
Chemical Composition and Biological micropropagation. Hortic Rev. 2000;24:1-31.
Properties of Coconut (Cocos nucifera L.)
Water. Molecules. 2009;14(12):5144-64. [18] Sumaryono N. Mardiana, and J. S. Tahardi
Embryogenic suspension culture of oil palm.
[8] Haberer G, Kieber JJ. Cytokinins. New Menara Perkebunan. 1994;2(3):41-6.
insights into a classic phytohormone. Plant
Physiology. 2002;128(2):354-62. [19] Li YL, Meng TT, Wang YX, Zhang XL.
Study on enzymatic browning in suspension
[9] Sobieszczuk-Nowicka E, Wieczorek P, cultures of licorice cells. Biotechnology &
Legocka J. Kinetin affects the level of Biotechnological Equipment.
chloroplast polyamines and transglutaminase 2016;30(2):277-83.
activity during senescence of barley leaves.
Acta Biochimica Polonica. 2009;56(2):255-9. [20] Zhao J, Zhu WH, Hu Q, He XW. Enhanced
indole alkaloid production in suspension
[10] Geetha V, K.P. Bhavana, R. Chetana, A.G. compact callus clusters of Catharanthus
Gopala Krishna, and G Suresh Kumar. roseus: impacts of plant growth regulators
Studies on the composition and In vitro and sucrose. Plant Growth Regulation.
Antioxidant Activities from Coconut Testa 2001;33(1):33-41.
and Tender Coconut Water. J Food Process
Technol. 2016;7(5):588-93. [21] Wolosiuk RA, Pontis HG. Role of Sucrose
and Sucrose Synthetase in Carbohydrate
[11] Cui XH, Murthy HN, Wu CH, Paek KY. Plant Metabolism. Molecular and Cellular
Sucrose-induced osmotic stress affects Biochemistry. 1974;4(2):115-23.
biomass, metabolite, and antioxidant levels in
root suspension cultures of Hypericum [22] Navarroalvarez W, Baenziger PS, Eskridge
perforatum L. Plant Cell Tissue and Organ KM, Shelton DR, Gustafson VD, Hugo M.
Culture. 2010;103(1):7-14. Effect of Sugars in Wheat Anther Culture
Media. Plant Breeding. 1994;112(1):53-62.
[12] Javed F, Ikram S. Effect of Sucrose Induced
Osmotic Stress on Callus Growth and [23] Moon HK, S. Y. Park, Y. W. Kim, S. H.
Biochemical Aspects of Two Wheat Kim. Somatic embryogenesis and planlet
Genotypes. Pakistan Journal of Botany. production using rejuvenated tissues from
2008;40(4):1487-95. serial grafting of a mature Kalopanax
Page | 227
PROCEEDINGS
septemlobus tree. In Vitro Cellular & concentrations of PEG on Hevea brasiliensis

Developmental Biology- Plant. somatic embryos development. Plant Science.
2004;44(2):119-27. 1997;124(2):183-91.
[24] Ma Z, Ge L, Lee ASY, Yong JWH, Tan SN, [27] Chen AH, Yang JL, Da Niu Y, Yang CP, Liu
Ong ES. Simultaneous analysis of different GF, Yu CY, et al. High-frequency somatic
classes of phytohormones in coconut (Cocos embryogenesis from germinated zygotic
nucifera L.) water using high-performance embryos of Schisandra chinensis and
liquid chromatography and liquid evaluation of the effects of medium strength,
chromatography-tandem mass spectrometry sucrose, GA(3), and BA on somatic embryo
after solid-phase extraction. Analytica development. Plant Cell Tissue and Organ
Chimica Acta. 2008;610(2):274-81. Culture. 2010;102(3):357-64.
[25] Etienne H, Sotta B, Montoro P, Miginiac E, [28] Nuutila AM, Kurten U, Kauppinen V.
Carron MP. Relations between Exogenous Optimization of Sucrose and Inorganic
Growth-Regulators and Endogenous Indole- Nitrogen Concentrations for Somatic
3-Acetic-Acid and Abscisic-Acid in the Embryogenesis of Birch (Betula-Pendula
Expression of Somatic Embryogenesis in Roth) Callus-Cultures - a Statistical
Hevea-Brasiliensis (Mull Arg). Plant Science. Approach. Plant Cell Tissue and Organ
1993;88(1):91-6. Culture. 1991;24(2):73-7.
[26] Linossier L, Veisseire P, Cailloux F, Coudret

A. Effects of abscisic acid and high
Page | 228
PROCEEDINGS
THE MICROPROPAGATION STRATEGY OF PHALAENOPSIS SP

ORCHID BY SOMATIC EMBRYOGENESIS
DidikPudjiRestanto1,2), SigitSupardjono1) and Budi Kriswanto1)
1) Plant Tissue Culture Laboratory Agronomy Department Agriculture Faculty Jember University
Indonesia , 2) Centre for Development Advance Sciences and Technology (CDAST) Jember
University Indonesia
Email :restanto.lemlit@unej.ac.id
Abstract
Indonesia is a tropical country that has the largest rainforest in the world. It is very rich on
biodiversity, especially orchids. Indonesia is a country that has the secondlargest orchid after Brazil with
26,000 species of orchids in the world's,around 5000-6000 species exist in Indonesia. The rain forest like
Sumatra, Borneo, Sulawesi and Irian Jaya have been changed become to oil palm plantations so Indonesia
lost orchid potential to be developed. The propagation is traditionally a little of technology so that the
Indonesiaorchidsunable to compete with other countries. The purpose of this study is the propagation of
orchids with TDZ hormone in the formation of the SE by using explants from the vegetative (leaf) and
generative (seeds). The results showed that from the self pollinatedwas encountered crown flower will
wither after 4 dayspollination. On the other hand, that orchid fruit (pod) was ready for culturing around
3-4 months. The propagation through the vegetative (leaf) have a problem in the high phenolic
compounds and can be overcome with the addition of activated charcoal as much as 3%. Effect of TDZ
concentration of 1 ppm will increase the wet weight of PLB around 3.47 g andnumber of PLB around
40.33 from explants generative (seeds). While explants of vegetative (leaves) the use of TDZ 2 ppm will
increase the formation of directly somatic embryogenesis around 9 and number of shoot around 29.
Increased concentrations of TDZ 3 ppm and 4 ppm shown to inhibit the formation SE and shoots
Keywords :Phalaenopsis sp, Thidiazuron (TDZ), Somatic Embryogenesis (SE), Protocorm Like Bodies
(PLB)
1. Introduction started directly from explant tissue creating an

identical clone like orchid [2]. Indirect
Indonesia is a tropical country rich in embryogenesis occurs when explants produced
biodiversity in the world such as orchids. Sumatra, undifferentiated, or partially differentiated, cells
Kalimantan, Sulawesi and Irian Jaya is the source (often referred to as callus) which then is
of orchid in Indonesia. Development of orchids in maintained or differentiated into plant tissues such
Indonesia is very slow due to limited of micro as leaf, stem, or roots.
propagation technology. Orchid development Phalaenopsis spis ornamental orchid, a very
through the establishment of somatic important and difficult to develop vegetatively.
embryogenesis is very important to get uniform Propagation is generally performed in vitro by
orchids and good quality by using the vegetative seed, but this method is not produced by plants that
explants like leaf and node. uniform and there is a segregation of the flower
Somatic embryogenesis (SE) is a process where color. The method most likely to use PLB [3].
a plant or embryo is derived from a single somatic Recently, it has been developed through somatic
cell or group of somatic cells. Somatic embryos induced from floral organs[4] and [3].
embryos are formed from plant cells that are not
normally involved in the development of embryos, 2. Methods
such as ordinary plant tissue. SE has been
described in the two ways : directly or Phalaenopsis orchid come from Agro-
indirectly[1]. Direct SE occurs when embryos are tecnoparkJember University as a material for self
pollination. The orchids are in afully blooming it
Page | 229
PROCEEDINGS
prepared to do a self-pollinating : taking anther

carefully using a toothpick and then put into the
hole collum. The pot will mature after 3 month
pollinating.
Vacin and Went medium has been recommended
for orchids that contain 20 g / l sugar, 30 ml / l
coconut water, 0.525 g / l KNO3, 0.25 g / l
KH2PO4, 0.5 g / l (NH4) 2S04, 0.007 g / l
Figure 2.The growing orchids from seed for 8
MnSO4.4H2O, 0.025 g / l MgS04.7H20, 0.028 g /
months in culture.
l FeS04.7H20 and 0.037 g / l na2-EDTA. Growth
regulators used TDZ 1 mg/l and 2 mg/l for
In the Figure 2have looked the complete orchid
generative explants and vegetative (leaf) explants,
with the root system and PLB to be used as a
respectively. Take one PLB and it was grown in
explants (vegetative and generative). PLB
VW medium with supplement 1 mg/l TDZ for
derived from seeds was grown in medium
generative explants. On the other hand, take peace
containing 1 mg / l TDZ will establish the number
of leaf around 1 cm 2 and incubated in WV
of PLB around 40.33 with a weight of about 3.7 g
medium with hormone 2 mg/l TDZ for vegetative
(Figure 3).
explants.
3. Result and Discussion
The red Phalaenopsis sp orchid have been self

pollination to produce of seed (Figure 1)
Figure 3. The Effect of TDZ 1 mg/l at PLB

Growth with Generative Explant.
This is because the role of TDZ is a kind of

cytokines that play a role in the formation of buds.
[3]. reported that the high TDZ concentration can
inhibit cell division, but in general TDZ which is
believed to be more active phenylurea derivatives
stimulate shoot formation of the somatic
1 week 2 weeks 3 weeks 4 weeks embryogenesis [4] [5].According [3] have been
reported that with the addition of 20 g of PLB
inoculum identical (1000 PLB section) in 2 liters
Figure 1.Self Pollination of Phalaenopsis of liquid media can produce about 18,000 PLB
Orchid with the process to get the seed (1-4 identical with 18,000 orchid plants
weeks). The leaves are used as a part of vegetative
explants for the induction of somatic
In Figure 1, it can be seen after one week embryogenesis. Phenol compounds appear after 4
pollinating the orchid flower will wither crown days incubasi (Figure 4).
that indicates successful pollination. The pot
willbe formed 4 weeks after pollination and mature
around 12 weeks. The mature pot was sterilization
very simple. It‘s pot washed with detergen and
rinsed with running water and then rinsed with
sterile water. Sterilization was done in a laminar
air flow by entering the pot into ethanol pa and
was burned then cut the edges with carefully than
the seeds was transferred in VW medium Figure 4. The Phenol Compounds in Leaf
containing 0.1 TDZ and 30% coconut water. The Explant at 4 Days in Culture .
seed will growth become the complete orchid
around 8 month in culture (Figure 2).
Page | 230
PROCEEDINGS
In Figure 4 indicated that appear phenol

compound around explant. It was synthesized
from explant can inhibit plant growth. Cotton
plants contain many phenol compounds, with the
addition of 3 percent maltose can control phenol
compounds released by eksplant. The high phenol
content in the explant will cause browning and
necrotic[6]. Secretion of phenolic compounds in 5-6 month 7-8 month
the medium adversely affects the callus culture and
regeneration capability in cotton. Hence to
overcome this problem, the present study was Figure 6. The Effect of TDZ 2 mg/l at Shoot
carried out to evaluate the effect of carbon sources Multiplication from SE.
on phenolic secretion in callus culture of SVPR-2
cotton cultivar. According to[7], the production of
phenolic compounds of explants was significantly The multiplication was formed around 5-6 month
controlled by incorporating higher levels of and the complete orchid around 7-8 month.
ascorbic acid into the medium. The best control However, the multiplication of orchid can reach
was achieved by supplying 200 - 250 mg/litre of 10-12 individual plant per m2 leaf explant. This
ascorbic acid in the woody plant medium result can be used for micro propagation for large
supplemented with BAP.Murashige and Skoog scale to produce the uniform seedling of orchid.
medium (MS medium) with 3% (w/v) sucrose,
0.8% (w/v) agar, 2 mg/l 6-benzylaminopurine and 4. Conclusion
2 mg/l thidiazuron supplemented with ascorbic
acid (1 mg/l) or activated charcoal (10 g/l), greatly The micro propagation using part of
reduced lethal browning in explants and improved vegetative explants very important especially for
shoot regeneration of faba bean[8]. orchid plant.TDZ concentration of 2 mg / l showed
The young leaves are used as eksplant the best results for the SE formation with
orchids. Somatic embryogenesis formed after vegetative explants around 9 of somatic
incubation for 2 months (Figure 5) embryogenesis and number of shoot around 29. In
the other hand Effect of TDZ concentration of 1
ppm will increase the wet weight of PLB around
3.47 g and number of PLB around 40.33 from
explants generative (seeds).
Acknowledgment
Thank for Plant tissue Culture Laboratory

Agriculture Faculty and Centre for Development
globular scutelar Advance Sciences and Technology (CDAST)
Jember University.
Figure 5. The Effect of TDZ 2 mg/l at Somatic Refferences

Embryogenesis induction with Vegetative
Explant. [1] Sharp et al. (1980). In: Horticultural
Reviews,Vol. 2. (janick, J., ed.). AVI
Figure 5 is formed on the phase se Publishing Co, Westport, Conn., USA, p. 268.
glubolar and scutelar. Phalaenopsis orchids have a
tendency to form direct SE. According [9], with [2] Chang, C., W. Chang. 2000. Effect thidiazuron
the addition of 3 mg / l TDZ highest single yield of on bud development of Cymbidium sinensis
SE, in contrast with the addition of NAA together WilldWilld in vitro. Plant Growth Reg.
with TDZ would reduce the number of SE. 30:171-175.
Page | 231
PROCEEDINGS
[3] Young. P. S, HN Murthy and PK. Yoeup, [7] Ndakidemi CF, E. Mneney and P.
2000. Mass Multiplication of Protocorn Like AloisNdakidemi, 2014. Effects of Ascorbic
Bodies using Bioreaktor System and Acid in Controlling Lethal Browning in in
Subsequent Plant Regeneration in Vitro Culture of Brahylaenahuillensis Using
Phalaenopsis.. Nodal Segments American Journal of Plant
Sciences, 2014, 5, 187-191
[4] Park, S.Y., E.C. Yeung, D. Chakrabarty, K.Y.
Paek. 2002a. An efficient direct induction of [8] AbdelwahdR , N. Hakam , M. Labhilili and
protocorm like bodies from leaf subepidermal S. Udupa, 2008.Use of an adsorbent and
cells of Doritaenopsis hybrid using thin- antioxidants to reduce the effects of leached
section culture. Plant Cell Report 21: 46-51. phenolics in in vitro plantlet regeneration of
faba bean. African Journal of Biotechnology
[5] Jiang, B., Y. Yang, M. Guo, Z. Guo, Y. Chen. Vol. 7 (8), pp. 997-1002,
2005. Thidiazuron-induced in vitro shoot
organogenesis of the medicinal plant [9] Chen, J. T., dan Chang, W. C. 2006. Direct
Arnebiaeichroma (Royle) Johnst. In vitro Cell Somatic Embryogenesis and Plant
Dev. Biol-Plant 41:677-681. Regeneration from Leaf Explant of
Phalaenopsis amabilis.BiologiaPlantarum,
[6] Kumar, GP, S. Subiramani S. Govindarajan, 50(2): 169-173.
V. Sadasivam, V. Manickam, K.
Mogilicherla, S. ThiruppathiandJ. [10] Tokuhara, K and M. Mii, 2003. Highly-
Narayanasamy, 1915. Evaluation of different efficient Somatic EmbryogenesisiFrom Cell
carbon sources for high frequency callus Suspension Cultures of Phalaenopsis
culture with reduced phenolic secretion in Orchids By Adjusting Charbohydrate
cotton (Gossypiumhirsutum L.) cv. SVPR- Sources. In vitro cell Dev Biol plant
2Biotechnology ReportsVolume 7, Pages 72– 39:635-639.
80
Page | 232
PROCEEDINGS
DIFFERENTIAL GENE EXPRESSION IN OIL PALM VARIETIES

SUSCEPTIBLE AND TOLERANT TO GANODERMA
Riza Arief Putranto1, Indra Syaputra2, Asmini Budiani1

1
Indonesian Research Institute for Biotechnology and Bioindustry, Jl. Taman Kencana No. 1, Bogor
16128, Indonesia
2
PT Socfin Indonesia, Jl. K.L Yos Sudarso No. 106, Medan 20235, Indonesia
E-mail: rizaputranto@iribb.org, asminib@yahoo.com
Abstract
Basal stem root (BSR) due to Ganoderma infection is the most important disease in oil palm plantations.
Even though, various attempts have been made to overcome the disease, significant results are yet to be
seen. Economic losses continue to increase annually during the production phase of oil palm. In
molecular aspect, differential expressed genes leading to tolerance of Ganoderma have been extensively
studied. Most of the works were carried out using artificial infection although Ganoderma -tolerant lines
have been reported previously. Thus, it can possibly lead to misinterpretation of oil palm tolerance
towards Ganoderma . Therefore, the objective of this study was to determine a better overview of
differentially expressed genes in Ganoderma susceptible and tolerant plants. Transcript sequences of
tested genes have been collected from open access database and manually annotated. Twenty one pairs of
specific primers encoding twelve genes related to response to Ganoderma have been designed. In silico
analysis has predicted the isoform of each gene. The PCR amplification resulted in fragments ranged
from 181 to 220bp. The expression of these selected genes was compared between DxP MT Gano
(moderate tolerant) and DxPYangambi (susceptible) oil palm varieties, respectively, by RT-qPCR.
Sixteen out of 21 genes were differentially regulated between DxP MT Gano and DxPYangambi. Six
upregulated genes (EgCHI1, EgVIR-1, EgVIR-2, EgIFR-2, EgMT-1, and EgSPI-2) in root can be
considered as potential positive biomarkers for moderate tolerant oil palm varieties. Our results suggest
distinct molecular regulation between moderate tolerant and susceptible oil palm varieties to Ganoderma .
Keywords: oil palm, Ganoderma, differential gene expression, Quantitative RT-PCR, tissue
1. Introduction degrading tissues in basal stems[5, 6].Various

attempts have been made to overcome this disease,
Basal stem root (BSR) caused by the white but until now a real impact decliningGanoderma
rot fungi Ganodermasp. is the most important attack is yet to be seen.Thus, early detection or
disease in oil palm plantations. This disease causes preventive measures are an important step to be
significant lost up to 80% of oil palm production, taken to minimize the occurrence of Ganoderma
including in South-East Asia region, over repeated infection. Molecular response of oil palm in
planting cycles [1]. Althoughearly Ganoderma relation to Ganoderma is essential for the
outbreak spread at 1% of the plantation area, development of diagnostic tools for disease control
potential loss could reach USD 256 million per [7].
year [2].Currently, economic losses continue to Gene expression analysis has been
increase annually during the production phase of widelyused to explore biological processes related
oil palm due to the extent of Ganoderma infections to plantdevelopmental and environmental cues.
not only in mature but also in juvenile oil palm Theaccumulation of messenger RNA (mRNA)
trees. The colonization of Ganoderma sp.in oil ismeasured using a rapid, sensitive and
palm roots is the key to devastating characteristic reliablemethod. Currently, a fluorescence based-
of white rot disease [3, 4]. White rot fungi PCR suchas Reverse Transcriptase quantitative
produces hydrolytic and oxidative enzymes PCR (RT-qPCR) is one of powerful techniques to
Page | 233
PROCEEDINGS
detectlow abundance of mRNA in the cell[8, The method used for RNA extraction from
9].Differential expression studies of gene leaf and root tissues is a modification of a protocol
transcripts leading to tolerance of Ganoderma described earlier for pine trees [19]. One gram of
have been extensively studiedin oil palm [10-15]. tissue, mixed with 1.5% polyvinylpyrrolidone was
Several potential biomarkers toward tolerance to ground by hand using a pestle and mortar in the
Ganoderma including those encoding chitinase presence of liquid nitrogen. The powder was
class II, DEFICIENS 1, early methionine-labeled transferred to a 50 ml tube, resuspended in 15 ml
polypeptide 1, isoflavonereductase, of preheated (65ºC) extraction buffer (100
metallothionein-like protein, and pathogenesis- mMTris-HCl pH 8.2, 1.4 M NaCl, 20 mM EDTA,
related protein have been identified [10- 2% (w/v) CTAB, and 75 µl of β-mercaptoethanol)
16].Nevertheless, most of the works were carried and homogenized in a warring blender at
out using artificialGanoderma infection, although maximum speed for two minutes. Next, the
Ganoderma -tolerant lines have been reported homogenate was incubated at 65°C for 1h, while
previously[17,18]. Even though the results are mixing by gentle vortexing every 15 min. The
accurate, it can still possibly lead to tubes were kept at room temperature for 5 min and
misinterpretation of oil palm tolerance towards then an equal volume of chloroform: isoamyl
Ganoderma . alcohol (24:1) was added. The mixture was shaken
Therefore, the objective of this study was to vigorously until an emulsion was formed, and then
determine a better overview of differentially centrifuged at 12,000 g for 15 min at room
expressed genes in Ganoderma susceptible and temperature. The upper aqueous phase containing
tolerant oil palm varieties. Gene expression nucleic acids and polysaccharides was carefully
profiles of target genes potentially related to transferred to a new tube, and extracted
Ganoderma tolerance in root and leaf of subsequently with phenol, phenol: chloroform:
susceptible and moderate tolerant oil palm isoamyl alcohol (25:24:1), and chloroform:
varieties were analyzed using Reverse isoamyl alcohol (24:1), each time followed by
Transcriptase Quantitative PCR (RT-qPCR). centrifugation at 12,000 g for 15 min. The aqueous
Twenty one pairs of specific primers encoding phases were transferred to new tubes and 8 M LiCl
twelve genes related to response to Ganoderma was added to a final concentration of 2 M. The
have been designed. In silico analysis was coupled RNA was allowed to precipitate overnight at 4°C
with primer design to ensure the specificity of each and then recovered by centrifugation at 17,000 g at
pair of oligos. Several potential biomarkers for 4°C for 30 min. The pellet was dissolved in milliQ
moderate tolerant oil palm varieties to Ganoderma grade water and was extracted with phenol,
were obtained. Taken together, the results provide phenol: chloroform: isoamyl alcohol (25:24:1),
a better understanding about molecular regulation and chloroform: isoamylalcohol (24:1),
of Ganoderma -response genes in moderate respectively each time followed by centrifugation
tolerant and susceptible oil palm varieties. 12,000 g for 15 min at 4ºC. The supernatant was
transferred to a new tube and RNA was
2. Methods precipitated with 0.1 volumes of 3 M sodium
acetate pH 5.8 and 3 volumes of 100% ethanol at –
Plant material 70°C for 4 hrs to overnight. The RNA was
recovered by centrifugation at 17,000 g in a
Leaf and root tissues were collected from 4- microfuge at 4°C for 30 min. The pellet was
year-old mature oil palm trees of washed with an equal volume of 70% cold ethanol,
DxPSocfindoYangambi (susceptible) and the ethanol was allowed to evaporate at room
DxPSocfindo MT Gano (moderate tolerant) temperature for 15 min, and the purified RNA
varieties to Ganoderma at the Socfindo Seed pellet was then resuspended in an appropriate
Production and Laboratories (SSPL), volume of nuclease-free water. The purity and
KebunBangun Bandar, DesaMartebing, concentration of the RNA was determined
KecamatanDolokMasihul, spectrophotometrically at 230, 260, and 280 nm.
KabupatenSerdangBedagai, North Sumatera, The integrity of total RNA was checked by
Indonesia (Latitude 3.32796; Longitude 99.04026). electrophoresis.
Both varieties were cultivated following standard
operation procedure (SOP) of PT Socfindo. Primer design and validation
Total RNA isolation Twelve sequences (Acc. nb.AF322914,
JN203288, GU301271, HQ831445, AY739700,
EL695076, EL690340, EL684283, EL690964,
Page | 234
PROCEEDINGS
EL690627, KJ789862, and KJ427025) from Expression data were transformed into heat
European Nucleotide map presentation using Microsoft Excel 2010
Archive(http://www.ebi.ac.uk/ena) were selected (Microsoft, USA). No statistical analysis was
as template to primer design. Based on done. To ensure the validity of the data, a stringent
bibliographical analysis, these sequences encode threshold of ratio value was applied. Upregulated
genes related to potential Ganoderma tolerance. genes were shown in bright red for a threshold
Primers were designed at the 3‘ side of each value ≥5; dark red for value <5, and down-
sequence using the Primer 3 module of Geneious regulated genes were shown in bright green for a
(Biomatters Ltd., New Zealand)[20, 21].In silico threshold value ≤0.2; dark green for value >0.2.
validation of each pair of oligos was carried out The non-significant genes are shown in dark
byMEGA-BLASTn short against color[20, 21].
Elaeisguineensisgenome data published by Singh
et al. [22]using GALAXY platform 3. Results and Discussion
(http://galaxy.southgreen.fr/galaxy/). Real-time
PCR amplification and the fusion curve were In silicoprimer design and analysis
carried out using a mix of cDNAs in order to check
the specificity of each pair of primers. Based on twelve template sequences from
European Nucleotide Archive, 21 oligopairs of
cDNA synthesis and Reverse target genes and 1 pair of housekeeping gene were
Transcriptase Quantitative PCR (RT- designed (Table 1). Primers were designed at the
3‘ side of each sequence in order to reduce the risk
qPCR) setup
of error due to short cDNA synthesis often
A DNase treatment to eliminate gDNA occurred in PCR reaction [20, 21]. The length of
contamination was done for each RNA sample each primer was ranged from 19 to 22 bp with
according to the manufacturer's instructions of expected PCR product length from 181 to 220
DNase I kit (Sigma-Aldrich, USA). cDNAs were bp.All pairs of primers matched 100% with
synthesized from 1μg of total RNA to the final 20 potential targeted genes in Singh‘s
μL reaction mixture using a BioneerAccuPower Elaeisguineensisgenome database. A MEGA
Cycle Script RT PreMix according to the BLAST-N short has predicted that these 21 pairs
manufacturer's instructions (Bioneer, Korea). Full- of primers encode potentially 12 known-genes in
length cDNA synthesis was checked on each oil palm. Several of these genes were known to
cDNA sample by PCR amplification of the encode proteins induced by Ganoderma treatment
EgActincDNA using primers at the cDNA ends. in oil palm such as L-ascorbate peroxidase,
Reverse Transcriptase quantitative PCR was Chitinase 10, MADS-box transcription factor 16
finally carried out using a real-time PCR StepOne (DEF1), Em protein H2-like, Isoflavonereductase-
Plus (Applied BioSystem, UK). The RT- like protein, Metallothionein-like protein type 2,
qPCRreaction mixtures consisted of 1 µL RT and Pathogenesis-related protein PR-1 [14, 15].
product cDNA, 0.625 µL of 5 µM of each primer, Transcript variants, also known as
4 µL NFW and 3 µL 2×SYBR green select master transcript isoforms, are differentially expressed
mix (Bio SM, USA) in a 20-µL volume. PCR transcripts across different tissue/cell types,
cycling conditions comprised one denaturation developmental stages and disease conditions [23].
cycle at 95°C for 5 min, followed by 45 Different transcript isoforms can lead to different
amplification cycles (95°C for 20s, 60°C for 15s, protein isoforms with distinctive functions.
and 72°C for 20s).Real-Time PCR was done at 96- Therefore, an in silicoanalysis of gene potential
well plate.The transcript abundance level for each isoform is necessary before confirming a primer
gene was relatively quantified by normalization design. In this experiment, one potential isoform
with the transcript abundance of endogenous gene for each pair of primers was predicted, except for
encoding oil palm actin EgActinas described by EgDEF1-1 and EgDEF1-2having 4 and 3 potential
Tan et al.[15]. All the normalized ratios isoforms, respectively. This result has shown that
corresponding to transcript accumulation were most of the designed primers were specific or at
calculated automatically by StepOne Software v2.3 least encoding one gene (Table 1).
provided by the manufacturer using the following Validation for integrity of cDNAs
calculation: Normalized Ratio = 2-Δ(Cp target-CpEgActin).
The quality and quantity of RNA
Data analysis determines largely the quality and quantity of
synthesized cDNA[24, 25]. In this work, total
RNA was isolated from each 2 samples of each
Page | 235
PROCEEDINGS
tissue (root and leaf) and each plant material

(DxPYangambi and DxP MTGano), respectively,
counting in total 8 samples. The RNA Basal expression of tested genes in root
quantification using Nanoquant showed that its
and leaf of DxPYangambi (susceptible)
concentration and purity met the requirement for
cDNA synthesis (data not shown). A experiment to and DxP MT Gano (moderate tolerant)
validate cDNAs used in this work was carried out oil palm varieties
by observing melting curve of EgActin for each
used tissue sample for each oil palm variety The transcript accumulation of 21
(DxPYangambi and DxP MT Gano) (Figure 1). Elaeisguineensis genes potentially involved in
The melting temperature for EgActin was ranged tolerance to Ganoderma was measured in
from 83.78 to 83.92. A single amplification of melt DxPYangambi (susceptible) and DxP MT Gano
curve showed the specificity ofEgActin primers (moderate tolerant) oil palm varieties (Figure 2). In
and correspondingly the quality of cDNA used. this work, fourteen genes were differentially
These results confirmed that the cDNAs expressed at basal level across two tissues and two
synthesized in this experiment has reached the oil palm varieties. Nine genes (EgAD1-2,
requirement for differential gene analysis using EgCAPX-1, EgCAPX-2, EgDEF1-1, EgDEF1-2,
RT-qPCR. EgEMLP1-1, EgIFR-2, EgVIR-2, and EgWRI1)
had higher transcript accumulation in leaf as
opposed to five genes (EgCHI1, EgEMLP1-2,
EgMT-1, EgSPI-1, and EgVIR-1) with higher
transcript accumulation in
Page | 236
Table 1. Primer list for tested genes of differential gene expression in this work. Primers were designed using Primer3 tool of Geneious software. All primer
sequences were blasted against Singh's genomic database [22]to ensure specificity
Potential Product
Name Forward (5’-3’) Reverse (5’-3’) MEGA BLAST-N short Identity%
isoform (bp)
EgAD1-1 ACCTGCGAGTCTCAAAGCCACA GCATGAAAGCTACGGGCAACCA Defensin EGAD1 Mrna 100 1 200
EgAD1-2 AAGGACCTGCGAGTCTCAAA CCACATAACCCTCACCATCC Defensin EGAD1 Mrna 100 1 185
EgCAPX-1 AGGCCGTCGACAAGTGCAAGAA AATAGCCTCACGGCGATGTCCA L-ascorbate peroxidase, cytosolic (LOC105044666) 100 1 202
EgCAPX-2 GCCATCTGACAAGGCTCTTC CGCCATCGTCTGCTTCTAAC L-ascorbate peroxidase, cytosolic (LOC105044666) 100 1 208
EgCHI1 TGTGGTCAGGGCTACATTGA CCATTTATTTGTGGCGTCCT Chitinase-like protein 1 (LOC105049526) 100 1 220
EgCHI2 AACGGCACCGGATGGTCCTTAT ACCATCAAATCCCAAGGCCCGT Chitinase 10 (LOC105035527) 100 1 193
EgDEF1-1 TGTTCTCCAGCACCGGCAAGTT ATCTTCACCCATCCGCTGCCTT MADS-box transcription factor 16 (DEF1) 100 4 197
EgDEF1-2 GGCTTCCCACATGTATGCTT GCGGATAGAGAGGCTTACCA MADS-box transcription factor 16 (DEF1) 100 3 183
EgEMLP1-1 AGAGCGTTTGGCTGAAGGT AGAACTGCGCGCTCTAAGAC Em protein H2-like (LOC105057111), transcript variant X2 100 1 188
EgEMLP1-2 TCAGCACCATGGACGAGTT AAACAAACCCGTCACCAAAC Em protein H2-like (LOC105057111), transcript variant X2 100 1 182
EgIFR-1 GATCATCGCCGCAATAAAAG ATGGGAGGAAGTAACCAGCA Isoflavonereductase-like protein (LOC105037680) 100 1 203
EgIFR-2 ACCGGGTACATCGGAAAGTT GGAGATCACCGTGTCCACTT Isoflavonereductase-like protein (LOC105037680) 100 1 210
EgMT-1 AGGCAAATGTGGCTGTGGCGTT ACTTGCAGTTGCAGCCTCCGTT Metallothionein-like protein type 2 (LOC105044410) 100 1 191
EgMT-2 GGGCACTATGAAGGGTTTGA TTGGATGCTTGGAAGGAGAC Metallothionein-like protein type 2 (LOC105044410) 100 1 182
EgPR1-1 ACCCAGATCGTCTGGAAGAG GGCACACCACCAATATGACA Pathogenesis-related protein PR-1 (LOC105039610) 100 1 207
EgPR1-2 CATTATTCTGGGACCCAAGG GAGTTGGCCGTGTAGGAGTAGT Pathogenesis-related protein PR-1 (LOC105039610) 100 1 208
EgSPI-1 ATGGCCTTGCTGCAATAGGTGC AAATAGCTTCTCGGCGGCGACT Bowman-Birk type trypsin inhibitor-like (LOC105045610) 100 1 204
EgSPI-2 AAAGAATGCGTTCGATCACC ACCCTCCTCCAAGAAAGCAT Bowman-Birk type trypsin inhibitor-like (LOC105045610) 100 1 212
EgVIR-1 ATTTGGAATCGGAGGCTTG CAAGGTCTCGTTTCCTGTCC Virescens R2R3-MYB gene 100 1 216
EgVIR-2 TGCCGACTACGGTGGTTGAACT TTGCCCAGGTGAGTGTTCCAGT Virescens R2R3-MYB gene 100 1 185
EgWRI1.1 ATGCACCCCTTTCTTCTCCT TTGCCTGCCTTTCTTGTTCT Ethylene-responsive WRI1-like (LOC105046121) 100 1 212
EgActin CCCACCTGAACGGAAATACA CGGATGGCACCTCAGTCTTA Actin-101-like (LOC105032827) 100 1 181
Page | 237
PROCEEDINGS
A B C
D E
Vigure 1.cDNA profile of leaf and voot RNA samples vrom DxPY!ngamfi aNd DxP MT Gano
oil$palm varéeties. The integrity of the cDNAs was ilLwstratee0using EgActin amplificavion"in a
real-tmme TCR StepOne Plus. Thg data shown wa3 the melting curve for each samp,e, The mElt
curve vaLue was mean gf tvo biological replicates. (A) Negative cO.tRol H 2O, (B) Root &rom
DxPY!ngamBi, (C) Root from DxP MT Gano, (D) Leaf &rom DxPYangambi,238(e) Leaf from!DxP
MT Gano.
rokt. Alongside with these ge.es, three genes gene with highest expression value reaching
(EcCAPX-1, gDGF1-2, and EgEMLP1-2) had 1.13E+02 in root tissue of DxPYangambi variety.
r%latively sdrong basal expre3sion in specifac The same trend has been achieved by Tan et al.
casEs. The ge~e EgCAPX-1 showed a hkgh [15] using DxP GH500 oil palm variety. This
transcriPt accumulation il rnot and le!f in either oil result revealed that EgEMLP1-2 could have an
p!lm varietIeS with values ranged from 1.90E-01 important role in basal regulation of secondary
to 4&05E+00, respectively. The high basal metabolism in root of oil palm.
expression of EgCAPX-1 was potentially related to
the effort of cell homeostasis during oxidative Regulation of tested genes potentially
stress [14]. Based on the reference, the gene involved in tolerance to Ganoderma
EgDEF1 was highly expressed in flower tissue
[26, 27]. In this work, the gene EgDEF1-2 had The ratios between the relative abundance of
relatively high transcript accumulation (4.22E-01) transcripts in the same tissue between susceptible
in leaf tissue of both oil palm varieties. and moderate-tolerant oil palm varieties showed
Meanwhile, the gene EgEMLP1-2 was the only that 16 out of 21 genes were differentially
Page | 238
PROCEEDINGS
regulated between DxP MT Gano (moderate represented by colors ranging from ≥1 to

tolerant) and DxPYangambi (susceptible) oil palm ≤10−4.
varieties (Figure 3). In root, six genes (EgCHI1,
EgVIR-1, EgVIR-2, EgIFR-2, EgMT-1, andEgSPI- In order to accumulate known information
2) were upregulated as opposed to eight about differential gene expression in oil palm,
downregulated genes (EgCAPX-1, EgCHI2, especially in relation to Ganoderma , current work
EgDEF1-1, EgIFR-1, EgSPI-1, EgAD1-1, results has been combined with previous studies
EgEMLP1-2, andEgAD1-2) in DxP MT Gano. The (Table 2). Even though the table might not be
fold change of two upregulated genes (EgCHI1and exhaustive regarding that the expression data was
EgVIR-1) in root reached more than five times in generated from Ganoderma -treated plants and the
DxP MT Gano in comparison to DxPYangambi. In inoculation of Ganoderma in the moderate tolerant
leaf, twelve genes (EgIFR-2, EgMT-1, EgSPI-2, varieties was not carried out in this work, the
EgEMLP1-1, EgWRI1, EgCAPX-1, EgCHI2, summarized information itself can be useful as an
EgDEF1-1, EgIFR-1, EgSPI-1, EgAD1-1, added value. The twelve target genes encode
andEgEMLP1-2) were upregulated as opposed to known function in oil palm. Firstly, in the current
four downregulated genes (EgCHI1, EgVIR-1, work, the target genes EgCAPX, EgCHI2, and
EgVIR-2, andEgAD1-2) in DxP MT Gano. The EgEMLP have shown contrasting results with
expression marker genes differed between root and known previous studies. These genes were
leaf except for three genes (EgIFR-2, EgMT-1, and downregulated in comparison to upregulation in
EgSPI-2). This suggests that tissue-specific root tissue of previous studies (Table 2). For
regulation of genes occurred between DxP MT Chitinase genes, Naheret al. has demonstrated that
Gano and DxPYangambi. the gene expression varied depending on tissue and
type of treatment[11]. This statement has been
Root Leaf correspondingly confirmed by the inversed result
YA MTG YA MTG for EgCHIgenes. A potential diverse regulation of
EgAD1-1 ascorbate peroxidase (APX) and Early methionine-
EgAD1-2 labeled polypeptide 1 (EMLP) between previous
EgCAPX-1 studies can be taken into account due to the use of
EgCAPX-2 different oil palm varieties in the experiment [14,
EgCHI1 15]. Secondly, three target genes (EgIFR, EgMT,
EgCHI2 and EgSP1) had analogous results to previous
EgDEF1-1 studies. This suggests that the regulation of
EgDEF1-2 isoflavonereductase, metallothionein-like protein,
EgEMLP1-1 and serine protease inhibitor were consistent across
EgEMLP1-2 various oil palm varieties. Thirdly, EgPR1 gene
EgIFR-1 showed no expression difference between DxP MT
EgIFR-2 Gano and DxPYangambi. Meanwhile, several
EgMT-1 authors showed an upregulation of EgPR1 in root
EgMT-2 of Ganoderma -treated oil palm [13-15]. This
EgPR1-1 result suggests that EgPR1 might be controlled in
EgPR1-2 relatively similar way in DxP MT Gano and
EgSPI-1 n≥ 1 DxPYangambi.
EgSPI-2 E-01
EgVIR-1 E-02
EgVIR-2 E-03
EgWRI1 n≤ E-04
Figure 2. Basal expression of 21 tested genes of

Elaeisguineensis potentially involved
intolerance to Ganoderma . The relative
transcript abundance was measured by a real-
time PCR StepOne Plus in root and leaf of
DxPYangambi (susceptible) and DxP MT Gano
(moderate tolerant) oil palm varieties. Values
were mean of 2 replicates for each tissue. No
statistical analysis was carried out. Values are
Page | 239
PROCEEDINGS
Root Leaf universal response of host plant to fungal attack,

EgCHI1 including Ganoderma . The higher expression of
EgVIR-1 EgCHI1 in DxP MT Gano compared to
EgVIR-2 DxPYangambi showed that the moderate tolerant
oil palm varieties have potential higher tolerance
EgIFR-2
to fungal attack. The function of EgVIR-1 and
EgMT-1
EgVIR-2 genes in oil palm fruit exocarp
EgSPI-2 pigmentation has been demonstrated by Singh et
EgCAPX-2 al. [26]. The upregulation of EgVIR-1 inDxP MT
EgDEF1-2 Gano suggests that the ripening of fruit bunch in
EgMT-2 moderate tolerant varieties to Ganoderma could
EgPR1-1 be dissimilar from susceptible varieties. The
EgPR1-2 upregulation of EgIFR-2 inDxP MT Gano revealed
EgEMLP1-1 an important role of this gene in moderate tolerant
EgWRI1 oil palm varieties. In matter of fact, Ho et al. has
EgCAPX-1 hypothesized that the fungal elicitor was
considered as a suppressing agent of JA and JA-
EgCHI2
induced genes, including isoflavonereductase,
EgDEF1-1
during the attack of Ganoderma [14]. Thus, the
EgIFR-1 n≥ 5 upregulation of EgIFR-2 in moderate tolerant was
EgSPI-1 1<n<5 potentially an activated phytoalexin biosynthesis
EgAD1-1 ND pathway related to defense against pathogen
EgEMLP1-2 0,2<n<1 infection. The EgMTgene encoding early
EgAD1-2 n≤ 0,2 methionine protein has been demonstrated by Tan
et al. to be a potential biomarker for early detection
Figure 3. Fold change profile of 21 genes tested of G. boninense infection. The gene was highly
genes of Elaeisguineensis potentially involved in induced in Ganoderma -treated plants compared
tolerance to Ganoderma . Values are ratio with untreated ones [15]. In this work, similar
between susceptible and tolerant plants. Values upregulation was obtained in DxP MT Gano. This
of relative transcript abundances were result suggests that an early defense mechanism
calculated using StepOne Real-Time PCR against pathogen was constitutively activated in
software. No statistical analysis was done. moderate tolerant oil palm varieties. In addition,
Upregulated genes were shown in bright red for the EgSP1 gene encoding a serine protease
a threshold value ≥5; dark red for value <5, and inhibitor was highly induced in DxP MT Gano.
down-regulated genes were shown in bright
green for a threshold value ≤0.2; dark green for Previous studies have confirmed the
value >0.2. The non-significant genes are shown positive regulation of serine protease inhibitors in
in dark color. Ganoderma -treated oil palm [13-15]. Protease
inhibitors, a pathogenesis-related (PR) protein, are
included in downstream oil palm defense
In regard to root as an important tissue responses. These are the secondary response of
related to direct contact during the attack of pathogen attack in plant. This result suggests that a
Ganoderma , the six upregulated genes genes secondary defense mechanism against pathogen
(EgCHI1, EgVIR-1, EgVIR-2, EgIFR-2, EgMT-1, was also constitutively activated in moderate
and EgSPI-2) can be considered as potential tolerant oil palm varieties. Taken together, the
positive biomarkers for moderate tolerant oil palm results of this work highlighted a potential better
varieties. The expression of EgCHI1 has been defense mechanism against biotic stress in
studied by Naheret al. and Yeohet al. [10-12]. moderate tolerant oil palm varieties to Ganoderma
These studies have come up with a conclusion that .
the upregulation of chitinases was likely a
Page | 240
PROCEEDINGS
Table 2. Summary of target genes for previous and current differential gene expressions in oil palm
(Elaeisguineensis). The accession numbers were accessed at European Nucleotide Archive
(http://www.ebi.ac.uk/ena). The specific expression in tissue comprises leaf (L), flower (F), fruit (Fr)
and root (R). The title for expression data were upregulated (Up), downregulated (Down), and non-
regulated (NoReg). The unknown data was shown as Unk
Known
Expression This work Function Reference
Data*
Gene Accession
Protein coded
name number
G-
Tiss
treate R L
ue
d
Flowering
AF322914 F Unk Down Up
EgAD1 DEFENSIN 1 protein abnormalities [27]
Cytosolic ascorbate Peroxidase

JN203288 R Up Down Up
EgCAPX peroxidase activity [14, 28]
Pathogen
GU301271 L, R NoReg Up Down
EgCHI1 Chitinase class I defence [10-12]
Pathogen
HQ831445 L, R Up Down Up
EgCHI2 Chitinase class II defence [10-12]
Flowering
AY739700 F Unk Down Up
EgDEF1 DEFICIENS 1 protein phenotype [29-31]
Early methionine-labeled Secondary

EL695076 R Up Down Up
EgEMLP polypeptide metabolism [13, 15]
Isoflavonoid
EL690340 R Down Down Up
EgIFR Isoflavonereductase biosynthesis [13-15]
Metallothionein-like Redox
EL684283 R Up Up Up
EgMT protein homeostasis [13, 15]
Pathogenesis-related Pathogen
EL690964 R Up NoRegNoReg
EgPR1 protein defence [13-15]
Proteolytic
EL690627 R Up Up Up
EgSPI Serine protease inhibitor activity [13-15]
Fruit color
KJ789862 Fr Unk Up Down
EgVIR VIRESCENS protein pigmentation [26]
Seed oil
KJ427025 Unk Unk NoReg Up
EgWR1.1 WRINKLED1 protein accumulation [32]
*Expression value was considered from all transcript analyses (reads count, qPCR, etc). Thus it might not
be an exhaustive data. All the works were done using Ganoderma -treated plants (G-treated).
4. Conclusion moderate tolerant and susceptible oil palm

varieties to Ganoderma . Sixteen out of 21 genes
Our findings showed that differential gene were differentially regulated between DxP MT
expression analysis is a powerful tool to determine Gano (moderate tolerant) and DxPYangambi
a better overview of expressed genes in (susceptible) oil palm varieties. Six upregulated
Ganoderma –susceptible and –tolerant oil palms. genes genes (EgCHI1, EgVIR-1, EgVIR-2, EgIFR-
In summary, the results obtained in this work 2, EgMT-1, and EgSPI-2) in root can be considered
suggest distinct molecular regulation between
Page | 241
PROCEEDINGS
as potential positive biomarkers for moderate Differential expression of oil palm pathology
tolerant oil palm varieties. genes during interactions with
Ganodermaboninense and
Acknowledgment Trichodermaharzianum. Journal of Plant
Physiology. 2011;168:1106-13.
This work was supported by the Fund
Management Agency of Oil Palm Plantation [8] Exner V. Quantitative Real Time PCR in Plant
(BPDPKS) Research Grant. The authors thank the Developmental Biology. In: Hennig L,
Socfindo Seed Production and Laboratories team Köhler C, editors. Plant Developmental
for preparing the plant material. We are also Biology: Methods and Protocols. Totowa, NJ:
grateful to ApriliaKardina for the preparation of Humana Press; 2010. p. 275-91.
RNA samples and Real Time quantitative PCR
experiment. [9] Rebouças EdL, Costa JJdN, Passos MJ, Passos
JRdS, Hurk Rvd, Silva JRV. Real time PCR
References and importance of housekeepings genes for
normalization and quantification of mRNA
[1] Paterson RRM. Ganoderma disease of oil expression in different tissues. Brazilian
palm—A white rot perspective necessary for Archives of Biology and Technology.
integrated control. Crop Protection. 2013;56:143-54.
2007;26:1369-76.
[10] Naher L, Ho C-L, Tan SG, Yusuf UK,
[2] Taniwiryono D. Mengatasi Monster Sebesar Abdullah F. Cloning of transcripts encoding
Kapal Selam yang Mengancam Perkebunan chitinases from Elaeis guineensis Jacq. and
Kelapa Sawit Indonesia. Sinar Tani. Jakarta: their expression profiles in response to fungal
SCOOP; 2010. p. 11-3. infections. Physiological and Molecular Plant
Pathology. 2011;76:96-103.
[3] Ward G, Hadar Y, Dosoretz CG. The
biodegradation of lignocellulose by white rot [11] Naher L, Tan SG, Ho CL, Yusuf UK, Ahmad
fungi. Fungal Biotechnology in Agricultural, SH, Abdullah F. mRNA Expression of
Food, and Environmental Applications: EgCHI1, EgCHI2, and EgCHI3 in Oil Palm
Marcel Dekker Press New York; 2004. p. Leaves (Elaeis guineesis Jacq.) after
393-407. Treatment with Ganoderma boninense Pat.
and Trichoderma harzianum Rifai. The
[4] Xiao L-P, Shi Z-J, Bai Y-Y, Wang W, Zhang Scientific World Journal. 2012;2012:647504.
X-M, Sun R-C. Biodegradation of
Lignocellulose by White-Rot Fungi: [12] Yeoh K-A, Othman A, Meon S, Abdullah F,
Structural Characterization of Water-Soluble Ho C-L. Sequence analysis and gene
Hemicelluloses. BioEnergy Research. expression of putative oil palm chitinase and
2013;6:1154-64. chitinase-like proteins in response to
colonization of Ganoderma boninense and
[5] Paterson RRM, Moen S, Lima N. The Trichoderma harzianum. Molecular Biology
Feasibility of Producing Oil Palm with Reports. 2013;40:147-58.
Altered Lignin Content to Control
Ganoderma Disease. Journal of [13] Ho C-L, Kwan Y-Y, Choi M-C, Tee S-S, Ng
Phytopathology. 2009;157:649-56. W-H, Lim K-A, et al. Analysis and functional
annotation of expressed sequence tags (ESTs)
[6] Su'ud MM, Loonis P, Seman IA. Towards from multiple tissues of oil palm (Elaeis
automatic recognition and grading of guineensis Jacq.). BMC Genomics.
Ganoderma infection pattern using fuzzy 2007;8:381.
systems. World Academy of Science,
Engineering and Technology, International [14] Ho C-L, Tan Y-C, Yeoh K-A, Ghazali A-K,
Journal of Medical, Health, Biomedical, Yee W-Y, Hoh C-C. De novo transcriptome
Bioengineering and Pharmaceutical analyses of host-fungal interactions in oil
Engineering. 2007;1:1-6. palm (Elaeis guineensis Jacq.). BMC
Genomics. 2016;17:1-19.
[7] Alizadeh F, Abdullah SNA, Khodavandi A,
Abdullah F, Yusuf UK, Chong PP.
Page | 242
PROCEEDINGS
[15] Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L. [24] Fleige S, Pfaffl MW. RNA integrity and the
Expression profiles of putative defence- effect on the real-time qRT-PCR
related proteins in oil palm (Elaeis performance. Molecular Aspects of
guineensis) colonized by Ganoderma Medicine. 2006;27:126-39.
boninense. Journal of Plant Physiology.
2013;170:1455-60. [25] Fleige S, Walf V, Huch S, Prgomet C, Sehm
J, Pfaffl M. Comparison of relative mRNA
[16] Tee S-S, Tan Y-C, Abdullah F, Ong-Abdullah quantification models and the impact of RNA
M, Ho C-L. Transcriptome of oil palm integrity in quantitative real-time RT-PCR.
(Elaeis guineensis Jacq.) roots treated with Biotechnology Letters. 2006;28:1601-13.
Ganoderma boninense. Tree Genetics &
Genomes. 2013;9:377-86. [26] Singh R, Low ET, Ooi LC, Ong-Abdullah M,
Nookiah R, Ting NC, et al. The oil palm
[17] Durand-Gasselin T, Asmady H, Flori A, VIRESCENS gene controls fruit colour and
Jacquemard JC, Hayun Z, Breton F, et al. encodes a R2R3-MYB. Nat Commun.
Possible sources of genetic resistance in oil 2014;5:4106.
palm (Elaeis guineensis Jacq.) to basal stem
rot caused by Ganodermaboninense – [27] Tregear JW, Morcillo F, Richaud F, Berger A,
prospects for future breeding. Singh R, Cheah SC, et al. Characterization of
Mycopathologia. 2005;159:93-100. a defensin gene expressed in oil palm
inflorescences: induction during tissue
[18] Idris A, Kushairi A, Ismail S, Ariffin D. culture and possible association with
Selection for partial resistance in oil palm epigenetic somaclonal variation events.
progenies to Ganoderma basal stem rot. J Oil Journal of Experimental Botany.
Palm Res. 2004;16:12-8. 2002;53:1387-96.
[19] Chang S, Puryear J, Cairney J. A simple and [28] Jeennor S, Volkaert H. Mapping of
efficient methode for isolating RNA from quantitative trait loci (QTLs) for oil yield
pine trees. Plant Molecular Biology. using SSRs and gene-based markers in
1993;11:98-100. African oil palm (Elaeis guineensis Jacq.).
Tree Genetics & Genomes. 2013;10:1-14.
[20] Putranto R-A, Duan C, Kuswanhadi,
Chaidamsari T, Rio M, Piyatrakul P, et al. [29] Jaligot E, Hooi WY, Debladis E, Richaud F,
Ethylene Response Factors Are Controlled by Beulé T, Collin M, et al. DNA Methylation
Multiple Harvesting Stresses in Hevea and Expression of the EgDEF1 Gene and
brasiliensis. PLoS ONE. 2015;10:e0123618. Neighboring Retrotransposons in mantled
Somaclonal Variants of Oil Palm. PLoS
[21] Putranto R-A, Herlinawati E, Rio M, Leclercq ONE. 2014;9:e91896.
J, Piyatrakul P, Gohet E, et al. Involvement
of Ethylene in the Latex Metabolism and [30] Adam H, Jouannic S, Orieux Y, Morcillo F,
Tapping Panel Dryness of Hevea brasiliensis. Richaud F, Duval Y, et al. Functional
International Journal of Molecular Sciences. characterization of MADS box genes
2015;16:17885. involved in the determination of oil palm
flower structure. J Exp Bot. 2007;58:1245-
[22] Singh R, Ong-Abdullah M, Low E-TL, Manaf 59.
MAA, Rosli R, Nookiah R, et al. Oil palm
genome sequence reveals divergence of [31] Ong-Abdullah M, Ordway JM, Jiang N, Ooi
interfertile species in Old and New worlds. SE, Kok SY, Sarpan N, et al. Loss of Karma
Nature. 2013;500:335-9. transposon methylation underlies the mantled
somaclonal variant of oil palm. Nature.
[23] Kim H, Bi Y, Pal S, Gupta R, Davuluri RV. 2015;525:533-7.
IsoformEx: isoform level gene expression
estimation using weighted non-negative least [32] Subroto AP, Utomo C, Darmawan C, Tanjung
squares from mRNA-Seq data. BMC ZA, Liwang T. Isolation and Characterization
Bioinformatics. 2011;12:1-9. of Oil Palm Wrinkled 1 (WRI1) Gene.
Procedia Chemistry. 2015;14:40-6.
Page | 243
PROCEEDINGS
IMPACT OF BATIK INDUSTRY WASTE ON SEVERAL RICE

VARIETIES (ORYZA SATIVAL.)
B. Suryotomo1), Samanhudi2), Suwarto3), A. Yunus2)

1)
Faculty of Agriculture, Pekalongan university, 2) Faculty of Agriculture, SebelasMaret University 3)
Faculty of Agriculture, JenderalSoedirman University.
e-mail: yunus.uns7@yahoo.com
Abstract
Batik industry produces liquid waste that contain stain and heavy metals which pollutes surrounding
water bodies and irrigation systems. This pollutions causes the production of rice plants grown in the
contaminated area to fall by 20 percent. To get rice varieties that are resistant to batik waste
contamination, a study on several rice varieties has been done. The study aimed to determine the elements
contained in batik waste; determined the effect of batik waste on rice plant; and determined the tolerance
of rice varieties to batik waste contamination. The experiment was conducted in a greenhouse using split
plot design with three replications. The main plot were water source for irrigation consisted of irrigation
with batik waste water and irrigation with clean water (control). The subplots were rice varieties consisted
of V1= Inpara 3, V2= Ciherang, V3=Lambur, V4=Mendawak, V5=Cisadane, V6=Inpari 13, V7=Inpari 5,
V8=Inpari 2 and V9=Inpara 2. The result showed that the weight of 1000 grains that contaminated with
batik waste decreased by 24.54% and dry grains of rice decreasedby 18.86%, batik waste water contained
Cd, Pb and Hg that were 3.5; 1.7 and 18 times higher than in clean water respectively, based on the
weight of dry grain, Inpari 3 variety is the most tolerant varieties, but based on the weight of 1000 grains,
Inpara 3 variety is the most tolerant to stress caused by batik waste.
Keywords: impact, rice varieties, batik waste, tolerance
1. Introduction decreasing harvest yield. One of the main factor

that causes rice harvest to decrease is water
The demands of rice (Oryza sativa L.) as a pollution (in irrigation system), especially in
staple food in Indonesia increase each year with industrial area like in batik industrial centre. This
the increase of population. In 2005, it is equal to industry produces liquid waste containing dye and
52.8 million tons of milled dry grains (MDG), so heavy metal such as Ni, Mg, Pb, Cr, Cd, Pb and
in 2025, it is projected to be as high as 65.9 million Hg as well as dissolved solids (Setyaningsih,
tons of MDG, (Suryana et al., 2009). Rice 2002). From previous study, batik waste pollution
production in 2012 reached 68.59 million tons of causes the production of rice plants grown in the
MDG or increase 2.84 million tons (4.31%) contaminated area to fall by 20 percent. Selecting
compared to the production in 2011 (65.75 million the right variety of rice plants might become one
tons MDG). This increase was due to the increase solution in overcoming this problem. The selection
of harvested area and productivity (1.80% or of rice varieties has been known to play an
277.30 thousand hectare and 2.47% or 1.23 important role in agricultural system as superior
quintal/hectare respectively). However, it still not variety tolerant to natural condition as well as the
enough to counterbalance the increasing rate of application of other technology allow us to
population that reach 2% per year. This, Indonesia increase rice production (Suryana et al., 2009).
still has to import around 239.000 ton rice each The Inpara 5 Genotype, for example, is a rice
year (BPS, 2012). variety with the highest tolerance to batik waste
Besides the concern of increasing rice compared to ciherang, IR 64, Inpara 3, Inpara 2
production, Indonesia also faces problem of
Page | 244
PROCEEDINGS
and Air Tenggulang variety (Suryotomo et al., 3. Results and Discussions

2011).
Inpara 5 is one of the new superior varieties for Batik waste heavy metal content
rice grown in swampland which is marginal and
1. The laboratory analysis showed that the batik
fragile land with varied biophysic condition. Some
waste contain higher N, P and K compared to
of the major problem in developing agriculture in
unpolluted water. This result implied that the batik
this type of tidal land are: water inundation, high
waste polluted water was potentially ―more fertile‖
soil acidity (low pH) and the presence of toxic
than unpolluted water. The high total nitrogen (N)
substance such as Al, Fe, H2S and Na (Badan
content in batik waste (table 1) might originate
Penelitian dan Pengembangan Pertanian, 2011).
from the use of FeSO4 solution, alum, soda ash,
Based on their characters, some rice plant
Mordanting dye and Naptol dye which contain
varieties, like Inpara (swamp rice), Inpari, Lambur,
high number of N in their chemical structure
Mendawak, Cisadane and Ciherang varieties,
(Nurdalia, 2006). In addition, these substance also
might have the tolerance to abiotic stress
contain soluble salts which caused the Total
(Suprihatno, 2010). From previous study, Ciherang
Dissolved Solids (TDS) of the batik waste to be
variety is more tolerant to batik waste stress
much higher (1,632.52) than in the unpolluted
compared to IR 64 and Situbagendit varieties
water (TDS=11,78). Thus, batik waste polluted
(Suryotomo, 2011). Thus, this research was aimed
water was not suitable for irrigation because its
to determine the elements presents in batik waste;
salt content has already exceeded the threshold
determined the effect of batik waste on several rice
value of TDS based on Permenkes (Ministry of
varieties and determined the tolerance of rice
Health, Indonesia) clean water standard No. 416,
varieties to stress caused by batik waste
1990 which is 1500 mg/l (Rusdiyantoet al., 2001).
contamination.
The metals content (Cd, Pb and Hg) in both
unpolluted water, batik waste water were
2. Material and Method conspicuously very low based on the standard
from LPT, Bogor (Soil Research Institution,
This research was conducted inside the Bogor). The total concentration of Cd, Pb, and Hg
Green House of faculty of Agriculture of the in batik waste water were 0,151; 922,413 and
University of Pekalongan. The experiment used 23,18 ppb respectively (table 1). These heavy
Split Plot Design with three replications. The first metals most probably came from the use of Kimia
variable werebatik waste water and the irrigation dye as well as additional substance such as Rinso
water as main plotand the second variable were (a brand of detergent), tepol, Nitrite and ash soda.
rice varieties as sub plot which consisted of 9 These chemicals produced waste containing metals
varieties which were V1=Inpara 3, V2=Ciherang, such as Zn, Cd, Cu, Cr and Pb (Nurdalia, 2006).
V3=Lambur, V4=Mendawak, V5= Cisadane, Heavy metals were also present in unpolluted
V6=Inpari 13, V7= Inpari 5, V8=Inpari 2 and water, indicating the intrusion of batik waste to the
V9=Inpara 2. The data was analyzed using the F groundwater in areas of Pekalongan City.
test which was further analyzed using HSD test.
The analysis of batik waste content was conducted
in the Laboratory of Soil Science of Faculty of
Agriculture, Jenderal Soedirman University. The
physical parameters were observed are plant
height, numbers of seedling per plant, numbers of
productive seedlings, length of inflorescence per
plant, weight of 1000 dry grains, wet weight of
grains per plant, dry weight of grains per plant,
weight of inflorescence per plant and numbers of
fully filled grains per plant. To determine the
tolerance level of each rice varieties, regression
test between production parameters of weight of
1000 grains and dry weight per plants and
environmental condition which is polluted versus
non polluted water was conducted. The rice plants
tolerance towards stress from batik waste was
determined based on the slope value of the
regression equation; lower slope value indicated
higher tolerance of rice plant towards stress.
Page | 245
PROCEEDINGS
Table 1. The result of laboratory analysis of macro-elements content, heavy metals content, acidity
and Total Dissolved Solid (TDS) in water for irrigation (Unpolluted water) and in batik
waste water in areas of Pekalongan City
Parameter (unit) Unpolluted Degree Batik waste Degree

water water
N total (ppm) 0.965 Very low 12.464 High
P total (ppm) 3.01 Very low 10.44 Very low
K total (ppm) 29.144 Very low 245.721 Moderate
pH 6.45 Mildly acidic 6.45 Mildly acidic
Cd total (ppb) 0.043 Very low 0.151 Very low
Pb total (ppb) 533.378 Very low 922.413 Very low
Hg total (ppb) 1.24 Very low 23.18 Very low
TDS (mg/l) 11.78 Suitable for 1632.52 Very high, not
irrigation suitable for irrigation
Notes: The degree was based on the regulation from Soil Research Institute (LPT)-Bogor (2005);
Rosmarkan and Yuwono (2001). ppb = part per billion; ppm = part per million
The effect of batik waste on the growth that textile industrial waste water exerted
and production of rice plants significant negative influence on the number of
filled grains per panicle and 1000-grain weight of
Boro rice.
Rice plants that were irrigated with unpolluted Our result was in accord with Suryotomo
water had higher seedling numbers, productive (2011) who stated that rice plants that were
seedling numbers, height and length of exposed to batik waste had their growth and
inflorescence compared to the plants irrigated by production 18.79% lower than rice plants grown
batik waste (table 2). This result was caused by the with clean water. Similar results presented by
higher TDS to batik waste water; a solution with Dehnavi et al. (2015), that the presence of
higher TDS tend to be more viscous so that its industrial waste in irrigation water causes the
osmosis level is higher than in plant root cells harvested product decreased by 14%.
(Rosmakam and Yuwono, 2001), thus jeopardizing Irrigation with sewage water increased TDS
the mechanism of nutrient absorption. value (Mahmoud and Ghoneim, 2016), soil
In addition, the result also showed that batik salinity, exchangeable Na, K, Ca, Mg, and
waste affect the production of rice plants available P (Mollahoseini, 2013 and Khaskhoussy
significantly. Plants exposed to batik waste had et al., 2013). The dye, solid suspension, TDS, total
lower production compared to control (unpolluted chrome, high pH as well as heavy metals content
water). Some production parameters that were in batik waste could be absorbed by plants together
affected were weight of dry grain per plant and with other nutrients and would accumulate in plant
weight of 1000 grains. Plants irrigated with batik tissues, causing their growth to be disturbed
waste had their dry grains and 1000 grains 18.86% (Suharto, 2011).
and 24.45% lower than control respectively (table
2).Similar results are found by Begum et al.(2011),
Table 2. Statistical Analysis result of decrease growth and production of rice plants (Oryza sativa
L.) caused by batik waste stress
Growth and production parameters of Unpolluted Polluted Decrease (%) Statistic

rice plants value
Plant height (cm) 103.12 100.94 2.11 NS
Maximum number of seedlings 27.73 23.20 16.33 NS
Weight of 1000 grains (gr) 22.26 16.77 24.54** HS
Numbers of productive seedlings 17.66 17.05 3.51 NS
Inflorescence length (cm) 27.48 26.77 2.58 NS
Weight of straws/plant (gr) 159.48 154.11 3.36 NS
Wet weight of grain/plant (gr) 24.73 22.40 9.42 NS
Numbers of fully filled grain/inflorescence 760.90 730.92 3.94 NS
Dry weight of grains/plant (gr) 17.92 14.36 18.86** HS
Page | 246
PROCEEDINGS
Tolerance level of several rice varieties were conducted. The regression equation of rice
to batik waste plant variety in stressful condition and normal
condition was formulated. Variety with the lowest
Yoshida (1981) stated that production of rice slope values indicated the most tolerant variety and
plants is affected strongly by the number seedlings, vice versa.
weight of 1000 grains and dry weight of harvested From the regression test based on the parameter
grain. From the observation and data analysis, the (weight of 1000 grains), Inpara 3 was the most
production of rice plants in normal condition tolerant variety when exposed to batik waste (table
(without stress) was better than in stressful 3). Since batik waste contained high concentration
condition (from batik waste). The production of metals (salts), the fact that Inpara 3 is a
margin of each variety in normal versus stressful swampland rice plant variety might play important
condition depended highly on the ability of each role on its tolerance. Suprihatno, B. (2010) also
variety to cope with the stress caused by batik reported Inpara tolerance to Fe and Al poisoning.
waste. Higher difference indicated varieties that On the other hand, the regression on the second
are more sensitive to batik waste pollution. The parameter resulted to Inpari 3 as the most tolerant
parameters affected by batik waste (significant variety (table 4). Inpari 3 variety came from the
difference between control and polluted water) line of BPT164C variety which is categorized as
were the weight of 1000 grains and dry weight of red rice and possesses dominant gene of
grains per plant. Thus, to analyze the tolerance of antioxidant content (Aryana et al., 2009; Aryana,
the rice plant varieties, regression test on those two 2012).
parameters in normal versus stressful condition
Table 3. The tolerance rank of several rice plant varieties in areas contaminated with batik waste
based on their regression slopes for parameter weight of 1000 grains
Variety Regression equation Regression slope Sensitive rank

Inpara 3 y=-30,92x+23 -30.92 1
Ciherang y=-40,09x+20,05 -40.09 3
Lambur y=-55,55x+25,71 -55.55 7
Mendawak y=-80,27x+25,45 -80.27 8
Cisadane y=-40,18x+21,39 -40.27 4
Inpari 13 y=-43,14x+26,18 -43.14 5
Inpari 5 y=-37,03x+21,59 -37.03 2
Inpari 3 y=-83,33x+28,91 -83.33 9
Inpara 2 y=-46,29x+27,66 -46.29 6
Table 4. The tolerance rank of several rice plant varieties in areas contaminated with batik waste
based on their regression slopes for parameter dry weight of grains per plant
Variety Regression equation Regression slope Sensitive rank

Inpara 3 Y = 21.39 - 2,62 X -2.62 4
Ciherang Y = 11.68 - 6.64 X -6.64 8
Lambur Y = 22.77 - 3.62 X -3.62 6
Mendawak Y = 19.19 - 4.53 X -4.53 7
Cisadane Y = 15.40 – 1.56 X -1.56 2
Inpari 13 Y = 23.97 – 3.42 X -3.42 5
Inpari 5 Y = 18.28 - 2,09 X -2.09 3
Inpari 3 Y = 20.84 – 1.20 X -1.20 1
Inpara 2 Y = 28.55 – 7.36 X -7.36 9
Page | 247
PROCEEDINGS
Table 5. Parameter of vegetative and generative of rice varieties
Total grain Total Weight of Weight of Weight of dry

Treatment per plant productive fresh grain 1000 dry grain/plant
tillers (gr) grain (gr) (gr)
Main Plot (Irigation)
P1 = water irrigation 760.90 17.67 24.73 22.26 a 17.92 b
P2= waste irrigation 730.92 17.67 22.40 16.79 b 14.36 a
Sub Plot (Varieties)
V1 = Inpara 3 754.10 15.73 19.38 22.50b 17.46b
V2 = Ciherng 750.45 16.96 21.85 16.16h 14.51c
V3 = Lambur 727.30 18.09 24.13 20.33e 17.34b
V4= Mendawak 756.25 16.73 29.27 17.66fg 12.39e
V5= Cisadane 744.50 17.69 19.44 17.50g 13.06d
V6= Inpari 13 754.10 18.56 23.92 22.00c 18.84a
V7= Inpari 5 745.55 17.50 22.33 18.00f 15.15c
V8= Inpari 3 719.25 17.79 26.45 23.17a 19.04a
V9= Inpara 2 761.70 18.13 25.33 20.83d 17.51b
4. Conclusion 2011. Effects of Textile Industrial Waste

Water and Uptake of Nutrients on The Yield
From tis research, we can conclude that the of Rice. Bangladesh J. Agril. Res. 36(2): 319-
batik waste contained 3.5, 1.7 and 18 times higher 331.
Cd, Pb and Hg than in clean water. Rice plants [4] Bustaman, M. dan Moelyopawiro S. 1998.
contaminated with batik waste had their Pemanfaatan Teknologi Sidik Jari DNA di
production 18.86%-24.54% lower than that of Bidang Pertanian. Zuriat 9(2): 77-90.
controls. Based on the dry weight of harvested
grain, Inpari 3 was the most tolerant variety to [5] Darmono. 2001. Lingkungan Hidup dan
batik waste. Meanwhile, Inpara 3 was the most Pencemaran Hubungannya dengan
tolerant variety batik waste based on the weight of Toksikologi Senyawa Logam. Universitas
1000 grains. Indonesia, Jakarta.
[6] Dehnavi, S., Akbar, A.A., Maghsoudi, Y.,
Acknowledgment: Dehnavi, S., 2015. A Study for Remote
Detection of Industrial Effluents‘ Effect on
We thank the General Directorate of High Rice Using Thermal Images, in Proceedings
Education and cq. The University of Sebelas Maret of The International Archives of the
(UNS) who funded this research through the Photogrammetry, Remote Sensing and
research scheme of DIPA PNPB UNS 2014: UNS Spatial Information Sciences Vol. XL-1/W5:
Graduate Grants for the Top Fields: Climate 147-152. International Conference on Sensors
Change and Biodiversity. & Models in Remote Sensing &
Photogrammetry, 23–25 Nov 2015, Kish
References Island, Iran.
[7] Endang Suhartatik. 2011. Karakter Morfologi
[1] Abdulrachman, S., Gani A., Susanti, Z. 2011.
dan Fisiologis Berapa Galur Padi Tipe Baru.
Ameliorasi Tanah Tercemar Logam Berat Cd
―Variabilitas dan Perubahan Iklim:
pada Tanaman Padi Sawah. dalam
Pengaruhnya terhadap Kemandirian Pangan
―Variabilitas dan Perubahan Iklim:
Nasional‖. Prosiding Seminar Ilmiah Hasil
Pengaruhnya terhadap Kemandirian Pangan
Penelitian Padi Nasional 2010. Balai Besar
Nasional‖ Prosiding Seminar Ilmiah Hasil
Penelitian Tanaman Padi, Badan Litbang
Penelitian Padi Nasional 2010. Balai Besar
Pertanian, Kementan, 2011.
Penelitian Tanaman Padi,. Badan Litbang
Pertanian, Kementan, 2011. [8] Harahap, I.A. 2012. Analisis Total Zat Padat
Terlarut (Total Disolved Soil) dan Total Zat
[2] Badan Pusat Statistik. 2012. Produksi Padi.
Padat Tersuspensi (Total Suspended Soil)
Badan Pusat Statistik, Jakarta.
Pada Air Limbah Industri (tidak
[3] Begum, R.A., Zaman, M.W., Mondol, dipublikasikan). Skripsi. Universitas
A.T.M.A.IA, Islam, M.S., Hossain, K.M.F., Sumatera Utara.
Page | 248
PROCEEDINGS
[9] Herman, M., Purwantara, B., dan Thohari, M. Bidadari Kepulauan Seribu. Jurnal
2008. Teknologi Rekayasa Genetik dan Matematika, Sain dan Teknologi Vol: 2.
Status Penelitiannya Di Indonesia. Tanaman
[16] Setyaningsih, D. 2002. Penyisian Warna dan
Produk Rekayasa Genetik Dan Kebijakan
Bio Degradasi Organik Limbah Pewarnaan
Pengembangannya Vol. 1. Balai Besar
Batik Menggunakan Reaktor Kontinyu Fixed
Penelitian dan Pengembangan Bioteknologi
An Aerob. (online),
dan Sumber Daya Genetik. Badan Litbang
(http://digilib.itb.ac.id/gdl.phpmod=browse&
Pertanian, Departemen Pertanian. 2008.
op=read&id=jbptitbpp-gdl-s2-2002-
[10] Ishi, T., Nakano, T., Maeda, H. and pudjisetya-1829&q=value,accessed on
Kamajiwa, O. 1996. Phylogenik relationships November 28th, 2013).
in a-genome species of rice as revealed by
[17] Suharto. 2011. Limbah Kimia dalam
RAPD analysis. Genes and Genetics
Pencemaran Udara dan Air. Andi
System71 (4): 195-210.
Yogyakarta, Yogyakarta.
[11] Khaskhoussy, K., Hachicha, M., Kahlaoui,
[18] Suprihatno, B., et al. 2010. Diskripsi Verietas
B., Messoudi-Nefzi, B., Rejeb, A., Jouzdan,
Padi. Balai Besar Penelitian Tanaman Padi,
O., Arselan, A. 2013. Effect of Treated
Badan Litbang Pertanian, Kementrian
Wastewater on Soil and Corn Crop in The
Pertanian.
Tunisian Area. J. Appl. Sci. Res. 9: 132–140.
[19] Suryana, A., Mardianto, S., Kariata, K. dan
[12] Mahmoud, E.K., Ghoneim, A.M., 2016.
Wardana, I.P. 2009. Kedudukan Padi Dalam
Effect Of Polluted Water on Soil and Plant
Perekonomian Indonesia. Balai Besar
Contamination by Heavy Metals in El-Mahla
Penelitian Padi, Bogor.
El-Kobra, Egypt. Solid Earth 7: 703-711.
[20] Suryotomo, B. 2011. Kajian Dampak
[13] Mollahoseini, H., 2013. Long Term Effects
Cemaran Limbah Pembuatan Batik pada
of Municipal Waste Water Irrigation on
Sawah dan Upaya Peningkatan
Some Properties of a Semiarid Region Soil of
Produktivitasnya dalam Rangka Mendukung
Iran. Int. J. Agr. Plant Pro. 4: 1023–1028.
Keamanan Pangan. Prosiding Seminar
[14] Mulyadi, Hendarwati, Y. dan Artanti, R. Nasional Pemuliaan Berbasis Potensi dan
2011. Logam berat Kadmuim (Cd) Dalam Kearifan Lokal Menghadapi Tantangan
Tanah dan Gabah Lahan Sawah Sub-Das Globalisasi. LPPM Universitas Jenderal
Juwana Pati, dalam ―Variabilitas dan Soedirman, Purwokerto.
Perubahan Iklim: Pengaruhnya terhadap
[21] Suryotomo, B., Badrudin, U., Soeprapto, H.
Kemandirian Pangan Nasional‖. Prosiding
2012. Kajian Dampak Cemaran Limbah
Seminar Ilmiah Hasil Penelitian Padi
Pembuatan Batik pada Sawah dan Upaya
Nasional 2010. Balai Besar Penelitian
Peningkatan Produktivitasnya dalam Rangka
Tanaman Padi, Badan Litbang Pertanian,
Mendukung Keamanan Pangan. Laporan
Kementan, 2011.
Penelitian. Universitas Pekalongan,
[15] Rusdiyanto, E., Pratomo, H., Winarni, I. Pekalongan.
2001. Studi Komparatif Kualitas Biofisik
[22] Yoshida, S. 1981. Fundamental of Rice Crop
Lingkungan antara Daratan Pulau Pramuka
Science. IRRI, Los Banos, Philippine.
Page | 249
PROCEEDINGS
PRODUCTION OF BIOPESTICIDE FROM TOBACCO LEAVES

(NICOTIANA TABACUM)WITH DIGESTION AND REFLUX
EXTRACTIONS
Ahmad Fauzantoro, Amirah Amatullah Dalimunthe,Misri Gozan*
Chemical Engineering Department, Faculty of Engineering, Universitas Indonesia,

Depok, 16424, Indonesia
Corresponding author:misrigozan@gmail.com;mgozan@che.ui.ac.id
Abstract
Cigarette industry‘s restriction must be accompanied by development of non-cigarette, tobacco-based

product to ensure the future of tobacco farmers. One of the prospective utilization of tobacco is as
biopesticide with nicotine as its active ingredient. In this study, the extraction method of digestion was
conducted at a variety of temperatures while the reflux method was carried in a variety of extraction time
to obtain the optimum condition of nicotine extraction. Nicotine yield was obtained with multiplying the
extraction yield by the concentration of nicotine in the extract which was obtained through HPLC (High
Performance Liquid Chromatography). The result showed that digestion extraction using ethanol for 2
hours has optimum temperature of 50°C with 3.92% nicotine yield. For reflux extraction with methanol,
the optimum time is 6 hours with 6.23% yield. An antifungal test showed that the tobacco extract
inhibited the growth of Aspergillus niger thus it could be utilized as fungicide. It is expected that the
study may trigger industries to produce tobacco biopesticides so it can utilize the harvest from tobacco
farmers to sustain their livelihood.
Keywords: Biopesticide; Nicotiana tabacum; extraction; digestion; reflux
1.Introduction (FCTC) international agreements [3]. If the WHO

convention is ratified by the Indonesian
Indonesia annually can produce more than 50 government, the tobacco farmers in Indonesia
thousand tons of dried tobacco leaves [1]. In fact, would have further difficulties in selling tobacco to
tobacco production in Indonesia increased from cigarette manufacturers in Indonesia and the
174.7 thousand tons in 2008 to 263.7 thousand world. It is therefore necessary to find alternative
tons in 2012. However, 99% of the tobaccos uses of tobacco as raw material for non-cigarette
harvested are currently used only as raw material that can overcome the problem which is caused by
for the manufacture of cigarettes, whether as a the restrictions especially for the survival of
cigarette or cigar [2]. This is certainly becoming an tobacco farmers in Indonesia.
issue when the government issued policies that One of the alternatives is the use of tobacco as
reduce the consumption due to the impact of a natural pesticide. In fact, agricultural farmers
cigarette smoking which is bad for health. Laws have already use tobacco as a traditional
governing tobacco industry impact directly to biopesticides [4, 10]. But right now, there are not
tobacco growers since almost their entire crop is many industry that produces specifically
absorbed by the industry. biopesticides of tobacco yet. The lack of scientific
The Indonesian government is not the only one documentation regarding the production of
who began to restrict the tobacco industry, the biopesticides of tobacco requires further scientific
World Health Organization (WHO) also has issued review of the methods that can be used to produce
a convention on the restriction of the use of tobacco biopesticides to yield a satisfactory and
tobacco for cigarette industry world through effective result.
Framework Convention on Tobacco Control
Page | 250
PROCEEDINGS
2. Materials and Methods obtained through High Performance Liquid

Chromatography (HPLC). The eluent used was
Plant material methanol (isocratic) with 0.6mL/ min flow rate,
10µL injection volume, 254nm wavelength, and
Nicotiana tabacum used in this study were the 39kgf pressure for 7 minutes.
Virginia variety from Ponorogo, East Java
Province. The tobacco leaves obtained were in the Antifungal test
form of dried tobacco leaves.They were then
furtherly dried in a 40°C oven for 4 hours and A. nigerwas used to study the effectiveness of
ground using kitchen blender. biopesticide from tobacco leaves against its growth
in culture. The method used was a modified Kirby-
Chemicals, medium, and Bauer method [5]. Spores of A. nigerwere
inoculated to PDA medium on petri dish. Filter
microorganism paper was cut into 6mm-diameter disks. The disks
are then steeped in solutions with different
The distilled water used were from the concentrations of tobacco extract and placed on the
laboratory of Center for Assessments of surface of the agar. The plates were incubated at
Biotechnology BPPT. Analytical grade
43°C until inhibition zones could be observed.
methanoland ethanolwere purchased from Merck.
Miconazole nitrate 2% was purchased under the
trade name of Daktarin. Potato Dextrose Agar
3. Results and Discussion
(PDA) powder was purchased from HiMedia Labs.
Aspergillus niger isolate were obtained from the Yieldofdigestion extraction
microorganism collection of Indonesian Institute
Below is figure 1 that shows the extractionyield
of Sciences (LIPI).
and nicotine yield of digestion at different
temperatures.
Extraction process
In digestion extraction, 50g of ground tobacco
leaves were extracted using 250mL ethanol in a
glass beaker above a hotplate for 2 hours.A lab
mixer is set so the agitator was fully submerged in
the solution with a speed of 150rpm. The digestion
extraction was conducted at temperatures 30, 35,
40, and 50°C. In reflux extraction, 50g of ground
tobacco leaves were extracted using 250mL
methanol in a reflux system. The temperature was
set at the solvent‘s boiling point (65-68°C). The
reflux extraction was performed in 2, 4, 6, and 12
hours.
Nicotine yield Extraction yield
Recovery process
Figure 1. Extraction yield at various digestion
The extract liquid and solid were then separated temperature.
using vacuum filtration. The filtrate was
evaporated using rotary evaporator until it was ⅓
of its initial volume. The filtrate was further The nicotine yield of digestion extraction at
evaporated using water bath at 69°C to constant temperatures 30, 35, 40, and 50 degrees Celsius
mass. are respectively 0.74; 1.93; 2.64; and 3.92%. The
yield of digestion extraction obtained shows an
Determination of yield increase as temperature increases. This suggests
that there is a proportional correlation between
Yield of extraction is the mass of extract digestion temperature with nicotine yield. The
divided by the dry weight of ground tobacco leaves minimum nicotine yield of 0.7% is obtained at
(% g/g). Yield of nicotine is obtained by 30°C temperature while the maximum nicotine
multiplying the yield of extraction by the yield was obtained at 50°C with 3.9%. Tobacco
concentration of nicotine in the extract, which is extraction yield of digestion extraction at
Page | 251
PROCEEDINGS
temperatures 30, 35, 40, and 50 degrees Celsius

showed a correlation between temperature
digestion to the extraction yield obtained, in which
the higher the temperature then the greater the
yield of the extract obtained. These results are
consistent with previous studies [6, 7], where an
increase in the extraction yield digestion is aligned
with the increase in temperature. Therefore, it can
be said that the optimum digestion temperature in
the range of 30-50°C is 50°C. The percentage of
nicotine successfully extracted compared to the
nicotine in tobacco leaves can be seen in figure 2
below.
Figure 3. Yield for varying reflux extraction

time.
Nicotineyield of reflux extraction for 2, 4, 6,

and 12 hours are respectively 2.92; 3.33; 6.23; and
5.84%. The nicotine yield‘s almost doubled in the
time span of 2 hours between the extraction time
of 4 hours and 6 hours. However, differences in
time for the next 6 hours i.e. on the 12-hour
extraction, the nicotine yield instead declined for
0.4%. From the time variation of the experiment
Figure 2.Percentage of nicotine successfully conducted it is inferred that the optimal extraction
extracted to the theoretical nicotine content of time of reflux is 6 hours with a nicotine yield of
tobacco leaves. 6.2%. The percentage of nicotine successfully
extracted compared with the nicotine content of
tobacco leaf can be seen at figure 4 below.
It can be seen in the chart that when compared
to the nicotine content of tobacco leaves of
Virginia variety which is 6.7% [8], then the
digestion extraction method at 50°C for 2 hours
with ethanol has successfully extracted 59% of
nicotine contained in tobacco leaves. When
compared with the result of Puripattanavonget al
[9], in which tobacco leaves maceration using
ethanol at room temperature for 72 hours had an
extraction yield of 18.15% this study shows that
digestion for 2 hours at 50°C is capable of
generating 10.79% yield. The extraction yield
obtained is more than half for much less time.
Yield of reflux extraction

Figure 4. Percentage of nicotine successfully
Below is figure 3 that shows the nicotine yield extracted to the theoretical nicotine content of
and extraction yield of reflux for varying tobacco leaves.
extraction time.
When compared to the nicotine content for the
variety of tobacco used which is 6.7%, the method
of reflux extraction for 6 hours using methanol had
successfully extracted 92% of nicotine contained
Page | 252
PROCEEDINGS
in tobacco leaves. The decline in nicotine yield mm. In comparison, the effectiveness of tobacco
obtained after a time of extraction more than 6 extracts containing 21% of nicotine is 19% the
hours shows that 6 hours is the optimum time of effectiveness of antifungal containing 2%
reflux extraction. The resulting graph is aligned Miconazole nitrate.
with previous studies [6, 7]. Thelonger the time of The test results are consistent with Suleiman's
extraction, the more compounds desorbed to the [10] which uses fungi Aspergillus viridae and
solvent. But especially in the extraction of organic Penicilium digitatum where the higher the
matters, whether it's tobacco or other plants, 6 concentration of tobacco extract used, the greater
hours is the optimal time. This is probably because the zone of inhibition. On all three species of
organic compounds have a decomposition time fungi, tobacco extracts specifically inhibit the
that is faster than inorganic compounds, so that growth of the fungi's mycelia. The antimicrobial
when the extraction time is more than 6 hours, activity is known as a characteristic of nicotine's
many compounds were already decomposed. pyridine ring nucleotide. Unfortunately, until now
the specific mechanism of mycelia growth
Antifungal test inhibition by nicotine is still unknown. There is a
possibility that it was caused by the activity of the
There were six types of sample that were being pyridine nucleotide which is recently discovered to
tested. The negative control agar plate consisted of not only act as a coenzyme but also in determining
fungi and PDA, whereas the positive control the survival and death of cells [11], causing the
contained fungi, media, and 2% miconazole nitrate mycelial cells to undergo premature death before
discs. After an incubation period of 2-3 days, they can reproduce themselves.
inhibition zones could be observed by naked eye.
Zone of inhibition around the disc will appear 4. Conclusion
white while the zone overgrown with A. niger will
be black. The inhibition zone's diameter was then
Based on the experiments that has been conducted
measured with a ruler which resulted in figure 5
in this study, the following conclusions can be
below.
inferred. At a temperature range of 30-50°C, the
optimum temperature of tobacco leaves extraction
with digestion method using ethanol for 2 hours
was 50°C with nicotine yield of 3.92%. The
optimum time of tobacco leaves extraction using
methanol with reflux method is 6 hours with a
nicotine yield of 6.23%. Biopesticide produced in
this study was able to inhibit the growth of A.
niger with an inhibition zone diameter length of
10.5 mm at an extract concentration of 2000 ppm.
References
[1] BPS: Production Data of Tobacco in
Indonesia 2007 - 2010. Badan Pusat Statistik
RI. Jakarta. 2011.
[2] Food and Agricultural
Figure5. Zone of inhibition of biopesticides and Organization.Projection of Tobacco
control of A. niger. Production, Consumption and Trade to The
Year 2013. Rome, Italy: FAO Press, 2013.
[3] World Health Organization.Framework
The enlargement of inhibition zones was
Convention on Tobacco Control. Geneva,
unanimous to increasing concentrations of the
Switzerland: WHO Press, 2005.
extract which showed a correlation between the
concentration of tobacco extracts and the growth [4] Carole Chibuzo Nweze, Alqasim Abdullahi
inhibition of A. niger. The inhibition zone of an Mustapha, and Ilyas Muhammed Alkali.
extract with a nicotine content of 21% which was Aqueous leaf extracts of Tobacco Plant
diluted to 4000 ppm is 7.83 mm, while the (Nicotiana tabaccum) Causes Hepatotoxicity
inhibition zone of a registered antifungal with 2% in male Wistar albino rats. AsianJournal of
miconazole nitrate diluted to 1000 ppm is 10.5
Page | 253
PROCEEDINGS
Pharmacology and Toxicology, 03 (07);2015; of some Nicotiana tabacum varieties

27-30. cultivated in Syria, Herba Pol, 2015; 61(4):
23-30.
[5] Bauer AW, Kirby WM, Sherris JC, Turck M.
Antibiotic susceptibility testing by a [9] J. Jindaporn Puripattanavong, Chalermkiat
standardized single disk method.Am J Clin Songkram, Luelak Lomlim, Thanaporn
Pathol. 1966 Apr;45(4):493-6. Amnuaikit. Development of
ConcentratedEmulsion containing Nicotiana
[6] S. Purwono, B. Murachman, J. Wintoko, B.A.
tabacum Extract for Use asPesticide. J App
Simanjuntak, P.P. Sejati, N.E. Permatasari
Pharm Sci, 2013; 3 (11): 016-021.
and D. Lidyawati: The Effect of Solvent for
Extraction for Removing Nicotine on the [10] M. N. Suleiman: Antifungal properties of leaf
Development of Charcoal Briquette from extract of neem and tobacco on three fungal
Waste of Tobacco Stem, Journal of pathogens of tomato (Lycopersicon
Sustainable Energy & Environment, 2011; esculentum mill). Advances in Applied
(2): 11-13. Science Research, 2011; 2 (4): 217-220.
[7] M. Dent, V. Dragovi-Uzelac, M. Peni, M. [11] J. Sadoshima, M. Nakamura, and A.
Brni, T. Bosiljkov and B. Levaj: Polyphenols Bhatnagar: Overview of Pyridine
from Dalmatian Wild Sage, Food Technol. Nucleotides Review Series. Circulation
Biotechnol., 2013; 51 (1) 84–91. Research, 2012; 111: 604-610.
[8] G. Tayoub, H. Sulaiman, and M. Alorfi:
Determination of nicotine levels in the leaves
Page | 254
PROCEEDINGS
BRADYRHIZOBIUM JAPONICUM PLASMID CHARACTER FROM

AGROFORESTRY SYSTEM
S. Idiyah1, Hartawati1, N.Z. Lutfiyah2, and M.P. Mberu2

1)
Agronomy Departement, Agriculture and Animal Husbandry Faculty, University of Muhammadiyah
Malang, Jl. Raya Tlogomas 246 Malang, 65151, Indonesia
2)
Agronomy Departement Student, Agriculture and Animal Husbandry Faculty, University
of Muhammadiyah Malang, Jl. Raya Tlogomas 246 Malang, 65151, Indonesia
E-mail:s.idiyah22@gmail.com
Abstract
The aim of this experiment is to characterized Bradyrhizobium japonicum plasmid from agroforestry
system with four kinds of antibiotics. Plasmid character of Bradyrhizobium japonicum-soybean
symbiosis using Kaba, Anjasmoro, Wilis, Sinabung and Burangrang varieties were studied in
agroforestry system under Tectona, Orange, Noniand Albisia. Bradyrhizobium japonicum suplied by
Idiyah (2011) were collected from agroforestry areas under Tectona, Orange, Noniand Albisia in Malang.
The plasmid character study, comprised by using 0.6% agarose gel electrophoresis conducted at
Biotechnology laboratory of University of Muhammadiyah Malang. Plasmid character observation was
carried out on nine strain cultivated in non-antibiotic media, in media with Ampicylin 5mg.ml-1; with
Kanamycin 20 mg.ml-1; with Chloramphenicol 5 mg.ml-1; and with Tetracycline 5 mg.ml-1. The result of
this research indicate that there was various plasmid characters of Bradyrhizobium japonicum from
agroforestry system in Malang at Biology Nitrogen Fixation and contain gene that controlled antibiotic
resistance of Ampicylin, Kanamycin, Chloramphenicol, dan Tetracycline. Almost all of Bradyrhizobium
japonicum strains that used resistance to Ampicylin. Strains number 1, 3, 6, 7, 8 and number 9 resistance
to Chloramphenicol. All strains un resistance to Kanamycin and Tetracycline.
Keyword :Bradyrhizobium japonicum, plasmid, and Agroforestry System
1. Introduction interplanting system, that cultivated soybean

together with the main plan (Purba, 2011).
Recently Indonesian soybean production Because of that, cultivated soybean in
avarage 900 thousand tons per year. Mean while sistem agroforestry system, that soybean cultivated
soybean demand up to 1,7 million tons per year. with tree became an alternatif to solved the
Sothe deficit must be completed by import problem. Although this system can‘t produce
(Metrotvnews.com,2011). On 2006 Indonesian soybean as much as monoculture system in the
import value up to288 million US dolars or more open field, using Bradyrhizobium japonicumas
than 2 billion rupiah.In addition to US, Indonesia Nitrogen suplier, agroforestry system expected can
also import soybean from Argentina which is contribute production soybean 60% of
soybean production up to 44 million metrik tons monoculture system.
(Pikiran Rakyat, 2008). Acording to Forestry Minister, forest
The goverment decision to import wide in Javais 2,4 million hectares or around
soybean caused by the lack of field. Agricultural 22%from main land (Bisnis Indonesia, 2010). If
Minister said that consucta minimum of 500 soybean productivity is 1,2 tons, so Java will
thousand hectare to cultivated soybean. But until contribute 1,728 million ton soybean/year. It mean
now that field unavailable. To solved the problem, soybean import will decrease 83,88% or 0,322
Suswono inisiated, soybean cultivation did by million ton.
Page | 255
PROCEEDINGS
We asumed that B. Japonicumstrain in Bradyrhizobium japonicumpure culture from

agroforestry sytem is the specific strain that boost agroforestry system suplied by Idiyah (2011) in
N equipping through nitrogenfixation if soybean gelatin pepton media were vary in shape, and
cultivated under tree expected boost soybean colony thicknes, showed that they had vary
productifity. According to that the aim of this character and growth althought they collected from
experiment is to study Bradyrhizobium japonicum same cultivar and tree as we can see at Figure 1.
plasmidcharacter from agroforestry system with The result of this research indicate that
vary antibiotic that can came from irigation water there was various plasmid characters of
have been through hospital in other field Bradyrhizobium japonicum from agroforestry
application undisturb. system in Malang at Biology Nitogen Fixation and
contain gene that controlled antibiotic resistance of
2. Methods Ampicylin, Kanamycin, Chloramphenicol, and
Tetracycline. Almost all of Bradyrhizobium
The object of this research is nine japonicum strains that used resistance to
Bradyrhizobium japonicumstrain from Ampicylin that are strain number 1, 2, 3, 4, 6, 7, 8,
agroforestry system suplied by Idiyah (2011) were and number 9. Strains number 1, 3, 6,7, 8 and
collected from soybean cultivarare Kaba, number 9 resistance to Chloramphenicol. All
Anjasmoro, Wilis, Sinabung and Burangrangunder strain un resistance to Kanamycin and
Tectona, Orange, Noni and Albisia in Malang with Tetracyclineas we can seeat Figure 2, 3, 4, 5, and
Ampicylin 5mg.ml-1; with Kanamycin 20 mg.ml-1; 6.
with Chloramphenicol 5 mg.ml-1; and with
Tetracycline 5 mg.ml-1. 1 2 3 4 5 6 7 8 9
Bradyrhizobium japonicumcultivated in
pepton gelatin media using 0,4 difco bacto pepton,
2 mM MgSO4.7H2O,15 g gelatin and1000 ml
water. the solution acidity arranged by add
NaOH(0,5N), until pH 6,8.
Plasmid isolated after treated with 5
mg.ml -1 Ampicillin, 20 mg.ml-1 Kanamicin, 5
mg.ml -1 Kloramphenicol and 5 mg.ml -
1
Tetracyclin. After that elektroforesis gel
agarose cunducted, coloured with sub merge as
long as 20 minutes in EtBr and documented with Figure2. Bradyrhizobium japonicumplasmid
gel document. without antibiotic.
1 2 3 4 5 6 7 8 9
1 2 3
4 5 6 Figure3. Bradyrhizobium japonicumPlasmid with

5 mg.ml-1 Ampicillin.
Figure 2, 3 and 5 showed that addition 5

7 8 9 mg.ml-1 Ampicillinand Chloramphenicol treatment
decreased plasmid size showed by bands position
Figure1. B. japonicumStrain colony.
Page | 256
PROCEEDINGS
that have been moved. Figure3Showedthat all B.thickness related with plasmid purity, as said by
japonicumstrains had resisten plasmid with 5 Wu Da Ying (2016), where thick band showed that
mg.ml-1 Ampicillin with vary bands thickness. plasmid was pured. Bacterial Strain Resistanceto
Strain number 1, 2, 3, 4, 6, 7, 8, and 9 had thick
antibiotic caused by many factors. bacteria can
band, but number 5 strain band thin relatifly.synthesis in activator enzym or antibiotic
destroyer, bacteria synthesis new enzym to replace
in activator enzym or antibiotic destroyer which
1 2 3 4 5 6 7 8 9
inhibited the activity, bacteria increase metabolit
synthesis that antagonis-kompetitive to antibiotic,
bacteria compose new way metabolism, bacteri al
cell wall or cell membrane permeability decrease
for antibiotic, and bacterial structure or ribosom
composition change (Jawet, 1998). bakteri
Resistance controlled by bacterial plasmid.
Plasmid consist R factor that can in fected to other
bacteria lainnya. this R factor consistof 2 units
that r-unitand RTF (Resistance Tranfer Factor)
segmen. r-Unitcontrole one antibioticresistance,
many r-unitin R factor will controle many
Figure4. Bradyrhizobium japonicumPlasmid antibiotic resistance. RTF controle move r-unit so
with 20 mg.ml-1 Canamicin resistance character can in fected to other bacteria
(Ganiswara, 1995). Katzung (1995) said that
enzym produce by antibiotic resisten bacteri
1 2 3 4 5 6 7 8 9 purpose to destroy antibiotic structure, so
antibiotic become not efective enough and change
membran permeability until antibiotic can‘t
entered to ribosom.
Figure 4 and 6 showed that nine B.
japonicum strainsun resisten treated with 20
mg.ml-1 Canamicin and 5 mg.ml-1 Tetrasiclinthat
proofed by no band appeared.
B. japonicum unresistensibility to
Canamicin and Tetracyclin caused by (1) high
level dosage used, and (2) to long duration
treatment (Triatmojo (1994); Anonymous (2005);
Figure5. Bradyrhizobium japonicum dan Imayanti (1994).
Plasmidwith 5 mg.ml-1 Chloramphenicol.
4. Conclusion
1. There was various plasmid characters of
1 2 3 4 5 6 7 8 9 Bradyrhizobium japonicum from agroforestry
system in Malang at Biology Nitogen
Fixation and contain gene that controlled
antibiotic resistance of ampicylin,
Kanamycin, Chloramphenicol, and
Tetracycline.
2. Almost all of Bradyrhizobium japonicum
strains that used resistance to Ampicylin.
Strains number 1, 3, 6, 7, 8 and number 9
resistance to Chloramphenicol. And All
strains unresistance to Kanamycin and
Figure6. Bradyrhizobium japonicumPlasmid Tetracycline.
with 5 mg.ml-1 Tetrasiclin
Six of nine B. Japonicum strains resisten

to 5 mg.ml-1 Chloramphenicol that are nomer 1, 3,
6, 7, 8, and number 9 strain (Fig. 5). Band
Page | 257
PROCEEDINGS
References [7] Katzung, B. 6th eds. 1995. Basic and Clinical

Pharmacology. EGC. Jakarta
[1] Anonymous. 2005. Uji Resistensi Tiga Galur
B. japonicum terhadap Antibiotik Ampicillin, [8] Krisno, A. 2011. Resistensi Mikroorganisme
Rifamisin, Tetrasiklin dan Kanamisin. Skripsi terhadap Antibiotik. Pondok ilmu.html.
Fakultas Matematika dan Ilmu Pengetahuan diakses pada 24 januari 2012
Alam. IPB
[9] Metrotvnws.com, 2011.HargaKedelai Makin
[2] Bisnis Indonesia, 2010. Naik. diunduhpadaKamis, 10 Februari 2011
AjakMasyarakatRehabilitasiHutan. 11:57
Diunduhpada 18 April 2011
[10] Pikiran Rakyat, 2008. PetaPotensi Dan
[3] Ganiswara, G.S., 1995. Farmakologidan KetersediaanSumberdayaLahanMendukungS
Terapi. Gaya Baru. Jakarta. 863 p. wasembadaKedelai 2014. Diunduhpada 18
April 2011.
[4] Idiyah, S. dan Hartawati (2011) Isolasi dan
karakterisasi Plasmid B. japonicum dari [11] Purba, J. 2011. Indonesia Perlu 500
system Agroforestri. Laporan Penelitian RibuHektarLahanuntukTanamKedelaibisnis
Hibah Bersaing. Un published (2008) Monday, 18 April 2011 Thursday, 10
March 2011 19:45
[5] Imayanti, R. 1994. Pencirian Galur Bakteri
Bintil (Bradyrhizobium japonicum) Akar [12] Triatmojo, P. 1994. Distribusi Geografis Pola
Kedelai dengan Menggunakan Antibiotik. Resistensi Salmonella terhadap
Skripsi jurusan FMIPA IPB. Bogor. Kloramfenikol dan Antibiotik Pilihan Lainya
di Daerah Jakarta dan Palembang. Pusat
[6] Jawet, E. 1998. Prinsip Kerja Obat Anti Penelitian Penyakit Menular Badan
Mikroba in : Katzung B. eds. Farmakologi Penelitian dan Pengembangan Kesehatan,
Dasar dan Klinik. EGC. Jakarta. 699-751 Departemen Kesehatan RI. Jakarta.
[13] Wu Da Ying, 2016, unpublished
Page | 258
PROCEEDINGS
NUTRIENT CONTENT AND ANTIOXIDANT OF TOMATO

UNDER DROUGHT STRESS INOCULATED WITH
MYCHORRHIZA
Amalia Tetrani Sakya*), Muji Rahayu and Heri Widiyanto
Agrotechnology, Faculty of Agriculture

Sebelas Maret University Surakarta
*)
email : sakya_at@yahoo.com
Abstract
Using mychorrhiza as an effort to increase drought resistance have been many conducted and reported,
but whether the use of mychorrhiza under drought stress will also improve the quality of fruit has not
been widely reported. Therefore, the study aims to assess the inoculation of mycorrhiza on mineral
concentration of plant, total caroten, antioxidant activity and micro mineral content on fruit tomato under
drought stress. Research done using two kinds of mycorrhiza were Glomus sp and Acaulosporasp at 5
tomato cultivars namely 'Lentana' F1, 'Tyrana' F1, 'Betavilla' F1, 'Berlian' and 'Opal'. Research used
factorial completely randomized design. Drought stress condition was applied by watering plant on every
8 daysinterval. The study was conducted in a greenhouse of Faculty of Agriculture,Sebelas Maret
University Surakarta, Central Java, Indonesia. Concentration of P, Fe and Zn in tomato tissue on each
cultivars were different depends on type of mychorrhiza. N content in all cultivar was increase by
inoculating Glomus sp or Acaulospora sp. The total carotene, activity antioxidant and Fe concentration in
fruit were also different depending on inoculation of mychoriza. InoculationGlomus sp increased the total
carotene on cultivar 'Betavilla'. The higher antioxidant activity than non-mychorrhizal plant was only
determined on the cultivar 'Opal' inoculated with Acaulospora sp. The highest Fe concentration of fruit
was on 'Betavilla' F1 inoculated with Glomussp.Concentration of Zn in tomato fruits increased by
inoculation withGlomus sp and Acaulospora sp.
Keyword: antioxidant activity, carotene, drought stress, mychoriza, tomato
1. Introduction mychorrizal plants under drought. Thisresult

suggest that mycorrhizaesymbiosis alleviates
Tomatoes is rich in food components drought stress by altering the hormonal profiles
these are antioxidant and considered to be a source and affecting plant physiology in the host plant
of carotenoids, in particular lycopene, ascorbic [10]. Stimulated plant growth under drought stress
acid and phenolic compounds [1-4]. Although the in mycorrhizal symbiosis is because of increasing
cultivar has a dominant influence on the quality water status of tomato [11]. Besidesincreasing
determinant properties, the environment in which growth, the use of mycorrhizae will also affect the
it grows also has a significant role in the quality quality of the yield. Recent studies have
characters [5], beside that the quality also depends demonstrated that mycorrhizae fungi can also
on factors such as genetics, fruit maturity, and increase the nutrient quality of tomato fruits for
cultivation conditions [6-9].The water stress is one most nutrients except vitamins [12].Mychorizal
of environment condition thatconsidered the as a treatment increased the concentration of carotenes
main factor causing limitations not only to plant (1.4 times) and the concentration of xanthophylls
growth but also quantity and quality of yield. (1.5 times) compared non-mychorizal plants [13].
It has been widely reported that one effort In strawberry, arbuscular mycorrhizal fungi
that can be done to cope with drought stress is by inoculation was significantly affected the contents
using mycorrhizae. In tomato drought stress, of anthocyanin and phenolics. Inoculation
mychorrizal plants showed an improved growth decreases the acidity in fruit but increase firmness
rate and efficiency of photosystem II than non- of fruit tomato [14].
Page | 259
PROCEEDINGS
However, there is little information on the effect uses the stable radical 2, 2-Diphenyl-1-
of mycorrhiza on potential quality of tomatoes picrylhydrazyl (DPPH) as a reagent [15-16].
under drought stress. Therefore, this article aims to Sample (100μl) was added to 3 ml of DPPH
provide an overview regarding quality of tomato solution. After 30 min incubation period at room
under drought stress treated with mycorrhiza, temperature, the absorbance was read against
especially ontrace mineral content, total carotene blank at 517 nm. The percentage inhibition of free
and activity antioxidant. radical (DPPH) was calculated as under:
Inhibition% (DPPH) = (Ablank –Asample/
2. Methods Ablank) x 100,Where, A=Absorbance. Total
carotene was measured according with some
The study was conducted in a greenhouse modification. As much as 0.1 g of extract was
and the Laboratory of Plant Physiology and weighed and dissolved in 5 ml of 1:1 ratio-80%
Biotechnology, Faculty of Agriculture, UNS acetone-Petrolium Eter, homogenized in a
Surakarta. The research was conducted from June homogenizer at 1000 rpm for 5 minutes. The
to November 2013. The material used was tomato supernatant was taken and measured the
seed,mycorrhizae and chemicals for fumigation, absorbance at λ 470 nm [17].
analysis quality of tomato and micro mineral. The data were statistically analyzed using
Fruit sample for analysis quality of tomato Analysis of Variance (ANOVA) and the means
was taken from plant under drought stress and were separated by Duncan‘s multiple range test
inoculated with mychorriza. Treatment consisted (P< 0.05) using SAS 9 program.
of mycorrhizal types and cultivar of tomatoes.
Mycorrhizal type used consists of Glomus sp and
Acaluspora sp. The cultivar used consisted of
‗Lantana‘ F1, ‗Tyrana‘ F1, ‗Betavilla‘ F1, ‗Berlian‘
and ‗Opal‘. Combination treatments are arranged
Nutrients content in plant tissue and
based on factorial completely randomized design fruit of tomato
and each repeated four times. Soil sterilized by
fumagated with Furadan 3 RD and Masalgin 50 In drought condition, nitrogen and
WP for 2 weeks, then mixed with manure and put phosphorus contents in shoot tissues of the
in a polybag measuring 40 x 40 cm2, then the soil mycorrhizal plants were significantly greater than
watered to field capacity. Planting is done by those in the equivalent non-mycorrhizal plants
moving the 3-week seedling into a polybag. Before (Table 1). Such increases in nutrient contents in
planting, the soil is inoculated with mycorrhizal response to the mycorrhizal effects were highly
according to treatment as much as 10 g planting associated, respectively, with the type of
medium-1. Up to the age of 3 weeks after planting, mycorrhizal infection and cultivar.
the plants watered every two days and then treated N content in all cultivar was increase by
in drought stress condition by watering only every inoculating Glomus sp or Acaulospora sp,
eight days until harvesting. respectiely, 39% and 31% compare non-
Three tomatoes selected from each sample mycorrhizal plants. Increasing P content was
were washed, blotted with a paper towel. different in each cultivar when inoculating with
Concentrations of Fe and Zn were determined by mychorriza. In ‗Tyrana‘ F1, ‗Betavilla‘ F1,
Atomic absorption spectrometry. 1g of dried ‗Berlian‘ and ‗Opal‘ showed that both type of
sample was added to 5ml conc. HNO3 and placed mychorizal was efficient to increase P content in
on hot plate for 1 hour and on getting semi dried, tomato plant under drought condition. However,
another 5ml of HNO3 and 2ml of H2O2 was added the effectiveness of mycorrhizal was different for
and kept on hot plate for another 1 hour and after each cultivar. In ‗Tyrana‘F1 and ‗Berlian‘F1,
getting semi dried, it was cooled and filtered with Aculospora was the most efficient, while in Opal,
the help of watt man filter paper and the volume of Glomus sp was the most effective and in
the residue was made up to 10ml with 2N HNO 3 ‗Betavilla‘ F1 both type of mychorrhiza was the
and taken for AAS analysis. This above mentioned similar capability in increasing P content of tomato
mineral analysis was developed following AOAC plant under drought condition. P content in
standard. ‗Lentana‘ F1inoculation with Glomus sp and
In this study, the antioxidant activity was Acaulospora sp was not significant different with
assessed in terms of hydrogen-donating or radical non-mycorrhizal plant.
scavenging ability of extracts. A concentration of 1 In the case of micro nutrient content, Fe and Zn
mgml-1 was prepared by adding 0.02 g sample in concentration in shoot tissues of tomato under
20 ml methanol. This spectrophotometric assay drought stress was also different in each cultivar
depend on type of mychorrhiza colonization (Table
Page | 260
PROCEEDINGS
1). The highest Fe content in ‗Lentana‘ F1 was in drought condition. In ‗Betavilla‘ F1 and ‗Opal‘,
tomato plant inoculating with Glomus sp and the inoculation with Glomus sp was more efficient
lowest was in tomato plant inoculating with than Acauospora sp. Inoculating with Glomus sp
Acaulospora sp. Inoculating with Glomus sp in increase 88% and 73%, respectively in ‗Betavilla‘
‗Lentana‘ F1 increased 35% Fe content compared F1 and ‗Opal‘ compare with non-mycorrhizal
with non-mycorrhizal plant. In ‗Tyrana‘ F1, both of plant. Fe content in ‗Berlian‘ was not different
mychorriza can increase Fe content and between mycorrhizal plant and non-mycorrhizal
Acaulospora sp was more efficient than Glomus sp plant.
in increasing Fe content of tomato plant under
.
Table 1. N,P, Fe and Zn concentration of tomato plant inoculated mychorrhiza under drought
stress at 10 weeks after transplanting
Cultivar
Mychorrhiza
‗Lentana‘ F1 ‗Tyrana‘ F1 ‗Betavila‘ F1 ‗Berlian‘ ‗Opal‘ Mean
N Concentration (%)
Non mychorrhiza 0.32 0.57 0.72 0.46 0.62 0.54 a
Glomus sp 0.60 0.91 0.86 0.74 0.74 0.75 b
Acaulospora sp 0.56 0.72 0.78 0.76 0.71 0.71 b
Mean 0.49 0.70 0.79 0.65 0.69 (-)
P Concentration (%)
Non mychorrhiza 0.12 b 0.14 b 0.19 b 0.30 b 0.30 c 0.21
Glomus sp 0.15 a 0.15 b 0.28 b 0.33 b 0.54 a 0.29
Acaulospora sp 0.10 ab 0.25 a 0.26 b 0.50 a 0.45 b 0.31
Mean 0.12 0.18 0.24 0.38 0.43 (+)
-1
Fe Concentration (µg g dw)
Non mychorrhiza 37.14 b 17.23 c 31.25 bc 30.95 a 27.40 b 28.80
Glomus sp 50.23 a 28.20 ab 58.85 a 32.93 a 47.41 a 43.52
Acaulospora sp 21.12 c 38.69 a 41.11 b 32.88 a 29.41 b 32.64
Mean 36.17 28.04 43.74 32.25 34.74 (+)
Zn Concentration (µg g-1 dw)
Non mychorrhiza 20.07 15.66 16.25 13.92 18.47 16.87 b
19.75
Glomus sp 21.17 17.36 24.89 17.16 18.18
ab
Acaulospora sp 24.78 18.21 22.02 23.78 20.94 21.95 a
Mean 22.01 17.08 21.05 18.29 19.20 (-)
Note: Values in each column labeled with the same letter are not significantly different at Dunc an test p
= 0.05
Differences Zn content in tomatoes drought Fruit Fe concentration in each cultivar gave

stress inoculated with mycorrhizal only showed on different response. Not all of the cultivar
‗Betavilla‘ F1, 'Berlian' and ‗Opal‘. In inoculated with mycorrhiza gave a higher Fe
‗Betavilla‘F1, inoculation with Glomus sp was concentration in fruit than in uninoculated plants
more efficient than Acaulospora sp in increasing (Table 2). There was more fruit Fe concentration
Zn content. However, in ‗Berlian‘ and inoculated with Acaulospora sp than Glamus sp at
‗Opal‘,Acaulospora sp was more efficient than ‗Lentana‘ F1 and ‗Opal‘. While at 'Betavilla 'F1,
Glomus sp. Zn concentration in tomato inoculation the highest concentrations of Fe in fruit was
with Acauslospora was increase 71% and 13% present on the plants inoculated with Glomus sp.
respectively in ‗Berlian‘ and ‗Opal‘.
Page | 261
PROCEEDINGS
But, Fe concentration in ‗Tyrana‘ F1 was higher in Fe has been identified as a key human mineral
tomatoes without inoculation. nutrient [27]. Fe and Zn content of fruits of
Fruit Zn concentration was increase in all mycorrhizal plants was higher than in control
inoculated plants, but was significantly different plants. The present data show that mychorrizal
when inoculated with Glomus sp. There was 25% symbiosis can improve the nutritional value of
increased of fruit Zn concentration when tomato tomatoes. Interestingly, Fe content of mycorrhizal
under drought stress inoculated with Glomus sp plants was 65%a nd 39% higher than that of
content in fruit in all cultivar increased by controls in ‗Lentana‘ F1 and ‗Opal‘ when
inoculating mychorrhiza, especially if inoculating inoculated with Acaulospora sp, while
using glomus sp. There was 5% increased of Zn ‗Betavilla‘F1 inoculated with Glomus sp has a 23%
content if tomato drought stress were inoculated higher than that non-mychorizal. Zn content of
with Glomus sp p. There wasno differences of Zn mycorrhizal plants also was 9% and 3% higher that
content in fruit among the cultivars, and the Zn of non-mychorizal. This finding was similar result
content of tomato under drought stress was around with other researcher who reported that mychorriza
1.5-1.62 mg 100 g-1 fresh weight. inoculation enhanced the nutritional status of
Mycorrhizal plants showed higher content tomatoes, that Ca, K, P and Zn content of fruits of
of N and P than non-mychorrhizal plant except in mycorrhizal plants was higher than in control plant
‗Lentana‘F1.There is well-documented evidence in [27].
the literature of both positive and negative changes
in mineral content. There is also evidence for Carotene total and antioxidant activity
changes in micronutrients, especially Cu. While it
is known that plants access Cu directly through The tomato fruit contains important
their fungal associates [18], increased [19] and components, namely, vitamin C, β-carotene and
decreased [20].Differences in response to each lycopene, tomatoes also contains polyphenols,
cultivar because the ability of roots to absorb carotenoids and vitamin C, all of which have
nutrients is affected by the absorption of the roots, antioxidant effects. Polyphenols on tomato
the ability to transport from the roots to the leaves, composed mostly of flavonoids, while the
and the ability to expand the root system, but it is dominant type of carotenoid pigments lycopene[2-
also due to the compatibility of mycorrhizae with 3].
host plants varies depending on the species of Mean value of carotene and of antioxidant
mycorrhizae, host species and environmental activity in fruit of non-mychorrizal and
conditions [21].Increasing nutrient uptake of mychorrhizal plants are given in Table 2. On the
mycorrhizal plant is caused byincreasing root basis of fresh matter, the concentration of carotene
length and depthand development of external total in each cultivar were different depends on
hyphae [23], by increasing the absorbing surface type of mycorrhizae inoculation. Carotene total of
area, via mobilizing sparingly available nutrient tomato fruit from mychorrizal plants was only
sources, or by excretion of chelating compounds or significant higher in ‗Betavilla‘ F1 and ‗Opal‘.
ectoenzymes[19] or by improving the exploration Carotene total in mychorrizal Betavilla was 40%
of the soil pore space [24]. External hyphae adhere and 31% higher than that of controls, respectively
to soil particles through aspecial glycoprotein inoculated with Glomus sp and Acaulospora sp.
glomalin, which would improve contact with the Inoculation with Acaulospora sp and Glomus sp
soil solution [25]. elevated carotene total in fruit of ‗Opal‘ was 27%
Results of the present study illustrated the and 23% higher than that of non-mychorizal plant.
positive role of mychorrhiza symbiosis in Zn and Effect of mychorrhiza inoculation in
Fe uptake. The effects of mychorrhiza on carotene also is reported by some researcher. Some
acquisition of immobile metal nutrients by the host researchers have reported that carotenoid
plant are still unclear and factors responsible for production in mychorrhizal plants was increase
the variable results reported by researchers in this [29-30]. Mychorrhizal
field need to be understood. Inconsistent responses fungimayincreaseecarotenoidin tomato fruit, it
of mycorrhizal plants in micronutrient uptake may could be stimulate endogenous carotenoid
be related to highly variable soil conditions, under biosynthetic pathwaysindirectly or directly [12].
conditions of low micronutrients level, uptake by Mycorrhiza fungi are acting as a carbon drain on
mychorrhizahyphae is increased [26]. the host plant, thereby leading to increased levels
Fe and Zn play an important role in many of carotenoids thus carbohydrate limitation can
biological functions including protein synthesis, increase carotenoid levels in tomato fruits [30].
cellular division and nucleic acid metabolism and In the present study, the antioxidant activity
need specially child and pregnant women. Zn and was assessed in terms of hydrogen-donating or
Page | 262
PROCEEDINGS
radical scavenging ability of extracts. The vegetables such as lettuce, vitamin C concentration
antioxidant activity in each cultivar were also sometimes increased depend on cultivar was used
different depends on type of mycorrhiza [31], other researcher also found that vitamin C
inoculation. The resultdemonstrated that increased in tomatoes inoculated with Glomus
antioxidant activity was not increase in all cultivar deserticola, but this was true only for tomatoes
and it seem lower than non mychorrhizal plants, under water stress, so that vitamin concentration is
except in ‗Opal‘. Inoculation with Acauluspora sp likely mediated by factors in addition to
only gave a significant higher of antioxidant mychorrhizal inoculation [32]. There was a
activity in ‘Opal‘. This result was similar with significant increase in carotenes and xanthophylls
other researcher that also found mycorrhizal of C. annuum fruits treated with mychorizal fungi
inoculum did not improve antioxidant content of [13]. Though the exact mechanisms the effect of
tomato fruits [14, 33]. mycorrhiza in antioxidant are yet to be fully
Some literatures have reported both elucidated, mycorrhiza fungi upregulate key
negative and positive effect of mycorrhiza enzymes found in the phenylpropanoid pathway
onantioxidant.In this present study, mychorrizal such as Lphenylalanine amonia-lyase (PAL) and
colonization has increased antioxidant chalcone synthase (CHS). Phenylalanine is an
activity.Effect on antioxidant activity in some important precursor to the phenylpropanoid
cultivars of tomato might be due mycorrhizae pathway, which produces a wide spectrum of
affect the content of vitamin C, lycopene,  and  antioxidant compounds such as ferulic acid, p-
carotene. Some researcher reported that in leafy coumaric, and cinnamic acid [30].
Table 2. Total carotene, antioxidant activity, Fe and Zn content of tomato fruit inoculated
mychorrhiza under drought stress
Cultivar
Mychoriza
‗Lentana‘ F1 ‗Tyrana‘F1 ‗Betavila‘F1 ‗Berlian‘ ‗Opal‘ Mean
Caroten Total
Non mychorrhiza 20.88 a 23.19 a 28.62 c 19.02 ab 16.33 c 21.61
Glomus sp 23.49 a 23.96 a 40.36 a 20.48 a 23.77 b 26.41
Acaulospora sp 20.54 a 21.63 a 30.65 b 16.17 b 26.83 a 23.17
Mean 21.64 22.93 33.21 18.56 22.31 (+)
Antioxidant activity
Non mychorrhiza 28.62 a 35.83 a 37.85 a 37.85 a 30.99 b 34.23
Glomus sp 29.28 a 26.20 b 35.89 a 29.77 b 34.26 a 31.08
Acaulospora sp 30.91 a 25.85 b 29.67 b 36.03 a 37.17 a 31.93
Mean 29.61 29.30 34.47 34.55 34.14 (+)
Fe Content (mg 100 g-1 fresh weight)
Non mychorrhiza 2.30 b 3.70 a 3.25 b 3.17 ab 2.84 b 3.05
Glomus sp 2.43 b 2.56 b 4.07 a 2.89 b 3.16 b 3.02
Acaulospora sp 3.79 a 2.71 b 2.94 c 3.50 a 3.67 a 3.32
Mean 2.84 2.99 3.42 3.19 3.22 (+)
-1
Zn Content (mg 100 g fresh weight)
Non mychorrhiza 1.46 1.55 1.55 1.50 1.56 1.52 b
Glomus sp 1.50 1.52 1.78 1.77 1.68 1.65 a
Acaulospora sp 1.59 1.53 1.54 1.54 1.61 1.56 ab
Mean 1.52 1.53 1.62 1.61 1.61 (-)
Note: Values in each column labeled with the same letter are not significantly different at Duncan test p
= 0.05
Page | 263
PROCEEDINGS
4. Conclusion Castañeda, F.T. Davies Jr., V. Olalde-

Portugal. Mycorrhiza 16 (2006) 16 261.
Concentration of P, Fe and Zn in tomato [14] A.P. Cecatto, F.M. Ruiz, E.O. Calvete ,
tissue on each cultivars were different depends on J. Martínez , P..Palencia. Acta Sci.,
type of mychorrhiza. The total caroten, activity Agron. 38/2 (2016). 227.
antioxidant and Fe content in tomato fruit under [15] W. Brand-Williams W, M.E. Cuvelier, C.
drought stress were different depending on Berset. LWT Food Science and Technology
inoculation of mychorrhiza. Content of Zn in 28/1 (1995) 25.
tomato fruit under drought stress increased by
[16] E. Ivanišová , M.Tokár , K. Mocko, T.
Glomus sp or Acaulospora sp.Therefore,
Bojňanská, J. Mareček, A. Mendelová .
application mycorrhizain drought stress was
Journal of Microbiology, Biotechnology and
anuseful agricultural tool for drought resistance
Food Sciences 2 (2013) 692.
and quality improvement although this effect was
cultivar dependent. [17] G.B. Cagampang, F.M Rodriguez. Methods of
analysis for screening crops of apropriate
References qualities. Analytical Services Laboratory,
Institute of Plant Breeding, University of The
[1] B. George, C. Kaur, D.S. Khurdiya, H.C. Philippines at Los Banos. 1980
Kapoor. Food Chem. 84 (2004) 45. [18] X.L. Li, H. Marschner, E. George. Plant
[2]E. Sahlin, G.P. Savage, C.E. Lister. J. Food Soil136(1991) 4957.
Composit Anal. 17 (2004) 635. [19] H. Marschner, B. Dell, B. Plant Soil 159
[3] R. Ilahya R, C. Hdiderb, M.S. Lenucci, I. Tlili, (1994) 89.
G. Dalessandro. Sci Horticulturae. 127 [20]C. Gonzalez-Chavez C, J.D. Haen, J.
(2011) 255. Vangronsveld , J.C. Dodd. Plant Soil
[4] J. Pinela, L. Barros L, A.M. Carvalho, I.C.F.R. 240(2002) 287.
Ferreira.Food Chem Toxicol. 50 (2012) 834. [21] M. Brundrett.Mycorrhizas in Natural
[5] J.W. Purseglove, E.G. Brown, C.L. Green, Ecosystems. Advances In Ecological
S.R.J. Robbins. 1981. Spices. Tropical Research Vol 21 Pp 171- Begon, M, Fitter,
Agriculture Series, Vol. 1, Longman Group A. H. & Macfadyen, A. (Eds.).1991.
Ltd., London. [23] F.T. Davies, J. R. Potter, R. G. Linderman. J.
[6] A.A. Abushita, H.G. Daood, P.A. Biacs. J Plant Physiol., 139 (1992) 289.
Agric Food Chem. 48 (2000) 2075. [24] R. M. Auge´. Mycorrhiza11 (2001) 3.
[7] K.A. Thompson, M.R. Marshall, C.A. Sims, [25] Q.S.Wu,, R.X. Xia, Y.N. Zou. Eur. J. Soil
S.A. Sargent, J.W Scott. J Food Sci. 65 Biol. 44 (2008) 122.
(2000) 791. [26] A. Liu, C. Hamel, R. I., Hamilton, B. L. Ma,
[8] G. Giovanelli, B. Zanoni, V.Lavelli , R. Nani . D. L. Smith. Mycorrhiza9 (2000 ) 331.
J Food Eng.52(2002) 135. [27] M. Giovannetti M, L. Avio L, R. Barale, N.
[9] I. Martinez-Valverde, M.J. Periago,G. Provan. Ceccarelli, R. Cristofani, A. Iezzi, F.
J Sci Food Agric. 82 (2002) 323. Mignolli, P. Picciarelli, B. Pinto, D. Reali D
[10]J.M. Ruiz-Lozano, R. Aroca,Á. M. Brit J Nutr 107 (2012) 242.
Zamarreño, S.Molina, B. Andreo-Jiménez, R. [28] R.M. Welch, R.D. Graham. J Exp Bot
Porcel,José M.G, Carolien, Juan A.L. Plant, 55(2004) 353.
Cell & Environment.Volume 39/2 (2016) [29] B. Nzanza B, D. Marais, P. Soundy. Sci
441. Hortic 144(2012)55.
[11] J. Dell'amico, A. Torrecillas,P.Rodríguez,A. [30] R.Q. Zhang, H.H. Zhu, H.Q. Zhao, Q.Yao. J
Morte, M J. Sánchez-BlancoThe Journal of Plant Physiol 170(2012) 74.
Agricultural Science 138.4 (2002) 387. [31] M. Baslam, N.
[12] M. Hart M, L.E. David, K. Angelika, Goicoechea.Mycorrhiza22(2012) 347.
L.Connie,M.Susan, T. Christina, F. Philipp. [32] M. Wahb-Allah, H. Abdel-Razzak, A.
Mycorrhiza (2014). DOI 10.1007/s00572- Aslsdon, A. Ibrahim. Life Sci J 11(2014)
014-0617-0 109.
[13] H.G. Mena-Violante, O. Ocampo-Jiménez, L. [31] A. Copetta, L. Bardi, E. Bertolone, G. Berta.
Dendooven, G. Martínez-Soto, J. González- Plant Biosystems, 145/1 (2011) 106.
Page | 264
PROCEEDINGS
GENETIC DIVERSITY OF RICE (ORYZA SATIVA) LOCAL

CULTIVATED OF BOYOLALI BLACK RICE BASED ON
MORPHOLOGICAL CHARACTERS.
Edi Purwanto , Endang Yuniastuti , Meyriza Ayu Hatari
Faculty of Agriculture, Sebelas Maret University
Email: edipur_uns@yahoo.com
Abstract
Black rice is a type of local rice which has rarely cultivated, whereas it has a high nutrient content.
Farmers who planted black rice on Central Java Province scattered in several areas including Boyolali .
The diversity of black rice in that region has not been studied. This study aims to determined
morphological characters and the diversity of Boyolali black rice. The research was conducted in Teras,
Boyolali. It is a survey research in order to describe the morphological characteristics of plants. The data
were descriptively analyzed and scoring analysis by Descriptors for Wild and Cultivated Rice (Oryza
spp.) and continued by clustering analysis using NTSYS program. The cluster analysis are presented in
Dendrogram. The results show morphological characters plant height between 102-135 cm, strength
stems of plants strong, number of culm between 11-25, flag leaf attitude erect and semi-erect, ligule shape
2-cleft, number of panicle per clumps 9-21, number of grain per panicle 73-108, clarity rice opaque,
pericarp color dark purple mix black. Dendrogram analysis showed 0.50 on similarity coefficient to 0.69
(dissimilarity 0.50 to 0.31).
Keywords: morphological characters, genetic diversity, local varieties, black rice
1. Introduction The morphology diversity is significant.

Characterization of plant morphology is the
Rice is one of the major food simplest way to identify plants. According to
commodities in Indonesia. Rice has different Tehrim et al. (2012) morphological characteristics
colors and shapes. Based on the colors there are 3 of the plant can be used for the initial evaluation to
types of rice varieties cultivated in Indonesia, those assess the genetic variability through phenotypic
are white rice, red rice and black rice. Black rice observation. Plant morphology connect to form
variety not common known to the public, so that and structure of plant organs which is the main
their utilization is still very limited both in basis in the classification of plants and used as tool
consumption, production or activity of breeding. to know plant‘s adaptation to their environment
Black rice contains many aleurone and endosperm (Makarim et al. 2009). Characterization based on
that produce anthocyanin so physically rice color morphological markers are usually influenced by
becomes purple to black. Black rice has benefit the micro and macro environment, and plant age
better than brown rice or white rice (Dewi et al. (Kristamtini et al. 2012). Therefore, morphological
2010). characterization test necessary done, to determine
Based on the information PPHP (2013) the diversity level of black rice in Boyolali.
black rice farmers in Central Java recorded exist in
the Magelang, Banjarnegara, Boyolali, Wonosobo,
and Temanggung regency. Description of the
characteristic of black rice crops have not been
recorded detail. The study of the data collection of
black rice germplasm diversity local rice varieties,
yet many do. On black rice fields, there are
variations of each other.
Page | 265
PROCEEDINGS
2. Materials and Methods above sea level). The study is a survey research to
describe the morphological traits of black rice
The research was conducted in Teras plants in Teras, Boyolali. Identification carried out
district, Boyolali regency (Altitude: 200 meters
to 10 clumps of black ricedthat selected Distinguishing traits in Byl4 and Byl6 samples are
intentionally in cropping land. stem length and plant height. According to Zafar et
The data were analyzed descriptively al. (2004) 65 to 130.4 cm tall plants are
using a score which refers to the Descriptors for characteristic genotype local variety those are
Wild and Cultivated Rice (Oryza spp.) (Bioversity superior in its ability to support growth of panicle
International, IRRI, WARDA 2007). Data analysis through the mobilization of large reserves. Plant
using SimQual process. The data matrix was used height is a complex character and end product of
to construct a phenetic dendrogram \\\ matrix data several factors that are controlled genetically
was calculated through DICE coefficient then called internode. Byl 8 sample clumped alone and
using the SAHN. Grouping method used is apart from Byl 4 and 6. Distinguishing traits Byl8
UPGMA and NTSYS program. The results of the with Byl 4 and 6 Byl are stem length and number
analysis are presented in Dendrogram. of tillers. Group III consists of two samples those
are Byl 5 and Byl 10 with the 0.61 similarity
3. Results and Discussion coefficient (0.39 dissimilarity coefficient).
Black rice identification Grain morphology

Stem morphology
Dendrogram of 10 samples black rice
Relatedness analysis based on based on morphological grain presented in Figure
morphological stems character, produce 2. Cutting Dendrogram are divided into 3 groups at
dendrogram as shown in Figure 1. Cutting 0.64 similarity coefficient (0.36 dissimilarity
dendrogram are divided into 3 groups at 0.50 coefficient).
similarity or 0.50 dissimilarity coefficient. Group I Group I consists of 4 samples which Byl
consists of 5 samples those are samples Byl 1, Byl 1, Byl 6, Byl 7, Byl 10. Byl 1 and Byl 6 samples
7, Byl 2, 3 and Byl Byl 9 with a similarity clustered with 0.83 high similarity coefficient
coefficient of 0.50 (dissimilarity 0.50) or 50% (0.17 dissimilarity coefficient). Distinguishing
similarity. Samples Byl1 and Byl7 have a high traits of Byl1 and Byl6 samples are lemma and
similarity with 0.75 similarity coefficient or 0.25 palea colors. Group II consists of 4 samples which
lower dissimilarities. Distinguishing characters of are Byl 2, Byl 3, Byl 5 and Byl 4 with 0.72
samples Byl1 and Byl7 those are the number of similarity coefficient or 0.28 dissimilarity
tillers and stem segment color. Samples of black coefficient. At 0.83 similarity coefficient or 0.17
rice Byl3 and Byl9 have 0.75 similarity coefficient dissimilarity coefficient on Byl 2, Byl 3 and Byl 5
or 0.25 lower on dissimilarity coefficient. samples form one group. Distinguishing traits of
Distinguishing characters in samples Byl3 and all three samples with Byl 4 sample are the color
Byl9 is the angle stem and stem segment color. of lemma and palea. Group III consists of two
Group II consists of three samples those samples which are Byl 8 and Byl 9 at 0.66
are Byl 4, Byl 6, Byl 8 with 0.50 similarity similarity coefficient (0.34 dissimilarity
coefficient or 50% similarity. Byl4 and Byl6 coefficient) or 66% similarity. Characters that
samples have high similarity coefficient that are distinguish the two samples is the number of
0.75 or lower 0.25 dissimilarity coefficient. grains per panicle.
Page | 266
PROCEEDINGS
Dendogram Morfologi Gabah

byl1
byl6
byl7
byl10
byl2
byl3
byl5
byl4
byl8
byl9
0.57 0.64 0.70 0.77 0.83

Koefisien Kemiripan (Koefisien DICE)
Figure 1. Dendrogram analysis UPGMA of black rice based on stem morphology characteristic.
Figure 2. Dendrogram analysis UPGMA of Black Rice based on grain morphology characteristics.
Page | 267
PROCEEDINGS
A B C D
Addition: The color of lemma and palea tawny (A), the color of lemma and palea tawny (B), the color of
lemma and palea tawny (C), the color of lemma and palea faded tawny (D)
Panicles morphology characteristics, they are clustered secondary

panicle branches (3-4) secondary panicle branches
Relatedness that formed 10 samples of per main panicle).
black rice panicle based on morphology, shows In sub-group IIA consists of one sample,
formation of two main groups with 0.39 similarity Byl 6. Sub-group IIB consisted of 2 samples, Byl 8
coefficient and 4 subgroups (IA, IB, 2A and 2B) and Byl 9 with 0.66 similarity coefficient or 0.34
with 0.54 similarity coefficient. Dendrogram dissimilarity coefficient of. Distinguishing traits of
presented in Figure 4. Byl 8 and Byl 9 samples are panicle length and
In subgroup IA consists of 4 samples they number of panicles per clumps. Panicle length was
are Byl 1, Byl 2, Byl 4 and Byl 3. Byl 1 separate or strongly associated with the number of grains per
clustered themselves. In subgroup 1B consists of 3 panicle and the number of seeds per panicle
samples they are Byl 5, Byl 10 and Byl 7 on 0.66 (Ashfaq et al. 2013). Byl 8 sample had panicle
similarity coefficient. Byl 5 and Byl 10 have 1.00 length between 23.15 to 23.81 cm and panicle
similarity coefficient or 0.00 dissimilarity length Byl 9 had between 21.80 to 22.46 cm.
coefficient. Byl 5 and Byl 10 have same Number of panicles per clump on Byl 8 is 9-11
morphological panicles characters 100%. Byl 7 panicles per clump and number of panicles per
sample clustered itself because it has different clump on Byl 9 is> 21.
Dendogram Morfologi Malai

byl1
byl2
byl4
byl3
byl5
byl10
byl7
byl6
byl8
byl9
0.39 0.54 0.69 0.85 1.00

Koefisien Kemiripan (Koefisien DICE)
Figure 3. Dendrogram analysis UPGMA of black rice based on panicle morphology

characteristics.
Page | 268
PROCEEDINGS
A B C
Addition : Panicles appear half, panicle neck not appear (A), Panicle appear only limited on panicle neck
(B), panicles appear fully, panicle neck moderate (C)
Grouping of black rice based on whole According to Sukartini (2006)

morphology characters morphology-ical identification can be used to
analysis the relatedness among accession. Relate
The observation and identification of with them, many or small number of
morphological traits on 10 black rice samples were morphological characters that have a high
analyzed based on cluster analysis in order to get a heritability or repeatability will determine the
sample grouping as shown in Figure 4. According accuracy of the grouping accessions.
to Aliyu, cluster analysis has the virtue of Characterization of the morphological level is
accession and the ability to identify plants with the required primarily for identification purposes and
highest level of similarity with views Dendrogram phenotype changes associated with the ecotype
(Aliyu 2000 cit Ogunbayu et al., 2005). The (Marzuki et al., 2008). According to Das (2012)
morphological dendrogram result of similarity morphological characterization important to do
matrix or genetic distance matrix has given overall more than the molecular characterization because
pattern of variation as well as the degree of it is easy and clear. Identification of morphological
relatedness between accessions (Ogunbayu et al., characters is one important factor for crop
2005). Similarity coefficient matrix is presented in improvement (Shinha AK and Mishra 2013).
Table 1.
Tabel 1. The entire similarity coefficient matrix morphology characters of black rice
byl1 byl2 byl3 byl4 byl5 byl6 byl7 byl8 byl9 byl10
byl1 1.00
byl2 0.53 1.00
byl3 0.53 0.65 1.00
byl4 0.56 0.65 0.65 1.00
byl5 0.46 0.59 0.53 0.43 1.00
byl6 0.50 0.53 0.46 0.59 0.59 1.00
byl7 0.59 0.68 0.53 0.50 0.53 0.56 1.00
byl8 0.43 0.40 0.43 0.53 0.50 0.50 0.43 1.00
byl9 0.50 0.56 0.53 0.59 0.40 0.46 0.56 0.53 1.00
byl10 0.53 0.65 0.40 0.53 0.62 0.56 0.53 0.46 0.43 1.00
Page | 269
PROCEEDINGS
Figure 4. Dendrogram analysis UPGMA of black rice based on all of morphology characteristics.
Dendrogram above shows samples of panicle length, and grain loss of panicle, number of
black rice has a similarity coefficient between 0.50 grains per panicle, long brown rice and root length.
to 0.69 (dissimilarity 0.50 to 0.31). Dendrogram Byl 2 has a dark green leaf color, plant height from
analysis showed black rice plants are divided into 128.43 to 135 cm, panicle length from 21.80 to
two main groups. Group I consisted of Byl1, Byl2, 22.46 cm, grain loss is rather easy, the number of
Byl7, Byl3, Byl4, and Byl9 samples. Group II grains per panicle 115.80 to 137.10 grains per
consists of Byl5, Byl10, Byl6, Byl8. According to panicle, long brown rice 7.0 to 7.1 mm, root length
Vitello et al. (2013) the smaller similarity from 18.4 to 21.7 cm and the sample Byl 7 has a
coefficient value (close to zero), the further the dark green leaf color, 121.88 to 128.43 cm plant
relatedness and conversely the greater the height, panicle length 23.82 -24.44 cm, number of
similarity coefficient value (close to one), then the grains per panicle 137.2 to 158.5 grains per
relationships are getting closer. This is consistent panicle, length of 6.8 to 6.9 mm brown rice, root
with the statement from Widayah (2006) cit length from 15 to 18.3 cm.
Sulistyawati et al. (2009) 100% similarity means Group II, samples with the highest
same exact and vice versa 0% means completely similarity or low dissimilarity coefficient are Byl6
different. and Byl8 with the degree of similarity or
The level of similarity black rice dissimilarity of 0.65 to 0.35. Morphological
suspected, because it comes from the same type so characters that distinguish the two samples is
that diversity is rarely achieved. Morphological quantitative character. According to Zafar et al.
diversity seen in the quantitative while the (2004) qualitative character are also important for
qualitative similar. Based on the research results description of plant and was particularly
Sudha et al. (2013) that the relationship between influenced by nature selection. Length of Byl 6
accessions in the cluster can be associated with between 45.28 to 50.15 cm and Byl 8 between
their diversity and plant genetic resources 40.40 to 45.27 cm. Byl 6 sample length of stem
exchange among farmers. The difference of between 92.7 to 103.5 cm and Byl 8 ranged from
varieties is affect the characteristic of plant large 70.9 to 81.7 cm. Byl 6 sample has plant height
enough. Rice genotypes are also classified into around 121.88 to 128.43 cm and Byl 8 ranged
different groups based on their various from 102.20 to 108.75 cm. Thickness of nodes for
morphological traits, the genotypes that have the Byl 6 is 5.8 to 6.3 mm and 8 Byl from 3.8 to 4.2
same characteristics are grouped into the same mm. Number of tillers on Byl 6 is 20-22 tillers and
cluster (Ashfraq et al. 2012). Byl 8 between 11-13 tillers. Panicle length on Byl
Group I sample with the highest similarity 6 between 23.82 to 24.44 cm and Byl 8 from 23.15
sample Byl 2 and Byl 7 with a 0.69 similarity or to 23.81 cm. Number of panicles per clump on Byl
0.31 dissimilarity coefficient. The differences of 6 is 15-17 and Byl 8 9-11 panicle per clump. Loss
two samples are in the leaves color, plant height, of grain samples Byl 6 rather easily (26-50%) and
Page | 270
PROCEEDINGS
Byl 8 moderate (6-25%). Number of grains per [4] Kartikaningrum Sn, Hermiati An, Sugiharto
panicle Byl 6 samples ranged from 137.2 to 158.5 2008. Analisis Kekerabatan Mentimun
and Byl 8 between 73.0 to 94.3 grains per panicle. (Cucumis Sativus L.) Menggunakan Metode
High degree of similarity on black rice Rapd-Pcr Dan Isozim. Biodiversitas. 9(2) :
can mean low genetic diversity. Differences and 99-102
similarities beyond the morphological appearance
[5] Kristamtini, Taryono, Panjisakti, Basunanda,
of a plant species can be used to find much close
Rudi Hm, Supriyanta, Setyorini W, Sutarno
relatedness (Suskendriyati et al. 2000).
2012. Morphological Of Genetic
Morphological traits are controlled genetically
Relationships Among Black Rice Landraces
inherited to next generation. Environmental
From Yogyakarta and Surrounding Areas.
factors also affect the expression of these traits,
ARPN Journal of Agric and Biol Sci. 7(12):
although only temporary (Kartikaningrum et al.,
982-989.
2002).
[6] Makarim AK, E Suhartatik 2009. Morfologi
4. Conclusion Dan Fisiologi Tanaman Padi. Balai Besar
Penelitian Tanaman Padi.
The result of morphological characters [7] Ogunbayu SA,Ojo DK, Guei RG, Oyelakin
are plant height between 102-135 cm, strength of OO, Sanni KA 2005. Phylogenetic Diversity
stem: strong, number of tillers 11-25, leaf flag and Relationships among 40 Rice Accessions
angle: erect and a bit erect,the shape of tounge using Morphological and RAPDs
leaves is pointed split triangular,the number of Techniques. Afr J Biotechnol 14(11): 1234-
panicles per clump 9-21, number of grains per 1244.
panicle 73-108, rice clarity is blurry or dull,
pericarp color dark purple to black. The diversity [8] Shinha AK, Mishra PK 2013. Morphology
of morphological characters between samples based multivariate analysis of phenotypic
contained on the properties of quantitative includes diversity of landraces of rice (Oryza sativa
leaf length, leaf width, plant height, stem length, L.) of Bankura District of West Bengal. J of
number of tillers, number of panicles, number of Crop and Weed 9(2):115-121.
grains, long brown rice, and the qualitative [9] Sudha et al. 2013. Genetic Diversity Analysis
properties includes leaf color, midrib color, stem Of Papaya (Carica Papaya L.) Genotypes In
segment color, lemma and palea color, and Andaman Islands Using Morphological And
pericarp color. Dendrogram analysis based on all Molecular Markers. Afr. J. Agric. 8(41):
the morphological characters showed 10 samples 5187-5192.
of black rice has a similarity coefficient between
0.50 to 0.69 (dissimilarity 0,50-0.31). Need further [10] Sulistyowati E, Sulistyowati, S Rustini, R
research on black rice in anatomy and physiology Sumartini, Abdurrakhman 2009. Variasi
in order to obtain more complete information. Genetik Beberapa Spesies Kapas (Gossypium
sp.) berdasarkan Keragaman Pola Pita
References Isozim. J Littri 15(4): 174-183
[11] Sukartini 2007. Pengelompokan Aksesi
[1] Ashfaq M, Abdus SK, Sultan HK, Rashid A Pisang Menggunakan Karakter Morfologi
2012. Association of Various Morphological IPGRI. J. Hort 17(1): 26-33.
Traits with Yield and Genetic Divergence in
Rice (Oryza sativa). Int. J. Agric. Biol. 14(1): [12] Suskendriyati H, A Wijayanti, N Hidayah, D
55-62 Cahyuningdari 2000. Studi Morfologi dan
Hubungan Kekerabatan Varietas Salak
[2] Bioversity International, Irri, Warda 2007. Pondoh (Salacca zalaca (Gaert.) Voss.) di
Descriptors For Wild And Cultivated Rice Dataran Tinggi Sleman. Biodiversitas 1(2):
(Oryza Spp.). Itali: Bioversity International, 59-64.
Filipina: International Rice Research
Institute, Benin: Warda (Africa Rice Centre). [13] Tehrim S, Pervaiz ZH, Mirza MY, Rabbani
MA, Masood MS 2012. Assessment Of
[3] Das Ss, Sudarsono, Hmhb Djoefrie, Wek Phenotypic Variability In Rice (Oryza sativa
Yudiwanti 2012. Keragaman Spesies Pala L.) Cultivars Using Multivariate Analysis.
(Myristica Spp.) Maluku Utara Berdasarkan Pak. J. Bot. 44(3): 999-1006.
Penanda Morfologi Dan Agronomi. J Littri
18(1): 1-9.
Page | 271
PROCEEDINGS
[14] Wijayanto T, Dirvamenia B, La E 2013. [15] Zafar N, Aziz S, Masood S 2004. Phenotypic
Hubungan Kekerabatan Aksesi Pisang Kepok Divergence for Agro-Morphological Traits
(Musa Paradisiaca Formatypica) Di among Landrace Genotypes of Rice (Oryza
Kabupaten Muna Berdasarkan Karakter sativaL.) from Pakistan. Int. J. Agric. Biol
Morfologi Dan Penanda RApd. J Agroteknos 6(2): 335-339
3(3): 16-31
Page | 272
PROCEEDINGS
EXPLORATION OF POTENTIAL MARINE RED MACROALGAE

FROM THE SOUTHERN COAST OF JAVA ISLAND, GUNUNG
KIDUL REGENCY, YOGYAKARTA, INDONESIA AS SOURCE OF
LECTINS
Choiroel Anam1, Danar Praseptiangga1, Ahmad Yunus2,

Ekowati Chasanah3, Nurrahmi Dewi Fajarningsih3
1)
Department ofFood Science and Technology, Sebelas Maret University (UNS) Surakarta
Jl. Ir. Sutami 36 A Kentingan Surakarta 57126, Indonesia
2)
Department ofAgrotechnology, Sebelas Maret University (UNS) Surakarta
Jl. Ir. Sutami 36 A Kentingan Surakarta 57126, Indonesia
3)
Research and Development Center for Marine and Fisheries Product Competitiveness and
Biotechnology, Ministry of Marine Affairs and Fisheries, Republic of Indonesia
Jl. K.S. Tubun Petamburan VI Jakarta 10260, Indonesia
Email : praseptiangga_de@yahoo.com
Dikchoir@yahoo.com
Abstract
Lectins (hemagglutinins) are widely present in the organism ranging from viruses to humans. They may
be regarded as protein interpreters of the ―sugar code‖ and represent convenient biochemical tools to
probe protein-carbohydrate interactions and play some important roles as recognition molecules in cell-
cell or cell-matrix interactions. Unlike antibodies, lectins showed diversity in the molecular structure and
carbohydrate-binding specificity depends on the organism's origin. This study aimed to determine the
hemagglutination activity of crude lectins fractions from various species of marine red macroalgae from
the southern coast of Gunungkidul Regency using rabbit and human erythrocytes.
Thirteen samples of Rhodophyta of which consisted of Eucheuma sp, Acanthopora muscoides, Palmaria
palmata, Eucheuma arnoldii, Gelidiela acerosa, Jania longifurca, Hypnea Spinella, Hypnea pannosa,
Halosaccion glandiforme, Gelidium robustum, Liagora farinose, Digenea simplex, and Ahnfeltiopsis
linearis were used. Results from hemagglutination activity assay with rabbit erythrocytes showed that ten
species had positive hemagglutination activity on native and trypsin-treated rabbit erythrocytes, except
Gelidiela acerosa, Gelidium robustum, and Digenea simplex. Further, hemagglutination activity assay
using human erythrocytes showed that trypsin-treated human erythrocytes exhibited higher activity than
the native one. These findings indicate that marine red macroalgae from Gunung Kidul coast are good
sources of lectins.
Keywords:Lectins, Hemagglutination activity, Marine red macroalgae, Gunung Kidul coast
1. Introduction antibacterial, antifungal, antiviral, and

antiinflammatory. The ability of seaweed is to
Algae or seaweed is one of Indonesia‘s produce secondary metabolites which are useful as
biological resources. The use of seaweed as food antimicrobial, such as volatile phenols, terpene,
has not yet provided advantages due to its low steroid, phlorotanin, lipid, and antiinflammatory
price. Meanwhile, seaweed particularly algae have compunds. Unlike green algae and brown algae,
some bioactive compounds which are very red algae are known to produce halogen containing
potential to use both in functionial food use and in metabolites particularly bromine dan iodine
pharmacy. Some studies has shown that (Oumaskur et al, 2013).
macroalgae have biological activity as
Page | 273
PROCEEDINGS
One of the uses of bioactive found in red materials for this research. Each species of red
algae to increase values of seaweeds is lectins algae found in Gunungkidul coast, Yogyakarta,
filtration. The word ‗lectin‘ is derived from Latin which was previously keptat temperature of -20oC
legere. According to Ainouz and Sampaio (1991), was melted, and then was weighed to 50 gram.
agglutinin or lectins are carbohidrate-binding Size reduction were done by cutting samples
proteins or glycoproteins. The chemical which had been prepared to grind and to add
compounds of lectins are very useful for many nitrogen solution aimed at turning samples into
studies in biology (immunology, cell biology, powder and homogen rapidly.
membrane structures, and cancer). Lectins can be The extraction proces was completed by
found in organism widely, from virus to human. adding 20 mM PhosphateBuffer solution
Unlike antibody, lectins show varies of molecular containing0,85% NaCl and 0,02% NaN3 (PBS, pH
structures and carbohydrate-binding specificities 7.0) into the powder samples with ratio of 1:2
depending on their organisms of origin (Hung et (b/v). The samples and buffer PBS were mixed by
al. 2009). But, lectins found in algae have several using mixer for 8 hours at 4oC. Next, the mixture
advantages compared to other lectins of higher was centrifuged (8.000 rpm) at 4oC for 30 minutes
plants. Some letins of algae have lower molecular and the solid ammonium sulfate which had been
weight compared to most lectins found in higher grinded was added into supernatan obtained to get
plants, monomer shape and stable over heat. the last concentrate of saturation of 75%. After
Besides, its activity of hemagglutination does not that, the mixture was kept for 10 hours at 4 oC and
depend on divalent cations. Generally, algae was centrifuged once more (8.000 rpm) at 4 oC for
lectins do not have affinity for simple glucose but 30 minutes. The presipitat obtained from the
specifically over complex oligosacharrides, process was dissolved by adding buffer as little as
commonly glycoprotein particularly found in possible and by dialysis using PBS. After
animals(Hori et al. 1990; Rogers dan Hori 1993). completed by dialysis procedure, the innerfraction
The research study on seaweed have been was centrifuged afterwards (10.000 rpm) at 4oC for
conducted in many countries. As quoted by Hung 30 minutes and the supernatant obtained from this
et al (2012), among them are England (Blunden et process was called as crude lectins fraction or
al. 1975, 1978; Rogers et al, 1980), Japan (Hori et. known as salting-outfraction. This salting-outwas
al. 1988), Spain (Fabregas et al, 1985, 1992), The then kept in the fridge at-20oC after being used to
United States of America (Chiles and Bird, 1989; analyze further for its hemagglutination activities
Bird et al. 1993), Brazil (Ainouz dan Sampaio, and protein contens..
1991; Ainouz et al. 1992; Freitaz et al. 1997), Trypsin-treated Erythrocytes(TRBC)were
Pakistan (Alam dan Usmanghani, 1994), China prepared from human blood group (A, B, and O),
(Zheng dan Lu, 2002), Vietnam (Hung et al. and from rabbit taken from Development and
2009), India (Kumar dan Barros, 2010) and the Research Department Laboratorium of Product
Antarctic water (Souza et al. 2010). Researches Management and Marine Biotechnology and
have been conducted toward more than 250 Fishery, The Ministry of Marine Affairs and
species of algae have so far been reported to Fisheries, Indonesia. The erythrocytes were
contain hemagglutinins, but the number of these washed three times with 50 volume salineto give
lectins purified and characterized is still small in 2% (v/v) suspension from nativeerythrocyte. Then,
comparison to lectins from higher plants. 0,5% (w/v) trypsin and saline(1/10 volumes) were
Indonesia is located in the tropical zone added into 2% suspension from nativeerythrocyte
with a long coastline of about 95.181 Km which is and the mixture was then incubated at 37oC for 60
rich of biodiversity (Ministry of marine fisheries, minutes. Next, the mixture was washed four times
2011). However, there are not many researches yet with salineand 2% suspension was prepared in the
conducted in Indonesia tropical waters. One of saline.
waters in Indonesia which is rich of its seaweed Hemagglutination activity assay was
biodiversity is the coast in Yogyakarta. determined using Hori et al methodes(1987). This
Gunungkidul coast, Yogyakarta has many beach hemagglutination activity was coated on 96-well
with different species makro algae. Thus, the microtiter V-plateby using TRBC and was
researcher conducted this research about bioactive repeated for three times. A series of two-fold
lectins filtration of red algae found in Gunungkidul dilutions (25 µl for each) were completed from the
coast, Yogyakarta. analyzed samples and was prepared in the saline,
previously. After that, 25 µl TRBC was added for
2. Materials and Method each. The microtiter platewas then shaken gently
and then was incubated at room temperature for an
Varieties of red algae taken from
hour. Hemagglutinin could be observed
Gunungkidul coast were used as the main
Page | 274
PROCEEDINGS
macroscopically and was marked as positive when 3. Results and Discussion

there were more than 50% of TRBC was
agglutinated. This hemagglutination activity was Extraction of crude fraction lectins
stated as titer, meaning the opposite of the highest
Red algae samples were taken from
two-fold dilutions which showed positive
Gunungkidul coast including 6 beaches, namely
hemagglutinin.
Krakal beach, Slili beach, Watulawang beach,
The protein content was determined by
Siung beach, Pok Tunggal beach, and Wedi Ombo
applying BCA Protein Assay Methods (Thermo
beach. The samples were identified their species.
ScientificTM PierceTM). This method applied
A set of 28 red algae species were obtained from
BovineSerumAlbumin(BSA) as a standard and
the identification result. However, in this work,the
was completed two times repetition.
crude fraction lectins extraction only used 13
species of macroalgae were obtained weighing up
to 50 grams. Table 1 shows the rendemen crude
fraction lectins of red algae.
Table 1. Crude Fraction Lectins Extraction
No The names of algae Strating Lectin Crude Total Hemagglutination Lectin Crude
species (gram) Fraction (ml) activity (THA) Fraction (mg)
1 Eucheuma sp 50 8 64 9.741
2 Acanthopora muscoides 50 4.5 9 10.026
3 Palmaria palmate 50 9 288 9.612
4 Eucheuma arnoldii 50 4 8192 4.552
5 Gelidiela acerosa 50 3 0 2.778
6 Jania longifurca 25 6.5 104 10.482
7 Hypnea spinella 50 8.5 1088 15.032
8 Hypnea pannosa 50 7.5 60 6.388
9 Halosaccion glandiforme 50 4 8192 4.603
10 Gelidium robustum 50 5.5 0 8.491
11 Liagora farinose 50 2.5 4096 4.358
12 Digenea simplex 50 8.5 0 19.962
13 Ahnfeltiopsis linearis 50 5 655360 11.145
The rendemen of crude fraction lectins Crude fraction lectins protein value
which were obtained was different between one
species and another. The highest rendemen was According to Table 2, the highest protein
found in Palmaria palmata for 9 ml, whereas the value was resulted in Digenea simplex species for
lowest rendement was found in Liagora farinosa 2.348,472 µg/ml. Meanwhile, the lowest protein
species for 2.5 ml. value was found in Hypnea pannosa species for
Total Hemagglutination Activity(THA) 851,8056 µg/ml. Lectins are specific carbohydrate-
was estimated by multiplying the milliliter binding proteins. This means that the primary
rendemen obtained from each species with rabbit structure of lectins is protein. The protein value
trypsin-treatederythrocytes. The THA was testing was done to illustrate that there was protein
necessary to estimate to compare with purification in red algae species crude fraction, and therefore
process. The highest THA was found in there were also bioactive lectins compounds. But,
Ahnfeltiopsis linearis specieswhich was655.360. the tested protein value in this research was not
THA of Ahnfeltiopsis linearis was the highest specific lectins. When the protein value was
since it showed the highest hemagglutination connected to lectins rendemen, then the highest
activityfor 217. protein value would not provide crude fraction
Cude fraction Lectins was also in lectins rendemen. This is because the protein tested
milligram unit (mg). The milligram unit was was total protein value, and therefore lectins were
counted by multiplying milliliter (ml) obtained not the only one identified as protein in the crude
from crude fraction lectins and its protein value. lectin.
According to the data in Table 3, thespecies having
the biggest rendement in milligram unit was
Dygenea simplex which was 19,962 milligrams.
Page | 275
PROCEEDINGS
Table 2. Crude Fraction Lectins Value.
No The names ofalgae species Protein Value (µg/ml)

1 Eucheumasp 1.217,639
2 Acanthoporamuscoides 2.228,056
3 Palmariapalmata 1.068,1
4 Eucheumaarnoldii 1.138,056
5 Gelidielaacerosa 926,15
6 Janialongifurca 1.612,7
7 Hypneaspinella 1.768,55
8 Hypneapannosa 851,8056
9 Halosaccionglandiforme 1.150,764
10 Gelidiumrobustum 1.543,95
11 Liagorafarinosa 1.743,5
12 Digenea simplex 2.348,472
13 Ahnfeltiopsislinearis 2.229,097
The average yield analysis of the protein Hemagglutination activitytesting on

content of the red macroalgae from Gunung Kidul rabbit Erythrocytes
coast, has a higher protein content than red
macroalga from Manado coast as submitted by Sharon and Lis (2004)stated that by the
Khairunnisa (2015), for Galaxaura rugosa 488.25 1960s it became apparent that such proteins also
µg/ml, Hydropuntia fragillisima 457.45 µg/ml agglutinate other types of cells, and that many of
and Amphiroa edulis 525,30 µg/ml . There are them are sugar-specific. These cell-agglutinating
many factors which can influence the of algae, and sugar-spesific proteins have been named
such as light, season and temperature, salt content, lectins. These characteristics were used as a basic
water movement, and nutrients (Achmad dan for hemagglutinin testing. According to Ainouz
Atmadja, 1988). and Sampaio (1991)and other previous researches,
it can be concluded that lectins of algae are the
most sensitive lectins used to agglutinate rabbit
erythrocytescompared other erythrocytes.
Table 3. Hemagglutination ActivityTestingon Rabbit Erythrocytes
No The names of algae species Native Erythrocytes Trypsin Treated Erythrocytes

7 4
1 Eucheumasp 2 2
4 2
2 Acanthopora muscoides 2 2
3 6
3 Palmaria palmata 2 2
6 11
4 Eucheuma arnoldii 2 2
5 Gelidiela acerosa 0 0
4 4
6 Jania longifurca 2 2
12 7
7 Hypnea spinella 2 2
2 3
8 Hypnea pannosa 2 2
10 11
9 Halosaccion glandiforme 2 2
10 Gelidium robustum 0 0
4 14
11 Liagora farinosa 2 2
2
12 Digenea simplex 2 0
12 18
13 Ahnfeltiopsis linearis 2 2
The hemagglutination activitytesting on The highest hemagglutination activity

rabbit erythrocytes was done to native erythrocytes was found in trypsin treatederythrocytes namely
and trypsin treated erythrocytes. Tripsin enzyme is Ahnfeltiopsis linearis species up to 217. Several
proteolytic enzyme and therefore it is expected to species having very high activities including
increase the hemagglutination activity. According Eucheuma arnoldii, Halosaccion glandiforme, and
Rogers and Hori (1993), the principle effects Liagora farinosa. The erythrocytes activities
resulted from the treated proteolytic enzyme on treated with trypsin enzyme became the basic to
erythrocytes release sialoglycoprotein of the cell conduct testing stability towards temperature, pH,
surface, and therefore the negative surface which and divalent cations. Moreover, the specific
are needed is lower and easier the agglutination by inhibition testing was also done towards
lectins. carbohydrates and glycoprotein.
Page | 276
PROCEEDINGS
Hemagglutination activitytesting on inhibited by α-linked N-acetyl-D-galactosamine

human Erythrocytes and that of type O cells by the lectin of L,
tetragonolobus was best inhibited by α-linked L-
The testing on human erythrocytes was fucose. They concluded that α-N-acetyl-D-
done to ascertain antigenetic effects when applied galactosamine and α-L-fucose are the sugar
as medicine or fungsional foods. The specific determinants conferring A and O blood group
hemagglutinin blood type plays an important role specificity respectively (Sharon dan Lis,
on the early assumptions cycle of antigen 2004).According to the data in Table 4,almost all
specificity basic structure with ABO blood group species but Liagora farinosa hashemagglutination
system. In the 1950s, Walter J T Morgan and activitytowards minimum one of human blood cell.
Winifred M Watkins found that the agglutination While species Hypnea spinella has high activity in
of type A red cells by lima bean lectin was best all blood groups.
Table 4.Hemagglutination Activity on Human Erythrocytes
No The names of erythrocytes A erythrocytes B Erythrocytes O

algaespecies Native Trypsin Native Trypsin Na tive Trypsin
Treated Treated Treated
4 8 5 1 4 10
1 Eucheuma sp 2 2 2 2 2 2
2 4 3 2 7
2 Acanthopora 2 2 0 2 2 2
muscoides
2 5 2 4 1 4
3 Palmaria palmata 2 2 2 2 2 2
1 2 2 2
4 Eucheuma arnoldii 2 2 2 0 2 0
3 3 8
5 Gelidiela acerosa 0 2 0 2 0 2
2 5 2 5 3 6
6 Jania longifurca 2 2 2 2 2 2
7 12 8 11 8 11
7 Hypnea spinella 2 2 2 2 2 2
4 9 5 7 6 8
8 Hypnea pannosa 2 2 2 2 2 2
7 11 3 10 8 11
9 Halosaccion 2 2 2 2 2 2
glandiforme
1 2
10 Gelidium robustum 2 0 0 2 0 0
11 Liagora farinosa 0 0 0 0 0 0
3 6 3 1 3
12 Digenea simplex 2 2 2 2 0 2
2 9 2 8 1 8
13 Ahnfeltiopsis linearis 2 2 2 2 2 2
4. Conclusion References
a. There were 13 species of red algae from coast [1] Ainouz, I Lima., A H Sampaio. 1991.
of Gunung Kidul, Yogyakarta which were Screening of Brazilian Marine Algae for
extracted crude fraction of lectins, namely Hemaglutinins. Botanica Marina Volume
Eucheuma sp, Acanthopora muscoides, 34.
Palmaria palmata, Eucheuma arnoldii,
[2] Blunden, G., Rogers, D.J., Farnham, W.F.,
Gelidiella acerosa Jania longifurca, Hypnea
1975. Survey of British seaweeds for
spinella, Hypnea pannosa, Halosaccion
hemagglutinins. Lloydia. 38, 162-168.
glandiforme, Gelidium robustum, Liagora
farinose, Dygenia simplex, Anhfeltiopsis [3] Blunden, G., Rogers, D.J., Farnham, W.F.,
linearis. The highest activity was found in 1978. Hemagglutinins in British marine
Anhfettiopsis linearis species and then algae and their possible taxonomic value.
followed by Liagora farinosa. In: Irvine, D.E.G., Price, J.H. (eds), Modern
b. The high Protein levels in red algae does not approaches to the taxonomy of red and
necessarily indicate the results of brown algae, pp 21-45. Academic, London.
hemagglutination activity is high on rabbit or
[4] Chiles, T.C., Bird, K.T., 1989. A
human Eritrocyt blood groups A, B and O.
comparative study of the animal erythrocyte
c. Based on this preliminary research, some red agglutinins from marine algae. Comp.
macroalgae from coast of Gunung Kidul have Biochem. Physiol. B. 94, 107-111.
bioaktive compounds that potential as a
source of lectins
Page | 277
PROCEEDINGS
[5] Fabregas, J., Llovo, J., Muñoz, A., 1985. Vietnamese Marine Macroalgae. Journal
Hemagglutinins in red seaweeds.Bot. Mar. Applied Phycologi Volume 24.
28, 517-520
[13] The Ministry of Marine Affairs and
[6] Freitas, A.L.P., Teixeira, D.I.A., Costa, Fisheries. 2011. Kelautan dan Perikanan
F.H.F., Farias, W.R.L., Lobato, A.S.C., dalam Angka 2011. Statistical Data Centers
Sampaio, A.H., Benevides, N.M.B., 1997. and Information The Ministry of Marine
A new survey of Brazilian marine algae for Affairs and Fisheries
agglutinins. J. Appl. Phycol. 9, 495–501.
[14] Oumaskur, Khadija., NN Boujaber., S
[7] Khairunisa, 2015, Penapisan Lektin Pada Etahiri., O Assobhei. 2013. Anti-
Alga yang Diambil dari Perairan Pantai Inflammatory and Antimicrobial Activities
Manado, Fakultas Kedokteran dan Ilmu of Twenty-Three Marine Red Algae from
kesehatan, UIN Syarif Hidayatullah the Coast of Sidi Bouzid (El Jadida-
Kaklarta. . Morocco). International Journal of
Pharmacy and Pharmaceutical Sciences
[8] Hori, Kanji., H Matsuda., K Miyazawa., K
Volume 5.
Ito. 1987. A Mitogenic Agglutinin from The
Red Alga Carpopeltis Flabellata. [15] Praseptiangga, D.,Hirayama, M., Hori, K.,
Phytochemistry Volume 26 No.5. 2012.Purification, characterization, and
cDNA cloning of a novel lectin from the
[9] Hori, K., Susumu Ikegami, Keisuke
green alga, Codium barbatum. Biosci.
Miyazawa and Keiji Ito, 1988, Mitogenetic
Biotechnol. Biochem. 76:805-811.
and Antineoplastic Isoaglutinins From The
Red Alga Soleria Robusta, Phytochemistry, [16] Praseptiangga, Danar. 2013. Penapisan
Vol 27, No 7, P 2063 – 2067 Hemaglutinin dari Alga Hijau Genus
Codium (Chlorophyceae, Codiaceae).
[10] Hori, Kanji., K Miyazawa., K Ito. 1990.
Jurnal Teknologi Hasil Pertanian Volume
Some Common Properties of Lectins from
VI, No 1.
Marine Algae. Hydrobiologia Volume 204.
[17] Rogers, D J., K Hori. 1993. Marine Algal
[11] Hung, Le Dinh., T Soto., H Shibata., K
Lectin : New Development. Hydrobiologia
Hori., 2009. Biochemical Comparison of
160/261.
Lectin among Three Different Color Strains
of Red Alga Kappaphycus Alvarezii. Fish [18] Sharon, N., Lis H. 2004. Review : History
Science Volume 75. of Lectins : from Hemaglutinins to
Biological Recognition Molecules.
[12] Hung, Le Dinh., B M Ly., V T D Trang., N
Glycobiologi Volume 14 Nomor 11
T D Ngoc., L T Hoa., P T H Trinth. 2012. A
Oxford University Pers.
New Screening for Hemagglutinins from
Page | 278
PROCEEDINGS
EFECTIVITY OF SOAKING PERIOD OF ARENGA FIBER

ANDCOCONUT WATER TO GROWTH AND YIELD IN
HIDROPONIC SUBSTRATES OF TOMATO
Dwi Harjoko1), Samanhudi2), W.S. Dewi2), andB. Pujiasmanto2)

1)
Graduated Student in Sebelas Maret University, Surakarta, Indonesia
2)
Department of Agrotechnology, Faculty of Agriculture, SebelasMaret University, Surakarta, Indonesia
E-mail : dwifpuns@yahoo.com
Abstract
This study was conducted to determine the effect of soaking period of arenga fibers and the addition of
coconut water to growth and yield of tomatoe. The observations were analyzed by using the 5% F test and
if significant continued by the 5% DMRT. The experiment was conducted using a completely randomized
factorial design with two factors, factors substrate consists of 5 levels, fiber arenga without soaking (S0),
fiber soaking for 1 month (S1), fiber soaking for 2 months (S2), fiber soaking for 3 months(S3), and
substrate husk as control. The second factor is a nutrient with two levels ie. AB mix nutrient (N1), AB
mix nutrient plus 50% coconut water (N2). The results showed that treatment of arenga fiber substrate by
immersion of one month, 2 month, and 3 month not significantly influenced on all growth variable and
yield of tomato. Treatment spraying coconut water with a concentration of 50% could be low variable
root length, root volume and fresh weight of the plant. There was no interaction between the two factors
of all the observed variables.
Keywords :Tomatoes, soiless culture, arenga fiber, soaking time, coconut water
1. Introduction plant growth (Radhouani et al. 2011). Related

research is also done by Shirani et al. (2013) in his
Tomato (Lycopersicumesculentum) is one research that the quality of media greatly influence
commodity that is considered important in the the quality of the fruit, which is a good culture
world and that comes from the family Solanaceae medium containing both physical and chemical
(Arthur et al. 2015). Currently the tomatoes properties that can support a healthy fruit mainly
consumed at a higher rate in developed countries landless farming techniques in green house.
than in developing countries therefore tomatoes are Organic growing media to be an alternative media
also referred to as a luxury commodity (Sakthivel that are more promising and competitive in an
et al. 2015). Horticultural production in most organic medium. This medium allows the plant to
tropical regions are very difficult because of the be able to access the nutrients that are in a critical
high rate of infection by diseases that are stored on limit (Olle 2012). Media planted in hydroponic
the ground (Wahome et al. 2011). One effort to substrate one of them with arenga fibers.
increase the production of tomatoes kontiyu is Hydroponic farming success is simple, other
using hydroponics technology. Hydroponics be the than specified by the medium is also determined
best alternative as the cultivation of plants without by nutrition (Silvina and Syafrinal 2008). Coconut
soil that is currently commercially bnyak applied water contains growth hormones, various minerals
in western countries (Mugundhan 2011). and vitamins that are essential for plant growth
Hydroponic cultivation system, the use of (Oka 2014). Accordingly, this study aimed to find
culture media is one of the key that must be out how much influence the long soaking arenga
considered to ensure the success of this technique, fibers and the addition of organic nutrients of
the use of inappropriate media standards will limit coconut water on plant growth and yield of
the acquisition of nutrient solution that could affect tomatoes.
Page | 279
PROCEEDINGS
2. Research Methods
This study was conducted from March 2015

until January 2016 is housed in Screen House B,
Faculty of Agriculture, University of March,
Surakarta. The tools used in this research is
measuring cup, EC meter, pH meter, analytical
balance, fiber grinding machine, water drum,
polybag size 30 x 35 cm, sprayer, calipers, stakes,
and the meter. Seedlings of tomato plants
(Lycopersicum esculentum) New Sutisna F1, palm
fiber waste without soaking and that has been
Figure 1. Effect of soaking arenga fiber onplant
marinated, Substrate Husk, AB mix nutrient and
height.
coconut water.
The experiment was conducted using a
completely randomized design (CRD) factorial
with two factors, ie, factors substrate plant consists Chlorophyll content
of 5 levels ie A1: substrate husk, S0: fiber palm
without soaking, S1: fiber aren immersion 1 Measurement of physiological characters such
month, S2: fiber aren immersion 2 months, S3: as chlorophyll, is one approach to determine the
palm fiber immersion 3 months. The second factor effect of water shortages on growth and yield, and
is a nutrient with two levels ie N1: AB mix this parameter is closely related to the rate of
nutrient, N2: AB mix nutrient plus a mixture of photosynthesis (Li 2006). ANOVA results show
coconut water with a concentration of 50%. Each preferential treatment to the substrate to give effect
treatment was repeated 3 times. The data were to the variable leaf chlorophyll content, and there
tested using the F test level of 5%. If significant is no interaction between the two treatments with
then continued with Duncan Multiple level of 5%. variable leaf chlorophyll.
In figure 2 above we can know that the average
3. Results and Discussion value of chlorophyll content teringgi contained in
the substrate treatment husk that is 44.4. These
results are significantly different from the
Plant height treatment with the treatment of arenga fiber
substrate are respectively the same.Good
Data from the observations of plant height after absorption of nutrients will increase levels of
ANOVA test indicated that treatment significantly chlorophyll in the leaves. This is supported by a
affected substrate as height of tomato plants, while statement Elli et al. (2012) that the chlorophyll
nutrients are not on the variable plant height. There content decreased allegedly due to the decreasing
is no interaction between the two treatments to concentration of Mg in the leaves. According
variable plant height. Savvas (2003) perishable organic substrates will
Based on Figure 1. can be seen that on average change their physical and chemical structure, thus
the highest treatment at 10 MST is a type of rice resulting in their petukaran ion and increase in pH.
husk substrate that is equal to 120.5 cm, followed When the substrate pH rises above 6.5 a lot of
by arenga fibers were soaked for 3 months with an micro nutrient elements (Fe, Mn, Zn, Bo) insoluble
average plant height of 102 cm, and the treatment so it is difficult to be absorbed by plants. Babaein
of palm fiber without soaking, soaked 1 month, et al. (2011) stated that the application of Fe and
and 2 months did not show a significant difference. Mn can provide the highest yields leaf chlorophyll
And for all the fiber substrate arenga show the content.
difference against the control treatment. The
media's ability to hold water and provide good
aeration and drainage, if the plant does not get the
nutrients as needed will then growth will be
hampered, it will also affect the plant height.
Page | 280
PROCEEDINGS
waterwith a value of 33.1 cm. Fungi will make

arenga fiber substrate media more quickly
decaying consequently kemapuan media to support
and provide a place to grow the plants will also
decrease. Coconut Water naturally contains a
natural hormone that is among the group of
cytokines. Cytokinins can mengambat root
formation and encourage the formation of
chlorophyll (Surachman 2011).
Figure 2. Effect of soakingarenga fiber on leaf

chlorophyll content.
Length roots
For plants, the root is an important factor for
growth, without roots process of photosynthesis to
produce carbohydrates and energy will not be able
to walk (Mahendra, 2009). The treatment of the
substrate and significantly affect root length
variables, but there are two factors interaction Information :
variable treatment of the root length. In Figure 3. N1 : AB mix
shows that the length of roots in rice husk showed N2 : AB mix + Coconut Water
different results on all treatments fiber substrate
with an average value of 44.3 cm, while the lowest Figure 4. Effect of nutrients to the length of the
average on the treatment arenga fibers were soaked roots of tomato plants.
three months with a value of 20.8 cm.
Root volume
Root volume is influenced by the level of root
distribution and availability of nutrients and water.
The roots spread and supported by sufficient water
and nutrients that will increase the volume of
roots. Treatment and nutrient substrates
significantly affect the root volume variable, but
there was no interaction of both factors on the
variable root volume.
Figure 5. Shows the average root volume is
Figure 3. Effect of soakingarenga fiber to the
highest in tomatoes grown on the substrate rice
length of the roots of tomato plants.
husk with a mean value of 55 ml followed by
crops planted in arenga fiber soaked for 3 months
by 20.8 ml. arenga trunk fiber has macropores that
In Figure 3. that the arenga fiber by soaking 0
much so nutrients are sprayed more who escaped
months and 1 month is easy to release nutrients,
from being held by the substrate even nutrients
therefore the plant roots grow longer to maintain
provided many pooled on the basis of polybags, it
its vitality in supplying nutrients. This is supported
is what causes the damage plant roots and rot due
by statements Sitompul and Guritno (1995) that
to waterlogged. Lutfyrachman et al. (2013) stated
the root of the relationship with the headline
that the tomato plants need plenty of water, but not
initially more emphasized in terms of
in excessive amounts, the roots of tomato plants
morphogenetic as in view of the more roots the
are not able to function properly in the stagnant
better the yield. But the plants growing in a state of
state it can cause stunted plant growth. According
lack of water will form roots longer with lower
to Sahin et al. (2002) the amount of the pore space
yields from crops grown in enough water.
of the substrate is an important physical
Figure 4. It appears that plants without the
characteristics that affects the absorption of water
addition of of coconut water has a root that is
and nutrients and gas exchange in the root system.
longer than with the addition of of coconut
Page | 281
PROCEEDINGS
different to the arenga fiber substrate in a variety

of treatments with a lower value in all treatments.
Figure 5. Effect of soaking arenga fiber to the

volume of roots of tomato plants.
Figure 7. Effect of soaking arenga fiber to dry
In Figure 6. there are differences in nutrient weight of tomato plants.
treatment significantly against the root volume.
Plants on the addition of of coconut water On arenga fiber media has a high pH value in
treatment produces root volume lower than compare husk charcoal. According to Jones (2008)
without the addition of of coconut water. Spraying in Lutfyrachman et al. (2013) tomato plants grow
of coconut water which falls in the media well in soil with a pH of 5.5 to 6.8. At the optimal
especially arenga fiber will quickly grow fungus. pH, essential nutrients will be available in the
According to Saraswati (2008) fungi are in every optimal amount. Reduced plant height, leaf formed
place, especially on the ground in different shapes, into a little more so the formation of carbohydrates
sizes, and colors. Generally have a better ability assimilation of plants has decreased, which will
than bacteria in breaking down plant debris cause a decrease in plant fresh weight and dry
(hemicellulose, cellulose and lignin). weight of plants.
Accumulation of tomato fruit weight
Weight of the fruit is a variable important
observation because it is the result of fotosintat
storage in the form of fruit and an indicator to
determine how the products harvested fruit
produced by plants. The results of ANOVA
Information : showed that no interaction between the media and
N1 : AB mix the nutrients provided. Figure 8. The above shows
N2 : AB mix + Coconut Water that the arenga fiber medium have the highest
average with 388.0 g value and the lowest yield on
Figure 6. Effect of nutrients to the volumeof the media's treatment arenga fiber soaked in 1
roots of tomato plants. month with a value of 155.0 g. In the media-
soaked arenga fiber 3 months has a weight
accumulation of high fruit each harvest due to the
Plant dry weight treatment of the always increas.
The measurement of total biomass is a
parameter that is best used as an indicator of plant
growth, the principal reason in using total plant
biomass is that the plant dry matter is seen as the
manifestation of all processes and events occurring
in plant growth. Therefore this parameter can be
used as a measure of global plant growth with all
the events that happened (Sitompul and Guritno
1995). Results of analysis of variance is known
that there is no interaction between the substrate
with nutrients on plant dry weight variable. In Figure 8. Effect of soaking arenga fiber to the
figure 7 above can be seen that the highest rates accumulation of weightfruit of
are in treatment with a rice husk substrate with a tomato plants.
mean value of 62.68 g, the value is significantly
Page | 282
PROCEEDINGS
In the rice husk yields are lower because chlorophyll fluorescence, leaf chlorophyll
fotosintat results more widely used for vegetative content and sunflower nutrient uptake in
growth. The degree of acidity greatly affects the Sistan region. Afr J Agric Res 6(15): 3526-
formation and quality of the fruit. Nemr (2012) 3531.DOI: 10.5897/AJAR10.1142
states that concentrations of K. in media can
[3] Elly P, Irfan DP, Diah R, Retno PS. 2012.
increase the yield and quality of tomatoes. arenga
Lajufotosintesisdankandunganklorofilkedelai
fiber substrate having a pH higher than the husk so
pada media
that the formation of optimal fruit for nutrients
tanammasamdenganpemberiangaramalumuni
needed for the formation of fruit available.
um. Agrotop 2(1): 17-24. URL : http://
download. Portal garuda.org /article.php
4. Conclusion and Suggestion ?article= 72052&val=924
Conclusion [4] Guritno B, Sitompul SM. 1995. Analisis

Pertumbuhan Tanaman. Yogyakarta: Gadjah
Based on the research results can be Mada University Press.
summarized as follows: [5] Li R, Guo P, Baum M, Grando S, Ceccareli
1. Treatment fiber substrate without soaking S. 2006. Evaluation of chlorophyll content
arenga, arenga fibers were soaked for 1 and flouresence parameters as indicators of
month, 2 months and 3 months did not drought tolerance in barley. AgricSci China 5
significantly affect growth and yield variables (10): 751-757. DOI: 10.1016/S1671-
observation tomatoes. 2927(06)60120-X
2. Treatment spraying of coconut water with a
concentration of 50% can significantly lower [6] Lutfyrachman H, Anas DS. 2013.
the variable root length, root volume and Optimasidosispupukanorganikdanpupukkand
fresh weight the plant. angayampadabudidayatomathibrida
3. There is no interaction factor soaking fiber (Lycopersiconesculentum Mill). BulAgrohorti
substrate arenga and coconut water spraying 1(1) : 119-126. URL: http://
against all the variables of growth and yield agrohort.ipb.ac.id/journal/index.php/agh/artic
of tomatoes. le/pdf
[7] Mahendra F. 2009.
Suggestion SistemAgroforetridanAplikasinya.
Yogyakarta :GrahaIlmu.
The advice given in this study is the use arenga
[8] Mugundhan M R, Soundaria M, Maheswari
fiber substrate should be mixed with other
V, Santhakumari P, Gopal V. 2011.
substrates, especially inorganic media that has a
―Hydroponics‖- a novel alternative for
mass that is heavier in order to support the
geoponic cultivation of medicinal plants and
establishment of the plant grow and have good
food crops. Intl J Pharm and Bio Sci 2 (2)
aeration and drainage when both substrates
.URL :http:// ijpbs. net/ volume2
combined. That is because if the arenga fiber used
/issue2/pharma/38.pdf
as a growing medium without the mixture of other
media, nutrients provided will quickly passes so [9] Nemr M, El-Baky A, Salman S, Tohami W.
that the nutritional needs of plants be lacking and 2012. Effect of different potassium levels on
the substrate is also less able to support the the growth, yield and quality of tomato
establishment of the plant grow. grown in sand-ponicculture .Aust J Basic and
App Sci 6(3) :779-784. URL: http: //
References ajbasweb. com /old/ ajbas /2012 /March/779-
784.pdf
[1] Arthur E, Oduro I, Kumah P. 2015. Postharvest
[10] Oka DN. 2014. Coconut water medium
quality response of tomato
increases the germination power of cucumber
(Lycopersiconesculentum, Mill) fruits to
(Cucumis sativus L) seed and the
different concentrations of calcium chloride
implementation in dormancy practicum.
at different dip- times. Am J Food Nutr 5 (1 ):
IJSRE 2(6):1019-1028. URL:http: //ijsae.in/
1-8. DOI: 10.5251/ajfn.2015.5.1.1.8
ijsaeems/ index.php /ijsae /article /view/
[2] Babaein M, Issa P, Abolfazl T, Yasser E, 230/179
Hossein G. 2011. Effect of water stress and
micronutrients (Fe, Zn and Mn) on
Page | 283
PROCEEDINGS
[11] Olle M, Ngouajio M, Siomos A. 2012. [17] Shirani M, Mohammadi-Ghehsareh A,

Vegetable quality and productivity as Manoukyan R. 2013. The effect of date
influenced by growing medium. J Agric vol palm wastes as a culture media on some
99 (4) : a review. URL : http: //www. lzi. lt/ nutrient element of tomato fruit. Agric
tomai /99% 284%29 tomas/ 4 tomasst r9 . pdf Forest J 59(1):73-84. URL: http: //www
.sjournals .com/ index.
[12] Radhouani A, Bekkay ME, Ferchichi A. 2011.
php/AA/article/view/467
Effect of substrate on vegetative growth,
quantitative and qualitative production of [18] Silviana F, Syafrinal. 2008.
muskmelon (Cucumismelo) conducted in Penggunaanberbagai medium
soilless culture. Afr J Agric Res 6(3) : 578- tanamdankonsentrasipupuk organic
585. DOI :10.5897/AJAR10.124 cairpadapertumbuhandanproduksimentimun
jepangsecarahidroponik. J Sagu7(1):7-
[13] Sahin U, Anapali O, Ercisli S. 2002. Physico-
chemical and physical properties of some 12.URL:Error! Hyperlink reference
susbtrates used in holticultures. not valid.
Gartenbauwissenschaft67 : 55-60. DOI [19] Surachman D. 2011. Teknikpemanfaatan
:10.17660/ActaHortic.2004.648.21 air kelapauntukperbanyakannilamsecara in
[14] Sakhivel S, Magnigandan V. 2011. Tissue vitro. BuletinTeknikPertanian (16) :31-33.
culture studies in tomatto (Lycopersicon URL : http: //pustaka .litbang. pertanian.
esculantum, Mill) from cotyledonary leaf go.id /publikasi /bt 16 1118.pdf
explants. Intl J Chem and Pharm 2 (3). URL : [20] Wahome PK, Oseni TO, Michael T,
http:/ /www. ijcps. com/ files/ vol2issue Masarieambi, Shongwe VD. 2011. Effects
3/5.pdf of different hydroponics systems and
[15] Saraswati, Rasti E, Santosa, Yuniarti E. 2008. growing media on the vegetative growth,
Organismeperombakbahan organik.URL: yield and cut flower quality of gypsophila
(Gypsophila paniculata L.). World J Agric
Error! Hyperlink reference not
Sci 7(6): 692-698.URL: Error! Hyperlink
valid..Diaksestanggal 1 Juni 2016
reference not valid.
[16] Savvas D. 2013. Hydroponics : A modern
technology supporting the application of
integrated crop management in greenhouse. J
Food Agric Environ 1(1): 80-86.URL:
www.world-food.net.
Page | 284
PROCEEDINGS
MULTIPLICATIONOF CURCUMA XANTHORRHIZA ROXB. IN

VITRO
Dyah Utami1), Samanhudi1), Sumijati 1)

1)
Department of Agrotechnology, Faculty of Agriculture, Sebelas Maret University in Surakarta
Biofarmaka Research Group, Faculty of Agriculture, Sebelas Maret University Ir. Sutami Street 36A,
Surakarta 57126 Indonesia
Contact author: dyah.utami@student.uns.ac.id
Abstract
This research aims to obtain the combination of BAP and NAA concentration which give the best effect
on Curcuma xanthorrhiza growth in vitro. The research was conducted at the Plant Fisiology and
Biotechnology Laboratory Faculty of Agriculture Sebelas Maret University from March 2015 to March
2016. The completely randomized design with two factorials (BAP and NAA) was used. The observed
parameters include time of shoot growing, shoot height, shoot number, time of root growing, root length,
root number, time of leaf growing, leaf color, and leaf number. The result showed that adding BAP 2 ppm
and NAA 1 ppm can produce highest shoot average 3 shoot than adding BAP 6 ppm and NAA 1,5 ppm
can produce root average 61 primary roots. Adding NAA significantly can increase root length.
Keywords : Curcuma xanthorrhiza, Multiplication, BAP, NAA
1. Introduction both growth regulators is to stimulate the growth

of shoots and roots.
Increasing the number of people very rapidly This study aims to obtain a concentration of
cause some problems. one of which is the field of BAP and NAA is right in increasing the in vitro
health. Health care can‘t be separated by the multiplication of Curcuma xanthorrhiza are
availability of medicines. One drug raw materials appropriate propagation method for the supply of
is Curcuma xanthorrhiza. Curcuma xanthorrhiza seeds of Curcuma xanthorrhiza quickly. This study
contains many benefits, one of which is used as a is expected to provide benefits in the form of
herbal medicine liver disease, diarrhea, dysentery, knowledge for businesses in the supply of seeds of
hemorrhoids and others. Curcuma xanthorrhiza so that it can provide seeds
Planting material for the propagation of rapidly.
Curcuma xanthorrhiza are rhizomes. However, the
use of the rhizome has problems include reduced 2. Methods
supply of Curcuma xanthorrhiza in the market. In
addition, the Curcuma xanthorrhiza rhizome are This research was conducted in Plant
dormant during the dry season so it needs special Fisiology and Biotechnology Laboratory, Faculty
handling. Therefore, the need for provision of of Agriculture, Sebelas Maret University. This
seeds that are not derived from the rhizome. One research used Completely Randomized Design
way quickly seedlings through tissue culture. (CRD) with two factor. First factor is BAP
Tissue culture is a technique to grow the cells, concentration with four taraf: 0 ppm (control), 2
tissues, organs of plants in the medium aseptically. ppm (B1), 4 ppm (B2), 6 ppm (B3). Second factor
Plant propagation through tissue culture needs to is NAA concentration with four taraf: 0 ppm
be accelerated using some plant growth regulators (control), 0.5 ppm (N1), 1 ppm (N2), 6 ppm (N3)
for the results according to our wishes. Growth so have control and 15 combination, each
regulator used is Benzyl Amino Purine (BAP) and combination repeated three times.
Naphthalene Acetic Acid (NAA). The function of The management of the nursery research
include Curcuma xanthorrhiza, washing bottle
Page | 285
PROCEEDINGS
culture, making stock solution and Murashige and 3. Results and Discussions
Skoog (MS), sterilization and the explants, then
planting explants in MS medium. Planting explants Time of emerge shoot
performed in Laminar Air Flow (LAF).
Maintenance is done by spraying alcohol every Time emerging shoots is very important in
three days to minimize contamination. Curcuma tissue culture propagation of plants because it can
xanthorrhiza plantlets harvesting is done after 12 accelerate quickly shoot multiplication. The
weeks after planting. addition of BAP and NAA in the media didn‘t
Variables include the observation are time significantly affect the average time to emerge
shoot emerge,number of shoot, shoots lenght, time shoots of Curcuma xanthorrhiza.
roots emerge, number of roots, root length, time Addition of BAP 2 ppm and NAA 0,5 ppm
leave emerge, leaf number, and leaf color. Data can speed up emergence of shoots with an average
normality was tested and subsequently analyzed by of 5.7 DAP (Figure 1). Adding NAA 1.5 ppm
F test level 5%. If there is a treatment which shows without BAP in the culture medium can slow
the real effect then followed Duncan's Multiple down time is 16,3 DAP shoots appear. This
Range Test (DMRT) level of 5%. indicates that adding of BAP 2 ppm and 0.5 ppm
NAA can be an alternative to speed up the
emergence of shoots. Cytokinin namely to increase
shoots induction, auxins to stimulate root growth
[1]. The combination of BAP and auksin (IAA and
NAA) showed sinergys effect. Concentration of
BAP higher number and elongation of shoots [2].
Figure 1. Effect of BAP and NAA to time of emerge shoots of Curcuma xanthorrhiza in vitro.
Number of shoot highest shoots are 3 buds. It is suspected that the

concentration of cytokinin and auxin will deliver a
The number of shoots is an indicator that synergistic relationship. These results supported
affects the speed of explants to grow and develop. the research, lower concentrations of NAA in
The addition of BAP and NAA singly or in combination with BA can improve shoots
combination did not significantly affect the multiplication of Curcuma amada[3]. Increasing
number of shoots. NAA concentration higher than 1 mg/l caan press
Figure 2 showed that the addition of BAP 2 multiplication rate but depend on BAP
ppm and NAA 1 ppm in combination produced the concentration [4].
Page | 286
PROCEEDINGS
Figure 2. Effect of BAP and NAA to number of shoot of Curcuma xanthorrhiza in vitro.
Shoot length (Table 1). The addition of 1.5 ppm NAA is able to
produce the highest shoot height with an average
Shoot length is one indicator of growth as of 24.767 cm. The addition of lower NAA
explants response to the addition of BAP and NAA concentrations can produce shoots a lower high.
in the media. Results of analysis of variance This is presumably due to the addition of 1.5 ppm
showed that the addition of NAA significantly NAA is an appropriate concentration for the
affected the shoot height of Curcuma xanthorrhiza elongation of shoots. Based on the research, high
plantlets. concentrations of NAA were effective for the
Addition of 0.5 and 1 ppm NAA is not elongation of shoots [5].
significantly different from the controls, but
significantly different from the NAA 1.5 ppm
Table1. Effect of BAP and NAA shoot length
NAA concentration (ppm) Shoot length (cm)

0 18.517 a
0.5 20.392 a
1 20.650 a
1.5 24.767 b
Note: Number which followed by same character are not different based on DMRT 5%; ppm (part per
million).
Time of emerge root in combination can slow time of the emergence of

Curcuma xanthorrhiza root in vitro is 8.7 days. It is
Explants have formed the roots will be able suspected BAP concentration greater than NAA
to grow and develop as it can absorb water and that can inhibit root growth. Addition to root
nutrients to the fullest. The addition of BAP and growth is inhibited by high concentrations of
NAA in the media did not significantly affect the cytokines but also occur due to inhibition of the
time ofemerge roots. formation of ethylene. Auxin with lower
Treatment of BAP 2 ppm to NAA 0.5 ppm concentrations more positively in an attempt to
and 1.5 ppm (Figure 3) can be said to speed up the avoid the occurrence of root initiation [6].
emergence of the root which is an average of 4.7
DAP. The addition of 6 ppm BAP and NAA 1 ppm
Page | 287
PROCEEDINGS
Figure3. Effect of BAP and NAA to time of emerge root.
Number of roots Root length

The more the number of roots, the more The longer the roots of plantlets, the greater
nutrients are absorbed so the explants growth will the scope for absorbing water and nutrients from
be more rapid. Results of analysis of variance the media. F-test level 5% showed that the NAA
showed that the BAP and NAA did not significantly affect root length plantlets.
significantly affect the number of root Curcuma Based on Table 2, adding 0.5 ppm NAA not
xanthorrhiza plantlets. significantly different from controls but
significantly different with the addition of NAA 1
Figure 4 shows that the addition of BAP 6 and 1.5 ppm. This means that the higher the
ppm and 1.5 ppm NAA produce the highest concentration of NAA is added it will be the length
number of roots is 61 pieces. Treatment of 6 ppm of roots produced. However, at certain
BAP without NAA can only produce an average of concentrations can inhibit root growth. This is
8.3 roots of fruit. It is suspected that the higher the supported by other research found that higher
concentration of BAP which will inhibit root concentrations of NAA is able to inhibit the
formation so that the roots are produced less. High induction and extension of roots [9].
ratio of auxin to cytokinin it will be profitable in
the formation of roots [8].
Page | 288
PROCEEDINGS
Figure4. Effect of BAP and NAA to number of roots.
Table2. Effect of NAA to root length
Concentration of NAA (ppm) Root Lenght (cm)

0 4.808 a
0.5 5.558 a
1 7.267 b
1.5 7.642 b
Note: Number which followed by same character are not different based on DMRT 5%
; ppm (part per million).
Number of leaves Based on the Duncan test level 5% (Table 3),

adding NAA 1 ppm and 1.5 ppm significantly
The number of leaves is often used as a different with controls. The addition of 1,5 ppm
benchmark the plant's ability to make their own NAA is not significantly different from the NAA 1
food through photosynthesis. Results of analysis of ppm. It is thought to 1-1.5 ppm NAA is right
variance showed that the addition of NAA concentration. Addition of BAP 5 mg/l produce
significantly affect the number of leaves formed on leaves in large quantities while NAA 1.5 mg/l also
Curcuma xanthorrhiza in vitro. produce leaves in large quantities [10].
Table3. Effect of NAA to number of leaves

NAA concentration (ppm) Number of leaves
0 2.67 a
0.5 3.75 ab
1 4.33 b
1.5 4.75 b
Note: Number which followed by same character are not different based on DMRT 5%; ppm
(part per million).
Page | 289
PROCEEDINGS
4. Conclusion [5] Yusuf NA, Annuar MMS, Khalid N 2011.

Rapid micropropagation of Boesenbergia
Based on the description above can be rotunda (L.) Mansf. Kulturfl. (a valuable
concluded that adding BAP 2 ppm and 1 ppm medicinal plant) from shoot bud explants.
NAA is able to produce shoots with the highest African Journal of Biotechnology
average is third with an average height of 18.2 cm 10(7):1194-1199
shoots. Then, adding BAP 6 ppm and 1.5 ppm
[6] Parvin MS, Haque ME, Akhter F,
NAA capable to producing roots with the highest
Moniruzzaman, Khaldun ABM 2009. Effect
average amount is 61 pieces with an average
of different levels of NAA on in vitro growth
length of 6.9 cm and a root emerge 4 days.The
and development of shoots of dendrobium
addition of various concentrations of NAA in the
orchid. Bangladesh J. Agril. Res. 34(3) :
media can significantly increase the length of
411-416, ISSN 0258-7122
roots.
[7] Karjadi AK, Buchori A 2007. Effect of NAA
Acknowledgements and BAP in onion meristem tissue growth on
B5 medium. J. Hort. 17(3):217-223
This study was funded by INSINAS RISTEK [8] Raihana R, Faridah QZ, Julia AA,
2014-2015 Abdelmageed AHA, Kadir MA 2011. In vitro
culture of Curcuma mangga from rhizhome
References bud. Jurnal of med pl. res. 5(28):6418-6422.
DOI: 10.5897/JMPR11.673
[1] Ngumuo M, Mneney E, Ndakidemi PA 2014.
The in vitropropagation techniques for [9] Eldessoky DS, Ismail RM, Abdel-Hadi AH,
producing banana using shoot tip cultures. Abdallah NA 2011. Establishment of
Am. J. Plant Sci. 5:1614-1622. regeneration and transformation system of
sugarcane cultivar GT54-9 (C9). GM
[2] Ferdous MM, Shahinzzaman M, Faruq MO, Crops2(2): 126-134. DOI:
Paul SP, Azad MAK, Amin MN 2012. in 10.4161/gmcr.2.2.17288.
vitro propagation of medicinal plant-mango
ginger (Curcuma mada Roxb.). International [10] Paulos M, Joshi VR, Pawar SV 2013. Effect
Journal of Biosciences (IJB) 2(11):2222-5234 of BAP dan NAA on in vitro shoot
establishment and Proliferation of Banana
[3] Nafari N, Othman RY, Khalid N 2011. Effect (Musa paradisiaca) cv. Grand naine.
of Benzylaminopurine (BAP) pulsing on in International Journal of Science and
vitro shoot multiplication of Musa acuminate Research (IJSR). 4(5): 318-323.
(banana) cv. Berangan. African Journal of
Biotechnology 10(3):2446-2450. ISSN 1684-
5315
Page | 290
PROCEEDINGS
COCONUT WATER AND BANANA EXTRACTS USED FOR

MULTIPLICATION SHOOTS OF
CURCUMA XANTHORRHIZA IN VITRO
Nur Andini1, Samanhudi2, Ahmad Yunus2
1
Students of Agronomy Post Graduate Studies Program, SebelasMaret University (UNS)
2
Lecturer Staff of Study Program of Agrotechnology, Faculty of Agriculture, SebelasMaret
University (UNS) Jalan Ir. Sutami No. 36A, Surakarta 57126, Indonesia
E-mail: heloandini@gmail.com
Abstract
Curcuma xanthorrhiza is one kind of medicinal plants. As a medicinal raw material, besides producing
higher rhizome, Curcuma xanthorrhiza should also has high quality. BPOM confirms that drug from
natural materials or commonly referred to the herbal medicine must fulfill requirements that include
quality, safety, and efficacy. The increasing demand for rhizome has encouraged the increasing demand
for Curcuma xanthorrhiza‘s seeds too, it is necessary to have another alternative to provide sufficiency
plant field. The effort in providing plant material in short-term time massively and also getting free from
pest can be done by tissue culture techniques. The use of this technique is still constrained by the high
cost of chemicals, especially plant growth regulator. Various natural materials can be used as a substitute
plant growth regulator, one of them is the extract of coconut water and various organic materials. The
purpose of this study is to assess the response of explants Curcuma xanthorrhiza with coconut water and
Cavendish bananas extract in in vitro.The experiment was conducted in February to May 2016 in the
Laboratory of Plant Physiology and Biotechnology, Faculty of Agriculture, SebelasMaret University
Surakarta. This study used a completely randomized design with two factors. The first factor was the
Cavendish banana fruit extract with 4 levels of concentration which 0 g/l, 50 g/l, 100 g/l and 150 g/l. The
second factor was coconut milk with 4 levels of concentration which 0 ml/l, 100 ml/l, 150 ml/l, and 200
ml/l. The observations were conducted for various variable: the period of sprouts appear, the period of
leaves emerge and the period of roots appear, the number of sprouts, the number of leaf and the number
of root, the height of sprout, the length of leaf and the length of root. The data from observation result was
analyzed by descriptive and variance analysis continued with Duncan Multiple Range Test (DMRT). The
results of the research showed that there were some effects on the treatment of coconut water and
Cavendish banana extract toward the variable observation. The use of coconut milk 150 ml/l and 150 g
Cavendish banana extract in the treatment of media showed the best results on increasing the average
time of sprouts appear, increasing the number of sprout, the number of leaf and the length of leaf.
Keywords: Curcuma, organic material, tissue culture method.
1. Introduction qualities. Ginger rhizome is useful as a raw

material of drugs that can stimulate the secretion of
Curcuma (Curcuma xanthorrhiza) is one kind bile and pancreatic [2]. As a medicinal raw
of medicinal plants. According to material, besides producing higher rhizome,
BadanPusatStatistik (BPS) [1], the total production Curcuma xanthorrhiza should also has high
of turmeric was 35.664 ton, which was exported quality. BadanPengawasanObatdanMakanan[3]
partly. There were some commodities in export confirms that drugs from natural materials or
market namely; fresh ginger and dried commonly called the herbal medicine must fulfill
rhizome. Currently, cultivated ginger has begun on requirements that include quality, safety, and
a limited scale among a population of cultivated efficacy. The researchKemalaet. al.[4] states that
plants, production potential and various the tendency for people to use treatment from
Page | 291
PROCEEDINGS
natural products has increased. About 70% of Range Test (DMRT) at 5% level. Some
herbal medicines on the market contain about 70% observations of variables including the period of
of ginger, and ginger from Indonesia is exported sprouts appear, the period of leaves emerge, the
abroad [5]. period of root appears, the number of sprouts, the
These conditions provide opportunities for number of leaves, the number of roots, the length
farmers as providers of raw materials ginger. The of sprouts, the length of leaves, and the length of
rising demand of rhizomes has encouraged the roots.
growing demand for seed ginger. In
vitro propagation is affected by various factors 3. Results and Discussion
including the type of basic medium which is being
used, appropriate plant growth regulator Generally, curcuma explants are planted in the
applications, and environmental conditions culture media treatment. Based on F test, the effect of
[6]. Various natural materials can be used as a single factor coconut water at 16 weeks average
substitute plant growth regulator one of them is significantly affect the period of sprouts appear
and the length of leaves, and very significant effect
coconut water. Coconut water is a natural
on the number of leaves. The use of Cavendish
substance that has an activity of cytokines for cell
bananas and the interaction between coconutmilk
division and encourages the formation of
and extract banana not significantly affect the
organs. The concentration of coconut water are
entire observation variables.milk and extract
commonly used in tissue culture is 20-15%
banana not significantly affect the entire
[7]. The previous research showed that the results observation variables.
of ginger with coconut water immersion namely
50% indicates the level of best buds [8]. In the The period of sprouts appear
manufacture of tissue
culture media can be added some complex organic The growth of sprouts in explant started from
materials. Examples of complex organic materials 1 to 2 MST. Sprouts multiplication in vitro using
are banana extract. The use of such materials as MS medium with coconut water and Cavendish
additives media can be different effects on banana extract. The period of sprouts appear is
different plants. Banana extract as additional influenced by the explants media which is given.
materials have been tried by the media for in The faster the period of sprouts appear, the better
vitro culture ofDendrobium canayo[9]. The results the treatment media which is given, and the chance
of previous studies showed that coconut milk and for multiplication of sprouts‘ rhizome increase in a
banana extract can be used as an adjunct in the short time. Based on the results of the analysis
planting of medium in vitro. Coconut water and showed that the coconut water on the media give
banana extract as a growing medium in this study significant effect on the average time to sprouts
is expected to increase the multiplication ginger appear of ginger in vitro (Table 1).
growth in vitro.
Table 1.Effect of coconut water at the time
2. Methods appeared shoots
Appears shoots
This research was conducted in February - Coconut water (A)
(days average)
May 2016 at the Laboratory of Biotechnology and
A0 4.33 a
Tissue Culture Faculty of Agriculture,
SebelasMaret University.Materials used are A1 5.50 a
coconut water, banana fruit extract, BAP and A2 8.66 b
rhizome‘s sprouts of java turmeric with at least 5
A3 4.25 a
cm in length. This study uses a completely
randomized design consisting of two treatment Description: A0: coconut water 0 ml/l; A1: coconut
water 100 ml/l; A2: coconut water 150 ml/l; A3:
factors combined with three replications. Coconut
coconut water 200 ml/l; Figures followed by the
water as 4 levels of concentration (0, 100 ml/l, 150 same letter in the same column are not significantly
ml/l, 200 ml/l) and fruit extract of banana different at 5% level DMRT.
(Cavendish) as 4 levels of concentration (0, 50 g/l,
100 g/l, 150 g/l). Materials used for adjusting
were; the pH (HCL and KOH) and BAP 1 The effect of coconut water with 150 ml/l to
ppm. The data were analyzed by using analysis of the growing media significant effect on theperiod
variance by the F test 5%, if there is a real of sprouts appear. According to Gunawan[10]
difference then continued with Duncan Multiple stated that in the hormone cytokines coconut water
Page | 292
PROCEEDINGS
contained 5.8 mg/l, auxin 0.07 mg/l and Based on Figure 1 shows that the addition of
gibberellin to stimulate germination and plant coconut milk 150 ml/l and banana extract 100 g
growth, it also functioned to stimulate affects the number of sprouts with the highest
tissuedivision accelerate metabolism and average is 7 buds and the addition of banana
respiration. The sufficiency of cytokines in extract 50 g produced 6 sprouts. The media used
concentrations greater than auxin is presumed to are also given with plant growth regulator BAP as
help the sprouts‘ growth of ginger. In this study, synthetic cytokines that play a role in encouraging
the use of plant growth regulator cytokines BAP as cell division, stimulating the multiplication of
synthetic as has been done by Seswita[11] with the sprouts, and the concentration of BAP given is
addition of coconut water concentration of 15% expected to help regenerating sprouts. According
and synthetic plant growth regulator BAP1.5 mg/l to the research done by Riansyah[12] in addition of
can respond in vitro growth of ginger shoots up to BAP 1 mg/l MS medium capable of increasing the
3.4 shoots/2 months of planting. number of buds and leaves on the plant turmeric
(Curcuma domestica Val.). The results of research
Number of shoots done by Rusnanda[13] also showed that the
treatment with a concentration of 1-3 mg BAP l
The number of shoots in this experienced MS medium is able to increase the number of
improvement on a weekly basis. Some treatments ginger‘s sprouts that is three times more than
of variance addition of coconut water, banana without BAP.
extracts and the interaction ofcoconut water and
banana extract did not significantly affect the The length of sprouts
number of shoots of ginger for 16 weeks average.
The explants in vitro growth is influenced by the
interaction and balance the provision of plant
growth regulators on the media. In the study, the
addition of coconut milk and banana extract
showed that immature sprouts, it is presumably
because there is no addition of synthetic auxin in
the media that serves to elongation of sprouts.
Description:
A0P0: coconut water 0 ml/l and bananas 0 g A2P0:
coconut water 150 ml/l and bananas 0 g
A0P1: coconut water 0 ml/l and 50 g banana A2P1:
coconut water 150 ml/l and 50 g banana
coconut water 200 ml/l and bananas 0 g Description:
A1P1: coconut water 100 ml/l and 50 g banana A3P1: A0P0: coconut water 0 ml/l and bananas 0 g A2P0:
coconut water 200 ml/l and 50 g banana coconut water 150 ml/l and bananas 0 g
A1P2: coconut water 100 ml/l and 100 g banana A3P2: A0P1: coconut water 0 ml/l and 50 g banana A2P1:
coconut water 200 ml/l and 100 g banana coconut water 150 ml/l and 50 g banana
Figure 1. Histogram effects the number of coconut water 150 ml/l and 150 g banana
shoots. A1P0: coconut water 100 ml/l and bananas 0 g A3P0:
Figure 2. Histogram effects of shoots length.

Page | 293
PROCEEDINGS
Based on Figure 2 showed that the addition of Sulistiyorini[15] states that the use of auxin
coconut milk 200 ml/l and banana extract 150 g for rooting at several different concentrations has
influenced on the sprouts that is the average for different effects on root growth. Combination of
the addition of 27.5 cm and 100 g banana extract MS medium with coconut water as much as 150
can affect an average of 23.8 cm. the growth of ml/l to 100 g banana extract showed a long time
explants can be influenced by the height of culture for root growth that is with an average of 16.7 days
bottle, so the height of sprouts will be obstructed average.
or even cannot grow well. The height of sprouts
that exceed the height of culture bottle can grow The number of root
by the stem of tucked plantlet or bend to the right
of media explants. The content of K nutrient The observation of roots per plant in every
mineral contained in coconut water and Cavendish week is done until the end of the observation. The
banana can affect the elongation of plant growth number of roots is an important factor for the
[14]. growth of explants in vitro. According
Yuniastuti[16] the roots of the plant required for
The period of roots appear the absorption of nutrients from the media, the
more the number, the more extensive the root areas
Root from explants without going through the of nutrient absorption by the root.
stage of formation of callus. Based on the results
of analysis of variance addition of coconut water,
banana extract and interaction with coconut milk
and banana extract did not significantly affect the
period of ginger root appears. Effect of coconut
water to the growing media can affect the time of
root growth. Figure 3 shows that the
administration of coconut water as much as 150
ml/l fastest affect the time arises ginger root
explants is 6 days after planting.
Description:
Description: coconut water 200 ml/l and bananas 0 g
A0P0: coconut water 0 ml/l and bananas 0 g A2P0: A1P1: coconut water 100 ml/l and 50 g banana A3P1:
coconut water 150 ml/l and bananas 0 g coconut water 200 ml/l and 50 g banana
coconut water 150 ml/l and 150 g banana Figure 4. Histogram effects the number of root.
A1P1: coconut water 100 ml/l and 50 g banana A3P1: The calculation of the number of the roots on
coconut water 200 ml/l and 50 g banana rhizome‘s explants can be done by cutting the root
A1P2: coconut water 100 ml/l and 100 g banana A3P2: part when the harvest time come or in the end of
coconut water 200 ml/l and 100 g banana the observation to get the accurate number of
roots. In figure 4, showed that the combination of
giving 150 ml/l coconut water with 100 g
Figure 3. Histogram effects ofappears root.
Page | 294
PROCEEDINGS
Cavendish banana extract having some effects 10.4 cm. Coconut water and banana extract is
toward the number of the roots in average of 38,3, expected to assist in the development of the
the giving of 100 ml/l coconut water with 150 g network, the provision of auxin and cytokines
banana extract also have the effect on the number should consider the concentration and the ratio in
of roots in average of 30. In the research done by the media. Widiastoety [18] states that if the auxin
Kasutjianingati and Irawan[17], showed that the is higher than cytokines cause the differentiation of
use of BAP 2 mg/l, coconut water is 150 ml/l and the growth of the roots. The formation of roots
banana extract 50 g/l indicates the number of the associated with the content of endogenous auxin
best roots. and cytokines in plant tissue, followed by the
process of elongation and cell enlargement.
The length of the root
The period of leaves appear
The length of the root affects the growth of
explants, long-rooted plants will have a better Each treatment influential media in this
ability to absorb water and nutrients in absorbing research to spur the growth of leaves. Based on the
the growing media compared with short-rooted results of analysis of variance addition of coconut
plants. Based on the results of analysis of variance water, banana extract and interaction with coconut
addition of coconut water, banana extract and milk and banana extract did not significantly affect
interaction with coconut milk and banana extract the time arises ginger leaf explants. The use of
did not affect the length of ginger root explants. coconut water to a concentration of 20% in
treatment have a fast time until spur emerging
leaves.
Description:
A0P2: coconut water 0 ml/l and 100 g banana A2P2: Description:
coconut water 150 ml/l and 100 g banana A0P0: coconut water 0 ml/l and bananas 0 g A2P0:
A0P3: coconut water 0 ml/l and 150 g banana A2P3: coconut water 150 ml/l and bananas 0 g
coconut water 150 ml/l and 150 g banana A0P1: coconut water 0 ml/l and 50 g banana A2P1:
A1P0: coconut water 100 ml/l and bananas 0 g A3P0: coconut water 150 ml/l and 50 g banana
coconut water 200 ml/l and bananas 0 g A0P2: coconut water 0 ml/l and 100 g banana A2P2:
A1P1: coconut water 100 ml/l and 50 g banana A3P1: coconut water 150 ml/l and 100 g banana
A1P2: coconut water 100 ml/l and 100 g banana A3P2: coconut water 150 ml/l and 150 g banana
coconut water 200 ml/l and 100 g banana A1P0: coconut water 100 ml/l and bananas 0 g A3P0:
A1P3: coconut water 100 ml/l and 150 g banana A3P3: coconut water 200 ml/l and bananas 0 g
Figure 5. Histogram effects of root length. A1P2: coconut water 100 ml/l and 100 g banana A3P2:
Based on Figure 5 best root length is affected A1P3: coconut water 100 ml/l and 150 g banana A3P3:
by the treatment of coconut milk 200 ml/l with an coconut water 200 ml/l and 150 g banana
average root length of 11.9 cm and the addition of
coconut milk 100 ml/l to 150 g banana extract Figure 6. Histogram effects of appears leaves.
effect on the length of the roots with an average of
Page | 295
PROCEEDINGS
Based on the average time of the leaves showed that the use of coconut water with a
appear in Figure 6, it can be seen that the use of concentration of 15% to spur growth in the number
coconut milk in range of 100 ml/l to 200 ml/l can of strands of leaves as much as 2.2 to 2 weeks.
affect the growth of leaves. In the treatment using
100 ml/l coconut water with additional 50 g of The length of the leaves
banana extract can accelerate the growth of leaves
with the average of 10.7 days after planting, the The observation toward the length of the leaves
water treatment without the use of coconut and done in the end of the observation by releasing
banana extract showed slower growth of leaves. explants from culture bottle. Every plantlet whose
The results of the research done by Prihatmanti the number of leaves will be done the
and Mattjik[19] showed that the use of natural measurement of the length of the leaves, which is
ingredients of coconut water atthe concentration of measured from the base until the longest tip from 1
100 to 200 ml/l for sprout multiplication of plantlet. The measurement of the length of the
Anthuriumandraeanum can improve grow cultured leaves used autoclave sterile ruler. Based on the
in vitro. The result of the research done by Bey[20] results of analysis of variance addition of coconut
suggested that single treatment of coconut water at water affect the length of the leaf explants of
a concentration of 250 ml/l were able to produce ginger (Table 3). The addition of Cavendish
leaves and roots faster in in vitro culture of orchids banana extract and interaction with coconut milk
(Phalaenopsis amabilis BL.). and banana extract did not affect long-leaf explants
of ginger.
The number of leaves
Table 3.Effect of coconut water at leaves length
The observation toward the number of leaves
on rhizome‘s explants is done in every week until Coconut water (A) Leaves length (cm)
the end of the observation. The number of leaves
A0 8.70 b
which is used on the various analyses is the highest
A1 9.44 b
number of leaves from every explant that has
A2 5.86 a
become plantlets. Based on the analysis‘ results of
A3 8.66 b
variance addition of coconut water, it affects the
Description: A0: coconut water 0 ml/l; A1: coconut
amount of ginger leaf explants (Table 2). The water 100 ml/l; A2: coconut water 150 ml/l; A3: coconut
addition of banana extract and interaction with water 200 ml/l; Figures followed by the same letter in
coconut milk and banana extract did not the same column are not significantly different at 5%
significantly affect the number of leaf explants. level DMRT.
Table 2.Effect of coconut water at the number

of leaves Table 3, the test result of Duncan analysis
showed that in the level of 5%, the use of 150 ml/l
Coconut water (A) Number of leaves coconut water is absolutely differ if it is compared
A0 5.75 b with the other treatments in the average of the
length of the leaves are 5.86 cm. Widiastoety[18]
A1 5.58 b
stated that the increase in the length growth of
A2 3.50 a
leaves can be caused by the acceleration of cell
A3 4.91 b division and promote the process of differentiation.
Description: A0: coconut water 0 ml/l; A1: coconut Cell division requires energy that can be obtained
water 100 ml/l; A2: coconut water 150 ml/l; A3: coconut from the auxin or cytokines nutrients. The length
water 200 ml/l; Figures followed by the same letter in and width of leaves is closely connected with the
the same column are not significantly different at 5% direction of the division, enlargement, the number
level DMRT.
and distribution of cells. The broader the leaves,
Based on the analysis results on the Duncan‘s the more stomata increase. Stomata was
continued test in the level of 5% media explants instrumental in the absorption and substances
with the giving of 200 ml/l of coconut water is needed in the metabolic processes of plants.
absolutely differ if compared with the other Widiastoety research results [18] on
treatments in average of leaves number on 3.5 orchidsmokara use coconut water with a
strands. The effect of coconut water is quite differ concentration of 15% + Banana 75 g + BAP 1 ppm
if compared the giving of banana extract and can significantly affect the length of the leaf
interaction between coconut water and banana compared with other treatments.
extract. The results of Seswita‘s research [11]
Page | 296
PROCEEDINGS
4. Conclusion [8] Karimah, A., Purwanti, S., Rogomulyo, R.

2013.Kajian perendamantemulawak
Based on the results of the research the writer (Curcuma xanthorrhiza) dalamurinsapidan air
conclude that the giving of 150 ml/l coconut water kelapauntukmempercepatpertunasan.J.Vegeta
can accelerate the period of sprouts appear and the lika.2/2 : 1-6.
period of roots appear in rhizome‘s explants. The
giving of 150 ml/l coconut water and 100g of [9] Muawanah, G. 2005. PenggunaanPupuk
banana extract can increase the number of sprouts Hyponex,
and roots. The giving of 200 ml/l coconut water EkstrakTomatdanEkstrakPisangdalamPerbany
and 150 g of banana extract can increase the height akandanPerbesaranPlanletAnggrek
of sprouts‘ rhizome and the length of the roots. Dendrobium (Dendrobium canayo) secaraIn
The use of 100 ml/l – 200 ml/l coconut water tends vitro. Skripsi. Program StudiHortikultura,
to increase the number of leaves, and the length of FakultasPertanian, InstitutPertanian Bogor.
the roots. Bogor.
[10] Gunawan, L.W. 1995. TeknikKultur

References jaringanIn vitrodalamHortikultura. Jakarta:
[1] BadanPusatStatistik 2013. Produksi tanaman PenebarSwadaya.
obat Indonesia. BPS Jakarta.
[11] Seswita, D. 2010. Penggunaan air
[2] Bintari, G.S., Windarti I, Fiana DN. 2014 kelapasebagaizatpengaturtumbuhpadamultipli
Temulawak (Curcuma xanthorrhizaRoxb) as kasitunastemulawak (Curcuma
gastroprotector of mucosal cell damage. xanthorrhizaRoxb.) in vitro. J. Littri.16/4 :
Medical Journal of Lampung University. 3/5 : 135-140.
77-84.
[12] Riansyah, R.S. 2007. Pengaruhinteraksi IBA
[3] BadanPengawasObat Dan Makanan (BPOM). dan BAP terhadapMultiplikasi Tunas Kunyit
2005. (Curcuma domesticaVal.)Secarain
PeraturanKepalaBadanPengawasObatdanMak vitro.Skripsi.DepartemenAgronomidanHortik
anan, Nomor.HK.00.05.41.1384, Tahun ultura.IPB. Bogor.
2005tentangKriteriadan Tata
[13] Rusnanda, Y. 2007.
LaksanaPendaftaranObatTradisional.Obat
PengaruhKonsentrasiBAPdanSukrosaterhada
Herbal Terstandar, danFitofarmaka. BPOM
pMultiplikasi Tunas Temulawak (Curcuma
Jakarta.
xanthorrhizaRoxb.)SecaraIn
[4] Kemala, S., Sudiarto, E.R. Pribadi, J.T. vitro.Skripsi.DepartemenAgronomidanHortik
Yuhono, M. Yusron, L. Mauludi, M. ultura.IPB. Bogor.
Rahardjo, Y. Ferry, B. Waskito, Dan H.
[14] Nihayati, E., Wardiyati, T., Retnowati, R., and
Nurhayati. 2003.
Soemarmo. 2013. The Curcumin Content of
StudiSerapanPasokandanPemanfaatanTanama
Temulawak (Curcuma xanthorrhiza)
nObat di Indonesia.LaporanTeknisPenelitian.
Rhizome as Affected by N, K and
Balai Penelitian TanamanRempahdanObat,
Micronutrients B, Fe, Zn. Agrivita.35/3: 218-
Bogor 2: 143-241.
226.
[5] Bermawie, N., M. Rahardjo, D. Wahyuno,
[15] Sulistyorini, Endah. 2012. Penggunaan Air
danMakmun. 2006. Status
Kelapadan
teknologibudidayadanpascapanentanamankun
BeberapaAuksinuntukInduksiMultiplikasi
yitdantemulawaksebagaipenghasilkurkumin.
Tunas danPerakaran Lada SecaraIn vitro. Bul.
EDSUS Littro, 2/4 : 84-99.
Ristri.3/3.
[6] George, E.F. 1993. Plant propagation by Tissue
[16] Yuniastuti, E., Praswanto, Harniningsih, I.
Culture. Part I. The Technology.Edington,
2010. PengaruhKonsentrasi BAP
Wilts, Exegetics Ltd, BA 134QG. England.
terhadapMultiplikasi Tunas Anthurium
[7] Trigiano, R.N And J.G. Dennis. 2000. Plant (Anthuriumandraeanum Linden)
Tissue Culture Concept and Laboratory padaBeberapa Media dasarSecaraIn Vitro.
Exercises Second Ed. CRC Press. Washington CarakaTani. 25/1 : 1-8.
DC.
Page | 297
PROCEEDINGS
[17] KasutjianingatidanIrawan, R. 2013.Media (Naphtalene Acetic Acid) dan BAP (6- Benzil
alternative perbanyakanin vitroanggrekbulan Amino Purine) serta Air
(Phalaenopsis amabilis).J. Agroteknos. 3/3 : KelapauntukMenginduksi Organogenesis
184-189. TanamanAnthurium (Anthuriumandraeanum
Linden ex Andre).Bul. Agron. 32/1: 20-25.
[18] Widiastoety, D. 2014.
PengaruhAuksindanSitokininTerhadapPertum [20] Bey, Y., W. Syafii, danSutrisna. 2006.
buhanPlanletAnggrekMokara.J. Hort.24/3. PengaruhpemberianGiberalin (GA3) dan air
kelapaterhadapperkecambahanbahanbijianggr
[19] Prihatmani, D dan N. A. Mattjik, ekbulan (Phalaenopsis amabilis BL.) secarain
2004.PenggunaanZatPengaturTumbuh NAA vitro. Jurnal Biogenesis. 2/2 : 41-46.
Page | 298
PROCEEDINGS
EFFECT OF POLYETHYLENE GLYCOL CONCENTRATIONS ON

GROWTH AND PROLINE CONTENT OF TACCA
LEONTOPETALOIDES SHOOTS CULTURED IN VITRO
Andri Fadillah Martin*, BetaliniWidhi Hapsari, Rudiyanto, and Tri Muji Ermayanti
Research Center for Biotechnology, Indonesian Institute of Sciences (LIPI)

Jalan Raya Bogor, KM 46, Cibinong, Bogor, Indonesia, 16911
*E-mail : andrifm@ymail.com
Abstract
Tacca leontopetaloides (called taka) is a tuberous plant producing high carbohydrate content useful as
functional food. This plant grows in some limited coastal area in Indonesia. Tissue culture of this plant
has been done for micropropagation and for in vitro conservations. Genetic improvement is important to
produce genotypes which are able to grow in a marginal land such as in a drought condition. The aim of
this research was to investigate the effect polyethylene glycol (PEG) concentrations added to culture
medium on growth and proline content of taka shoots culturedin vitro. Shoots of taka were treated with
2.5-15% PEG. After 6 weeks of treatments, growth was evaluated by recording height of shoots, number
of shoots, number of leaves, number of roots and fresh weight. Proline content was also determined at the
same time. The results showed that growth of taka decreased along with increase in PEG concentrations.
In contrary, proline content in taka explants increased along with increase in PEG concentrations. Taka
produced few roots on the medium added with high level of PEG (7.5-15%).
Keywords:Tacca leontopetaloides, polyethylene glycol (PEG), proline content, growth,in vitro
1. Introduction accumulation was reported to occur during

conditions of drought, high salinity, high light and
Water stress is a major abiotic factor that limits UV radiation, heavy metals, oxidative stress and in
crop productivity, restrict plant distribution, response to biotic stresses [4]. Proline is often
growth, and yield [1]. The insufficient water status considered to act as a compatible solute involved
in plant leads to water deficit or drought. Drought in osmotic adjustment at the plant cell level,
or water deficit is not only caused by lack of water, although the precise role of this accumulation in
but also because of environmental condition such osmotic adjustment is still debated, proline is
as low temperature and salinity, thus plants share accumulated in cytoplasm without having a
many molecular compounds in response to these detrimental effect on cytosolic enzyme activities
stresses[2]. There are two principal strategies in [3].
response to water stress i.e. synthesis of protective Plant responses to abiotic stresses are complex
molecule during water stress to prevent damage phenomenon with specific characteristic among
and repair-based mechanism during rehydration to various species, thus understanding mechanism
neutralize damage[2]. involved in stress response of plants is necessary
The plant in osmotic stress (salinity and [5]. In vitro culture is a tool that frequently used
drought) has been reported to synthesize and for studying of stress tolerance mechanism because
hyper-accumulate protective molecules such as its advantages in controlling the physical
soluble carbohydrate, amino acids, betaines and environment, nutrition, and homogeneity[1].
proline [3]. Proline is a proteinogenic amino acid Various studies have been conducted by using
with an exceptional conformational rigidity, and polyethylene glycol (PEG) in tissue culture as
essential for primary metabolism. Proline osmotic agent such as in castor bean[1], rice [6],
wheat [7], Atriplex[8], soybean [9],pigeonpea[10],
Page | 299
PROCEEDINGS
and tomato[11]. PEG is a neutral polymer and is fluorescent tube with 1000-1400 lux light
available in different molecular mass[12] and it intensity.
has been used for several research on plant water
stress [6–17]. PEG with high molecular weight is Growth parameters
often used for inducing water stress in in vitro
plant culture research because it is chemically The height of shoots, number of shoots, and
inert, does not enter the cell, does not cause number of roots per explant were recorded 6 weeks
toxicity, thus it is satisfactorily simulating the after culture. The shoot fresh weight per explant
drought effects[18].The molecular weight of PEG was also recorded after 6 weeks of culture.
used for the study of water stress were various i.e. All data were analyzed by variance analysis
PEG-4000 [6,12], PEG-6000 [11,13,17] and PEG- (ANOVA), followed by Duncan‘s Multiple Range
10000[8,9,19]. Test (DMRT) at 5% probability from themean
Polynesian arrowroot (Tacca leontopetaloides comparison.
(L.) Kuntze Syn. T. pinnatifida Forst, T.
involucrataSchum and Thonn.) is a species of Determination of proline concentration
flowering plant and recently were grouped into
family Dioscoreaceae[20,21]. Physicochemical After six weeks of culture, whole parts of
analysisfrom T. leontopetaloidesstarch revealed explants were harvested for proline analysis.
that the starchis similar to those of potato and Purified proline was used as standard for proline
maize starch, andTacca starch was relatively more quantification. The proline assay was determined
resistant to compression. This particular attribute as described by Bates et al.[25]. The acid-
of taccastarch could make it to be used for ninhydrin reagent was prepared by warming 1.25 g
pharmaceutical excipient comparable to maize ninhydrin in 30 mL of glacial acetic acid and 20
starch in tablet formulation[22].Taccawas often mL of 6 M phosphoric acid, agitated and
found in thedappled shade behind sandy beaches dissolved. Approximately 0.5 g of plant material
and therefore this plant was suspected to be was homogenized in 10 mL of 3% sulfosalicylic
tolerant against osmotic stresses such as drought acid and filtered by Whatman no.2 filter paper.
and salinity. The tissue culture of Tacca Two mL of filtrate was reacted with 2 mL acid-
leontopetaloides has been done[23] and thus the ninhydrin and 2 mL of glacial acetic acid in a test
aim of this study was to investigate the effect of tube for 1 h at 100oC, and the reaction was
drought induced by PEG on growth of in vitro terminated in ice bath. The reaction mixture was
culture and proline content ofT. leontopetaloides. extracted with 4 mL toluene, mixed with stirrer for
15-20 sec. The chromophore containing toluene
2. Methods was aspirated from the aqueous phase, warmed to
a room temperature and read the absorbance at 520
Plant culture materials and PEG nm with toluene as a blank. The proline
treatment concentration was determined based on a standard
curve and calculated on a fresh weight basis as
The corms of T. leontopetaloides used in this follows: [(µg proline/mL x mL toluene)/115.5
experiment were came from two-month-olds µg/µmole] / [(g sample)/5] = µmoles proline / g of
shoots of T. leontopetaloides culturedin vitro. The fresh weight material.
cultures were grown in MS medium [24]
supplemented with 0.5 ppm Benzyl Amino Purine 3. Results and Discussion
(BAP)and 30 g/L sucrose. The medium was
solidified with 8 g/L agar and adjusted to pH 5.8 After six weeks in culture (Figure 1),
with 1N KOH. The medium was autoclaved at 121 thegrowth of T. leontopetaloidesshoot
0
C and 103 kPa for 15 min. The corms were culturesreduced along with the increase of PEG
planted on MS solid medium supplemented with concentrations. The growth of T.
various concentrations of PEG (MW 4000) at 0; leontopetaloidesculture were qualitatively
2.5; 5; 7.5; 10; 12.5 and 15%, respectively. The observed to be reduced in addition of PEG from
cultures were incubated at 25 ± 2 0C under 7.5 up to 15%.
continuous light provided by cool white
Page | 300
PROCEEDINGS
to 15% inhibitedformation of new shoots. The

highest number of shoots were recorded from 2.5%
PEG treatment at 1.417 ± 0.416 per explant and
significantly different from the control
treatment.The lowest number of shoots were
recorded from 10, 12.5, and 15% PEG treatment at
1.000 ± 0.000. This indicated that with those PEG
concentration treatments there are no new shoot
formed.
Figure 1. T. leontopetaloides culture after six

weeks in the treatment medium: (A) MS
medium (control); (B) 2.5% PEG; (C) 5% PEG;
(D) 7.5% PEG; (E) 10% PEG; (F) 12.5% PEG;
(G) 15% PEG.
The addition of PEG into the medium induced Figure 3. The effect of PEG with various
an inhibiting effect on growth of T. concentration on number of shoot of T.
leontopetaloidesculture. From data shown inFigure leontopetaloidesin the sixth week after
2, the shoot height decreases along with the subculture. Bar with different letter is
increase of PEG concentration. As data showedin significantly different (P=0.05) according to
Figure 2, theaddition of 2.5 and 5% PEG had DMRT.
already decreased the shoot height of T.
leontopetaloides culture significantly. The lowest
shoot height wasachieved at culture treated with The highest number of leaves was recorded
15% PEG treatment at 1.088 ± 0.040 cm whilst the from 2.5% PEG treatment at 3.500 ±0.565,
highest shoot height was recorded from control however, it is not significantly different from the
treatment at 2.417 ± 0.170 cm. control treatment (Figure 4). Similar to number of
shoots parameter (Figure 3), number of leaves
increased with addition of 2.5 up to 5% PEG
(Figure 4). The growth inhibition effect on number
of leaves was strongly seenat 7.5 up to 15% PEG
treatments. The lowers number of leaves were
from 12.5% PEG treatment at 0.750 ± 0.202.
Figure 2. The effect of PEG with various

concentration on shoot height of T.
leontopetaloides in the sixth week after
subculture. Bar with different letter is
significantly different (P=0.05) according to
DMRT.
Figure 4. The effect of PEG with various
concentration on number of leaves of T.
leontopetaloidesin the sixth week after
The number of shoots increased with the
subculture. Bar with different letter is
addition of 2.5 to 5% of PEG treatment (Figure 3).
significantly different (P=0.05) according to
As data shown in Figure 3, PEG addition from 10
DMRT.
Page | 301
PROCEEDINGS
Similar data trend were recorded on number of

roots parameter that number of roots
increasedfrom 2.5 to 5% PEG treatment compared
to the control. The highest number of roots per
explant were obtainedat 5% PEG treatment at
1.083 ± 0.275 and significantly different compared
to the control (Figure 5). PEG treatment from 7.5
up 15% inhibited the root formation significantly.
The roots were not formed in the 12.5% PEG
treatment as data shown inFigure 5.
Figure 6. The effect of PEG on fresh weight of

T. leontopetaloidesand its proline content in the
sixth week after subculture. Bar with different
letter is significantly different (P=0.05)
according to DMRT.
Growth analysis is a fundamental

characterization toassess‘ plant‘s responses to
environmental stress [26]. The high-molecular-
weight PEG has been used to study in vitro
Figure 5. The effect of PEG with various induction water deficit because it reduces the
concentration on number of roots of T. osmotic potential of the medium [18]. In our
leontopetaloidesin the sixth week after present studyosmotic stress induced by PEG from
subculture. Bar with different letter is 7.5 to 15% resulted in decrease of growth
significantly different (P=0.05) according to significantly as data shown on Figures 1-5. In
DMRT. lower level of PEG (at 2.5 – 5% PEG) the cultures
were able to maintain growth as shown in Figure
3-5. Number of shoots and number of leaves were
Figure 6 shows that fresh weight (FW) of T. slightly higher compared to the control, although it
leontopetaloidesexplantdecreased along with the was not significantly different. Interestingly the
increase of PEG concentrations. The highest fresh root numbers increased significantly in the present
weight was obtained from control treatment (0.859 of 5% PEG. This result was similar to research
± 0.121 g) whilst the lowest fresh weight was finding in germination of cotton cultivar [13]that
obtained from 15% PEG treatment (0.245 ± 0.030 had radicle length increased in the present of low
g). In contrary, proline content increased along level of PEG.
with the increase of PEG concentrations. The The fresh weight of T. leontopetaloidesculture
highest proline content was obtained from 15% tends to decrease along with the increase of PEG
PEG treatment (1.675 µg/g FW), whilst the lowest concentrations. Even though the decrease of FW in
proline content was obtained from control 2.5 and 5% PEG are not significantly different
treatment (6.875 µg/g FW). compared to the control. The decrease of FW was
significantly different compare to the control on
7.5 up 15% PEG. This indicates that T.
leontopetaloides culture has the ability to sustain
their water content to mild stress, whereas this
ability lost under severe stress treatment. Similar
result was reported in pigeonpea[10]where the
plant was able to maintain growth under PEG mild
stress.It has been shown that proline has a key role
in stabilizing cellular protein and membranes in
presence of high concentration of osmoticum [27].
In our previous work, proline concentrations
increased in the presence of stress
Page | 302
PROCEEDINGS
osmoticum(NaCl)[28,29]. In our present work [3] P.M. Hasegawa, R.A. Bressan, Z. Jian-
prolineconcentrations began to increase at 2.5% Kang, H.J. Bohnert, Annual Review of
and at higher than 15% PEG.Similar result was Plant Physiology and Plant Molecular
also reported in rice calli [17], pegionpea (Cajanus Biology 51 (2000) 463–499.
cajan)[10]. The accumulation of proline during
[4] L. Szabados, A. Savouré, Trends in Plant
drought is related to its basic chemical properties
Science 15 (2010) 89–97.
whereas proline is the most water soluble amino
acids and exists much of the time in zwitterionic [5] P. Rodziewicz, B. Swarcewicz, K.
state having weak negative and positive charges at Chmielewska, A. Wojakowska, M.
the carboxylic acid and nitrogen groups, Stobiecki, Acta Physiologiae Plantarum 36
respectively [30]. In our present work, it seems (2014) 1–19.
that proline was effective in maintaining growth
[6] J. Wu, Z. Zhang, Q. Zhang, Y. Liu, B.
from 2.5 to 5% PEG as shown inFigures 3, 4 and
Zhu, J. Cao, Z. Li, L. Han, J. Jia, G. Zhao,
5. This was also because of characteristic of
X. Sun, PLoS ONE 10 (2015) 1–15.
proline whereas proline capable to maintain a
hydration sphere around the biopolymers and [7] M. Bajji, J.M. Kinet, S. Lutts, Plant
maintain their native state, thereby regulating Growth Regulation 36 (2002) 61–70.
growth under drought and salinity stresses
[31].Thus, it can be concluded that addition of [8] J.-P. Martínez, J.-M. Kinet, M. Bajji, S.
PEG into the medium clearly indicated water stress Lutts, Journal of Experimental Botany 56
effect on T. leontopetaloides culture. Even (2005) 2421–2431.
thoughT. leontopetaloidesculture could maintain [9] M. Hamayun, S.A. Khan, Z.K. Shinwari,
growth from 2.5 to 5% PEG, T. leontopetaloides A.L. Khan, N. Ahmad, I.J. Lee, Pakistan
culture was not able to tolerate higher PEG Journal of Botany 42 (2010) 977–986.
concentrations which were from7.5 to 15%.
[10] R.R. Kumar, K. Karajol, G.R. Naik,
Recent Research in Science and
4. Conclusion Technology 3 (2011) 148–152.
Shoot height and Fresh weight of T. [11] S. George, N.M. Minhas, S.A. Jatoi, S.U.
leontopetaloidesculture decreased along with the Siddiqui, A. Ghafoor, Pakistan Journal of
increase of PEG concentration, whereas the Botany 47 (2015) 835–844.
number of shoots, number of leaves and number of
[12] J.L. Van Zyl, C.S. Kennedy, South African
roots slightly increased in the presence of 2.5 up to
Journal of Enology and Viticulture 4
5% PEG then decreased athigh level of PEG
(1983) 1–5.
(from7.5 to 15%). Proline level increased along
with the increase of PEG concentrations. [13] C.H.S.G. Meneses, R.D.L.A. Bruno, P.D.
Fernandes, W.E. Pereira, L.H.G.D.M.
Acknowledgements Lima, M.M.D.A. Lima, M.S. Vidal,
Scientia Agricola 68 (2011) 131–138.
The authors would like to thank Evan Maulana [14] W. Xu, L. Jia, W. Shi, J. Liang, F. Zhou,
and Lutvinda Ismanjani for media preparation and Q. Li, J. Zhang, New Phytologist 197
culture maintenance. This research was funded by (2013) 139–150.
DIPA Prioritas Nasional 2011-2014.
[15] M.S.A. Ahmad, F. Javed, M. Ashraf, Plant
References Growth Regulation 53 (2007) 53–63.
[16] I. Dami, H.G. Hughes, Plant Cell, Tissue
[1] M.M. de A. Silva, L. Willadino, D.Y. a. C. and Organ Culture 47 (1997) 97–101.
dos Santos, A.F.M. Oliveira, T.R. Camara,
Plant Growth Regulation 78 (2015) 195– [17] R. Joshi, A. Shukla, R.K. Sairam, Acta
204. Physiologiae Plantarum 33 (2011) 2209–
2217.
[2] H. Hirt, K. Shinozaki, eds., Plant
Responses to Abiotic Stress, Springer [18] M.K. Rai, R.K. Kalia, R. Singh, M.P.
Berlin Heidelberg, Berlin, Heidelberg, Gangola, A.K. Dhawan, Environmental
2004. and Experimental Botany 71 (2011) 89–
98.
[19] M.F. Mohamed, A.A. Tawfik, Plant Cell,
Page | 303
PROCEEDINGS
Tissue and Organ Culture 87 (2006) 255– [26] T. He, G.R. Cramer, Plant and Soil 153
262. (1993) 19–31.
[20] L. Caddick, R.P. Wilkin, P.J. Rudall, [27] A.S. Rudolph, J.H. Crowe, L.M. Crowe,
T.A.J. Hedderson, M.W. Chase, Taxon 51 Archives of Biochemistry and Biophysics
(2002) 103–114. 245 (1986) 134–143.
[21] L. Zhang, H.T. Li, L.M. Gao, J.B. Yang, [28] A.F. Martin, F. Azizah, D.R. Wulandari,
D.Z. Li, C.H. Cannon, J. Chen, Q.J. Li, T.M. Ermayanti, Annales Bogorienses 16
Journal of Integrative Plant Biology 53 (2012) 15 – 20.
(2011) 901–911.
[29] A.F. Martin, B.W. Hapsari, T.M.
[22] O.O. Kunle, Y.E. Ibrahim, M.O. Emeje, S. Ermayanti, Annales Bogorienses 19 (2015)
Shaba, Y. Kunle, Starch/Stärke 55 (2003) 1–7.
319–325.
[30] P.E. Verslues, S. Sharma, The Arabidopsis
[23] A.F. Martin, T.M. Ermayanti, B.W. Book (2010) 8:e0140.
Hapsari, D.E. Rantau, in:, The 5th
[31] G. Gangopadhyay, S. Basu, Advances in
Indonesia Biotechnology Conference,
Plant Physiology - Vol III, Scientific Publ,
2012, pp. 240–251.
Jodphur, India, 2000.
[24] T. Murashige, F. Skoog, Physiologia
Plantarum 15 (1962) 473–497.
[25] L.S. Bates, R.P. Waldern, I.D. Teare, Plant
and Soil 39 (1973) 205–207.
Page | 304
PROCEEDINGS
IN VITRO MULTIPLICATION OF TURMERIC (CURCUMA

DOMESTICA VAL.) AXILLARY SHOOT USING BAP AND NAA
Ayudya Kartika Sari1, Pratignja Sunu1, Ahmad Yunus1, Samanhudi1

1
Department of Agrotechnology, Faculty ofAgriculture, University of Sebelas Maret Surakarta,
Kentingan, Surakarta, 57101, Indonesia
E-mail: ayudyaks@gmail.com
Abstract
One of the medicinal plants properties that have many industrial raw materials and traditional medicine is
turmeric (Curcuma domestica Val.). Alternative healthy plant propagation, fast and not depending on the
season is through in vitro propagation. The success of in vitro propagation is determined by the
application of plant growth regulators. This research aims to determine the concentration of BAP and
NAA that suitable for in vitro multiplication of turmeric axillary shoots. The research was conducted at
the laboratory of Plant Physiology and Biotechnology, Faculty Agriculture of Sebelas Maret University,
Surakarta from September 2015 until May 2016. The research using a completely randomized design
arranged in factorial. The first factor was the concentration of BAP which consists of four levels (0; 2; 4
and 6 ppm). The second factor was the concentration of NAA which consists of four levels (0; 0,5; 1 and
1,5 ppm). The results showed that there was no interaction between BAP and NAA to all variables
observation, and the best combination for shoot multiplication resulted in the treatment of BAP 4 ppm
and NAA 1 ppm which produced the highest number of shoots are 3 shoots and the highest shoots are
17.73 cm.
Keywords : Plant Growth Regulator, Benzyl Amino Purine, Naphthalene Acetic Acid, Rhizome Buds,
Medicinal Plants
1. Introduction the description above, this research needs to be to

examine the concentration of BAP and NAA are
One of the medicinal plants properties that appropriate and their influence on in vitro
have many industrial raw materials and traditional multiplication of axillary shoot turmeric.
medicine is turmeric (Curcuma domestica Val.)
[1]. Data from the Ministry of Commerce in 2014 2. Methods
shows Indonesian herbal medicine export growth
during the 2009-2013 period increased by 6.49% The research was conducted at the laboratory
per year [2], including the demand for turmeric. of Plant Physiology and Biotechnology, Faculty
The propagation of turmeric constrained by Agriculture of Sebelas Maret University,
rhizome dormancy and the high level of the Surakarta from September 2015 until May 2016.
ravages of the disease [3]. Alternative healthy The research using a completely randomized
plant propagation, fast and not depending on the design arranged in factorial. The first factor is the
season is through in vitro propagation [4]. The concentration of BAP which consists of four
success of in vitro propagation is determined by levels (0; 2; 4 and 6 ppm). The second factor is
the application of plant growth regulators (PGR). the concentration of NAA which consists of four
The PGR are widely used on in vitro multiplication levels (0; 0,5; 1 and 1,5 ppm), in order to obtain
among others sitokinin and auxin. The use of 16 treatment combinations, each repeated three
sitokinin and auxin is required in a balanced times.
condition, so that the results obtained are expected Plant material in the form of turmeric derived
to different when compared with the addition of from Kluster Biofarmaka Karanganyar. The
sitokinin or auxin on media culture [5]. Based on rhizome further sowing to form buds were used as
Page | 305
PROCEEDINGS
explants. The sterilization explant made using

materials such as distilled water, detergent
(sunlight), bactericidal 10 gL-1, fungicide 10 gL-
1
and clorox 10%. Variables include the
observation of the time emerged root, root lenght,
number of roots, time emerges shoot, shoot
height, number of shoots, time emerges leave,
leave lenght and number of leaves. Data were
analyzed using analysis of variance by the F test
level of 5%. If there is a significant difference
DMRT followed by a further test at 5% level, if
not then analyzed descriptively.
B0 = BAP 0 ppm; B1 = BAP 2 ppm; B2 = BAP 4
ppm; B3 = BAP 6 ppm; N0 = NAA 0 ppm; N1 =
3. Result and Discussion NAA 0,5 ppm; N2 = NAA 1 ppm; N3 = NAA 1,5
ppm
Time of emerged root
Figure 1 Histogram average of root lenght
Based on the data in Table 1, the time of on various concentrations of BAP and NAA in
emerged roots ranged from 6.67 until 19.67 DAP. vitro.
The treatment of NAA 0 ppm with increased
concentra
tions of BAP showed a tendency to decrease the
number of days to induce the formation of roots. Ruzicka et al.[7], repoted that the increase in
The results indicate that, with or without the NAA, exogenous cytokinin it will inhibit root growth and
explant was capable of forming roots by reduce the size of the root meristem. However, the
optimizing the available nutrients in the media high concentration of BAP until 6 ppm
culture. According to Marlin [6], it proves that the accompanied by an increase in NAA concentration
root cells generally contain enough auxin to led to an increase in root length. This shows the
elongate normally, where the media with the same need for balance between cytokinin and auxin in
nutrient content and without the addition of PGR, an effort to plant propagation in vitro. According
plant cells remained capable of optimizing the Wroblewska [8], the balance between cytokinin
division process to form roots. and auxin important to be maintained because both
are antagonistic to the process of organogenesis.
Table 1 Average time of emerged root on
various concentrations of BAP and Number of roots
NAA in vitro (DAP)
Based on the analysis of variance were
BAP NAA (ppm) performed no interaction between BAP and NAA
(ppm) 0 0,5 1 1,5 to the number of roots. However, there is a
0 19.67 19 23 18 significantly different effect on the treatment of
2 8 8 11.5 13 NAA to the number of roots. According on the
4 6.67 17.33 14.67 21 Table 2 can be seen that the addition of NAA is
6 9.33 9 9 15.67 able to increase the number of roots than without
DAP = days after planting; ppm = parts per million
NAA. Something similar was reported by Bahera
et al. [9], that the addition of NAA in the medium
Root lenght culture is able to increase the percentage of live
explants, number of shoots, the average length of
Based on Figure 1, the longest roots 10.6 cm shoots, the average number of roots and root
was formed in the treatment of BAP 2 ppm NAA + length Curcuma longa.
1.5 ppm, while the shortest roots 1 cm was formed
in the treatment of BAP4 ppm + NAA 1.5 ppm.
The results show that increasing the concentration
of BAP in the same NAA concentration led to a
decrease in the root length of explant turmeric.
Page | 306
PROCEEDINGS
Table 2 The effect of NAA concentration on the Shoot height

amount of turmeric roots in explant
Based on Figure 2, the highest shoots 17.73 cm
NAA concentration Average Number of formed on the treatment BAP 4 ppm + NAA 1
(ppm) Roots
ppm, while the shortest shoots 1.3 cm formed on
0 9.92 a treatment BAP 4 ppm + NAA 1.5 ppm. The results
0.5 36.70 b
showed the same of BAP concentrations an
1 41.18 b
1.5 30.88 b
increase in the concentration of NAA led to a
Mean followed by the same letter are not pressuare on high-growth shoots.
significantly different according to show DMRT
level of 5%
Average number of roots tend to be high indicated

on the NAA 1 ppm i.e. 41.18 (Table 2). In
accordance with results of research Ayenew et al.
[10], that the addition of NAA 1 ppm increase the
average number of roots and the average length of
root Zingiber officinale on in vitro propagation.
However, the results not significantly different
with the average number of roots in addition NAA
0.5 ppm and 1.5 ppm, although the average
number of roots tend to decline at increased
concentrations until 1.5 ppm. It gives that to ppm; B3 = BAP 6 ppm; N0 = NAA 0 ppm; N1 =
stimulate an increased number of roots, the optimal NAA 0,5 ppm; N2 = NAA 1 ppm; N3 = NAA 1,5
concentration of NAA range between 0.5-1 ppm. ppm
Figure 2 Histogram averageof shoot height on
Time of emerged shoot various concentrations of BAP and
NAA in vitro.
According to Cheng et al. [11] the interaction
auxin and sitokinin played an important role in the Yusuf et al. [13], reported that the increase in
initiation and formation meristem cells in the NAA concentrations higher than 1.0 ppm effect to
regeneration of shoots. Based on the data in Table pressured on the growth rate of shoots. Auxin in
3, the fastest time of emerged shoots i.e. 10 DAP low concentrations effect on cell elongation, but
in the treatment of BAP 4 ppm + NAA 1.5 ppm. high concentrations are otherwise due to their
Similar results were reported by Bahera et al.[9], placement in the competition at the position of the
about C. longa range first time of emerged shoots recipient cells [14].
i.e. 12 to 16 DAP with the addition of BAP and
NAA. The addition of PGR with a combination of Number of shoots
different concentration and also able to accelerate
the emergence of shoots Boesenbergia Based on Figure 3, the highest number of buds
pulcherrimaon in vitro culture to range from 5-10 formed on treatment BAP 0 ppm + NAA 0.5 ppm,
DAT [12]. BAP 2 ppm + NAA 1 ppm, BAP 4 ppm + NAA 1
ppm and BAP 4 ppm + NAA 1.5 ppm i.e. 3 shoots
Table 3 Average time of emerged shoots on per explant. These results indicate a role of NAA
various concentrations of BAP and in the shoot multiplication. The addition of NAA
NAA in vitro (DAP) singly in low concentrations can increase the rate
BAP NAA (ppm) of multiplication of shoots, but be opposite if in
(ppm) 0 0,5 1 1,5 high concentrations.
0 43.00 29.00 21.00 17.00
2 15.67 10.33 21.50 17.00
4 16.00 32.67 13.67 10.00
6 14.33 25.67 19.33 16.67
DAP = days after planting; ppm = parts per million
Page | 307
PROCEEDINGS
Table 4 Average time of emergedleaves at

various concentrations of BAP and
NAA in vitro (DAP)
BAP NAA (ppm)

(ppm) 0 0,5 1 1,5
0 71.00 23.00 48.00 22.00
2 27.67 27.50 37.00 31.00
4 28.67 45.50 28.33 38.00
6 36.00 29.50 36.00 26.67
DAP = days after planting; ppm = parts per
million
ppm; B3 = BAP 6 ppm; N0 = NAA 0 ppm; N1 =
NAA 0,5 ppm; N2 = NAA 1 ppm; N3 = NAA 1,5 Leave length
ppm
Based on the data in Figure 4, the treatment
Figure 3 Histogram average number of shoots BAP 0 ppm + NAA 1 ppm produced the longest
explant turmeric on various average leaf 10.30 cm. According Pamungkas et
concentrations of BAP and NAA in al. [18] auxin in plant tissue acts to stimulate cell
vitro. renewal. Response of cell elongation in the leaf
tissues causes an increase in the length of the
leaves. However, the increase in the addition of
Seyyedyousefi et al. [15]reported that the NAA singly until 1.5 ppm effected in a decrease in
presence of NAA in low concentrations required leaf length as in the treatment of BAP 0 ppm +
for the growth of primordial buds. The increase in NAA 1.5 ppm. The same thing expressed by
NAA more than 0.5 ppm without the addition of Lestari et al. [19], that on higher concentrations,
BAP showed a decrease in average number of auxin will inhibit plant growth because auxin
shoots. However, the combination of NAA and induces ethylene production and suppress the
BAP at higher concentrations showed a balance so growth of plants.
as to increase the average number of shoots.
Bharalee et al. [16] also reported that MS medium
with BAP 4 ppm + 1.5 ppm NAA is the best
medium for shoot multiplication C. caesia. The
right combination of the addition of PGR was
recommended to increase shootsmultiplication
from shoot meristem [13].
Time of emerged leaves

Based on Table 4, indicate that treatment of
BAP 0 ppm + NAA 1.5 ppm has emerged leaves
fastest time by an average of 22 DAP. According ppm; B3 = BAP 6 ppm; N0 = NAA 0 ppm; N1 =
Arimarsetiowati and Ardiyani [17] in addition to NAA 0,5 ppm; N2 = NAA 1 ppm; N3 = NAA 1,5
the growth of root length, auxin also can affect the ppm
growth of leaves. The function of auxin in the
growth of the leaves is to assist the development of Figure 4 Histogram average length of leaf on
candidate leaf meristem tissue. various concentrations of BAP and
NAA in vitro.
Number of leaves
The highest average number of leaves on the
figure 5 i.e. 5 leaves ware contained in the
treatment of BAP 2 ppm + 0.5 ppm NAA, NAA +
BAP 2 ppm 1.5 ppm and 4 ppm BAP + NAA 0
ppm. Other results indicated in the treatment
Page | 308
PROCEEDINGS
without the addition of PGR showed the average [4] P.S. Chougule, R.V. Hegde, A.N. Mokashi,
number of leaves are quite high, 4 leaves. C.K. Venugopal, R. Bhat, Karnataka J. Agric.
Sci.24(4) (2011): 493-496.
[5] R. Raihana, Q.H. Faridah, A.A. Julia, A.H.A.

Abdelmageed, M.A. Kadir, J. Med. Plants
Research5(28) (2011): 6418-6422.
[6] Marlin, J. Ilmu-ilmu Pertanian Indonesia 7(1)

(2005) : 8-14.
[7] K. Ruzicka, M. Simaskova, J. Duclercq, J.

Petrasek, E. Zazimalovz, S. Simon, J. Friml,
B0 = BAP 0 ppm; B1 = BAP 2 ppm; B2 = BAP 4 M.C.E. Van Montagu, E. Benkova, PNAS
ppm; B3 = BAP 6 ppm; N0 = NAA 0 ppm; N1 = 106(11) (2009): 4284-4289.
NAA 0,5 ppm; N2 = NAA 1 ppm; N3 = NAA 1,5
ppm [8] K. Wroblewska, Acta. Sci. Pol. Hortorum
Cultus 12(1) (2013): 101-113.
Figure 5 Histogram average number of leaf at
various concentrations of BAP and [9] K.K. Behera, D. Pani, S. Sahoo, Inter. J. Biol.
NAA in vitro. Tech. 1(1) (2010): 16-23.
[10] B. Ayenew, W. Terefa, B. Kassahun, African

Marlin [6] revealed that some plant cells can J. Biotech. 11(16) (2012): 3911-3918.
grow, develop and regenerate into a new plant in
the media without PGR. In addition explant [11] Z.J. Cheng, L. Wiang, W. Sun, Y. Zhang, C.
development also depends on the content of Zhou, Y.H. Su, W. Li, T.T. Sun, X.Y. Zhao,
endogenous hormones that can stimulate the X.G. Li, Y. Cheng, Plant Physiology 161
formation of leaves without the effect of hormones (2013): 240-251.
from the outside [20].
[12] N.P. Anish, M. Dan, M. Bejoy, Inter. J. Bot.
4. Conclusions 4(1) (2008): 93-98.
Based on research that has been done can be [13] N.A. Yusuf, M.M.S. Annuar, N. Khalid,
concluded that: African J. Biotech. 10(7) (2011): 1194-1199.
a. There was no interaction between BAP and
NAA to all variables observation. [14] H. Sudrajad, D. Suharto, Fauzi, Agrovigor
b. The treatment combination of BAP 4 ppm and 8(1) (2015): 26-32.
NAA 1 ppm produced the highest number of
shoot are 3 shoots and the highest shoots are [15] S.R. Seyyedyousefi, B. Kaviani, N.P.
17.73 cm. Dehkaei, European J. Experimental Biol. 3(5)
Suggestions can be submitted related to the (2013): 133-136.
results of research that need further research
related to the combination of BAP and NAA at [16] R. Bharalee, A. Das, M.C. Kalita, J. Plant.
concentration levels that have produced plantlets. Biochem. Biotech. 14 (2005) :61–63.
References [17] R. Arimarsetiowati, F. Ardiyani, Pelita

Perkebunan 28(2) (2012): 82-90.
[1] Fauzi A, Sutrisno J, Suprapto, e-jurnal Agrista
1(1) (2013): 1-9, http://agribisnis.fp.uns.ac.id. [18] F.T. Pamungkas, S. Darmanti, B. Raharjo, J.
Sains dan Matematika 17(3) (2009): 131-140.
[2] Kementerian Perdagangan Republik Indonesia,
Warta Ekspor 5(9) (2014): 1-20. [19] S.R. Lestari, D. Ermavitalini, D Agisimoto, J.
Sains dan Seni Pomits 2(1) (2013): 2337-3520.
[3] S. Nayak, P.K. Naik, ScienceAsia 32 (2006) :
31-37. [20] A.K. Karjadi, A. Buchory, J. Hort. 18(4)
(2008): 380-384.
Page | 309
PROCEEDINGS
ISOLATION AND PURIFICATION OF PROTOPLAST FROM

LEAVES MESOPHYLL OFTACCA LEONTOPETALOIDES
TO ESTABLISH PROTOPLAST CULTURE AND FUSION
Dyah Retno Wulandari*, Andri Fadillah Martin, Tri Muji Ermayanti
Research Center for Biotechnology, Indonesian Institute of Sciences (LIPI)

Jalan Raya Bogor, KM 46, Cibinong, Bogor, Indonesia, 16911
*E-mail : dyahwulandari@yahoo.com
Abstract
Somatic cell manipulation of Tacca leontopetaloides (taka) useful for alternative source of carbohydrate
needs to develop. One technique to produce somaclonal variation and hybrid of taka is by protoplast
culture and protoplast fusion. The first important step in establishing protoplast culture is isolation
followed by purification of protoplasts in order to produce protoplasts with high density and viable. The
aim of the research was to find out a technique for isolation and purification of taka protoplasts using leaf
mesophyll to establish protoplast culture and fusion. Protoplast isolation was done by soaking in vitro
taka leaf in mixed of cellulose (0.25-1.0%), macerozyme (0.25-1.0%) and pectolyase (0.05-0.2%)
enzymes. Incubation was done at 3, 6, 16 and 24 h. The results showed that combination in concentration
of mixing enzyme with liquid BH3 medium produced protoplasts with optimum density. Protoplast was
successfully purified by adjusting sucrose and mannitol concentrations. The highest protoplast density
was 8.71 x 105cell/mL after 6 h incubation in 1.0% cellulose, 1.0% macerozyme and 0.2% pectolyase.
The lowest density was 3.5 x 104cell/mL after 3 h incubation in 0.25% cellulose, 0.25% macerozyme and
0.05% pectolyase .
Keywords: protoplast, taka, Tacca leontopetaloides, isolation, purification, enzyme concentrations
1. Introduction propagation of taka and its growth pattern was

investigated to determine cultivation methods
Taka (Tacca leontopetaloides (L.) Kuntze guidelines [7].
is a species of flowering plant belongs to family Plant tissue culture technology has been
Dioscoreaceae[1]. Characteristics of this plant is applied on taka forin vitro propagation,
similar to other species of Dioscoreaceae, such as conservation and plant improvement. Induction of
having tuberous underground parts which is rich in polyploidtaka and mutation by Gamma ray
steroidal saponins, having petiolate reticulate irradiation have also been reported. Taka in vitro
veined leaves, and reflexed stamens, while its propagation was conducted at Research center for
acaulescent habit and unilocular ovaries with Biotechnology-LIPI [8], and several others
parietal placentation are distinctive [2]. This experiments have been conducted in this instutute
species is native to western Africa, Southeast Asia such as phytochemical analysis andantioxidant
and northern Australia [3], grows in limited coastal activity of taka grown in a greenhouse compared to
area in Indonesia. those of plantlets grown in vitro[7], cellected the
In Indonesia, taka has been used as food, medium compositions to increase the plantlet
traditional medicine and as animal feed [4]. Taka formation [9], and to investigate the effect of high
was found in Java and surrounding islands [5]. concentrations of sugar suplemented to the culture
Takas from 9 provenances in Indonesia were media on growth of in vitro shoot of taka
characterized using ISSR. It is found that taka had [10].Cluster analysis on Gamma irradiated taka
high level of genetic variation [6]. Vegetative
Page | 310
PROCEEDINGS
plantletsbased on their growth performance temperature of 25-27 °C by irradiating with 800-

resulted in 8 clones of taka [11]. 1000 lux continuously. After culturing for 1 - 2
Somatic cell manipulation through months, leaves were used as source of protoplasts.
protoplast culture and fusionof taka has not
previously been reported yet. Protoplasts offer an Enzyme solution and liquid culture
attractive tool to study genetic transformation, medium preparation
such as delivering foreign genes to protoplasts of
D. alata using a polyethylene glycol-mediated Enzyme solution consisted of 0.7 mannitol
uptake method [12]. Protoplast based technology as osmoticum; three different enzymes: 1% (w/v)
has developed rapidly in citrus breeding programs cellulose Onozuka RS (Phytotech); 1% (w/v)
because it produces hybrids, cybrids and macerozyme R10 (Phytotech); 0,2% (w/v)
transgenic plants [13-14]. Curently protoplast pectolyase Y23 (Phytotech); 6,15 mM MES as a
isolation technique was supporting transient buffer (Sigma); and 24 mM CaCl2; 0,92 mM
genetic transformation and expression in citrus NaH2PO4 as membrane stabilizers. The pH was
[15]. These technique is very useful for genetic adjusted to 5,6 [18]. Liquid medium used for
improvement of taka for cellection of genotypes protoplast culture was 0.6 M BH3 with
which increase in productivity or for other modification [18]. Combination of enzyme
purposes. solution with 0.6 M BH3 medium was prepared for
Protoplasts can be isolated from different protoplast isolation.
plant organs. Mesophyll tissue of leaves are one of
the best sources for a large number of uniform
cells for protoplast isolation. Protoplast isolated Enzymatic protoplast Isolation
from plant tissues retain their cell identity and
differentiate state. An ideal technique for Protoplasts were isolated from leaves of in vitro
protoplast preparation that aims at achieving rapid taka shoot cultures. Four different enzyme
isolation with maximum yield and high metabolic concentrations were used for tissue degradation.
integrity of protoplasts must be observed [16]. The The composition consisted of0.25-1.0%Onozuka
optimum incubation conditions, the concentration RS cellulose; 0.25-1.0%macerozyme R10 and
and combination ofenzymes required to release 0.05-0.2%pectolyase Y23. Concentrations of
viable protoplasts from mesophyll tissue of leaves enzyme stock solution were 2% Onozuka RS
are needed to explore on taka. Leaf of in vitro taka cellulose, 2% macerozyme R10 and 0.4%
was chosen because it has to be aseptic. This pectolyase Y23. Enzyme stock solution was
eliminates the need for decontamination prior to diluted with BH3 medium in the ratio of 1:3; 1:1;
protoplasts isolation. Comparative studies may be 3:1 and no dilution (1:0) (v/v enzyme
essential to optimize the mosteffective solution/BH3 medium) in a 12 ml total volume.
combination of enzymes and their concentrations To isolate protoplasts, leaves of taka were
to maximize the protoplast release [13]. cut into thin strips (2-5 mm) horizontally along the
The aim of this study was to find out a leaves midrib to enhance enzyme penetration.
technique for isolation and purification of taka Tissues were then incubated in enzyme solution
using leaf mesophyll for protoplast culture and using a 100 ml Erlenmeyer flask. Flasks
fusion. containing tissues and enzyme solution were
incubated for 3, 6, 16 and 24 h at 28°C in the dark
on a rotary shaker at 50 rpm.
2. Materials and Methods
protoplast purification
Shoot culture of taka as explants for
sources of protoplasts isolation Protoplasts were first purified by passing
the digestion mixture through a nylon sieve (50-
The explants used in this study werein 100 µm mesh) to remove undigested cell clumps
vitroculture of Tacca leontopetaloides collection and debris, followed by second passing step
of Plant Cell and Tissue Culture Laboratory, through a nylon sieve CellTrics® (Partec) with
Research Center for Biotechnology, Indonesian pores size of 30 µm to synchronize the protoplast
Institute of Sciences (LIPI). Cultures were grown size. Filtrate was collected on 15 mL centrifuge
on MS medium [17] containing 30 g/L sucrose and tube (Corning). Filtrates precipitation was
solidified with 8 g/L agar. Medium was sterilized conducted by centrifugation at 800 rpm for 8 min
by autoclave at 121 °C for 15 min. The cultures (Hitachi Himac 6EL). After removing
were incubated in an incubation room with supernatants, the protoplast sediments and cell
Page | 311
PROCEEDINGS
debris were resuspended with ‗bubling‘ methods In this study, concentrations of enzymes
by added Cell and Protoplast Washing (CPW) and incubation time periode were very crucial to
solution containing of 5 ml of 25% sucrose and obtain the best protoplasts isolation from taka
added with 2 ml CPW containing 13% Mannitol. mesophyll tissues. In vitro leaves from 1-2 months
CPW solution consisted of 27.2 mg/L KH2PO4, old of taka culture used for the isolation of
100 mg/L KNO3, 150 mg/L CaCl2, 250 mg/L protoplasts gave a good yield. Protoplasts were
MgSO4, 0.16 mg/L KI and 0.00025 mg/L CuSO 4, successfully isolated by enzymatic digestion
PH 5.8 [19].CPW mannitol was added drop to ofleaves surrounding cell walls.The enzyme
drop on the top of sucrose layer (to avoid mixing), solution used consisted of appropriate osmoticum,
and suspension was centrifuged for 8 min at 800 enzymes, buffer and cell membrane stabilizers.
rpm. Viable protoplasts usually form a band at the Pectinases digest the middle lamella between
interface between the two layers. The protoplasts adjacent cells, while celluloses remove the walls to
were removed carefully from the interface using a release a population of osmotically fragile naked
Pasteur pipette and washed in 5 ml BH3 medium cells (protoplasts) [20]. Pectolyase is one of
at 800 rpm for 5 min centrifugation. Pellet pectinase member. Macerozyme R10 is an
containing protoplasts was resuspended in an enzyme derived from Rhizopus sp. possesses high
appropriate amount of BH3 medium. Purified pectinase and hemicellulose activity, suitable for
protoplasts were then ready for further decompose plant tissue to isolate single cells.
manipulations. Different protoplast densities were
resulted from 3, 6, 16 and 24 h incubation in 4
Protoplast density measurements with different concentrations of enzymes. After 3 h
haemocytometer incubation, protoplast density isshowed on Figure
2. The result indicated that protoplast density
Protoplasts were observed under an decreased along with reducing enzyme
inverted microscope (Leica, DMIL LED) with 400 concentrations. Protoplast density indicated
times of magnification. Haemocytometer was used significant decreaseon mixed enzymes with media
to count the protoplast density. Protoplast yield from full enzyme concentration to 3:1 enzyme and
was calculated as average of 8 area with 1/16 mm2 liquid medium ratio, while further enzyme
wide and 0.1 mm depth per box. Protoplast concentration reduction had nomore significant
density was defined as protoplast number per ml decrease. The same result occured after 6 h
isolated from 1 g of takain vitro leaves. incubation (Figure 3), and different result occured
after 16 h incubation (Figure 4).
Protoplast density after 6 h incubation
3. Results and Discussion showed an increase at 1:1 enzyme and liquid
medium ratio. These results may be caused by
Isolated protoplasts from leaf mesophyll variation condition of leaves tissues. Leaves of
of taka had spherical shape (Figure 1). The taka werecollected from 1-2 months of culture.
absence of birefringence indicated complete All leaves were used, except the senescence one.
enzymatic removalof the cell wall and showed that This condition may affect the great variation on
osmoticum concentration was suitable to maintaine amount of protoplast released. Different leaf age
viable protoplasts. Since isolated protoplasts are has different physiological conditions as shown by
osmotically fragile, the osmotic pressure of immature and fully expanding leaves. Leaf age of
theculture medium is crucial to prevent lysisor taka as protoplast sources proved to influence the
plasmolysis of protoplasts, especiallyduring the protoplast density. This phenomenon was similar
early stages of culture. with result on protoplast isolation of Vitis spp.
leaves where leaves older than 4 weeks released
fewer protoplasts [21].
Figure 1. Tacca leontopetaloides protoplast cells

after purification (400 x magnification; bar=50
µm).
Page | 312
PROCEEDINGS
concentrations as well as incubation periode for

1,00E+06 each condition of tissue.
Protoplast density
8,00E+05
(cell/mL)
6,00E+05 1,00E+06
Protoplast density
4,00E+05 8,00E+05
(cell/mL)
2,00E+05 6,00E+05
0,00E+00
4,00E+05
1:0 3:1 1:1 1:3
Enzyme:liquid medium 2,00E+05
0,00E+00
Figure 2. Protoplast density after 3 h incubation 1:0 3:1 1:1 1:3
in 4 different concentrations of enzymes diluted Enzyme:liquid medium
with BH3 medium. (Enzymes:BH3 medium
=1:0 (no dilution); 3:1; 1:1; and 1:3).
Figure 4. Protoplast density after 16 h
incubation in 4 different concentrations of
1,00E+06 enzymes diluted with BH3 medium.
Protoplast density
(Enzymes:BH3 medium =1:0 (no dilution); 3:1;

8,00E+05
1:1; and 1:3).
(cell/mL)
6,00E+05
4,00E+05 1,00E+06
Protoplast density
2,00E+05 8,00E+05
(cell/mL)
0,00E+00 6,00E+05
1:0 3:1 1:1 1:3 4,00E+05
Enzyme:liquid medium 2,00E+05
0,00E+00
Figure 3. Protoplast density after 6 h incubation
1:0 3:1 1:1 1:3
in 4 different concentrations of enzymes diluted
with BH3 medium. (Enzymes:BH3 medium Enzyme:liquid medium
=1:0 (no dilution); 3:1; 1:1; and 1:3).
Figure 5. Protoplast density after 24 h
incubation in 4 different concentrations of
Figure 4 shows the optimum protoplast enzymes diluted with BH3 medium.
density was obtained at 1:1 enzyme and liquid (Enzymes:BH3 medium =1:0 (no dilution); 3:1;
medium ratio after 16 h incubation. This 1:1; and 1:3).
incubation period was commonly used in
protoplast isolation of in vitro leaves of yam as the This study indicated that concentrations
same member of Dioscoreaceae as taka [12], of full enzyme mixture (cellulose 1.0%,
Citrus sp. [13-14] and Vitis spp. [21]. Figure 5 macerozyme 1.0% and pectolyase 0.2% without
indicates the similar results as Figure 2 but higher dilution) were sufficient for release of taka leaves
protoplast densities were resulted on 24 h mesophyll protoplast in short (3-6 h) and long
incubation periode. incubation periods (16-24 h), because all
Different type of plant tissue needs treatments producing protoplast up to 1 x 10 5
specified conditions for releasing its protoplasts. cell/mL with optimum incubation periods were 6 h
In Citrus sp. [13], optimal condition for isolating and produced 8.71 x 105 cell/mL of protoplasts.
protoplast from leaves was used 1 part of enzyme
added with 4 part of liquid medium culture for
very tender leaves tissues, but for more hardened
4. Conclusion
tissues commonly used 2:3 ratio of enzyme and
liquid medium. Therefore, it is very important to Protoplasts of taka were successfully
find out the best composition of enzyme isolated by optimizing enzymes concentrations and
incubation time period. Protoplasts were purified
by sucrose and mannitol gradient centrifugation.
Page | 313
PROCEEDINGS
The highest protoplast density was 8.71 x [8] A.F. Martin, T.M. Ermayanti, B.W. Hapsari,
105cell/mL after 6 h incubation in 1.0% cellulose, D.E. Rantau, Proceedings ofthe 5th
1.0% macerozyme and 0.2% pectolyase. The Indonesian Biotechnology Conference an
lowest protoplast density was 3.5 x 104cell/mL International Forum ―Green Industrial
after 3 h incubation in 0.25% cellulose, 0.25% Innovation through Biotechnology‖,
macerozyme and 0.05% pectolyase. These Mataram, Indonesia, 2012, p.240.
optimum condition was suitable for isolation and
[9] A.F. Martin, E. Maulana, T.M. Ermayanti,
purification of protoplasts of taka from mesophyll
Proceeding of the XVIII National Conference
cell of in vitro culture leaves. on Kimia dalam Pembangunan, Yogyakarta,
Indonesia, 2013, p.7.
Acknowledgements
[10] B.W. Hapsari, A.F. Martin, T.M. Ermayanti,
The authors would like to thank Proceedings of the XVIII National
Dr.Witjaksono for supporting this experiment, Conference on Kimia dalam Pembangunan,
Evan Maulana for his assistance on medium Yogyakarta, Indonesia, 2015, p.227.
preparation for taka shoot culture, [11] B.W. Hapsari, A.F. Martin, D.E. Rantau,
LutvindaIsmanjani for her assistance on taka shoot Rudiyanto, T.M. Ermayanti,Proceedings of
culture maintenance. This research was financially the National Conference on Hasil Penelitian
supported by Competitive LIPI program year Unggulan Bidang Pangan Nabati, Bogor,
2012-2013 on somatic cell manipulation: polyploid Indonesia, 2014, p.305.
and protoplast fusion induction forincreasing taro
(Colocasia esculenta) and garut (Maranta [12] M. Tör, C.C., Ainsworth,S.H. Mantell, Plant
arundinaceae) productivity and DIPA thematic Cell Rep.12 (1998) 468.
program on developing PVT (Perlindungan [13] J.W. Grosser, F.G. Gmitter, Plant breeding
Varietas Tanaman) from basic and applied review 8 (1990) 339.
research on Biotechnology-LIPI 2015.
[14] J.W. Grosser, F.G. Gmitter Jr., Plant. Cell.
References Tiss. Organ. Cult. 104 (2011) 343.
[15] C. Liu, J. Long, K. Zhu, L. Liu, W. Yang, H.
[1] L.R Caddick, P. Wilkin, P.J. Rudall, T.A.J. Zhang, L. Li, Q. Xu, X. Deng, Sci. Rep.,6
Hedderson, M.W. Chase, Taxon 51(1)(2002) (2016), 25352.
103.
[16] I. Mukhtar, R. Bajwa, G. Nasim, J.App.Sci.
[2] L. Zhang, H.T. Li, L.M. Gao, J.B. Yang, D.Z. Environ. Manage, 16 Vol.1(2012) 11.
Li, C.H. Cannon, J. Chen, Q.J. Li, J. Integr.
Plant Biol. 53 (2011) 901. [17] T. Murashige, F. Skoog, Physiologia
Plantarum 15 (1962) 473.
[3] U.J. Ukpabi, E. Ukenye, A.O. Olojede, J.
Food Technol., 7 Vol.4 (2009) 135. [18] J.W. Grosser, M. Calovic, E.S. Louzada, In:
M.R. Davey, Anthony (Eds.), Plant cell
[4] A.F. Martin, A. Aviana, B.W. Hapsari, D.E. culture: essential methods, John Wiley &
Rantau, T.M. Ermayanti, Proceedingsof the Sons. Ltd, U.K. 2010, p.175.
XV National Conferenceon Kimia dalam
Pembangunan, Yogyakarta, Indonesia, 2012, [19] E.M. Frearson, J.B. Power, E.C. Cocking,
p.373. Dev. Biol. 33(1973)1130.
[5] F. Syarif, P. Lestari, A.H. Wawo, Berita [20] M.R. Davey, P Anthony, D Patel, J.B.
Biologi 13 Vol.2 (2014) 161. Power, In:M.R. Davey, Anthony (Eds.),
Plant cell culture: essential methods, John
[6] M. Ardiyani, L.D. Sulistyaningsih, Y.N. Wiley & Sons. Ltd, U.K., 2010, p.153.
Esthi, Berita Biologi 13(1)-April (2014) 85.
[21] N.Lee, H.Y. Wetzstein, Plant Cell Rep.
[7] A.H. Wawo, P. Lestari, N.W. Utami, Berita 7(1988) 531.
Biologi14 Vol.1 (2015) 1.
Page | 314
PROCEEDINGS
MULTIPLICATION OF RED GINGER IN VITRO

USING BAP AND NAA
Dwi Fajar Sidhiq1), Ahmad Yunus2), Bambang Pujiasmanto2)

1)
Undergraduate Student of Study Program of Agrotechnology, Faculty of Agriculture, University of the
March (UNS) in Surakarta
2)
Lecturer staff of Study Program of Agrotechnology, Faculty of Agriculture, Sebelas Maret University
(UNS) in Surakarta
Contact Author: dwifajars1402@gmail.com
Abstract
Red Ginger one of medicinal plant that has advantage as a traditional medicine. The high demand of red
ginger must be followed by technology that can provide the red ginger in a short time and pest-disease
free. One way that is rapid propagation of plant by tissue culture. This research aims to obtain the
combination of BAP and NAA concentration which give the best effect on Red ginger growth in vitro.
The research was conducted at the Plant Fisiology and Biotechnology Laboratory Faculty of Agriculture
Sebelas Maret University from March 2015 to May 2016. The completely randomized design with two
factorials (BAP and NAA) was used. The observed parameters include time of shoot growing, shoot
height, shoot number, time of root growing, root length, root number, time of leaf growing, and leaf
number. The result showed that adding Combination of BAP and NAA treatment emerging highest
number of shoots at BAP 2 ppm + NAA 1 ppm (3 pieces), longest shoots with 25,1 cm at BAP 0 ppm +
NAA 0,5 ppm, the highest number of leaves at BAP 0 pppm + NAA 1 ppm with 8 pieces leave,highest
number of roots at BAP 6 ppm + NAA 1 ppm (14 pieces), and the longest roots at combination of BAP 0
ppm + NAA 0,5 ppm with 13,7 cm.
Keywords:Ginger, In Vitro, Multiplication, Plant Growth, Zingiber officinale var. rubrum
1. Introduction techniques which are less precise, and pests and

diseases of plants. Red ginger Rhizome also has
Indonesia is a potential market and has good the nature of dormant whenautumn, so that need
prospects for the development of medicinal plants. special handling. Need for the provision of seeds
The benefits are very diverse primarily for keeping that are not derived from the rhizome to resolve
and maintaining the health of the already widely the problem. One way of providing seedlings
known by the public. Ginger is one of the rapidly through tissue culture. Tissue culture is a
medicinal plants that have a lot of benefits and technique to grow cells, tissues, organs of plants in
much sought after community. One type of ginger the sterile media. Singh and Satty (2011) report the
that has benefits as traditional medicine is red replacement of conventional methods with tissue
ginger. Red Ginger rhizome has an aroma and culture can increase crop productivity in the same
flavor that is very strong compared to other types area.
of ginger. In addition the content of its nutrition Reproduction of plants through tissue culture
value is high enough, red ginger rhizome contains needs to be spurred to use several substances
starch 52,9% 3.9% essential oil, and alcohol- growing regulatory for the results match our
soluble extract 9.93% (Hernani and Hayani 2001). desire. Growing regulatory substances used are
Red ginger usually farmed conventionally, but Benzyl Amino Purine (BAP) and Naphthalene
there are some fundamental constraints include the Acetic Acid (NAA). The function of both the
unavailability of quality seeds, cultivation
Page | 315
PROCEEDINGS
growing regulatory substances are stimulating the sat appears leaves, and the number of leaves. Next
growth of roots and shoots. analyzed data obtained in descriptive, i.e.
Based on the above problems then the research describing the results of observation research.
needs to be done to get the concentration of BAP
and an appropriate increase in the NAA 3. Result and Discusion
multiplication in vitro red ginger and Red ginger
reproduction methods appropriate for the provision Shoots emergence
of seedlings of Red ginger quickly. This research
is expected to benefit in the form of knowledge for Table 1 shows that not all treatments are able
businessman in the field of the provision of to grow shoots until observation ends, this is due
seedlings of red ginger, so it can provide the seeds to the high contamination when planting explant.
quickly. The contamination occurred allegedly because
internal contaminants originating from eksplan
2. Methods (endophyte) form of bacteria and fungi. According
to Sinaga et al. (2009) is a group of fungal
This research was carried out in March 2015 endophyte fungus that part or all of his life in the
until May 2016 in the laboratory of Plant tissue. Fungal endophyte on rhizome generally
Physiology and Biotechnology Faculty of secondary metabolites and producing a lot of
Agriculture Sebelas Maret University Surakarta. found on plants especially on medicinal plants.
This study used a Randomized Complete Design Internal contaminants are more difficult to be
(RAL) 2 factors. The first factor was the controlled because with just external sterilization is
concentration of BAP comprises four ranks, not able to kill the endophyte which lives within
namely 0 ppm (B0), 2 ppm (B2), 4 ppm (B4) and 6 the plant tissue.
ppm (B6). The second factor was the concentration The emergence of buds in the process of in
of NAA consists of four levels, namely 0 ppm vitro culture is one of the indicators to know the
(N0), 0.5 ppm (N1), 1 ppm (N2), 1.5 ppm (N3), so growth and development of eksplan. The
the retrieved 16 combination treatment and each appearance of shoots range from 5 HST to 20
repeated three times. HST. Most buds appear on 11 HST with
Research governance includes the seedbed of combination treatment treatment NAA 0 ppm up to
red ginger , bottle washing, creation of culture 1.5 ppm and BAP 2 ppm to 6 ppm. The emergence
media and stock solutions of Murashige and Skoog of the fastest shoot in combination treatment of
(MS), sterilization of tools and explant, then BAP 2 ppm with NAA 1 ppm, and BAP 2 ppm
planting explant in MS media. Explant planting do with NAA 1.5 ppm which occurred on 5 HST.
in Laminar Air Flow (LAF). The maintenance is Combination of sitokinin and Auxin that right can
by pouring alcohol every 3 days to minimize the spur morphogenesis in the formation of buds
occurrence of contamination. Red ginger planlet (Lestari 2011). It is also supported by the Gubbuk
harvesting 60 days after planting. and Pekmezci statement (2004) states that the
The independent observations include time concentration of the right sitokinin can increase
appears the number of buds, shoots, buds, roots, breeding shoots.
appears when the number of roots, root length, the
Table 1. Average time of emerging shoots (HST) with various concentration of BAP and NAA
NAA (ppm)
BAP 0 0.5 1 1.5 Average
(ppm) 1 2 3 1 2 3 1 2 3 1 2 3
0 20 - - 13 - - 17 - - 6 - 19 15
2 7 11 14 - 11 - 7 11 5 5 - - 8.9
4 7 11 - 7 - 16 - - - 11 - - 10.4
6 17 13 16 17 11 10 13 9 11 16 - - 13.3
Average 12.9 12.1 10.4 11.4
Description:
DAP : Days After Planting
- : not emerging shoots.
Page | 316
PROCEEDINGS
Number of shoots in the number of shoots. It also supported the

statement of Ngumuo et al. (2014) that sitokinin is
The number of shoots is an important indicator known to boost the formation and growth of
of success in multiplication. The more buds shoots, while the Auxin encourages root
formed then the higher levels the multiplication. In development and induction. Higher concentrations
tissue culture, the number of buds can also indicate will cause a decrease in response plants drastically.
in as a benchmark of success in multiplication. BAP is a cytokinin type of plant growth,
According to Lestari (2011), the more buds formed Wilkins (1989) States that BAP is the active
have a possitive corelation with seeds that can be cytokinin that when given on the buds and shoots
produced through in vitro techniques. will encourage poliferation root and the discharge
Based on table 2 it can be seen that most of the shoot more than one. If seen from table 2 is best
explant was only able to bring up 1 shoots, not combination treatment on BAP 2 ppm + NAA 1
many eksplan who was able to bring up more than ppm and 4 ppm BAP + NAA 1.5 ppm which is
1 shoots. The granting of the concentration of able to bring up three shoots. The addition of BAP
Auxin and cytokinin on the media to be precise so in higher concentrations are able to induce more
as to produce shoots in large quantities. The shoots. This is in accordance with statement of
number of shoots on the treatment of the BAP 2 Pardal et al. (2004) that if the comparison
ppm and NAA 0 ppm on average produce 1 cytokinin higher than for Auxin, then cytokinin
shoots. It's supposedly inappropriate combination, will spur towards the setting up of the buds, and
because was only able to bring up 1 shoots. Faisal vice versa if the Auxin higher than cytokinin will
et al. (2007) mentions that the reduction of the drive the growth of the root.
concentration of sitokinin can lead to a reduction
Table 2. Average number of shoots with a combination of concentration BAP and NAA
NAA (ppm)
BAP
0 0.5 1 1.5 Average
(ppm)
1 2 3 1 2 3 1 2 3 1 2 3
0 2 - - 2 - - 1 - - 2 - 2 1.8
2 1 1 1 - 1 - 1 3 1 1 - - 1.2
4 1 1 - 1 - 2 - - - 3 - - 1.6
6 1 1 1 1 1 1 1 1 1 2 - - 1.1
Average 1.1 1.3 1.3 2
Description:
- : not emerging shoots
Shoots height with other treatment combinations are also quite

high.
One of the most important stages in the This is allegedly due to an interaction between
reproductionof red ginger in vitro is at the stage of the endogenous hormones the right explant with
regeneration shoots, i.e. lengthening shoots exogenous hormones are added. George and
(George 1996). Height of bud is one of the easiest Sherrington (1984) stated that the growth and
variable to observe the plant growth. Heightof development of the explant affected the presence
buds are affected by interactions between NAA of interaction and balance of exogenous and
and BAP. The higher the buds formed the better endogenous plant growth.
response internally developed plants in vitro. Average height of lowest shoots in NAA
Based on table 3 indicates that the highest treatment 1.5 ppm with average 1.1 cm. It is
produced shoots on combination treatment BAP 0 accordance with the statement of Karjadi and
ppm and NAA 0.5 ppm 25.1 cm high, with not far Buchori (2007) which says that high planlet tends
different treatment BAP 0 ppm and 1 ppm NAA to decrease with increasing the concentration of
also have high shoots 22.8 cm when compared NAA. Auxin in high concentrations will cause a
stopping cell enlargement.
Page | 317
PROCEEDINGS
Table 3. Average plant height (cm) as various concentrations of BAP and NAA
NAA (ppm)
BAP
0 0.5 1 1.5 Average
(ppm)
1 2 3 1 2 3 1 2 3 1 2 3
0 4.7 - - 25.1 - - 22.8 - - 0.9 - 1.8 11
2 0.4 0.3 0.5 - 0.5 - 1.7 7.9 5 0.5 - - 2.1
4 0.3 4.5 - 0.7 - 0.6 - - - 1.7 - - 1.6
6 0.3 0.4 0.4 0.3 4.2 1 0.7 0.7 0.4 0.9 - - 0.9
Average 1.3 4.6 5.6 1.1
Description:
- : not emerging
Roots emergence Based on table 4. not all of the combination

treatment was able to produce shoots and roots, but
The time of occurrence of the root is one of the produces 65% eksplan planted was able to induce
indicators is important in plant growth. The root root although not induce bud. Table 4 indicates the
has the primary function of absorbing nutrients root appears in the range 4 to 20 HST HST,
from the media culture. Therefore carried out however most roots appear on the HST 6. At the
various efforts to be able to grow roots. One way moment the fastest roots appear to occur at 4 ppm
that's done is add ZPT. ZPT used to stimulate the and BAP treatment NAA 0.5 ppm i.e. 4 HST.
growth of the roots i.e. ZPT type of Auxin. Induction of the root affected by Auxin is added to
According to Wattimena (1988), a plant hormone the media. According to Liu et al. (2002) Auxin
Auxin is essential for cell division and also the induces formation of complicated process of lateral
formation of roots. roots through repeated cell division.
Table 4. Average time emerging the root (HST) at different concentrations of BAP and NAA
NAA (ppm)
BAP
0 0.5 1 1.5 Average
(ppm)
1 2 3 1 2 3 1 2 3 1 2 3
0 12 - - 17 6 - 18 - - 20 9 11 13.2
2 9 6 6 5 6 6 12 6 10 5 11 - 7.5
4 - 6 - 4 8 11 - - - 14 13 - 9.3
6 - 13 - - 6 8 10 - 6 16 6 - 9.3
Average 8.7 7 10.3 11.7
Description:
- : not emerging roots.
Number of roots formation of roots. NAA is able to generate a

strong rooting system.
The root is one of the vital organs within a Based on table 5 it can be seen that the number of
plant, which serves to absorb water and nutrient roots most resulting from the combination
elements for the process of photosynthesis and the treatment BAP 6 ppm and 1 ppm of NAA with 14
metabolism of plants. The number of roots that root, not unlike the combination treatment BAP 0
grows berkolerasi with the absorption of nutrients ppm and NAA 1.5 ppm also mengasilkan 13th
in the media culture. The more the number of root. The number of roots that appears allegedly
roots, the expected explant is able to absorb the due to the womb Auxin and sitokinin are balanced
nutrients in the media culture are more optimal. so that roots are able to appear. Raihana et al.
Nickell (1982) States that Naphthalene acetic acid (2011) explains in general terms, the ratio of
(NAA) and Indole Butyric acid (IBA) is a type of sitokinin against high Auxin will be favorable to
active Auxin which can be used to stimulate the the formation of buds. In contrast, the ratio of
Auxin against high sitokinin it will be profitable in
the formation of roots.
Page | 318
PROCEEDINGS
Table 5. Average number of roots at different concentrations of BAP and NAA
NAA (ppm)
BAP
0 0.5 1 1.5 Average
(ppm)
1 2 3 1 2 3 1 2 3 1 2 3
0 9 - - 10 4 - 6 - - 2 8 13 7.4
2 1 6 6 2 8 5 1 6 6 1 1 - 3.9
4 - 9 - 2 2 2 - - - 1 3 - 3.2
6 - 1 - - 11 1 6 - 14 8 9 - 7.1
Average 5.3 4.7 6.5 5.1
Description:
- : not emerging roots.
produce eksplan with most root length i.e. 13.7
Roots length cm. Eksplan with the most short roots resulting
from the combination treatment BAP 2 ppm and
The length of the roots is also one of the indicators NAA 1.5 ppm 0.3 cm. long, based on Table 6 of
of success in tissue culture. The length of the root some combinations of treatment, the average grant
is associated with the range of nutrient elements in of NAA is the awarding of the most excellent
getting the media to grow the plant. Increasingly NAA 0.5 ppm, which was able to produce average
long roots, hence the broad range of absorption 3.2 cm root length and BAP 0 ppm with average
will also be more extensive. 4.4 cm long.
Based on the combination treatment table 6,
BAP 0 ppm and NAA 0.5 ppm was able to
Table 6. The average root length (cm) at different concentrations of BAP and NAA
NAA (ppm)
BAP
0 0.5 1 1.5 Average
(ppm)
1 2 3 1 2 3 1 2 3 1 2 3
0 3.8 - - 13.7 2.2 - 3.5 - - 0.6 2.1 5.2 4.4
2 0.7 3.6 3 0.8 2.3 4,4 0.4 3 1.8 0.3 1.2 - 2.6
4 - 4 - 1.2 0.9 0,7 - - - 1.9 0.6 - 1.6
6 - 1.5 - - 4.1 1,5 1.9 - 2.5 2.8 2.5 - 2.4
Average 2.8 3.2 2.1 1.9
Description:
ppm : part per million
- : no emerging roots
Leaves emergence the fastest leaves indicated by the treatment

combination BAP 2 ppm and 1 ppm NAA i.e. 14
Leaves is a vegetative organs are essential for HST. It is in accordance with the statement of the
plants. The hallmark of the leaves generally have Buah et al. (2010) that axiler shoots and adventive
green color, have the substance chlorophyll for aksiler and also the formation of leaves affected by
photosynthesis. The growth of leaves affected by the addition of the BAP. Treatment of BAP 2 ppm
Nitrogen content in media culture. According to and 1 ppm of NAA is able to bring up the leaves
Pierik (1987), organic N sources on media culture faster than in the other treatments. Whereas when
in the form of NH4 + and NO3-, the N content of the leaves appear at the latest was BAP 0 ppm and
the highest on the basic tissue culture media NAA 0 ppm or control i.e. 48 HST treatment,
contained on the media base MS. The emergence because the controls are not added to the BAP.
of leaves was also influenced by ZPT i.e. The presence of contamination causes a
cytokinin. According to Wetherell (1982) cessation of growth of explant. According to Islam
cytokinin has a role that is stimulates cell division et al. (2004) the researchers assumed that
and stimulates the growth of shoots and leaves. contamination on the rhizome of the plant eksplan
Based on Table 7 looks that only a few explant come from the land of very high and efforts for
are able to grow leaves. The leaves begin to grow disease free culture will be very difficult to do.
in the range of 14 to 48 HST. The time appeared This is supported by research conducted by
Page | 319
PROCEEDINGS
Hamirah et al. (2007) the Red ginger, researching cm at the time of the final observations of the
about that red ginger endurance his life will induced endogenous microorganism found in
plummet if planted with a length of 0.5 cm and 1 explant grown.
Table 7. The average time of emerging leaves (HST) at different concentrations of BAP and NAA
NAA (ppm)
BAP
0 0.5 1 1.5 Average
(ppm)
1 2 3 1 2 3 1 2 3 1 2 3
0 48 - - 25 - - 25 - - - - - 32.6
2 - - - - - - - 14 21 - - - 17.5
4 - 28 - - - - - - - - - - 28
6 - - - - 28 - - - - - - - 28
Average 38 26.5 20 -
Description:
- : not emerging leaves
Number of leaves highest leaves appear on the treatment of the BAP
0 ppm and 1 ppm NAA IE 8 strands, followed by
The leaf is the organ which is used for the treatment of the BAP 0 ppm and NAA 0.5 ppm
process of photosynthesis. The number of leaves with 7 strands of leaves. Whereas the amount of
related to photosynthesis of plants, since the leaves the lowest leaves on the treatment of the BAP 0
contain chlorophyll as a place for the process of ppm and NAA 0 ppm (control), BAP 4 ppm and
photosynthesis (Mufidah 2013). The greater NAA 0 ppm, and BAP 6 ppm and NAA 0.5 pp, i.e.
number of leaves, the more number of 1 strands of leaves. The number of leaves affected
photosynthat produced. The number of leaves also by the BAP, it is delivered by Yelnititis et al
indicates the growth of explant is good. In this (1999) that the addition of BAP on media can
study, the number of leaves were observed and encourage the growth of leaves, but leaves most
calculated at the end of observation, i.e. when precisely at the treatment that uses a BAP 0 ppm.
eksplan reaches 60 HST. This is allegedly due to endogenous hormones in
Table 8 shows that the average number of plants is already sufficient.
leaves that grow in the range of 1 to 8 strands. The
Table 8. Average number of leaf at different concentrations of BAP and NAA
BAP NAA (ppm)

Average
(ppm) 0 0.5 1 1.5
0 1 7 8 - 5.3
2 - - 1.5 - 1.5
4 1 - - - 1
6 - 1 - - 1
Average 1 4 4.8 -
Description:: not emerging leaves
4. Conclusion and Advice cm from the treatment of the BAP 0 ppm +

NAA 0.5 ppm, the highest number of leaves on
Conclusion the combination BAP 0 ppm + NAA 1 ppm
Based on the above description it can be with 8 strands of leaves, highest number roots
concludedthat: on a combination of BAP 6 ppm + NAA 1 ppm
1. Treatment of the BAP gave rise to shoots at (14 pieces), and the longest roots resulting
most 3 shoots at a concentration of 2 ppm and from a combination of BAP 0 ppm + NAA 0.5
4 ppm, at a concentration of 6 ppm was able to ppm 13.7 cm in length.
produce the highest number of roots with 14 2. Treatment of NAA gave rise highest shoots at
roots, and highest leaves at concentration of 0 concentration 1.5 ppm which generate average
ppm IE 8 strands. (3 buds), longest shoots 25.1 2 shoots and also a number of root with 13
Page | 320
PROCEEDINGS
roots, whereas on the concentration of 0.5 ppm MS. Proc. International Seminar on natural
was able to produce the highest shoots (25.1 products chemistry and utilization of natural
cm), the longest root i.e. 13.7 cm, and highest resources. UI-Unesco, Jakarta : 501-505
leaves IE 7 strands.
[8] Islam A, Kloppstech K, Jacobsen J. 2004.
3. The combination treatment of BAP and NAA
Effect of benzylaminopurine (BAP) pulsing
gave rise to shoots at most on BAP 2 ppm +
on in vitro shoot multiplication in Curcuma
NAA 1 ppm
longa l. (Zingiberaceae) – a medicinal plant
of tropical asia. Plant Tissue Culture.
Advice 14(2):123-134.
Based on this research, more research needs to be [9] Lestari EG 2011. Peranan zat pengatur
done about the concentration of BAP and NAA tumbuh dalam perbanyakan tanaman melalui
reproduction which is optimum for Red Ginger in kultur jaringan. J AgroBiogen 7(1):63-68.
in vitro. As well as the way or a more refined [10] Liu C, Zhu J, Liu Z, Li L, Pan R, Jin L. 2002.
method of sterilization in order to explant the Exogeneous auxin effectson growth and
resulting contamination does not occur and are phenotype of normal and hairy roots of
able to survive until the end of the observation. Puerarialobata (Wild.) Ohwi. Plant Growth
Regul. 38: 37-43.
Acknowledgements
[11] Mufidah N. 2013. Pengaruh pemberian 2,4-D
The authors acknowledged the financial support by dan BAP terhadap pertumbuhan eksplan
INSINAS RISTEK DIKTI 2014 - 2015. bawang putih (Allium sativum L.) Skripsi.
Fakultas Pertanian UNS. Surakarta.
References [12] Ngumuo M, Mneney E, Ndakidemi PA 2014.
The in vitropropagation techniques for
[1] Buah JN, Danso E, Taah KJ, abole EA, producing banana using shoot tip cultures.
Bediako EA, Asiedu J, Baidoo R. 2010. The Am. J. Pl Sci. 5:1614-1622.
effects of different concetrationcytokinins on
[13] Nickell, L. G. 1982. Plant Growth Regulators
the in vitro multiplication of plantain (Musa
Agricultural Uses.Springer-Verlag.Berlin
sp.).J Biotech 9(3): 343-347.DOI
Heidelberg. New York.
10.1007/s11816-007-0025-4
[14] Pardal SJ, I Mariska, EG Lestari, Slamet.
[2] Faisal M, Ahmad N, Anis M 2007. An
2004. Regenerasi tanaman dan transformasi
efficient micropropagation system for
genetik salak pondoh untuk rekayasa buah
Tylophoraindica: an endangered, medicinally
partenokarpi. J. Biotek Pert 9(2):49-55
important plant. J PlBiotec Rep.1:155-161.
[15] Pierik RL. 1987. In vitro culture of higher
[3] George EF, Sherrington PD 1984. Plant
plants. Dordrecht (NL): artinus Nijhoff
Propagation by Tissue Culture. London:
Publishers.
Exegetics Ltd.
[16] Raihana R, Faridah QZ, Julia AA,
[4] George EF. 1996. Plant Propagation by
Abdelmageed AHA, Kadir MA 2011. In vitro
Tissue Culture Part 1 n Practice. 2nd
culture of curcuma mangga from rhizhome
Edition. London (UK): Exegetics Limited.
bud. J. of med pl research Vol. 5(28):6418-
[5] Gubbuk H, Pekmezci m. 2004.N Vitro 6422. DOI: 10.5897/JMPR11.673
Propagation of Some New BananaTypes
[17] Sinaga E, Noverita dan Fitria D 2009. Daya
(Musa spp.).Turkish J. of Agric and Forestry.
antibakteri jamur endofit yang diisolasidari
28(5):355-361
daun dan rimpang lengkuas (Alpinia galangal
[6] Hamirah M.N, Sani H.B, Boyce P.C, and Sim Sw.). J. Farmasi Indonesia. 2009: 4(4):161-70
S.L. 2007.Micropropagation of red ginger, a
[18] Singh G, Satty S 2011. Impact of tissue
medicinal Plant.In : Proceedings Asia Pacific
culture on agriculture in India. Review
Conference on Plant Tissue Culture and
Biotechnol Bioinf Bioeng Vol. 1(3): 279-288.
Agribiotechnology (APaCPA). Pp 17-21
[19] Wattimena GA 1988.
[7] Hernanidan E. Hayani. 2001. Identification
ZatPengaturTumbuhTanaman. Bogor:
of chemical components on red ginger
LembagaSumberdayaInformasi IPB.
(Zingiberofficinale var. Rubrum) by GC-
Page | 321
PROCEEDINGS
[20] Wetherell DF. 1982. Pengantar propagasi [22] Yelnititis, Bermawie N, Syafarudin. 1999.
tanaman secara in vitro. Semarang (ID): IKIP Perbanyakan klon lada varietas panniyur
Semarang Press. secara in vitro. J. Littri 5(3):109-114.
[21] Wilkins, M B. 1989. Fisiologi Tumbuhan.
Cetakan Kedua. Jakarta: Bina Aksara.
Page | 322
PROCEEDINGS
PERFORMANCE OF MENTIK WANGI RICE GENERATION M1

FROM RESULTS OF GAMMA RAY IRRADIATION
Raden Dirgory Kuneng Brokusumojo1, Ahmad Yunus1, and Sri Hartati2

1.
Department of Agrotechnology, Faculty of Agriculture, Sebelas Maret University, Jl. Ir. Sutami 36 A,
Surakarta, 57126, Indonesia
Research Group, Institution, Address, City, Zip Code, Country
E-mail: radendirgory_tkg@yahoo.co.id
Abstract
Mentik wangi is one of the local rice varieties in Indonesia less attractive to farmers. That is because the
rice Mentik wangi has some weakness, namely a long harvest time, easy to collapse, and the results less
than the maximum productivity. To increase the interest of farmers in rice cultivation Mentik wangi, then
an attempt is made to improve the quality of rice Mentik wangi properties with plant breeding techniques
one of which is a genetic mutation using gamma radiation. This study was conducted to determine the
performance (performance) of rice Mentik wangi (M1) results of gamma-ray radiation that is expected to
have a positive properties of new or better than its origin. This research was conducted in paddy fields in
the village of Nangsri Lor, District Kebakkramat, Karanganyar and implemented in September 2015 to
January 2016. Data were analyzed by descriptive with sorting and comparing each individual plant at
each radiation dose to the average control accurately and objective. The results showed that gained some
plants that could potentially be a mutant plant that has better properties (positive) that appears at the
variable plants from each individual plant, ie the number of lines T16 with a radiation dose of 300 gray
tall plants are very short 86 cm, strain number T204 with a radiation dose of 200 gray pick the highest
panicle length of 33.5 cm, strain number T133 with a radiation dose of 100 gray has a total number of
tillers and productive tiller high of 17 rods (total) and 11 rods (productive), strain number T133 with
radiation dose of 200 gray had the highest number of filled grain and 624 grain strain T70 numbers with a
radiation dose of 100 gray had the highest percentage of filled grain at 96%, and the number of lines T (1-
7) with a radiation dose of 100 gray and strain number T ( 1-9) with a radiation dose of 200 gray had a
shorter harvesting time is 110 days.
Keywords: performance, gamma radiation, mutant plant
1. Introduction wangi can be developed to improve the results of

its productivity. The development of plant
Mentik wangi is the local varieties of rice breeding has been widely performed by modern
plant (Oryza Sativa l.) in Indonesia. Mentik wangi techniques namely irradiation of gamma rays.
came from Magelang Regency, Central Java. Gamma rays is one physical mutagens are often
Mentik wangi varieties have the advantage in a used in the technique of insertional plant.
typical and natural aroma and the texture of the A mutation that is expected is that it may
rice sticky so attractive to most of Indonesia cause the diversity in the nature of which will be
society to consume. However, varieties of Mentik selected so that the nature or the better character
wangi has weaknesses, namely at the age harvest can be selected, while a good character on
of about 125 days (4 months) so the less sought crops/varieties of origin are retained. The purpose
after by farmers to grown due to exceeding the age of this research is to obtain information for the
harvest an average of about 3 months. In addition, performance of Mentik wangi (M1) from the
the weakness of the Mentik wangi is easy to results of gamma ray irradiation, as well as
collapsed [1]. selecting the individuals of the plant that produces
The potential owned by the Mentik wangi the radiation yield characters better than its parent.
can be maintained while the weakness of Mentik
Page | 323
PROCEEDINGS
Experiment research about mutation of of tools for laboratory analysis and in airy. The
gamma ray irradiation has been widely performed materials used include fragrant rice seed Mentik,
in Indonesia especially by the nuclear energy manure, urea, SP36 and KCl.
agency (BATAN). Up to this point, the activities This research use the draft treat
of the exaltation of the mutation in the BATAN observations on each individual dose of radiation
has produced 22 varieties of superior plants, by comparing the average value of the control
consisting of 15 rice, soybean, 5 soybeans, 1 green treatment for knowing the difference and influence
beans, and 1 cotton [2]. One of the varieties of rice of radiation against the growth of Mentik wangi.
have been produced and have a positive advantage The treatment of this research consists of rice seed
is sidenuk varieties which are derived from gamma 773 Mentik wangi with given 3 doses of gamma
ray irradiation on pandan wangi varieties. ray irradiation. Without Radiation treatment or
The doses of irradiation that used to induce control (R0) amounted to 100 seeds, dosa 100 gray
diversity is succesfully determines the formation (R1) totaled 232 seeds, dose 200 gray (R2) totaled
of mutant plant. If the irradiation is carried out on 221 seeds, and a dose of 300 gray (R3) totaled 221
seeds (such as rice), in general the effective dose seeds. The data is analyzed with descriptive
range of the higher amount between 100-500 Gray obtained by comparing each individual crop on
than if done on other plant parts such as each dose of radiation with an average control
ornamental plants (carnations and because research has the purpose to know the
chrysanthemums) which only at doses of positive development of the quality individual to
irradiation between 25-120 Gray). It because each accurately and objectively.
type of, part, and age of the plant have the
sensitivity and responsiveness of different types 3. Results and discussion
and doses of irradiation against. High doses of
these mutations will cause the frequency of The height of plant
occurrence of mutations is becoming increasingly
high. Doses that are considered effective dose is A good height of rice crops in General is to
50% resulting in death (LD50) of the population have short plant height (< 115 cm). Height shorter
who get treatment [3]. Determination of the plants make plants resistant to fall because of the
effective dose of irradiation is a prerequisite for the wind and forth. Sobrizal [7] in his research that the
development of genetic variation and breeding shorter the crop expected the plant will be a solid
result of mutations [4]. foundation not easily collapsed due to exposure to
On rice crops, the recommended dose is the wind. Based on table 1, high plant low and
lower than the curve of the LD50 (Lethal Dose 50) high plant group is the best are on radiation dose
below 500 doses of Gray [5]. LD50 is the dose T16 300 strains of gray that is 86 cm compared
causing 50% mortality of population irradiated [6]. with an average of 116 cm. It shows that there is
an indication of the occurrence of a mutation
2. Methods because found the differences of the performance
T16 strain phenotype with a dose of radiation that
The research was carried out in September appears gray 300 look more plant height runt.
2015 until January 2016. Take a place in paddy Based on table 1, high plant low and high plant
fields in the village of Nangsri, district group is the best are on radiation dose T16 300
Kebakkramat Lor, Karanganyar Regency with strains of gray that is 86 cm compared with an
height 95 mdpl and including soil type rice has average of 116 cm. It shows that there is an
ordo Inceptisol or Alluvial. Radiation seeds indication of the occurrence of a mutation because
Mentik wangi with gamma rays at the Center for found the differences of the performance T16
the application of Isotope and radiation (PAIR), strain phenotype with a dose of radiation that
the National Atomic Energy Agency (BATAN) in appears gray 300 look more plant height runt.
South Jakarta. Tools used in this research include Based on table 1 shows that the dose of radiation
tools to radiate the seeds "The Gamma Chamber treatment on the 100, 200, and 300 gray has a
Cobalt 60", PIN, stationery, meter label, Board, wider range of value compared with the control
net, jar, newspaper or paper folio (envelope), a set treatment.
Page | 324
PROCEEDINGS
Table 1. The Height of The Palnt in Different Doses of Irradiations

Doses of The lower plant height The highest plant height
Range Average
Irradiations
Strain Height of plant (cm) Strain Height of Plant (cm) (cm) (cm)
(gray)
0 T43 107 T6 134 107 – 134 116
100 T210 102 T29 143 102 – 143 123
200 T215 101 T43 144 101 – 144 124
300 T16 86 T35 147 86 – 147 117
Treatment with irradiation plant breeding in Total amount of sampling

rice varieties and airy Mandoti Ase may cause
some changes to characters such as plant The total number of saplings of correlated
morphology is shorter than not radiation [8]. A positively with the results a better productivity. An
good height of rice crops in General is to have indication of the occurrence of a mutation done by
short plant height (< 115 cm). Height shorter selecting and sorting the individual number of
plants make plants resistant to fall because of the saplings of the best total i.e. by comparing the total
wind and forth. Sobrizal [7] in his research that the number of individual sapling most of the radiation
shorter the crop expected the plant will be a solid dose T133 100 strains of gray totaled saplings total
foundation not easily collapsed due to exposure to 17 rods with an average treatment controls have a
the wind. number of saplings of a total of 6 stems. An
The increasing radiation dose given resulted indication of the occurrence of a mutation can be
in the increasing difference between the high seen from the range of values in table 2, that the
ranges of the plants, the high value of the range of value of the range of radiation dosing treatment
variation in the extent of genetic diversity. shows a wider genetic diversity (3-17, 3-12, 3-11
Research results are ever done shows a decrease in trunk) compared to the control treatment (3-9 rod).
the high rice plant by increasing the dosage of
irradiation, and loss that is directly proportional to
the increase in dose [9].
Table 2. Total Amount of Sapling In Different Doses of Irradiations
Doses of The lower amount of Sapling The highest amount of Sapling

Range Average
Irradiations Amount Amount
Strain Starin (stem) (stem)
(gray) (stem) (stem)
0 T67 3 T46 9 3–9 6
100 T7, T37, T216, T226 3 T133 17 3 – 17 7
200 T1 3 T16, T115, T204 12 3 – 12 7
300 T69, T107, T109 3 T97, T220 11 3 – 11 6
Many mutants that have been identified and has an average number of saplings of productive
proved to be better than their elders by way of i.e. 5 stems. It shows that the occurrence of
selecting and sorting out the best results [10]. The mutations is marked with an indication that there is
total number of saplings more shows the a change in the phenotype of an individual plant.
emergence of opportunities for individuals who An indication of the occurrence of a mutation can
have better properties. Wide genetic diversity that be seen from the range of values in table 3, that the
is a requirement of success against the selection of value of the range of radiation dosing treatment
the desired properties in the process of plant shows a wider genetic diversity (3-11, 3-9, 2-8
breeding [11]. rods) compared to the control treatment (3 to 7
rods).
The number of productive sapling Research results Wijaya [12], that the
radiation doses of the treatment produces a number
The number of saplings of the best of gray 20 chicks more than controls on a celery
productive has one of the more prolific saplings in plant shows the occurrence of a change of the
the radiation dose with T133 strains 100 gray i.e. nature of that look (phenotype).
11 stem as compared with an average of control
Page | 325
PROCEEDINGS
Table 3. The Number of Productive Sapling In Different Doses of Irradiations

The lower amount of The highest amount of productive
Doses of
productive sapling sapling Range Average
Irradiations
Amount Amount (stem) (stem)
(gray) Strain Strain
(stem) (stem)
0 T67, T68 3 T36, T38, T51 7 3–7 5
T75, T26, T30,
100 2 T133 11 2 – 11 5
T57
T16, T39, T53, T102,
200 T29 2 9 2–9 6
T116, T133
300 T1,T17 2 T62, T220 8 2–8 5
Genetic diversity is determined from the The lenght of the panicles

extent of the difference between a range of such
plants in the population, in the results of his Plant mutants with better characteristic
research on the intersection of rice plant Gogo with known from long panicles of highest on each strain
the properties of a new type of Anther culture compared with the average length of the malai
results explains there is a highest productive tidal treatment control. Long panicles of the highest
range shows the vast diversity in anther culture results may affect the productivity of paddy rice
results from strain crosses Rarem Way, anther panicle length because significantly correlated
culture results strain from Kampung SGJT-36 positively with grain weight per clump, which is
anther culture, a result of the Fatmawati, and none other than results per ha [14]. Based on table
anther culture results from strain SGJT- 4, there are the highest in strain T204 radiation
36/Fatmawati higher than the elder (> 8 rods) [13]. doses 200 gray i.e. 33.5 cm. Length of the highest
panicles better than the average control i.e. 27.011
cm. The long range of the panicle showed that
gamma ray radiation dosing has a wider diversity
compared to the control treatment.
Table 4. The Lenght of The Panicles In Different Doses Of Irradiations
The Lower Length of the The Longest Lenght of the

Doses of Panicles panicles
Range Average
Irradiations The Length of The Length of
(cm) (cm)
(gray) Strain panicles Starin panicles
(cm) (cm)
T5, T15, T16,
0 T19 21 29.5 21 – 29.5 27.011
T37
100 T26 19 T49 31.5 19 – 31.5 26.09
200 T94 21 T204 33.5 21 – 33.5 26.52
300 T124 19.5 T64, T220 29.5 19.5 – 29.5 25.85
It indicates that the occurrence of mutations The amount of content per grain
in each individual who poses the greater clumps and percentage content of grain
opportunities in the mutant plants are better than
its parent. The success of plant breeding depends per clumps
on the availability of genetic diversity, the more An indication of the occurrence of a
extensive genetic diversity owned will be even mutation on the independent observation of the
greater chances of success for the plant breeding amount of content contained on the performance of
program [15]. grain contents of most number of phenotype and
the lowest i.e. number of grain most content
resides on the radiation dose with T133 strains 200
gray as , many as 624 seeds and the amount of the
lowest content of the grain is at radiation doses
T76 strain 300 gray 15 seeds compared to the
average amount of grain contents i.e. 281 seed.
Page | 326
PROCEEDINGS
Table 5. The Amount of Content Per Grain In Different Doses of Irradation
Doses of The Lowest grain The highest grain

Range Average
Irradiations Amount Percentage Amount Percentage
Strain Strain (seeds) (seeds)
(gray) (seeds) (%) (seeds) (%)
0 T68 158 61 T60 450 75 158-450 281
100 T26 32 75 T232 469 62 32-462 203.1
200 T73 33 14 T133 624 37 33-624 226.2
300 T76 15 7 T174 432 83 15-432 120.7
It indicates the occurrence of the changes content and a high percentage of grain showed
look (phenotype) in the lowest and most strains high grain yields. The value range that is having a
than the nature of the control treatment. Changes wider genetic diversity found in the radiation dose
the nature of the interactions that seem due to the 100 gray i.e. range 12-92%.
radiation of gamma rays provide better response Based on table 6, the percentage of grain
that is located on the rice genotype Pare Lotong content is highest on the radiation dose with T70
with 300 doses of the parameters for the number of strains 100 gray that is 96%. The amount of the
Gray grain contains per panicle 88.31% better than highest content of grain and the highest percentage
the treatments without radiation [16]. An has great opportunities to become mutant plant that
indication of the occurrence of other mutations in has better properties. The vast diversity is one of
the variables number of grain contents per clump is the terms against the desired properties in the
on diversity. The vast diversity can be found in the selection because the selection process against
value range of the radiation doses at the treatment those properties will be more efficient. If the
100, 200, and 300 higher or wide gray compared to genetic diversity in a population is large, this
the value of the range of radiation without shows individuals in the population so diverse
treatment (control). Treatment of radiation doses opportunities to acquire the expected genotype
200 gray had the highest range values increments larger or extensive. Increasingly broad owned
so that its genetic diversity is broader compared to genetic diversity will be even greater chances of
the treatment without radiation. The amount of success breeding program [17].
Table. 6. Percentage Content Of Grain Per Clump At Different Doses Of Radiation
Doses of The Lower percentage og grain The higher percentage of grain

Range Average
Irradiations Percentage Amount(s Percentage Amount
Strain Strain (%) (%)
(gray) (%) eeds) (%) (seeds)
0 T47 58 300 T42 88 400 58-88 74.3
100 T179 12 108 T70 96 136 12-92 62
200 T44 12 48 T77 88 110 12-88 56.9

300 T37 4 16 T199 69 212 4-69 34.5
The genetic diversity of a narrow or broad number of empty grain per clump is present on the
can distribute hope habitat and populations can be grain number performance of phenotype the most
affected by spesie and the environment [18]. The vacuous and empty grain amount i.e. lowest most
vast diversity can also improve the response of the are on radiation doses T119 strains 200 gray as
selection (selection response) because the selection many as 935 seeds and the number of empty grain
response is directly proportional to the genetic strain T7 is at lowest doses of radiation 100 gray 7
diversity [19]. seeds compared to the average amount of grain
vacuum that is 99 seeds. It indicates the occurrence
The number of empty grain per clump of the changes look (phenotype) in the lowest and
and the percentage of empty grain per most strains than the nature of the control
family treatment. Research results Saleh [16] shows that
treatment with doses of gamma ray radiation 0.2
An indication of the occurrence of a kGy in rice plant to Pare lotong find plant mutant
mutation on the independent observation of the with a decrease in the number of empty grain.
Page | 327
PROCEEDINGS
Table 7. The Number of Empty Grain Per Clump In Different Dose Of Radiation
The highest amount of empty

Dose of The lower amount of empty grain
grain Range Average
Radiation
Amount Percentage Amount Percentage (seeds) (seeds)
(seeds) (%) (seed) (%)
0 T80 33 17 T45 219 34 33-219 99.9
100 T7 7 4 T18 898 83 7-898 160.7
200 T157 12 17 T119 935 85 17-935 210.8
300 T35 21 37 T85 879 83 37-879 262.9
An indication of the occurrence of other and 300 higher or wide gray compared to the value
mutations in the independent observation of the of the range of radiation without treatment. The
number of empty grain per clump is on diversity. wider range and highest radiation dosing is at 200
The vast diversity can be found on the value of gray 17-935 seeds. The lowleest radiation dosing
value of range radiation dose treatment 100, 200, is at without radiastion 33-219 seeds.
Table 8. The Percentage Of Empty Grain Per Clump At Different Doses Of Radiation
The lower percentage of The highest percentage of

Doses of
empty grain empty grain Range Average
irradiations
Percentage Amount Percentage Amount (%) (%)
(%) (seed) (%) (seeds)
0 T42 12 55 T47 42 217 12-42 25.6
100 T173 8 12 T179 88 792 8-88 37.9
200 T77 12 15 T44 88 352 12-88 43
300 T199 31 95 T37 96 384 31-96 65.4
An indication of the occurrence of al. [13] shows the value of the KKG on percentage
mutations in this observations of the variables of void gogo rice anther culture results reached
percentage number of empty grain per clump is 35.79% more narrow its genetic diversity
present on the the performance of phenotype compared with the value of the KKG on
percentage number of grain most vacuous and the percentage of void gogo rice anther culture results
lowest i.e. percentage number of grain most silangan Way rarem achieve Fatmawati silangan
hollow lies on the radiation dose with the T37 36.35% and 43.58% wider its genetic diversity.
strain 300 gray of 96% and the percentage of the Characters with KKG (Genotype Diversity
amount of the lowest vacuum grain are on Coefficient) including a narrow genetic diversity,
radiation doses T173 strains 100 gray by 8% while characters with fairly high KKG criteria
compared to the average percentage of the amount including genetic diversity [21].
of grain vacuum i.e. 25.6%. It indicates the
occurrence of the changes look (phenotype) in the The age of harvesting
lowest and most strains than the nature of the
control treatment. Research results Rahayu [20] Shorter harvest age showed a tolerant age
shows a decrease in the percentage of the total harvest that is affected by the presence of
number of seeds per panicle and vacuum vacuum mutations. An indication of the occurrence of
seed per panicle rice varieties selection results mutations in the harvest age variables can be seen
IR64 gamma ray radiation mutation M1 generation on Figure 1 is characterized by the presence of the
compared to the elders. changing nature of that looks at some of the strains
An indication of the occurrence of other of the plant signifies the age harvest earlier or
mutations in the observations of the variables flowering age faster. Based on Table 9 showed that
percentage number of empty grain per clump is on the average age of harvest increasing doses of
diversity. The vast diversity can be found in the radiation causes a wider diversity compared to the
value range of the radiation doses at the treatment control treatment, the higher the dose of radiation
100, 200, and 300 higher or wide gray compared to is given make more length or duration of the
the value of the range of radiation without harvest age.
treatment (control). Research results Herawati et
Page | 328
PROCEEDINGS
Table 9. The Age of Harvesting in Different Doses of Irradiation
Doses of Irradiations Age of harvestng Number of Average

Strain *)
(gray) (days) strain (days)
115 T1 – T30 30
0 gray (control) 120 T31 – T72 42 119.9
125 T73 – T100 28
110 T1 – T7 7
115 T8 – T31 24
100 gray 120 T32 – T98 67 123.1
125 T99 – T188 90
130 T189 – T232 44
110 T1 – T9 9
115 T10 – T43 34
200 gray 120 T44 – T157 114 120.5
125 T158 – T207 50
130 T208 – T221 14
120 T1 – T46 46
125 T47 – T112 66
300 gray 128.2
130 T113 – T141 29
135 T142 – T221 80
*) : Strain sequential. Ex ; T1-T30 (Strain 1 until 30)
Figure 1. The Rice Plant Indicates The Lower Age of Harvesting.
Indication of other mutations occurred in T204 strains 200 gray has long panicles of the
comparison to the average age of the harvest of highest radiation doses T133 strains 100 gray
each treatment dose. The mutation causes a change has the number of chicks and chicks the most
in the genetic material at the level of the genes or productive, with a dose of radiation T133
chromosomes, resulted in a change in phenotype or strains 200 gray has the most content of grain,
trait that looks [22]. Research results Rahayu [20] radiation dose with a T70 strains 100 gray has
finding the occurrence of mutations of rice plant the highest percentage of grain content, a T (1-
varieties IR64 i.e. on treatment dose of 0.3 kGy 7) with a dose of radiation 100 gray and strain
showing the longer root phenotype compared T (1-9) with the radiation dose is 200 gray has
treatment without radiation. a shorter harvest age.
2. Indication of the occurrence of a mutation
4. Conclusions known from genetic diversity more widely on
the value of the range and the average value of
The conclusion that can be drawn from the each treatment doses are more diverse. The
study of The Performance of Mentik Wangi M1 wider genetic diversity for the value of the
generation from the result ofgamma ray range occurs on the independent high number
irradiation, namely: of saplings of plants, total number of saplings,
1. Retrieved some mutant plants that have the productive, long panicles, number of grain
character of nature better than its parent, are at content and percentage of grain contents per
a dose of radiation treatment of strain with clump, the amount of grain hollow and empty
certain strains are: T16 with radiation dose 300 grain percentage per clump. The wider genetic
gray tall plant shorter, with a dose of radiation
Page | 330
PROCEEDINGS
diversity for the average value of variables [11] Kartikaningrum S and Effenfie K. 2005.
occur in the age of the harvest. Keragaman genetik plasma nutfah anggrek
spathoglottis. J Hort 15(4):260-269.
References
[12] Wijaya K A. 2006. Evaluasi keragaan
[1] Abdullah B, Prajitno KS, Mudjisihono R. 2006. fenotipe tanaman seledri daun (Apium
Keragaan beberapa genotipe padi menuju graveolens L. Subsp. Secalinum Alef.)
perbaikan mutu beras. Subang (ID). Balai kultivar amigo hasil radiasi dengan sinar
besar penelitian tanaman padi sukamandi. gamma cobalt-60 (Co60). Skripsi. Bogor.
Program Studi Hortikultura. Fakultas
[2] BB-BIOGEN. 2011. Pemanfaatan sinar radiasi Pertanian. Institut Pertanian Bogor.
dalam pemuliaan tanaman. J Litbang
Pertanian 33(1). [13] Herawati R, Purwoko BS, Dewi SI. 2009.
Keragaman genetik dan karakter agronomi
[3] Ramchander S, Ushakumari R, Arumugam galur haploid ganda padi gogo dengan sifat
Pillai M. 2014. Lethal dose fixation and tipe baru hasil kultur antera. J Agron Ind
sensitivity of rice varieties to gamma 37(2):87-94.
radiation. Indian J Agric Res 49(1): 24-31.
[14] Bakhtiar, Purwoko B S,
[4] Taher HM, Hafiz M, Sadat S, Cirus V, Reza Trikoesoemaningtyas, Dewi I S. 2010.
NM, and Abbas M. 2011. Sensitivity to Analisis korelasi dan koefisien lintas antar
gamma rays studies in two Iranian rice beberapa sifat padi gogo pada media tanah
(Oryza sativa) genotypes. J Agricult Res masam. J Floratek 5(2):86-93.
6(23): 5208-5211.
[15] Martono B. 2010. Keragaman genetik dan
[5] Khikmah M. 2014. Pengaruh dosis radiasi sinar heritabilitas karakter ubi bengkuang
gamma terhadap pertumbuhan bibit padi (pchyrhizus erosus L.). Balai penelitian
sawah. Skripsi. Program Studi Agronomi. tanaman rempah dan aneka tanaman
Fakultas Pertanan. Universitas Sebelas industri.
Maret Surakarta.
[16] Shaleh M R. 2013. Aplikasi sinar gamma
[6] Ritonga AW, Wulansari A. 2011. Pengaruh terhadap keragaan karakter tiga genotipe
induksi mutasi iradiasi sinar gamma pada padi lokal generasi M1. Skripsi. Jurusan
beberapa tanaman. Budidaya Pertanian. Fakultas Pertanian.
Universitas Hasannuddin.
[7] Sobrizal, Ismachin M. 2006. A significant
contributing of mutation techniques to rice [17] Vaughan DA, Morishima H, and Kadowaki
breeding in Indonesia. Plant Mut Rep 1(1): K. (2003) Diversity in the Oryza genus.
18-21. Current opinion in plant molecular biology
6:139–146.
[8] Haris A, Abdullah, Bakhtiar, Subaedah,
Aminah, Jusoff K. 2013. Gamma ray [18] Medrano M and Herrera CM. 2008.
radiation mutant rice on local aged dwarf. Geographical structuring of genetic diversity
Middle-East J Sci Res 15(8): 1160-1164. across the whole distribution range of
narcissus longispathus. Oxford J Ann Bot
[9] Kumar DP, Anurag C, Sreedhar M, Aparna M, 102:183–194.
Babu P V, Singhal RK. 2013. Impact of
gamma radiation stress on plant height and [19] Kristamtini. 2009. Keragaan beras hitam
pollen fertilityin rice (oryza sativa L.). sebagai sumberdaya genetik lokal. prosiding
Asian J Exp Biol Sci 4(1). risalah aplikasi paket teknologi ―Mendukung
Hari Pangan Sedunia‖. BPTP Yogyakarta.
[10] Mohamad O, Nazir M, Alias I, Azlan S,
Rahim A. 2006. Development of improved [20] Rahayu SY. 2009. Induksi mutasi dengan
rice varieties through the use of induced radiasi sinar gamma pada padi (oryza sativa
mutations in Malaysia. Plant Mut Rep 1(1): L.) sensitif dan toleran aluminium. Tesis.
27-34. Pascasarjana. Institut Pertanian Bogor.
Page | 331
PROCEEDINGS
[21] Islam MZ, Khalequaman M, Bashar MK, Ivy traits. J Sci World 2796720:14.[22] Djoar
NA, Haque MM, Mian MAK. 2016. WD and Nandarriyah. 2011. Perbaikan sifat
Variability assessment of aromatic and fine tanaman. Surakarta (ID): UNS Press
rie germplasm in bangladesh on quantitative
.
Page | 332
PROCEEDINGS
PERFORMANCE OF PANDAN WANGI RICE GENERATION M1

FROM RESULTS OF GAMMA RAY IRRADIATION
Rachmad Nurcahyono1, Ahmad Yunus1, and Nandariyah2

1.
E-mail:rachmad014@gmail.com
Abstract
Pandan wangi rice varieties having high value for sale than other varieties, but many farmers are reluctant
to cultivated their due to a long harvest, stem easily fall and quality of rice produced is still dependent on
geographic area. So there should be improvement of Pandan wangi‘s genetic, that can be obtained by
induction mutation using radiation of gamma ray. This research is aimed to determine the effect of
gamma irradiation on growth and production component, and select suspected mutated plant who has
better quality. This research takes place on field around Nangsri Lor Village, Kebakkramat, Karanganyar
and started from September 2015 to January 2016. This research was conducted and compiled in
experimental plots with gamma irradiation dosage treatment of 100, 200 and 300 gray and compared
them with controlled plants. Results showed there are some plants being a mutant plant based on their
positive character that appears at the variable of their each individual. Strain T10 with radiation dosage of
200 gray has shortest height of 123 cm, strain T2 with radiation dosage of 300 gray has highest amount of
filled grain of 663 seeds, strain T109 with radiation dosage of 300 gray has lowest amount empty grain of
21 seeds, and strain T120 with radiation dosage of 100 gray has highest percentage of filled grain and
lowest percentage of empty grain which amonted to 92.1% and 7.9%. Gamma ray irradiation affected
components of harvesting age, plant height, amount and percentage of filled grain, amount and percentage
of empty grain. Besides irradiation treatment had no affected on the components of total amount of tillers,
amount of productive tillers and panicle length.
1. Introduction non-existant. Creation of new varieties can be done

with mutation induction using gamma ray
Pandan wangi rice is one of superior irradiation. Gamma rays is the most widely used
national commodity of Cianjur. Excess Pandan mutagen in the breeding program because it has
wangi rice that rice has a distinctive taste, fluffier energy and a relatively high penetrating power
and scented pandan. The specificity of Pandan than others.
wangi rice make higher value than other rice. Dose irradiation is one of the factors that
Some farmers believe that Pandan wangi rice is influence changes in the genetic properties of the
about 155 days long lived and easy to fall because plant cell. Dose irradiation is one of the factors that
the plants are too high. Pandan wangi rice will affect the genetic nature of changes in the cells of
produce an aroma and taste like the flavor of plants. High dose irradiation can lead to tissue
Pandan wangi if grown in the Cianjur District of death, whereas low dose irradiation will lead to
Warung Kondang. The result would be different if abnormal changes in plant phenotype [2]. The
grown elsewhere, this is caused by factor of soil, optimum dose is the best dose because it causes
water, a place to grow and varieties [1]. the occurrence mutations to the maximum with
Annually productivity of rice are required minimum damage on plants [3].
to continue to rise. Reduced interest of farmers Gamma ray radiation can cause various
who plant Pandan wangi rice make productivity types of cytogenetic aberrations such as an
decreases. Based on this it is necessary genetic increase in the number of cells and translocation in
improvement of Pandan wangi rice varieties that is the chromosome [4]. Mutations in the genetic
Page | 333
PROCEEDINGS
material is often expressed directly and observed The materials used include Pandan wangi rice
on the phenotype plants, and passed down to the seeds, cow manure, urea, SP36 and KCl.
next generation. Expression of mutations in Research was conducted through field trials
phenotype can lead to positive or negative with planting seeds of M0 (the results of gamma
(depending on the relative breeding purposes), and ray irradiation). Planting includes 4 populations :
mutations may also be able to return to normal without irradiation (control), M0 result of radiation
(recovery). Mutations in the negative direction are 100 gray, M0 results of radiation 200 gray and M0
likely to cause death (lethality), an abnormality, results of radiation 300 gray. Pandan wangi rice
sterility or other physiological disorders. seed number 578 seed treated with 3 gamma ray
Mutations in the positive direction and passed on radiation doses. Without radiation treatment or
to the next generation is a mutation that is control (R0) totaled 91 seeds, a dose of 100 gray
expected by general breeders [5]. The use of (R1) amounted to 176 seeds, a dose of 200 gray
gamma ray irradiation is expected to create new (R2) amounted to 151 seeds, a dose of 300 gray
varieties of rice mutants Pandan wangi that retains (R3) amounted to 160 seeds. Data were analyzed
the potential possessed and overcome weaknesses descriptively by comparing each individual plant at
to improve productivity. each dose of radiation to control. Individuals of the
plants show his best characters (supposedly
2. Methods mutant) selected and marked, and harvested to be
planted as individual M2.
The research was conducted in September
2015 to January 2016 on paddy fields in the village 3. Results and Discussion
of Nangsri Lor, District Kebakkramat,
Karanganyar. Radiation seed Pandan wangi rice Age of harvesting
with gamma rays carried out at the Center for
Isotopes and Radiation Application (PAIR), Based on Table 1, the radiation treatment
National Atomic Energy Agency (BATAN) South was not significant enough to shorten life Pandan
Jakarta. Tools used in this research is the "Gamma wangi rice. Indications are negative mutations that
Chamber Cobalt 60" tool to radiate the seeds, extend the life of the rice plants seen in the average
stakes, stationery, meter, board labels, nets, jars, value of the radiation treatment. Gamma ray
newspapers or paper folio (formed envelope), a set radiation makes the age of the plant longer than
of tools for analytical laboratories and in the field. control and radiation dose increases each also adds
to the old age of harvest of 1-4 days.
Table 1 Age of harvesting in different doses of irradiation
Doses of irradiations Age of harvesting Number of Average

Strain *
110 T1 – T23 23
0 gray (Kontrol) 115 T24 – T69 46 115
120 T70 – T91 22
110 T1 – T38 38
100 gray 115 T39 – T116 78 116
120 T117 – T176 60
110 T1 – T28 28
115 T29 – T72 44
200 gray 118
120 T73 – T126 54
125 T127 – T151 25
110 T1 – T16 16
115 T17 – T51 35
300 gray 119
120 T52 – T129 78
125 T130 – T160 31
*: Strain sequence. Example : T1 - T23 ( Lines 1 through 23 strains )
Age rice plants recorded in the days from panicles have yellowed. Quality rice seeds after the
seedling to mature grains [6]. The appropriate harvest is usually in line with the physiological
harvest when the seeds have physiological quality, physical quality and seed health [7].
maturity, or when approximately 90-95% of
Page | 334
PROCEEDINGS
Relationship between radiation dose Height of plant

treatment with harvest time (days), that is given
the higher dose of radiation affect the average age Based on Table 2, the lowest plant height is
of harvest tends to increase [8]. The length of at a dose of 200 gray gamma ray radiation that is
reproductive phase and maturation phase of grain 123 cm contained in the Pandan wangi rice lines
for each variety is generally the same. Long age of T10. Higher plants that are in the highest dose of
rice plants due to the length of the vegetative phase gamma rays gray 0 (control) is 152 cm contained
[9]. in the Pandan wangi rice lines T10. The average
lowest for the radiation dose of 200 gray that is
133.6 cm. The highest average radiation dose
contained on gray 0 (control), which is 142.7 cm.
Table 2 Height of Plant in different doses of irradiations
Doses of Lower plant height Highest plant height

Range Average
irradiations Height of plant Height of plant
Strain Strain (cm) (cm)
(gray) (cm) (cm)
0 T7 138 T10 152 138 – 152 142.7
100 T19 125 T24 143 125 – 143 134.8
200 T10 123 T11 147 123 – 147 133.6
300 T3 125 T2,T18, T26 140 125 – 140 134
Based on the average value of the height of the of lodging [13]. Under these conditions, the mutant
plant, the plant in radiation has positive influence plant is expected to have short stems that are not
to change the height that is shorter than its parent. easily fall to impacting on productivity results.
Difference in height of plants occur in the
treatment and control. Plant height decreased with Total amount of tillers
increasing dose of gamma rays [10]. Effects of
gamma ray radiation can cause genetic changes in Total amount of tillers is variable plants
somatic cells and can result in a change in were observed by counting the whole number of
phenotype. Irradiation can lead to changes in the total tillers (stems) contained in one clump. Based
structure of chromosomes and chromosome on Table 3, the total amount of tillers was lowest
breakages [11]. for the strain (T6, T65, T97) of 300 gray radiation
High reduction plant M1 can be caused by treatment 4 stems. The highest total amount of
inhibition of the synthesis of DNA or other tillers found in strain T41 in 200 gray radiation
physiological damage after being given treatment treatment as much as 15 stems. Based on
that cause mutation [12]. Rice plant that has high observation data indicate that radiation treatments
stem generally susceptible did not significantly affect the total amount of
tillers produced by plants.
Table 3 Total amount of tillers in different doses of irradiations
Doses of Lower amount of tillers Highest amount of tillers

Range Average
irradiations Amount Amount
Strain Strain (stem) (stem)
0 T17,T87 5 T13 14 5 – 14 8
100 T3,T6,T7,T69 5 T12 11 5 – 11 7
T1,T11,T13,T15,
T16,T18,T23,T33,
200 6 T41 15 6 – 15 8
T43,T73,T124,
T132,T147
300 T6,T65,T97 4 T2 14 4 – 14 7
Tillers of rice is an indicator rice plants growth stems, a dose of 100 gray 5-11 stems, a dose of
that healthy or sick, though genetically engineered 200 gray 6-15 stems, and a dose of 300 gray 4-14
varieties of plants determine the number of tillers. stems indicate that the presence of diversity that
Value range in the control treatment that is 5-14 vary on each individual plant. Best total amount of
Page | 335
PROCEEDINGS
tillers that which has the highest tillers because the of 200 and 300 gray on strain T41 and T2 as many
more tillers, the opportunity to produce productive as 13 stems. Lowest amount of productive tillers
tillers also greater [14]. Total amount tillers growth are all treatments that 3 stems. Average ratio
and productive tillers affected by plant density between the control plant with treated radiation
[15]. plants there was no significant difference. These
results indicate that the amount of productive
Amount of productive tillers tillers Pandan wangi rice is not affected by the
presence of gamma radiation doses of 100, 200,
Based on Table 4, amount of highest and 300 gray.
productive tiller in the treatment of radiation doses
Table 4 Amount of productive tillers in different doses of irradiations
Lower amount of Highest amount of

Doses of productive tillers productive tillers Range Average
irradiations
(stem) (stem)
0 T22,T63, T87 3 T9,T74 11 3 – 11 6
100 T69,T161 3 T12,T61 9 3– 9 5
T9,T16,T25,T38,
T42,T60,T62,T69,
200 3 T41 13 3 – 13 5
T79,T86,T92,T124,
T132,T143,T150
T1,T65,T78,T90,
300 3 T2 13 3 – 13 5
T97,T99,T109,T117
The amount of productive tillers are a Panicle lenght

growing amount of suckers further and produce
panicles. The more amount of tillers getting the The longest panicle length contained in the
more productive tillers produced by plants [16]. radiation treatment of 100 and 300 gray by 30 cm
Amount of tillers was positively correlated with the strain T120, T103 and T125. The shortest
the amount of panicles. Genetic differences also panicle length contained in 300 gray radiation
affect the fast or slow time rice tillers initiation so treatment at 18 cm the strain T99. Based on
that affect the end result of the rice panicle [17]. observations in Table 5, the average highest are in
Amount of tillers affected by plant spacing, the panicle length of 100 gray radiation treatment
light, nutrients and nutrient supply in particular N that is 25.1 cm. Average panicle length was lowest
[15]. In addition, amount of productive tillers also for the dose of 300 gray that is 24.1 cm.
influenced by the presence or absence of a disease
that attacks like of the disease [18].
Table 5 Lenght of the panicles in different doses of irradiations
Lower length of the panicles Longest lenght of the panicles

Doses of
Length of Length of Range Average
irradiations
Strain panicles Strain panicles (cm) (cm)
(gray)
(cm) (cm)
0 T20 20 T77 29 20 – 29 24.8
100 T57,T75,T80,T96 22 T120 30 22 – 30 25.1
200 T10 20 T30,T32 29 20 – 29 24.7
300 T99 18 T103, T125 30 18 – 30 24.1
Panicle length is the seat of grain. If the research which showed dose of gamma radiation
panicle is broken then the tillers will not produce did not significantly influence the panicle length
grain and reduced productivity. Based on the [19].
average yield of panicle length, it is concluded that Increasing plant population per m2 will
the dose of radiation does not affect the length of increase the number of panicles obtained,
the panicle. These results are also similar to the consequently resulting panicles will become
Page | 336
PROCEEDINGS
shorter. On the other hand the longer the average Amount of Content per Grain Clumps
of panicle rice crops, will be more the amount of and Percentage Content of Grain per
grain produced [14]. Panicle length were positively
correlated with grain yield. Rice varieties with Clumps
long panicles expected to increase the production
of rice plants [20]. Based on Table 6, the highest amount of
filled grain were in strain T2 with 300 gray dose
treatment that is 663 seeds. Lowest number of
filled grain were in strain T65 with a radiation
dose of 300 gray at 42 seeds. T2 strain potentially
a promising lines of mutant with the highest
number of grains. The average number of filled
grain highest in radiation treatment of 200 gray.
While the average amount of filled grain was
lowest for the radiation treatment of 300 gray.
Table 6 Amount of content per grain in different doses of irradation
Doses of Lowest grain Highest grain

Range Average
irradiations Amount Percentage Amount Percentage
0 T87 60 67.4 T6 630 77.8 60-630 225
100 T82 81 66.9 T12 540 81.1 81-540 212
200 T150 72 63.2 T41 624 75.4 72-624 226
300 T65 42 56.0 T2 663 78.5 42-663 159
Grain is an important component in the According to Table 7, the highest

production of rice plants. The higher the amount of percentage of filled grain were in strain T120 with
filled grain will increase the total weight gained, a radiation dose of 100 gray ie 92.1%. The
however, if the contents of a little filled grain or percentage of filled grain was lowest for the strain
empty grain more then the farmers will lose T9 with a radiation dose of 300 gray ie 19.5%.
money. Although the 300 gray radiation contained Strain T120 into one mutant strain of expectations
the highest amount of filled grain but on average because of the high percentage of filled grain. The
each 300 gray radiation treatment be the lowest. percentage of the highest average amount of filled
This shows that the treatment and dosage of grain per panicle located on 100 gray radiation
radiation toeach individual Pandan wangi rice treatment that is 76.9%, while the lowest for the
plants are not uniform in nature change. treatment of radiation 300 gray ie 60.6%.
Table 7 Percentage content of grain per clump at different doses of radiation
Doses of Lower percentage of grain Higher percentage of grain

Range Average
irradiations Percentage Amount Percentage Amount
Strain Strain (%) (%)
(gray) (%) (seeds) (%) (seeds)
0 T25 51.7 248 T23 90.2 230 51.7-90.2 76.5
100 T41 41.1 150 T120 92.1 325 41.1-92.1 76.9
200 T28 21.9 82 T108 91.4 424 21.9-91.4 68.6
300 T9 19.5 80 T6 90.3 224 19.5-90.3 60.6
The average value of this shows that the grain. Percentage of filled grain is influenced by
effects of radiation treatment are very diverse on genetic factors, while in the environment can occur
the percentage of filled grain per clump of plants . when environmental conditions such as abnormal
In the 200 and 300 gray radiation showed a pest attack, high temperatures can cause high
downward trend in the percentage of filled grain. respiration and limitations of available nutrients
Based on observational data, 100 gray radiation [21]. Percentage of filled grain is influenced by the
has a positive influence on the percentage of filled ability of plants to absorb nutrients [22]
Page | 337
PROCEEDINGS
Amount of empty grain per clump and strain T15 were treated with radiation dose of 300
percentage of empty grain per clump gray ie 450 seeds. The average amount of grains
per panicle empty are in the highest radiation dose
Based on Table 8, amount of grains per of 300 gray treatment that is 118 grains, while the
panicle empty room in strain T109 was treated lowest average value is at 100 gray radiation
with radiation dose of 300 gray is 21 seeds. treatment that is 65 seeds.
Amount of empty grain per panicle highest in
Table 8 Amount of empty grain per clump in different dose of radiation
Doses of Lower amount of empty grain Highest amount of empty grain

Range Average
irradiation Amount Percentage Amount Percentage
0 T22 24 17.8 T13 260 41.9 24-260 69
100 T80 27 21.3 T16 224 42.1 27-224 65
200 T113 25 8.9 T12 406 55.8 25-406 109
300 T109 21 23.3 T15 450 50.6 21-450 118
Lowest amount of empty grain is the result have the lowest amount of grain hollow in strain
expected by plant breeders because of the lower T109 . But in strains T109 does not necessarily
amount of grain grain grain hollow so that another have a good crop genetic, but it still depends on
can be fully charged and rice production can be the percentage of grain owned by these strains.
increased . The range of the amount of empty grain Indications mutations in the observation
per panicle in the control treatment which ranges variable percentage of the amount of grains per
from 24-260 seeds, the treatment dose ranges from panicle empty phenotypes found in the percentage
27-224 seeds 100 gray, 200 gray dose treatment of empty grain highest and lowest. According to
ranges from 25-406 seeds, and the treatment dose Table 9, the lowest percentage of empty grain were
of 300 gray ranging from 21-450 seeds. The range in strain T120 with a radiation dose of 100 gray ie
in each treatment showed a high degree of 7.9%. The highest percentage of empty grain were
diversity resulting from the existence of gamma in strain T9 with a radiation dose of 300 gray ie
radiation. Plants are predictably good or mutant 80.5%. Strain T120 into one mutant strains
estimated to be at a radiation dose of 300 gray that expectations for a low percentage of empty.
Table 9 Percentage of empty grain per clump at different doses of radiation
Doses of Lower percentage of empty grain Highest percentage of empty grain

Range Average
irradiations
Percentage Amount Percentage Amount (%) (%)
(%) (seed) (%) (seed)
0 T23 9.8 25 T25 48.3 232 9.8-48.3 23.5
100 T120 7.9 28 T41 58.9 215 7.9-58.9 23.1
200 T108 8.6 40 T28 78.1 292 8.6-78.1 31.4
300 T6 9.7 24 T9 80.5 330 9.7-80.5 39.4
Based on the average value, suggesting that 4. Conclusions

increasing the radiation dose of 200 and 300 gray
also make a percentage of empty grain per panicle The conclusion that can be drawn from the
increased. It is also equivalent to the results of study of the performance of fragrant rice Pandan
research which showed that the percentage of M1 generation gamma-ray irradiation results are:
empty grain increased with increasing radiation 1. The gamma ray radiation affected
dose. The percentage of empty grain without components on the age harvesting, plant
radiation of 0.85% and at a radiation dose of 300 height, amount and percentage of filled grain,
gray amounted to 75.53% [11]. and the amount and
2. percentage of empty grain. Additionally
radiation treatment did not affect components
Page | 338
PROCEEDINGS
of total tiller amount, amount of productive [9] Faozi, Khavid, Bambang R. 2010. Tanggap
tiller and panicle length. The selected plant tanaman padi sawah dari berbagai umur bibit
strains which have better properties than the terhadap pemupukan nitrogen. Jurnal
parent (potentially mutant) include : strain Agronomika 1(10): 32-42.
T10 with a radiation dose of 200 gray has a
height of 123 cm; T2 strain with a radiation [10] Tabasum A, Cheema AA, Hameed A, Rashid
dose of 300 gray had the highest amount of M, Ashraf M. 2011. Radio sensitivity of rice
filled grain seed 663; strain T109 with a genotypes to gamma radiations based on
radiation dose of 300 gray has the lowest seedling traits & physiological indices. Pak J
amount of empty grain of 21 pieces; strain Bot 43(2): 1211-1222.
T120 with a radiation dose of 100 gray had
the highest percentage of filled grain and the [11] Haris A, Abdullah, Bakhtiar, Subaedah,
percentage of empty grain low of 92.1% and Aminah, Kamaruzzaman J. 2013. Gamma ray
7.9%. radiation mutant rice on local aged dwarf.
Middle East J Sci Res 15(8): 1160-1164.
References [12] Cheema AA, Atta BM. 2003. Radiosensitivity
studies in basmati rice. Pak J Bot 35(2): 197-
[1] Said DD. 2014. Beras berkualitas mendukung 207.
kualitas hidup keluarga indonesia. Diskusi
hotel lor in, solo. Kementerian Pertanian. [13] KashiwagiT, Haruto S, Ken I. 2005. Factors
responsible for decreasing sturdiness of the
[2] Yunita R, Nurul K, Didy S, Ika M. 2014. lower part in lodging of rice (Oryza sativa
Pengaruh iradiasi sinar gama terhadap L.). Plant Prod Sci 8(2): 166-172. DOI:
pertumbuhan & regenerasi kalus padi varietas 10.1626/ pps.8.166
ciherang & inpari 13. Jurnal Agro Biogen
10(3): 101-108. [14] Makarim AK, Suhartatik E. 2009. Morfologi
& fisiologi tanaman padi. BBPTP.
[3] Ramchander S, Ushakumari R, Arumugam Sukamandi.
MP. 2015. Lethal dose fixation & sensitivity
of rice varieties to gamma radiation. Indian J [15] Yoshida S. 1981. Fundamentals of rice crop
Agric Res 49(1): 24-31. science. International Rice Research Institute.
Los Banos, Philippines.
[4] Basi S, Subedi LP, KC GB, Adhikari NR.
2006. Cytogenetic effects of gamma rays on [16] Rasyad A. 1997. Keragaman sifat varietas
indica rice radha-4. J Inst Agric Anim Sci 27: padi gogo lokal di kabupaten kampar riau.
25-36. Lembaga Penelitian Universitas Riau.
Pekanbaru
[5] Human S. 2011. Riset & pengembangan
sorgum & gandum untuk ketahanan pangan. [17] Bian J, H He, H Shi, C Zhu, X Peng, C Li, J
PATIR-BATAN. Fu, X He, X Chen, L Hu, L Ouyan. 2013.
Dynamic qtl detection & analysis of tiller
[6] Silitonga TS, Somantri IH, Daradjat AA, amount before & after heading in japonica
Kurniawan H. 2003. Panduan sistem rice. Aust J Crop Sci 7(8): 1189-1197.
karakterisasi & evaluasi tanaman padi.
Komisi nasional plasma nutfah. Badan [18] Widiarta IN, Kusdiaman D, Hasanudin A.
Penelitian & Pengembangan Pertanian. 2002. Pengendalian terpadu tungro
Departemen Pertanian. berdasarkan epidemologi virus & dinamika
populasi wereng hijau. Jakarta: Penebar
[7] Samrin. 2013. Petunjuk teknis produksi benih Swadaya
padi. Balai Besar Pengkajian &
Pengembangan Pertanian Sulawesi Tenggara. [19] Babaei A, Ghorban AN, Viacheslav A,
Seyyed H, Hashemi P. 2010. Radio
[8] Aziz LMS, Khairunnisa L, Grace LBS. 2012. sensitivity studies of morpho-physiological
Pengaruh radiasi sinar gamma terhadap characteristics in some iranian rice varieties
pertumbuhan & produksi beberapa varietas (Oryza sativa L.) in m1 generation. Afr J
tanaman padi (Oryza sativa L.) dengan sistem Agric Res 5(16): 2124-2130.
tanam SRI (System of Rice Intensification).
Jurnal Ilmu Pertanian Kultivar 6(1): 44-58.
Page | 339
PROCEEDINGS
[20] Sutaryo B, A Purwantoro, Nasrullah. 2005. [21] Abdullah B. 2009. Perakitan &
Seleksi beberapa kombinasi persilangan padi pengembangan padi tipe baru. BBPTP.
untuk ketahanan terhadap keracunan
aluminium. Jurnal Ilmu Pertanian 12(1): 20- [22] Rusdiansyah, Subiono T. 2014. A study of
31. local rice cultivars from krayan grown in tidal
swam area. Internat J Sci Eng 6(2): 131-134.
Page | 340
PROCEEDINGS
PERFORMANCE OF ROJOLELE RICE GENERATION M1 FROM

RESULTS OF GAMMA RAY IRRADIATION
Adi Prabu Mahardhika1, Ahmad Yunus1, and Nandariyah2

1.
E-mail: adiprabu12@gmail.com
Abstract
Rojolele is a local superior variety that hasn't been cultivated well by our farmers because of their lacks
such as long harvest time needed, over height stem, and pest de-resistance. So there should be
enhancement of Rojolele's quality, one way to achieve it is by induction mutation using radiation of
gamma ray. This research is targeted to select better quality of radiated plant compared with their
previous plants. This research takes place on field around Nangsri Lor Village, Kebakkramat,
Karanganyar. This research was held and organized in a squared experimentation of examining every
plants with radiation and compare them with controlled plants to find out their differences and the effect
of radiation to Rojolele's growth. Result shows 20 strains with mutant potential, based on their positive
character of their each individuals. Strain T112 with radiation dosage of 300 grays has very short height
of 127cm, strain T10 with 200 grays of radiation dosage has tallest panicle of 39,5cm, strain T20 with 200
grays of radiation dosage has highest number of tiller of 10 stems, strain T121 with 100 grays of radiation
dosage has 8 stems of stems, which is the highest number of tillers productivity, strains T30 with 200
grays of radiation dosage has highest number of filled unhulled rice of 1104 pulps and strains T77 with
300 grays of radiation dosage has highest percentage of filled un-hulled rice of 97,25% and strains T(1-4)
with 100 grays and T(1-5) with 200 grays of radiation dosage has shortest harvest time of 142 days.
1. Introduction long harvest period, over height stem, and pest de

resistance. These weaknesses make Rojolele hasn‘t
Rice (Oryza sativa L.) is an important crop cultivated well by our farmers.
that is used as a staple food for the population of Improvement of Rojolele quality product
the world, including Indonesia. Indonesian people can be achieved by genetic improvement. Genetic
had high consumption of rice, up to 139.5 kg for a improvement of rice plants is done through
year [1], with a population that continues to mutations induced by gamma irradiation.
increase. National rice production should continue Application of induced mutation in rice plants can
to increase to obtain needs of national food [2]. In generate mutant plants with early maturity,
the future, productivity of rice plants improvement resistant to pathogens and drought, as well as seed
must be obtained, because increasing of rice quality preferred by consumers. This research
production through the extension program will be targeted to obtain information about performance
constrained by the availability of land suitable for of rice Rojolele results of various doses of gamma
rice cultivation [3]. irradiation and select better quality of radiated
Rojolele is a local variety of rice plants that plant compared with their previous plants.
come from the District Delanggu, Klaten, Central Research about performance of rice
Java. Rojolele are a yielding rice that taste good or improvement by induced mutation techniques with
fluffier rice, fragrant and has high economic value gamma irradiation has been done before, the
[4], so favored by farmers and consumers [5]. example is Cisantana variety on experiments that
However rojolele still has disadvantage, such as have been conducted obtained two mutant strains
Page | 341
PROCEEDINGS
which have the changing nature of grain shape that control plants to find out the differences and the
is not fluffy, high production, shorter height plant, effect of radiation on the growth of rice Rojolele.
resistant to leaf blight strains IV, as well as The study treatment consisted of 598 rice seed
excellence in the quality of grain and rice [6]. Rojolele to be given three doses of gamma
Other experiments conducted at Fatmawati radiation. Without radiation treatment or control
varieties are susceptible to attack blast disease [7]. (R0) totaled 82 seed, a dose of 100 gray (R1)
amounted to 218 seeds, a dose of 200 gray (R2)
2. Methods amounted to 166 seeds, and a dose of 300 gray
(R3) amounted to 132 seeds. The data were
The research was carried out in September analyzed descriptively by comparing each
2015 until January 2016. Take a place in paddy individual plant at each radiation dose to the
fields in the village of Nangsri, district average control for this study has the objective to
Kebakkramat Lor, Karanganyar Regency with soil select individuals who allegedly mutated.
type rice has ordo Inceptisol or Alluvial. Radiation
seeds Rojolele with gamma rays at the Center for 3. Results and Discussion
the application of Isotope and radiation (PAIR),
the National Atomic Energy Agency (BATAN) in Height of plant
South Jakarta. Tools used in this research include
tools to radiate the seeds "The Gamma Chamber Plant height is one of the selection criteria
Cobalt 60", PIN, stationery, meter label, Board, in rice, but does not guarantee a high growth rate
net, jar, newspaper or paper folio (envelope). The of production. Higher plants have a considerable
materials used include fragrant rice seed Rojolele, influence on the relationship between panicle
manure, urea, SP36 and KCl. length with the results [8]. Based on Table 1, the
The research was conducted and compiled lowest plant height had the most excellent results
in experimental plots. Observations were made on obtained with the radiation treatment dose of 300
all plants treated with radiation and compared with gray in strain T112 with 127 cm height.
Table 1 Height of the plant in different doses of irradiations
Doses of Lower plant height Highest plant height

Range Average
Irradiations Height of plant Height of Plant
Strain Strain (cm) (cm)
(gray) (cm) (cm)
0 T78 131 T38 167 131 – 167 152.1
100 T116 128 T15 181 128 – 181 149.5
200 T50 132 T10 176 132 – 176 150.6
300 T112 127 T61 174 127 – 174 150.4
Plant height of Rojolele varieties is high, radiation dose will produce mutant rice with
according to the description of Rojolele varieties shorter plant height.
listed in the decree of Minister of Agriculture
Number: 126 / Kpts / TP.240 / 2/2003, namely Total amount of sapling
Rojolele plant height reaches 146 to 155 cm. Plant
height is too high causing the plant easily fall Total amount of sapling is the number of
especially when there are strong winds total number of saplings that grow from the main
accompanied by rain [9]. The character changes in stem of rice. Total amount of sapling is one of the
plant height lower on Rojolele indicates mutations important parameters of rice growth by showing
with changes in the nature better than gamma the standard of living for the production of these
radiation treatments are given. Higher plants in crops. Total amount of sapling per hill rice can be
strain T112 with a radiation dose of 300 gray has a classified into 4 groups [11], namely the number of
very low height when compared to the control tillers few (<10), moderate (11-15), many (16-20),
treatment and the variety description Rojolele. and very many (> 20). The average total amount of
These results are similar to research Sasikala and sapling showed values in the control treatment 5, a
Kalaiyarasi [10], which results in shorter plant dose of 100 gray 6, a dose of 200 gray 5, a dose of
height in rice varieties CO 43 and CO 49 by 300 gray 5. The average value of which can be in
treatment with a dose of 250 gray. The higher the the control treatment or treatment of any radiation
dose is included in the group number of tillers bit
Page | 342
PROCEEDINGS
(<10). Most of the total amount of sapling each of seedlings, saplings both total and productive
treatment radiation dose obtained most excellent tillers. Then Planting of trees per planting hole can
results as much as 10 rods that are in strain T20 increase the potential for seedling development.
with a radiation dose of 200 gray. By planting one rod per planting hole, it can
Rice has clump properties through tillering, provide an opportunity for the seed to sprout more,
then planting with a spacing of meeting resulted in giving freedom of movement, and avoiding
a limited growing space and reduce the production competitive.
Table 2 Total amount of sapling in different doses of irradiations
Doses of Lower amount of Sapling Highest amount of Sapling

Range Average
Irradiations Amount Amount
Strain Starin (stem) (stem)
0 T12, T21, T52, T63 3 T75 7 3–7 5
100 T6, T56, T83, T125 3 T170, T202 9 3–9 6
200 T23, T25, T67, T68 3 T20 10 3 – 10 5
300 T55, T96, T112 3 T117 9 3–9 5
Number of productive sapling 100 gray radiation strain T121, T218 and radiation
300 gray strain T75, T78, T86, T97. When
Number of productive sapling is the compared with the control treatment that only
number of seedlings that can produce both grain produce productive tillers 6 stem the treatment of
rice grains or grain-filled hollow. Based on data in all doses of radiation have a number of productive
Table 3, it was found that the highest number of tillers more. However, these results still are at a
productive tillers 8 bars located on lower value than the variety description Rojolele.
Table 3 Number of productive sapling in different doses of irradiations
Lower amount of Highest amount of productive

Doses of
productive sapling sapling Range Average
Irradiations
(stem) (stem)
0 T12 2 T74, T82 6 2–6 4
100 T16, T94, T206 2 T121, T218 8 2–8 4
200 T154 2 T41, T160 7 2–7 4
300 T31,T87 2 T75, T78, T86, T97 8 2–8 4
Based on the description of varieties, Lenght of panicles

rojolele had a number of productive tillers were
fairly low, ie 8 to 9 rod. This resulted in lower Mutant plants with better properties that
production results, and one of the weaknesses emerge can be seen from the highest panicle length
rojolele varieties that need to be repaired. The of each strain compared to Malai is the top of the
number of productive tillers in essence, determined uppermost limit on rice stem segments. Panicles in
according to the total number of tillers. Overall the rice plant is very important as a place of growing
total number of seedlings obtained relatively little, grains, so long panicles maximum desired length.
then the number of productive tillers obtained too Based on Table 4, the longest panicle length
little. The use of irradiation influenced by several radiation contained in 200 gray strain T10 with
factors, including genotype, parts of the plant used, panicle length 39.5 cm.
the environment, and the irradiation dose [12].
Page | 343
PROCEEDINGS
Table 4 Lenght of the panicles in different doses of irradiations
Lower length of panicles Longest lenght of panicles

Doses of
Length of Length of Range Average
Irradiations
Strain panicles Starin panicles (cm) (cm)
(gray)
(cm) (cm)
0 T35 24.3 T45 38.7 24.3 – 38.7 32.6
100 T173 24.0 T26, T46, T101 38.0 24.0 – 38.0 32.5
200 T81 24.0 T10 39.5 24 – 39.5 31.9
300 T112 22.5 T107 38.3 22.5 – 38.3 31.3
Panicle length indeed determine the extent Amount of content per grain clumps
of grain produced, so that the longer panicles so and percentage content of grain per
the more grain will be produced. This is in line
with the opinion of Rahayu which states that the clumps
increase in panicle length is a factor that can Number of filled grain is the number of
increase the number of grains per panicle and per grains in each panicle pithy. Total grain permalai
clump [13]. Panicle length generally positively represent average total grain obtained from a rice
correlated to the number of seeds per malainya. panicle. The number of grains per panicle showed
The longer the size of a panicle, the more seeds that there are many grain in a panicle of rice plant
that can produce [14]. Strain T10 on the radiation [15]. Strains of plants with the best results at the
dose of 200 gray values are better when compared variable number of filled grain contained in strain
to the length of the longest panicle and the average T30 with a radiation dose of 200 gray ie 1104
in the control treatment. These results can be said seeds.
that the strain is a mutant with the changes
indicated an improved properties.
Table 5 Amount of content per grain in different doses of irradation
Doses of Lowest grain Highest grain

Range Average
Irradiations Amount Percentage Amount Percentage
0 T19 261 51.33 T82 978 81.09 261-978 529.0
100 T67 201 39.07 T121 1088 82.63 201-1088 519.9
200 T154 178 41.64 T30 1104 93.53 178-1104 504.9
300 T31 172 42.31 T109 1015 86.76 172-1015 490.8
Treatment of gamma-ray radiation can probability of obtaining the desired new genotype
provide a broad genetic diversity among individual [16].
plants. Strains of plants with the best results at the Based on Table 6, it can be seen that the
variable number of filled grain contained in strain average show all treatments and controls have
T30 with a radiation dose of 200 gray. These filled grain percentage above 70%, which means a
results indicate the effect of gamma radiation when very high percentage of filled grain. The
compared with the highest number of filled grain percentage of empty grain strain T134 lowest is at
as well as the average in the control treatment. 100 gray radiation with a percentage of 31.93%,
Gamma ray irradiation is an effective technique to while for the highest percentage of radiation strain
generate new mutant or enhance genetic variation, T77 300 gray, with a percentage of 97.25%.
with high genetic diversity, the greater the
Page | 344
PROCEEDINGS
Table 6 Percentage content of grain per clump at different doses of radiation
Doses of Lower percentage og grain Higher percentage of grain

Average
Irradiations Percentage Amount Percentage Amount Range (%)
Strain Strain (%)
(gray) (%) (seeds) (%) (seeds)
0 T59 41.36 476 T28 96.21 504 41.36-96.21 79.43
100 T134 31.93 412 T51 97.13 657 31.93-97.13 78.06
200 T140 33.86 204 T23 96.71 696 33.86-96.71 79.10

300 T1 36.30 234 T77 97.25 690 36.30-97.25 78.72
Values range percentage in all treatments Numberof empty grain per clumps and
showed diversity varies greatly, it is because the percentage of empty grain per clumps
genetic nature of each individual is not yet stable
and non-genetic factors that also affect. Although An empty grain seeds that failed to be
as a whole the average value of the percentage fertilized when the anthesis or their denaturation
obtained in all treatments were above 70%, but when it begins charging lasting grains [14].
still many people are individuals who generate According to the Table 7, the average value of the
lower percentage of filled grain. The low number of grains per panicle vacuum in the control
percentage of filled grain permalai can also be treatment amount of 145 seeds. While the radiation
caused by a disruption of plant pests such as treatment dose of 100 gray obtained an average
locusts, and walang rice pest. Where pests walang number of 155 seeds, 200 gray dose of 156 seeds,
rice pest grasshoppers and generally ruin the fruit and a dose of 300 gray amount of 148 seeds.
of rice is still young (mature milk) with the road
sucking fruit or eat the fruit [17].
Table 7 Number of empty grain per clump in different dose of radiation
Dose of Lower amount of empty grain Highest amount of empty grain

Range Average
Radiation Amount Percentage Amount Percentage (seeds)
Strain Strain (seeds)
(gray) (seeds) (%) (seed) (%)
0 T28 20 3.79 T59 675 58.64 20-675 145
100 T51 19 2.87 T134 878 68.07 19-878 155
200 T81 15 4.95 T37 624 51.39 15-624 156
300 T42 18 4.59 T75 628 56.36 18-628 148
Mutations are changes in genetic material the number of grains per panicle empty obtained
that may cause a change in expression. Changes showed that overall the radiation dose of each
may occur at the base pair level, level one segment treatment was no better than the control treatment.
of DNA, even at the level of the chromosome. Generally have the Rojolele rice panicle length
Mutations or changes in the structure of the gene with the number of grains per panicle could exceed
can be detected by changes in the level of gene 300 grains, the number is too many, so the plants
structure or changes in the level of expression. To are not capable of supplying carbohydrates and
see these changes can be done by comparing the other nutrients for the seed filling [19].
mutant with wild-type [18]. The average value of
Page | 345
PROCEEDINGS
Table 8 Percentage of empty grain per clump at different doses of radiation
Lower percentage of empty Highest percentage of empty

Doses of
grain grain Average
irradiations Range (%)
Percentage Amount Percentage Amount (%)
(%) (seed) (%) (seeds)
0 T28 3.79 20 T59 58.64 675 3.79-58.64 20.57
100 T51 2.87 19 T134 68.07 878 2.87-68.07 21.94
200 T23 3.29 24 T140 66.14 398 3.29-66.14 20.90
300 T77 2.75 20 T1 63.70 411 2.75-63.70 21.28
The percentage of empty grain is a grain Age of harvesting

hollow division number by the number of total
grain multiplied by 100% [20]. Results showed the According to the Table 9, earned a total of
lowest percentage empty grain owned by strains nine plants that coined the shortest harvest age to
T77 at 300 gray dose radiation treatment that the age of 142 days, which is contained in strain
amounted to 2.75%. While the highest percentage T1-T4 with 100 gray dose radiation treatment and
of empty grain owned by strain T134 is equal to strain T1-T5 with 200 gray dose radiation
68.07%. Results Rahyu study [13] showed a treatment. These results indicate the presence of 9
decrease in the percentage of the number of grains strains as positive mutant who has the shortest
per panicle hollow and empty seeds per panicle lifespan.
rice variety IR64 result of the selection of Harvesting is an important indication in
mutations M1 generation gamma ray radiation plant [22]. Rice with early maturity is character
compared to elders. Values obtained in the preferred by farmers. Harvesting (HSS) calculated
percentage of empty grain can also be influenced at 90% of grain on each strain ripe. Through
by environmental factors, such as the presence of selection has gained a lot of mutants were
pests and diseases. Hama contained in this research identified and shown to have better properties than
is stinky stinky. Walang rice pest in rice plants are their elders [23]. The results in Table 9 shows the
flowering for sucking grain, causing a decrease in gamma ray radiation treatments in rice plants can
the quality of grain, which are causing empty grain produce changes in the nature of harvesting faster.
[21]. These results are similar to studies Haris et al., the
rice variety and Mandoti Ase Field that shows
faster harvesting through the provision of gamma
irradiation at a dose of 200 gray [24].
Page | 346
PROCEEDINGS
Table 9 Age of harvesting in different doses of irradiation
Doses of Irradiations Age of harvestng Numbre of Average

Strain *
149 T1 – T13 13
155 T14 – T61 48
0 gray (control) 156 T62 – T69 8 154.5
157 T70 – T76 7
158 T77 – T82 6
142 T1 – T4 4
149 T5 – T47 43
155 T48 – T174 127
100 gray 156 T175 – T198 24 153.9
157 T199 – T207 9
158 T208 – T213 6
159 T214 – T218 5
142 T1 – T5 5
149 T6 – T28 23
155 T29 – T58 30
200 gray 156 T59 – T69 11 155.6
157 T70 – T102 33
158 T103 – 126 24
159 T127 – 166 40
149 T1 – T17 17
155 T18 – T101 84
156 T102 – T116 15
300 gray 154.6
157 T117 – T125 9
158 T126 – T129 4
159 T130 – T132 3
*: Strain sequential. Ex : T1-T30 (Strain 1 until 30)
4. Conclusions 200 gray had the highest panicle length is 39.5

cm. Strains T20 with a radiation dose of 200
Conclusions that can be drawn from the gray has the highest number of tillers total of
study of The Performance of Rojolele M1 10 rods. Productive tillers highest radiation 8
generation from the result ofgamma ray bars located on 100 gray strain T121, T218 and
irradiation, namely: radiation 300 gray strain T75, T78, T86, T97.
1. Gamma radiation treatment provides better to the Strains T30 with a radiation dose of 200 gray
changing nature of the growth, development had the highest number of filled grain ears and
and yield of rice Rojolele. The radiation dose strain T77 1104 with a radiation dose of 300
of 100 gray have a better effect on the character gray had the highest percentage of filled grain
of the age of the plant and the number of that is 97.25%. Strain T (1-4) with a radiation
productive tillers. The radiation dose of 200 dose of 100 gray and strain T (1-5) with a
gray have a better effect on the character radiation dose of 200 gray had a shorter
panicle length, total tillers, grain content, as harvesting time is 142 days.
well as harvesting. The radiation dose of 300
gray have a better effect on plant height, References
productive tillers, as well as the percentage of
filled grain. [1] Christianto E. 2013. Faktor yang memengaruhi
2. Treatment of gamma radiation at a dose of 100, volume impor beras di indonesia. J JIBEKA
200 and 300 gray resulted in 20 strains that 7(2): 38-43.
could potentially be based on the changing
nature of the mutant plants for the better that [2] Irawan B. 2005. Konversi lahan sawah :
appears at the variable plants from each of the potensi dampak, pola pemanfaatannya, dan
individual. The strain T112 with a radiation faktor determinan. Forum Penelitian
dose of 300 gray has a very short plant height Agroekonomi 23(1): 1-18.
is 127 cm. Strains T10 with a radiation dose of
Page | 347
PROCEEDINGS
[3] Sumardi. 2010. Produktivitas Padi Sawah pada [14] Mangera Y. 2014. Pengaruh kerapatan
Kepadatan Populasi Berbeda. J Ilmu-Ilmu tanaman dan kombinasi pupuk nitrogen
Pertanian Indonesia 12(1): 49-54. anorganik dan nitrogen kompos terhadap
produksi gandum. Agricola 4(1): 49-57.
[4] Desriani, Kusumawati DE, Rivai A, Hasanah
N, Amrinola W, Triratna L, Sukma A. 2013. [15] Kaderi H. 2004. Pengamatan percobaan bahan
Potential endophytic bacteria for increasing organik terhadap tanaman padi di
paddy var rojolele productivity. Int J Adv Sci rumahkaca. Prosiding temu teknis nasional
Eng Inf Technol 3(1): 76-78. tenaga fungsional pertanian. Banjarbaru,
2010. Balai Penelitian Pertanian Lahan
[5] Priadi D, Kuswara T, Soetisna U. 2007. Padi Rawa. hlm164-170.
organik versus non organik : studi fisiologi
benih padi (Oryza sativa L.) kultivar lokal [16] Maluszynski M, Ahloowalia, Sigurbjornsson.
rojolele. J Ilmu-Ilmu Pertanian Indonesia 2005. Application of in vivo and in vitro
9(2): 130-138. mutation techniques for crop improvement.
Euphytica 85(1): 303-315.
[6] Mugiono L, Harsanti, Dewi AK. 2009.
Perbaikan padi varietas cisantana dengan [17] Suwarno. 2001. Kemajuan penelitian dan
mutasi induksi. J Ilmiah Aplikasi Isotop dan produktifitas benih padi hibrida di Indonesia.
Radiasi 5(2): 194-207. Makalah Penelitian Teknologi Benih Padi
Hibrida 26-27. Sukamandi.
[7] Lestari EG, Dewi IS, Yunita R, Sukmadjaja D.
2010. Induksi mutasi dan keragaman [18] Jusuf M. 2001. Genetika I, struktur dan
somaklonal untuk meningkatkan ketahanan ekspresi gen. Jakarta (ID): Sagung Seto.
penyakit blas daun pada padi fatmawati.
Buletin Plasma Nutfah 16(2): 96-101. [19] Sobrizal, Ismachin M. 2006. Possible
contribution of induced mutations on
[8] Rubiyo, Suprapto, Darajat A. 2005. Evaluasi breaking the rice yield barrier. Sci J Appl Is
beberapa galur harapan padi sawah di Bali. Radiat 2(1): 51-65.
Buletin Plasma Nutfah 11(1): 6-10.
[20] Rahmah R, Aswidinnoor H. 2013. Uji daya
[9] Sudarka W, Sarwadana SM, Raka IGN, hasil lanjutan 30 galur padi tipe baru generasi
Pradnyawati NLM, Gunadi IGA. 2009. f6 hasil dari 7 kombinasi persilangan. Buletin
Upaya pengembangan varietas jagung tahan Agrohorti 1(4): 1-8.
kering. J Bumi Lestari 9(2): 193-200.
[21] Ponnusamy K. 2003. Farmers participatory
[10] Sasikala R, Kalaiyarasi R. 2010. Sensitivity of assesment of neem based insecticide in
rice varieties to gamma irradiation. J Plant controlling the ear head bug (Leptocorisa
Breed 1(4): 885-889. acuta) in rice. Madras Ag J 90(7-9): 564-566.
[11] Las I, Widiarta IN, Suprihatno B. 2004. [22] Totok ADH, Suwarto, Riyanto A, Susanti D,
Perkembangan varietas dalam perpadian Kantun IN, Suwarno. 2011. Pengaruh waktu
nasional. Inovasi Pertanian Tanaman Pangan. tanaman dan genotipe padi gogo terhadap
Puslitbang Tanaman Pangan. Bogor. hlm 1- hasil. Penelitian Pertanian Tanaman Pangan
25. 30(1): 17-22.
[12] Balithi. 2006. Keragaman genetik mawar mini [23] Mohamad O, Nazir M, Alias I, Azlan S,
dengan iradiasi sinar gamma. Warta Peneli Rahim A. 2006. Development of improved
Pengemb Pertan 28(4): 17-18. rice varieties through the use of induced
mutations in Malaysia. Plant Mut Rep 1(1):
[13] Rahayu SY. 2009. Induksi Mutasi Dengan 27-34.
Radiasi Sinar Gamma Pada Padi (Oryza [24] Haris A, Abdullah, Bakhtiar, Subaedah,
sativa L.) Sensitif dan Toleran Aluminium. Aminah, Jusoff K. 2013. Gamma ray
Tesis. Institut Pertanian Bogor. radiation mutant rice on local aged dwarf. J
Sci Res 15(8): 1160-1164.
Page | 348
PROCEEDINGS
RAPD MARKERS SCREENING FOR GENETIC DIVERSITY

ANALYSIS OF Pterocarpus indicus Wild
Purnamila Sulistyawati1, Anto Rimbawanto1, AYPBC Widyatmoko1

1
Center for Forest Biotechnolgy and Tree Improvement (CFBTI)
Ministry of Environment and Forestry Indonesia
Email: purnamila@biotifor.or.id
Abstract
Pterocarpus indicus Wild known as Rosewood, Angsana (local) or Sonokembang (local) belongs to
Fabaceae (Leguminosae) which often used as a shade plant and has good-quality of wood for furniture
manufacture, flooring, cabinets, musical instruments and some parts of the tree can be used as natural
medicines. Thirty two RAPD primers have been screened, and eight polymorphic primers were selected
using 12 samples from 3 natural population in East Timor. Sixty (60) polymorphic loci were obtained
from eight (8) RAPD primers. High discrimination power (DP = 0.43; in average) was obtained from 8
RAPD primers. The selected loci can be used to asses‘ genetic diversity of Pterocarpus indicus Wild to
support the breeding program and conservation of this species. Using the 60 loci, genetic diversity of the
12 samples was 0.219. Mean genetic distance among the 3 population was 0.22. This information is very
important to decided number of samples per population and also distribution of population those will be
used for analyzing genetic diversity of the species.
Keywords: Pterocarpus indicus Wild, screening, RAPD, genetic diversity.
1. Introduction leukorrhea (vaginal discharge), blenorrhea (excess

mucus), and hemorrhoids (piles).
Rosewood, Angsana or Sonokembang Recently, the populations have declined due
(Pterocarpus indicus Wild) is parts of Fabaceae to overexploitation and habitat loss due to illegal
(Leguminosae) which its natural distribution is in logging. This species have been included by the
Southeast Asia - Pacific, from Burma through IUCN Red List of Threatened Species in the
Southeast Asia to the Philippines and the Pacific category Vulnerable (VU A1D). Surveys in
Islands. In Indonesia is naturally spread over the Vietnam and Sri Lanka failed to find the species,
whole of Java, Sulawesi, Maluku, Bali, East Nusa while the presence of the population in India,
Tenggara, West Nusa Tenggara, and Papua. Indonesia and the Philippines showed that the
Growing at an altitude of about 600 m asl (Putri species is endangered. The exploitation in
and Suita, 2005). Peninsular Malaysia, may lead to its extinction in
This species has good quality of wood place; and the population which are believed to be
which usually use for furniture manufacture, the largest remaining populations in New Guinea
flooring, cabinets, and musical instruments. The also turned out to be heavily exploited (Joker,
tree is often used as a shade plant that is widely 2002).
planted in the roadside (Suryowinoto, 1997). Illegal logging causes Pterocarpus indicus
Pterocarpus indicusis also a type of plant nitrogen- Wild population decreases and causes a lessening
free which is great for soil fertility. This tree is in genetic diversity. The decline in the genetic
highly recommended as part of agroforestry and diversity is very detrimental for the breeding
tree shade coffee (Joker, 2002). The sap also used program, because the less genetic diversity means
widely by people in Borneo, East Timor, Papua the less potential genetics that can be used for tree
and West as a textile dye and traditional medicine improvement and will decrease the chance to get a
for patients with toothache, chronic diarrhea, new variety of desired traits.
Page | 349
PROCEEDINGS
Genetic diversity is an important factor for 3. Results and Discussion

the survival of a population. Populations with high
genetic diversity are able to defend itself from the RAPD markers were known has low
threat of climate change, pests and diseases. The reproducibility due to environment condition
level of genetic diversity was strongly influenced (Jones et al., 1997). Screening primers conducted
by the size of a population. Information on the to overcome the low reproducibility by several
level of crop genetic diversity, individuals, species criteria i.e. polymorphic bands, good/strong signal
or population needs to be known, as for and clear bands. Screening primer intended to seek
consideration in formulating conservation random primers which generate polymorphic
strategies, breeding, management and utilization of markers; because not all nucleotide primer can
plant genetic resources. In order to support the tree produce amplification products (positive primer)
improvement programme, it is important to have and not all positive primers producing
an accurate and valid identification method. polymorphic DNA fragments (Siregar et al., 2008).
Molecular markers offer superior accuracy and First screening using 6 materials found that
reliability in conducting genetic diversity analysis 20 out of 32 RAPD primers produced fragments.
and flexibility to be applied at various stages of Others primers failed to produce fragments
plant growth. RAPD (Random Amplified because of incompatibility DNA sequences
Polymorphic DNA) is the most widely used between samples and primers. From the first
markers for plant molecular marker in forestry. screening there were 12 primers produce
RAPD markers system is the easiest to use because polymorphic fragments which used to the next
it does not require information of its DNA screening. Second selection using 12 materials
sequence. Primer used very little and usually less found that 8 out of 20 RAPD primers selected. The
than 10 nanograms (Neale et al., 2007). The aim of result from second selection showed 12 primers
this study was to select polymorphic RAPD generate fragments that were unclear, confusing
primers for future activity on genetic diversity and less polymorphic. In this stage, 60
assessment of Pterocarpus indicus Wild. polymorphic fragments obtained from 8 RAPD
primers selected.
2. Methods In this study there were no replications.
Screening of the RAPD markers was based on the
Leaf samples collected randomly from 3 polymorphic fragments amplified by the primers.
population (Seram, Soe and Kefa) of Pterocarpus Selected polymorphic fragments were varies in a
indicus Wild. Total DNA samples extracted using range of 400 – 2000 bp. Both of the sample
a modified CTAB method; purified and measured frequency (present and absent) fragments was
its quantity and ratio followed by dilution to 2.5 varied between 0.17 – 0.83 (Table 1).
ng/μl. The total PCR volume was 10 mL. The All polymorphic loci were analyzed using
process of PCR was performed using GeneAmp Tessier et.al, (1999). Most selected fragments have
9700 thermocycler (Applied Biosystems). Agarose a high ability to be used as an identification marker
gel-based electrophoresis conducted using 1.0% characterized by the average value of
gels with Ethidium Bromide. Data was analyzed Discrimination Power (DP) by 0.43 with the DP
using GenAlEx 6.5 (Peakall and Smouse, 2012) variation between 0.30 - 0.55. The maximum DP
and PopGene (Yeh, 2000). The Discrimination obtained on a sample which have a f balance
Power analyzed based on Tessier et.al (1999). frequency present fragments and absent fragments.
There were 6 markers which have the highest DP
i.e. OPJ20-800, OPJ20-1350, OPY07-1200,
OPY11-700, OPY11-1100 and OPY11-1150
(Table 1). High DP means that all primers selected
have the ability to be used as identification
markers
Page | 350
PROCEEDINGS
Table 1 Polymorphic fragments selected using RAPD markers
Fragment Number Frequency

Sequens (5’ to Present Absent
Primer of Present Absent DP
3’) Size Fragment Fragment
sample (1) (0)
OPF-01 ACGGATCCTG 1300 5 7 12 0.42 0.58 0.53
1500 8 4 12 0.67 0.33 0.48
2000 8 4 12 0.67 0.33 0.48
OPF-09 CCAAGCTTCC 600 8 4 12 0.67 0.33 0.48
700 9 3 12 0.75 0.25 0.41
1100 8 4 12 0.67 0.33 0.48
1400 9 3 12 0.75 0.25 0.41
1500 7 5 12 0.58 0.42 0.53
OPG-13 CTCTCCGCCA 400 3 9 12 0.25 0.75 0.41
500 2 10 12 0.17 0.83 0.30
600 10 2 12 0.83 0.17 0.30
650 5 7 12 0.42 0.58 0.53
750 8 4 12 0.67 0.33 0.48
800 7 5 12 0.58 0.42 0.53
900 4 8 12 0.33 0.67 0.48
1000 4 8 12 0.33 0.67 0.48
1200 7 5 12 0.58 0.42 0.53
1500 3 9 12 0.25 0.75 0.41
OPJ-20 AAGCGGCCTC 400 10 2 12 0.83 0.17 0.30
500 10 2 12 0.83 0.17 0.30
800 6 6 12 0.50 0.50 0.55
850 4 8 12 0.33 0.67 0.48
1200 10 2 12 0.83 0.17 0.30
1350 6 6 12 0.50 0.50 0.55
1400 2 10 12 0.17 0.83 0.30
1500 3 9 12 0.25 0.75 0.41
OPQ-17 GAAGCCCTTG 500 4 8 12 0.33 0.67 0.48
700 8 4 12 0.67 0.33 0.48
900 5 7 12 0.42 0.58 0.53
1000 5 7 12 0.42 0.58 0.53
1200 10 2 12 0.83 0.17 0.30
1300 5 7 12 0.42 0.58 0.53
OPW-04 CAGAAGCGGA 500 5 7 12 0.42 0.58 0.53
600 10 2 12 0.83 0.17 0.30
700 10 2 12 0.83 0.17 0.30
800 4 8 12 0.33 0.67 0.48
850 10 2 12 0.83 0.17 0.30
OPY-07 AGAGCCGTCA 600 8 4 12 0.67 0.33 0.48
750 5 7 12 0.42 0.58 0.53
850 8 4 12 0.67 0.33 0.48
900 4 8 12 0.33 0.67 0.48
1000 10 2 12 0.83 0.17 0.30
1200 6 6 12 0.50 0.50 0.55
1400 2 10 12 0.17 0.83 0.30
1500 7 5 12 0.58 0.42 0.53
1800 2 10 12 0.17 0.83 0.30
2000 3 9 12 0.25 0.75 0.41
OPY-11 AGACGATGGG 400 3 9 12 0.25 0.75 0.41
500 2 10 12 0.17 0.83 0.30
600 10 2 12 0.83 0.17 0.30
700 6 6 12 0.50 0.50 0.55
750 4 8 12 0.33 0.67 0.48
900 10 2 12 0.83 0.17 0.30
950 10 2 12 0.83 0.17 0.30
Page | 351
PROCEEDINGS
1100 6 6 12 0.50 0.50 0.55

1150 6 6 12 0.50 0.50 0.55
1200 8 4 12 0.67 0.33 0.48
1275 4 8 12 0.33 0.67 0.48
1500 9 3 12 0.75 0.25 0.41
1900 4 8 12 0.33 0.67 0.48
Rates 6.32 5.68 12 0.53 0.47 0.43
Table 2 Average values of He (Expected Heterozigosity) of each population
Population N* Na* Ne* I* He*

Seram 4.000 1.200 1.320 0.257 0.177
Soe 4.000 1.600 1.494 0.402 0.276
Keta 4.000 1.100 1.366 0.298 0.204
Total 4.000 1.300 1.393 0.319 0.219
*N : Number of samples
Na : Number of different alleles
Ne : Number of effective alleles
I : Shannon’s Information Index
He : Expected Heterozygosity
All primer selected can be used for the (Yeh et.al, 1999). The result shows that the mean
next study in genetic mapping, genetic diversity, genetic distance among the 3 population (Seram,
etc. Those primers also can be developed into Soe and Kefa) was 0.22. The highest genetic
more specific and accurate markers for specific distance was between Seram Island population and
purposes. In this research, all loci from selected Kefa District (0.291) while the lowest genetic
primers were used for early genetic diversity distance was between Seram Island and Soe
detection. All loci were analyzed using GenAlEx district (0.272) (Table 3). The results can be
6.5 (Peakall and Smouse, 2012). Using the 60 loci, different with the addition of population and
mean of expected heterozygosity(He) of the 12 number of samples.
samples was 0.219 (Table 2).The highest He Dendogram analysis shows the relation of
obtained from Soe District population (0.276) genetic distance and geographical conditions. The
while the lowest He was from Seram Island results show that the population of Pterocarpus
(0.177). This information is very important to indicus Wild from Soe District was closely related
decided number of samples per population and to Kefa District. In addition, those two populations
also distribution of population those will be used (Soe and Kefa) were separate with the Seram
for analyzing genetic diversity of the species. Island population (Figure 1). The dendogram result
Preliminary study about genetic diversity was related to the geographical conditions where
of Pterocarpus indicus Wild from 3 natural the location of Soe District and Kefa District
population i.e Seram Island, Soe District and Kefa relatively closer because it is located on the same
District was conducted based on all polymorphic island (Timor Island).
loci from all selected primers using POPGENE
Table 3 Genetic Distances of 3 populations of Pterocarpus indicus Wild using Popgene.
Population Seram Soe Kefa

Seram - - -
Soe 0.272 - -
Kefa 0.291 0.287 -
Page | 352
PROCEEDINGS
Figure 1 Dendrogram Based Nei's (1978) Genetic distance of 3 natural population of Pterocarpus
indicus Wild Method = UPGMA Modified from NEIGHBOR procedure of PHYLIP
Version 3.5.
Seram
2
Soe
1
Kefa
From the preliminary results of early genetic software for teaching and research—
genetic diversity analysis it shows that all loci an update. Bioinformatics. Oct 1; 28(19):
from selected primer were really capable to be 2537–2539.
used as identification markers. RAPD polymorphic
fragments generated in this study can be used to [4] Putri, K. P. and E. Suita. 2005. Indonesia
support the breeding program Pterocarpus indicus Forest Seed Plants Atlas Volume V: Angsana
Wild. The information provided can be applied to (Pterocarpus indicus Wild) . Special
the study of genetic diversity. Other advantages of Publications Vol. 4 No. 2.
these results is all polymorphic fragments
produced can be further developed into more [5] Siregar, I.Z., T. Yunanto, dan P.
specific markers such as SCAR marker so that Pamoengkas. 2008. The implications of
identification can be done easier, simpler and less genetic plant breeding methods of Shorea
affected by environmental conditions. johorensis Foxw on silviculture systems
Selective Logging Line (TPTJ). Biodiversity
4. Conclusion Vol. 9, No. 4
There were 60 polymorphic bands [6] Suryowinoto, S. M., 1997. Flora Exotica ,
obtained from 8 RAPD markers with high DP Shade Plants. Kanisius, Yogyakarta.
which can be used for further analysis of genetic
diversity of Pterocarpus indicus Wild. All [7] Tessier, C., David, J., This, P., Boursiquot,
polymorphic fragments produced in this study can J.M., and Charrier, A. 1999. Optimization of
be further developed into more specific markers the choice of molecular markers for varietal
such as SCAR marker so that identification can be identification in Vitis vinifera L. Theor Appl
done easier, simpler and less affected by Genet 98:171-177
environmental conditions.
[8] Yeh, F.C., Yang, R.C., Boyle, T.B.J., Ye,
References Z.H. and Mao, J.X. 1999. POPGENE 3.2 The
User-Friendly Shareware for Population
Genetic Analysis. Molecular Biology and
[1] Joker, D. 2002. Pterocarpus indicus Wild. Biotechnology Center. University of Alberta.
Seed Brief Information. No. 22. Indonesia Edmonton
Forest Seed Project, Bandung
[2] Neale, D.B., T.L.White, and W.T. Adams.

2007. Forest genetics. School of Forest
Resources and Conservation. University of
Florida, USA.
[3] Peakall, R and Smouse, P.E. 2012. GenAlEx

6.5: genetic analysis in Excel. Population
Page | 353
PROCEEDINGS
INFLUENCE OF 2,4-D AND COCONUT WATER ON CALLUS

INDUCTION AND SHOOT MULTIPLICATION OF ARTEMISIA
ANNUA L. IN VITRO
Noorita Retno Ning Tyas1, Ahmad Yunus2, Samanhudi2
1
Students of Agronomy Post Graduate Studies Program, Sebelas Maret University (UNS)
2
Lecturer Staff of Study Program of Agrotechnology, Faculty of Agriculture, Sebelas Maret
University (UNS) Jalan Ir. Sutami No. 36A, Surakarta 57126, Indonesia
E-mail: nurita_sasongko@yahoo.co.id
Abstract
Artemisia is a genus of plants whose use has been explored in medicine, especially as a source of
Artemisinin. Artemisia is a medicinal plant with Asteraceae tribe, in the form of annuals shrubs. ―Wood
worm‖ species is used to treat fever due to malaria, artemisinin is clinically proven to impede the growth
of Plasmodium sp. The increase of Artemisia is usually done in generative conventional way. However,
by conducting that way, there are some obstacles happened. Some obstruction that happened in increasing
of Artemisia can impede the sufficiency of active substance‘s content. Therefore, it is necessary to
implement in vitro technique or plant tissue culture. The research was conducted at the Laboratory of
Plant Physiology and Biotechnology, Faculty of Agriculture UNS in February 2016 to April 2016. The
type of hormones used in the in vitro technique is; the first factor with the concentration of 2,4-D which
consists of four levels ie 0 ppm; 0.5 ppm; 1 ppm; and 1.5 ppm. The second factor is the coconut water
which consists of four levels ie 0 ppm; 50 ml ppm; 100 ml and 150 ml. The parameters which were being
observed were namely; the period of callus appear, the colour of callus, the texture of callus, the period of
sprouts appear, the number of buds, the period of roots appear, and the number of roots. In the treatment
of 2,4-D 0.5 ppm + 50 ml of coconut water most rapidly inducted the callus in 9.7 HST, besides it also
has a compact texture with the green colour that dominates the callus. The fastest sprouts that grew in the
control treatment was in 10.7 HST, the number of most sprouts conducted in the treatment of 2,4-D 0.5
ppm + 150 ml of coconut water has the average at 3.5 and produced the tallest sprout in the treatment of
2,4-D ; 0.5 ppm and 150 ml of coconut water with the average as much as 2.0 cm.
Keywords: Artemisinin, Plasmodium
1. Introduction found yet. Some researches showed that malaria

parasites such as Plasmodium falciparum (the
Indonesia is a country that has abundant cause of tropical malaria) had drug-resistant
biodiversity, almost all the types of plants can malaria, such as quinine. Therefore, it is necessary
grow well in this country. One of medicinal plants to find the other alternatives to cure malaria [1].
having merit is Artemisia. They are usually found The increase of Artemisia is usually done in
in cold areas, such as Tawangmangu or Wamena, generative conventional way, but there are some
Papua. In Wamena‘s local language, this plant is obstructions by conducting that way, which is the
called as ―ganjo lalai‖ that has merit to cure seeds of Artemisia having low viability does not
malaria. Malaria is a dominant infectious disease have dormancy period. Therefore, it can be
in tropical and subtropical regions, it is very difficult to get the same seeds with their primary
dangerous disease. The disease is caused by [2]. The increase of plant tissue culture is
Plasmodium falciparum, which is transmitted by necessary to be done to fulfil the needs for seeds in
Anopheles spp. From time to time, the quick relative time and the plants can be exploited
dissemination of Malaria increases more and more, massively [3]. Biotechnology can be an alternative
because the vaccine for this disease has not been supply of seed required, by using that techniques,
Page | 354
PROCEEDINGS
it depends on the success of plant regeneration c. Callus color

system through plant tissue culture techniques.
Besides, in vitro method plants can be done in two The observations on the color of callus
ways, which are namely; organogenesis and recorded at the end of the observation by visually
somatic embryogenesis [4]. observing the color of callus formation.
The increase of plant tissue culture on Determination of callus color set based scoring [7]
medicinal plants are more likely through the :
formation process of indirectly organogenesis, it 1: brown
relates to the production of secondary metabolites 2: off-white
because it always involves the production of cells 3: brownish green
aggregates which were being cultured in culture 4: white yellowish
suspension before bioreactor system. Then, most 5: chartreuse
of the initial target is to get a callus [5]. By giving 6: whitish green
growth regulators substances on medicinal plants, 7: green
it can affect the production of secondary
metabolites on it. It happened because the addition d. Shoot time emerge
of growth regulators substances can cause the
changes in physiology and biochemistry of plants The observations are made during the first time
through the work of the enzyme. Plant growth shoots appear, the shoots emerge marked by the
regulators substances plays a role in binding green color on the bulge of the explants.
membrane protein that has the potential for
e. Shoot number
enzyme activity, the results of this binding
activated the enzyme and changed the substrate The number of shoots counted at the end of
into new products. The new product that has been the observation by counting the number of shoots
formed caused a sequence of secondary reactions, emerging.
one of them is the formation of secondary
metabolites [6]. f. Shoot height
2. Material And Methods The observations of the shoot length at the

end of the observation.
This research is conducted at the
Laboratory of Plant Physiology and Biotechnology g. Time emerge root
Faculty of Agriculture, Sebelas Maret University
from February to April 2016. The study was using Time emerge of the roots observed by
a combination of 2,4-D and coconut water, the observing the first time the roots grow, the
experiment used a completely randomized design formation of roots characterized by their white
(CRD) by factorial (4x4) with three replications. bumps on the surface of explants and declared
roots if its length is ± 5 mm.
Observations variable are:
h. Root number
a. Callus time emerge
The observations of the root at the end of the
The observations are made during the time observation.
emerge of callus, stated in HST (days after
planting). The formation of callus appeared i. Root length
marked by an amorphous on the surface of the
explants. The observationsof the root length at the end of the
observation.
b. Callus texture
The observations are performed at the end of
the observation by observing the texture of callus Plant propagation of Artemisia using leaf in
formed, the texture is usually characterized by the lateral area, which was grown in a tissue
their compact callus or crumbs (friable / fragile). culture medium MS (Murashige and Skoog),
aiming of inducing callus and shoot multiplication.
Their browning (browning) usually occurs because
of media run out the nutrient, resulting plants
become deficiency of hormone or can also occur as
Page | 355
PROCEEDINGS
a result of the sterilization process that can contamination can also inhibit plants growth,
stimulate the metabolism of phenolic compounds usually the contamination occurs in Artemisia
which are toxic, causing the plants become stunted dominated by internal and external contaminants.
and even death. The process of browning
(browning) due to the thickness of the leaves, Time emerge callus
Artemisia had a thin leaf structure, therefore after
the sterilization process, the leaves has only 50% The stages of formation in this process are
percentage to live. The vulnerable of Artemisia including callus induction, callus formation, cell
leaf structure is not resistant to the chemicals division and cell differentiation. The swell in the
compound and the duration of the sterilization explant indicating the respond given to medium,
process, therefore, when performing the the explants will undergo further stages of the
sterilization process it must be done with the right multiplication of cells (proliferation) resulting
dose, chemicals and soaking time. The level of from the absorption of nutrients in the media.
Table 1. Callus time emerge on the Artemisia callus with combinations 2,4-D and coconut water
(day after planting)
Treatment 1 2 3 Mean
D0A0 (control) - - - -
D0A1 (2,4-D 0 + CW 50 ml) - - - -
D0A2 (2,4-D 0 + CW 100 ml) - - - -
D0A3 (2,4-D 0 + CW150 ml) - - - -
D1A0 (2,4-D 0.5 ppm + CW 0 ml) 11.0 14.0 12.0 12.3
D1A1 (2,4-D 0.5 ppm + CW 50 ml) 10.0 9.0 10.0 9.7
D1A2 (2,4-D 0.5 ppm + CW 100 ml) 11.0 10.0 12.0 11.0
D1A3 (2,4-D 0.5 ppm + CW 150 ml) 10.0 10.0 11.0 10.3
D2A0 (2,4-D 1 ppm + CW 0 ml) 14.0 14.0 11.0 13.0
D2A1 (2,4-D 1 ppm + CW 50 ml) 11.0 14.0 11.0 12.0
D2A2 (2,4-D 1 ppm + CW100 ml) 12.0 14.0 14.0 13.3
D2A3 (2,4-D 1 ppm + CW 150 ml) 14.0 10.0 11.0 11.7
D3A0 (2,4-D 1.5 ppm + CW 0 ml) 14.0 14.0 12.0 13.3
D3A1 (2,4-D 1.5 ppm + CW 50 ml) 14.0 12.0 14.0 13.3
D3A2 (2,4-D 1.5 ppm + CW 100 ml) 14.0 - - 14.0
D3A3 (2,4-D 1.5 ppm + CW150 ml) 14.0 10.0 14.0 12.7
Mean 12.4 11.9 12.0
The treatment 2.4-D 0.5 ppm + 50 ml of be able to induce callus faster and provide a high
coconut water respond rather quickly on callus percentage of explants on plant green grapes (Vitis
induction for 9.7 HST. Provision of 2,4-D with a vinifera. L). Giving the different types of auxin are
low concentration it can stimulate callus formation influencing the speed of callus induction, it is
is faster, even by given a low concentrations can partly because of 150 ml coconut water contained
stimulate the growth of callus on the other hand at diphenil urea which has activities such as
high concentrations can inhibit the growth of cytokines that play a role in cell division, therefore
callus. Hypocotyls culture in Jatropa curcas L., if a media is given by auxin and cytokines with the
the fastest generated on 2,4-D treatment with a appropriate concentration can help the
dose of 2 mg / L. In addition, by given coconut development and callus growth [10].
water with 150 ml / L the results is also able to
help the stimulation of the emergence of callus, Callus texture
with combination of cytokinin and auxin functions
to stimulate callus growth [8]. The components Callus texture is differentiated into two kinds;
contained in coconut water can interact with crumbs (friable) and compact (nonfriable),
endogenous hormones in explants that spur cell compact texture (nonfriable) has the solid
division [9]. Other studies have shown that by characteristics and not easily separated and it
adding 2,4-D and coconut water up to 10% it will
Page | 356
PROCEEDINGS
usually also good for being used as a material produced bright-green callus color and it would be
producing secondary metabolites [11]. durable, meanwhile auxin caused chlorophyll
Giving of NAA and coconut water showed degradation which can be seen from the change of
that not the entire callus appeared as compact callus color [15].
texture, but some of them also belong to crumb On the increase of agarwood seeds (Aquilaria
texture. In previous study showed that the callus malaccencis Lamk.), produced whitish-green
which is produced from Rosella plants (Hibiscus callus by giving NAA concentration of 4 ppm and
sabdariffa) with NAA and BAP treatment had the 6 ppm produce brownish-white callus, it is
texture of the crumb, because the texture of the different from the treatment of IBA callus, which
fragile callus showed the future proliferation of is prodeuced on the treatment of 2 ppm and 8 ppm
cells in the callus [12]. Callus which produced in green callus color [16]. The differentiation in
crumb texture on the treatment of NAA and giving combination, type and concentration of
coconut water showed that the existence of NAA growth regulators substance will produce different
could not fully produce the compact callus texture, response depends on physiological condition of the
eventhough it had been mixed with coconut water. plant tissue [17]. The existence of coconut water
To get a textured compact callus, it is necessary to will also affect callus color, it is proven from the
decrease the concentration of auxin, the formation analysis of turmeric leaf chlorophyll content
of friable callus which was triggered by the showed that the content of chlorophyll a,
existence of endogenous auxin hormone produced chlorophyll b and total chlorophyll a / b is higher
internally by the explants that have formed the after being given coconut water as much as 15%
callus [13]. [18].
Callus color The period of sprouts appear

The quality of callus was also being assessed, The period when the sprouts appear showed
the greener of the callus color is, the better its that the explants which were planted had a process
quality, because in callus cells contained of growth. By manipulating the media
chlorophyll. The provision of plant growth formulations, the physical environment and the use
regulators on the media will also affect the color of of embryonic plant material in general can lead to
callus, the cytokinins on the media can influence multiplication of sprouts increased. Therefore, by
the green color on the callus, it happens because the existence of a high multiplication, seed
the formation of chlorophyll [14]. production efficiency through the in vitro can be
The green color which was produced from enhanced [19].
the treatment of 1.5 ppm NAA + coconut water
100 ml, showed that there were high cell activities
which was showed by high color absorption. It is
caused by the increase of cytokinin concentration
Table 2. The period when Artemisia Annua L. sprouts appear on the combined treatment of 2,4-D
and coconut water (day after planting)
D0A0 (control) 11.0 10.0 11.0 10.7
D0A1 (2,4-D 0 + CW 50 ml) - - - -
D0A2 (2,4-D 0 + CW 100 ml) - - - -
D0A3 (2,4-D 0 + CW150 ml) 11.0 - - 11.0
D1A0 (2,4-D 0.5 ppm + CW 0 ml) - - - -
D1A1 (2,4-D 0.5 ppm + CW 50 ml) - - - -
D1A2 (2,4-D 0.5 ppm + CW 100 ml) - - - -
D1A3 (2,4-D 0.5 ppm + CW 150 ml) 14.0 14.0 - 14.0
D2A0 (2,4-D 1 ppm + CW 0 ml) - - - -
D2A1 (2,4-D 1 ppm + CW 50 ml) - - - -
D2A2 (2,4-D 1 ppm + CW100 ml) - - - -
D2A3 (2,4-D 1 ppm + CW 150 ml) - - - -
D3A0 (2,4-D 1.5 ppm + CW 0 ml) - - - -
D3A1 (2,4-D 1.5 ppm + CW 50 ml) - - - -
D3A2 (2,4-D 1.5 ppm + CW 100 ml) - - - -
D3A3 (2,4-D 1.5 ppm + CW150 ml) - - - -
Mean 12.0 12.0 11.0
Page | 357
PROCEEDINGS
Control treatment grew the fastest sprout split quickly, the existence of coconut water in
with 10 HST, MS media had enough macro/micro media can develop the plant growth until 20-70%
nutrients and vitamins. Besides, endogenous auxin [21].
and cytokinin contained in explants can produce
sprouts with their macro and micro nutrients on Total sprouts
MS media, the formation of sprouts due to the
balance of growth hormones contained The observation on the number of sprouts
components outside and inside the explants [20]. done in the end of observation to determine how
At the volume of 250 ml, it gave effect on better fast the responses obtained from Artemisia by
nutrient sufficiency compared with less giving auxin and cytokinin, so that it can be seen
concentration of coconut water, besides the on which treatment that able to expand the growth
existence of auxin which can stimulate cells to of sprouts and will become a new individual plant.
Table 3. Total sprouts of artemisia shoots on 2,4-D and coconut water treatment
D0A0 (control) 2.0 2.0 4.0 2.7
D0A1 (2,4-D 0 + CW 50 ml) - - - -
D0A2 (2,4-D 0 + CW 100 ml) - - - -
D0A3 (2,4-D 0 + CW150 ml) 3.0 - - 3.0
D1A0 (2,4-D 0.5 ppm + CW 0 ml) - - - -
D1A1 (2,4-D 0.5 ppm + CW 50 ml) - - - -
D1A2 (2,4-D 0.5 ppm + CW 100 ml) - - - -
D1A3 (2,4-D 0.5 ppm + CW 150 ml) 4.0 3.0 - 3.5
D2A0 (2,4-D 1 ppm + CW 0 ml) - - - -
D2A1 (2,4-D 1 ppm + CW 50 ml) - - - -
D2A2 (2,4-D 1 ppm + CW100 ml) - - - -
D2A3 (2,4-D 1 ppm + CW 150 ml) - - -
D3A0 (2,4-D 1.5 ppm + CW 0 ml) - - - -
D3A1 (2,4-D 1.5 ppm + CW 50 ml) - - - -
D3A2 (2,4-D 1.5 ppm + CW 100 ml) - - - -
D3A3 (2,4-D 1.5 ppm + CW150 ml) - - - -
Mean 3.0 2.5 4.0
The treatment of 2,4-D 0.5 ppm + 150 ml highest number of sprout [23]. In addition, other
coconut water had a higher average of 3.50 than research studies showed that the use of coconut
the control treatment, giving high concentrations water on ginger as much as 20% produced a high
of 2,4-D would be a poison that can obstruct the of 2.22, it is proven that the coconut water
plant growth. Explants of soybean cv. White can contained cytokinins, auxin, zeatin, vitamins and
produce sprouts by giving 2,4-D and showed the minerals that can improve sprouts multiplication
number of increasing sprouts, medium components on ginger in vitro [18].
with a quantity of growth regulator substances
affecting plant regeneration, it would cause the
interaction and balance of growth regulators can
determine the direction of explants growth [22].
The addition of coconut water with concentration
of 150 ml combined with auxin was more generate
the more number of sprouts in coconut water
which contained cytokinins regulators and other
complex compounds. The addition of cytokines in
a high concentration of the auxin provided a good
effect on the formation of sprouts and produced the
Page | 358
PROCEEDINGS
The period of roots appear water supply, mineral and materials which is
necessary to support the development of plants.
Roots is an organ that affects the growth Because of the roots, the plants are able to thrive
processes in plants, since the root has merit as to and grow better since the roots can absorb
absorb nutrients from the growing media, such as nutrients from the media optimally.
Table 4. The period of roots appear in the treatment of 2,4-D and coconut water (day after
planting)
D0A0 (control) - - - -
D0A1 (2,4-D 0 + CW 50 ml) - - - -
D0A2 (2,4-D 0 + CW 100 ml) - - - -
D0A3 (2,4-D 0 + CW150 ml) - - 13.0 13.0
D1A0 (2,4-D 0.5 ppm + CW 0 ml) 14.0 14.0 - 14.0
D1A1 (2,4-D 0.5 ppm + CW 50 ml) 12.0 - - 12.0
D1A2 (2,4-D 0.5 ppm + CW 100 ml) 14.0 14.0 12.0 13.3
D1A3 (2,4-D 0.5 ppm + CW 150 ml) 14.0 - 14.0 14.0
D2A0 (2,4-D 1 ppm + CW 0 ml) 13.0 14.0 12.0 13.0
D2A1 (2,4-D 1 ppm + CW 50 ml) - - 15.0 15.0
D2A2 (2,4-D 1 ppm + CW100 ml) 14.0 - - 14.0
D2A3 (2,4-D 1 ppm + CW 150 ml) - 14.0 14.0 14.0
D3A0 (2,4-D 1.5 ppm + CW 0 ml) - - - -
D3A1 (2,4-D 1.5 ppm + CW 50 ml) - - - -
D3A2 (2,4-D 1.5 ppm + CW 100 ml) - - - -
D3A3 (2,4-D 1.5 ppm + CW150 ml) - 19.0 - 19.0
Mean 13.5 15.0 13.3
The provision of 2,4-D 0.5 ppm + 50 ml roots growth. The components of coconut water
coconut water stimulated the roots to appear faster can be integrated with endogenous hormone of the
than other treatments, 2,4-D treatment with a low explants, so it can influences the cells split.
concentration, it can stimulate more adventitious
roots up to 86% higher [24]. Meanwhile, the The number of roots
treatment that arouse the latest roots is 2,4-D 1,5
ppm + 150 ml coconut water, it caused by giving Increasing the number of roots can affect the
high 2,4-D can obstruct the root existence and by growth and development of plants due to the
formulating the appropriate auxin, it will produce existence of roots can optimize plants optimally in
high-quality roots.The existence of coconut water absorbing nutrients from the media.
also influences the formation of roots, but if it is
given in high concentration, it will decelerate the
Page | 359
PROCEEDINGS
Table 5. Number of roots artemisia root in the treatment of 2,4-D and coconut water
D0A0 (control) - - -
D0A1 (2,4-D 0 + CW 50 ml) - - -
D0A2 (2,4-D 0 + CW 100 ml) - - -
D0A3 (2,4-D 0 + CW150 ml) - - 19.0 19.0
D1A0 (2,4-D 0.5 ppm + CW 0 ml) 7.0 5.0 - 6.0
D1A1 (2,4-D 0.5 ppm + CW 50 ml) 8.0 - - 8.0
D1A2 (2,4-D 0.5 ppm + CW 100 ml) 14.0 30.0 14.0 19.3
D1A3 (2,4-D 0.5 ppm + CW 150 ml) 21.0 - 14.0 17.5
D2A0 (2,4-D 1 ppm + CW 0 ml) 9.0 12.0 19.0 13.3
D2A1 (2,4-D 1 ppm + CW 50 ml) - - 4.0 4.0
D2A2 (2,4-D 1 ppm + CW100 ml) 3.0 - - 3.0
D2A3 (2,4-D 1 ppm + CW 150 ml) - 37.0 8.0 22.5
D3A0 (2,4-D 1.5 ppm + CW 0 ml) - - - -
D3A1 (2,4-D 1.5 ppm + CW 50 ml) - - - -
D3A2 (2,4-D 1.5 ppm + CW 100 ml) - - - -
D3A3 (2,4-D 1.5 ppm + CW150 ml) - 8.0 - 8.0
Mean 10.3 18.4 13.0
The most numerous roots are obtained from References

the treatment of2,4-D 1 ppm + 150 ml coconut
water, which is namely 22.5 that the treatment of [1] Purnamaningsih, R., Lestari, E.G., Syukur, M.,
combination and concentration given very dan Yunita, R. 2010. Evaluasi Keragaman
precisely to increase the number of roots.While the Galur Mutan Artemisia Hasil Radiasi
treatment that produced less number of roots is Gamma. Jurnal Ilmiah Aplikasi Isotop dan
2,4-D 1 ppm + 100 ml coconut water, it is Radiasi. Vol. 6(2).
presumed due to the combination and
concentration being used is still lack of
interaction with the endogenous hormones which [2] Yunita, R dan Lestari, E.G. 2010. Perbanyakan
are on the plants to elongate the number ofroots. Tanaman Artemisia annua secara In Vitro.
Agro Biogen. Vol. 4(1).
4. Conclusions
[3] Mariska, I. 2002. Perkembangan Penelitian
There are several conclusions drawn from the Kultur In Vitro pada Tanaman Industri,
study of "The effect of 2,4-D and coconut water to Pangan dan Hortikultura. Agrobio. Vol.
callus induction and sprout multiplication of 5(2):45-50.
Artemisia annua L. using in vitro technique "
which is elaborated as follows:
[4] Litz, R.E. dan Gray, D.J. 1995. Somatic
1. The best callus induction is obtained in the
Embryogenesis for Agricultural
treatment of 2,4- D 0.5 ppm + 150 ml of
Improvement. World Journal Microbiology
coconut water in duration 9.7 day after planting,
and Biotechnology.
besides it has compact texture with the green
color as dominant one.
2. The fastest sprouts that grew in the control [5] Maharajan, M., Ahmed, A.B., Rosna, M.T.,
treatment was in 10.7 day after planting and the Jawahar, S., Ravi, P.R and Jayaseelan, M.
number of most sprouts conducted in the 2010. In vitro mass propagation from shoot
treatment of 2,4-D 0.5 ppm + 150 ml of coconut tip explants of Vernonia cinerea (L.) Less.
water has the average at 3.5. An antioxidant, anti inflammatory medicinal
plant. Plant Tissue Cultture &
Biotechnology. 20(2).
Page | 360
PROCEEDINGS
[6] Wardani, D.P., Solichatun dan Setyawan, A.D. [14] Widyawati, G. 2010. Pengaruh Variasi
2004. Pertumbuhan dan Produksi Saponin Konsentrasi NAA dan BAP Terhadap
Kultur Kalus Talinum paniculatum Gaertn. Induksi Kalus Jarak Pagar. Tesis. Surakarta:
Pada Variasi Penambahan Asam 2,4- Universitas Sebelah Maret.
Diklorofenoksi Asetat (2,4-D) dan Kinetin.
Biofarmasi. Vol. 2. (1). [15] Andaryani, S. 2010. Kajian Penggunaan
Berbagai Konsentrasi Bap Dan 2,4-D
[7] Thomy Z. 2012. Effect of plant growth Terhadap Induksi Kalus Jarak Pagar
regulators 2,4 D dan BAP on callus growth (Jatropha Curcas L.) Secara In Vitro.Skripsi
of plants producing gaharu (Aquilaria Fakultas Pertanian UNS. Surakarta.
malaccensis Lamk.). Prosiding Seminar
Hasil Nasional Biologi. Medan, 11 Mei [16] Romasli,, N.N.A., dan Edy, B.M.S. 2010.
2012. Respon Eskplan Biji Gaharu (Aquilaria
malaccencis Lamk.) terhadap Pemberian
[8] Zulkarnain dan Lizawati. 2011. Proliferasi NAA dan IBA Secara In Vitro Effect of Plant
Kalus dari Eksplan Hipokotil dan Kotiledon Growt Regulator NAA and IBA on Seed
Tanaman Jarak Pagar (Jatropha curcas L.) Explants Agarwood(A. malaccensis Lamk.)
Pada Pemberian 2,4-D. Jurnal Natur In vitro. Program Studi Kehutanan. Fakultas
Indonesia.Vol. 14(1). Pertanian. Universitas Sumatera Utara.
[9] Surachman, D. 2011. Teknik Pemanfaatan Air [17] Lestari, E. G. 2011. Peranan Zat Pengatur
Kelapa untuk Perbanyakan Nilam secara In Tumbuh dalam Perbanyakan Tanaman
Vitro. Buletin Teknik Pertanian. (16). melalui Kultur Jaringan. Balai Besar
Penelitian dan Pengembangan Bioteknologi
[10] Niluh, M.D.PYD., Waeniati., Muslimin dan dan Sumberdaya Genetik Pertanian. Bogor.
Suwastika, N. I. 2012. Pengaruh Jurnal AgroBiogen.Vol. 7 (1): 63-68.
Penambahan Air Kelapa Dan Berbagai
Konsentrasi Hormon 2,4-D Pada Medium [18] Kristina, N.N dan Syahid, F.S. 2012.
Ms Dalam Menginduksi Kalus Tanaman Pengaruh Air Kelapa Terhadap Multiplikasi
Anggur Hijau (Vitis Vinifera L.). J. Natural Tunas In Vitro, Produksi Rimpang dan
Science. Vol. 1.(1) 53-62. Kandungaan Xanthorrhizol Temulawak Di
Lapangan. J. Littri. Vol. 18 (3) :125-134.
[11] Indah, N.P., dan Dini, E. 2013. Induksi Daun
Nyamplung (Calophyllum inophyllum Linn.) [19] Hutami, S., Purnamaningsih, R., Mariska, I.,
pada Beberapa Kombinasi Konsentrasi 6- dan Diantina, S. 2014. Multiplikasi Tunas
Benzylaminopurine (BAP) dan 2,4-D dan Induksi Perakaran pada Ubi Kelapa
Dichlorophenoxyacetic Acid (2,4 D). Sains (Dioscorea alata L.) dan Gembili
dan Seni Pomits. Vol. 2 (1) : Hal E1-E6. (Dioscorea esculenta L.) Secara In Vitro.
Jurnal Agrobiogen. Vol. 10(2):53-60.
[12] Imam, M., Sri, M., Dan Addarwida, O. 2014.
Pembentukan Kalus Tanaman Rosella [20] Nursetiadi, E. 2008. Kajian Macam Media
(Hibiscus Sabdariffa) Pada Pemberian dan Konsentrasi BAP Terhadap Multiplikasi
Naftalen Acetyl Acid (Naa) Dan Benzyl Tanaman Manggis (Gercinia mangostana.
Amino Purin (Bap) Sebagai Sumber Belajar L) Secara in vitro. UNS. Surakarta.
Konsep Bioteknologi. Jurnal Biogenesis. [21] Riny, R.T. 2014. Pengaruh Penggunaan Air
Vol. 11 (1). Kelapa (Cocos nucifera) Terhadap
Pertumbuhan Tanaman Sawi (Brassica
[13] Lizawati. 2012. Induksi Kalus Embriogenik juncea L.). Biopendix. Vol. 1 (1).
Dari Eksplan Tunas Apikal Tanaman Jarak
Pagar (Jatropha Curcas L.) Dengan [22] Shan Z, Raemakers K, Emmanouil N,
Penggunaan 2,4 D Dan Tdz.Fakultas Tzitzikas ZMA, Richard G, Visser F. 2005.
Pertanian. Universitas Jambi. Vol. 1 (2). Development of a high efficient, repetitive
system of organogenesis in soybean (Glycine
max (L.) Merr). Plant Cell Rep.
Page | 361
PROCEEDINGS
[23] Peni, K., Muhammad, T. H., dan Evie, R.

2013. Pengaruh Zat Pengatur Tumbuh 2,4-D
(2,4-Dichlorophenoxyacetic acid) dan
Kinetin (6-Furfurylaminopurine) untuk
Pertumbuhan Tunas Eksplan Pucuk
Tanaman Jabon (Anthocephalus cadamba
Miq. ex Roxb.) secara In Vitro. LenteraBio.
Vol.2 (1).
[24] Zia, M., Riaz-ur-Rehman, and Chaudhary,

M.F. 2007. Hormonal Regulation for
Callogenesis and Organogenesis of
Artemisia absinthium L. Afrc. J. of Biotech.
6(16).
Page | 362
PROCEEDINGS
OPTIMIZING OF AUXIN AND CYTOKININ FOR IN VITRO

SHOOT AND ROOT INDUCTION, MULTIPLICATION AND MINI-
TUBER SEED PRODUCTION OF POTATO CULTIVAR
”GRANOLA KEMBANG”
Misbah Ruhiyat, Syarif Husen, Nurina Farahiyah
Department of Agrotechnology, University of Muhammadiyah Malang, Tlogomas 246, Malang,

Indonesia
E-mail: mruhiyat@yahoo.co.id; syarifhusen.hasan@gmail.com; nagamitsuazuki@gmail.com
Abstract
This study aimed to evaluate the effect of auxin (NAA and IAA) and cytokinin (Kinetin) on the growth of
potato through in vitro. The explants used are plantlets of varieties of potato Granola Kembang (GK).
Murashige and Skoog with treatment (IAA 0005 mg L-1 - 0015 mg L-1); (NAA 0.005 mg L-1 - 0015 mg
L-1); (Kinetin 1 mg L-1 - 2 mg L-1). Research using randomized block design. The results showed that the
best buds potato plantlets grown on MS medium that is equipped with 0,005 mg L -1 NAA and 1 mg L -1
Kinetin. Root growth in the media that comes with 0.005 mg L-1 IAA and 1 mg L -1 Kinetin. Percentage
of life and growth of the plantlets best at this stage of acclimatization was obtained on media 0.005 mg L-
1
NAA and 1 mg L -1 Kinetin. Meanwhile, production of mini-tubers seed best shown in media MS is
equipped with 0,005 mg L-1 NAA and 1 mg L -1 Kinetin which gives the best results on diameter (mm),
weights (g) and the number of mini-tuber crops.
Keyword: auxin, cytokinin, mini-tubers, in vitro
1. Introduction kinetin) gives the best results on potato growth [4].

Auxin and cytokinin compounds will be in effect
Potato variety of Granola Kembang (GK) is until plantlets were planted in the field. So that it
an important commodity in Indonesia. GK needs to be seen the effect of using plant media in
cultivars production is still low due to the culture towards acclimatization and mini-tuber
constraints of climate, soil and seed. The quality formation.
seed potatoes is not yet available in sufficient Therefore, it is necessary to study the effect
quantities (of seed production in the country has of plant growth regulator IAA, NAA and Kinetin
only met 7.4%). It is necessary for the procurement on MS medium to the growth of potato shoots.
of seeds in the country of quality and virus-free, Thus, we get a more efficient use of hormones
through in vitro culture. Planting medium in vitro during in vitro culture until planting in the field.
culture must have the right composition to ensure
the growth of plantlets during incubation, 2. Methods
multiplication and acclimation time in the field.
This study aims to assess the combination of auxin The study was conducted at the Laboratory of
and cytokinin compounds in vitro potato GK Biotechnology University of Malang. Research
during incubation until acclimatization in the field. using Random Block Design with 6 treatments and
Some reports indicated that cytokinin 4 replications. The treatments were P1 (IAA 0,005
optimal concentration to enhance the growth of mg L-1 + Kinetin 1 mg L-1 ), P2 (IAA 0,010 mg L-1
shoots on average is 2 mg / l [1], [2], [3]. And, + Kinetin 1,5 mg L-1 ), P3 (IAA 0,015 mg L-1
(IAA) auxin concentration 0.01 mg / l [1]. Other
studies have shown that the concentration of auxin
(0.1 mg / l NAA) and cytokinin (0.01 mg / l
Page | 363
PROCEEDINGS
Planting material 3. Results and discussion

The planting material used is stem segments Shoots growth
plantlets of potato variety of Granola Kembang
from sub-culture results conducted at the The result showed that the combination of
Laboratory of Biotechnology University of IAA, NAA and Kinetin significantly affect the
Muhammadiyah Malang. number of shoots and shoot length, but did not
significantly affect the time to shoot growth, leaf
Shoots and roots induction number and the number of node.
The result revealed that NAA and Kinetin
Stem cutting from plantlets grown in combination gives the best results for the mean
medium MS [5] with 4 explants of each bottle number of shoots compared with the combination
were then incubated in the culture room at 22 ± 2 ° of IAA and Kinetin. In several studies reported
C with 16 hours of light and 8 hours of dark. that cytokinin synthesis applied to plant culture led
Variable observations of shoot growth observed to the level of natural zeatin, so that zeatin ribose
when the sprout first, the number of shoots, shoot in the plant increases [6].
length, number of nodes and the number of leaves. The concentrations of NAA 0.005 mg L-1 +
Variable observation of root growth observed Kinetin 1 mg L-1 provides the best results for the
while growing the first root, root number, and root parameters of shoot length, number of nodes and
length. The data were analyzed using the F test and the number of leaves. While the treatment of 0,005
the test continued HSD 5% if the effect using ppm IAA + kinetin showed the fastest time when
Microsoft Excel 2007. the sprout first. On the parameter number of buds
treatment NAA 0,010 mg L-1 + kinetin 1.5 mg L-1
Acclimatization planlet gave the highest mean value. Number of shoots
and shoot length, the higher the concentration of
Planlet 40. HST incurred in the culture auxin and cytokinin given the lower average value.
bottles, cleaned the root of the media that is then It proves that the higher of concentration of auxin
cut ± 5 stem segments and grown in medium husk and cytokinin have a negative effect on the growth
and compost in the ratio of 1: 3, for 3 weeks. The of potato shoots. Other studies have reported the
parameters observed percentage of plantlets life, IAA with a concentration of 0,015 mg L-1 to above
plant height and number of leaves. are not effective for the growth of shoots from
potato plantlets segment [2].
Production of mini-tubers
Roots growth
Cuttings planted on seedbox (40 x 25
cm), medium husk and compost (1: 3). Results of analysis of variance showed
Fertilization use liquid fertilizer growmore 1g/l, that auxin (IAA and NAA) and cytokinin (Kinetin)
watering is done every day. All treatments were with different combinations grow significantly
planted in Insect net. The parameters observed during the first root, root number and root length
were tuber diameter (mm), Weight bulbs (g) and (Table 2). The treatment of IAA 0.005 mg L-1 +
the number of tuber crops. Kinetin 1 mg L-1 provides the fastest roots
growth. Such treatment also results not
significantly different from the NAA 0.005 mg L-1
+ Kinetin 1 mg L-1 against the average number of
roots and root length. Based on the average time to
grow roots first, the number and length of roots
showed a lower, if the concentration of auxin and
cytokinin given higher. It is proved that a high
concentration of plant growth regulator that has a
negative effect on the growth of potato tubers [2].
Page | 364
PROCEEDINGS
Table 1. Average shoot growth, shoot number, shoot length, leaf number, and number of node of
potato plantlets in vitro after 40 days.
Shoot growth Shoot Shoot length Leaf Node

Treatments
(day) number (cm) number number
-1 -1
IAA 0.005 mg L + Kinetin 1 mg L 3.63 a 4.30 ab 5.85 b 13.40 a 13.31 a
-1 -1
IAA 0.010 mg L + Kinetin 1.5 mg L 3.85 a 3.38 a 4.99 a 11.07 a 10.88 a
-1 -1
IAA 0.015 mg L + Kinetin 2 mg L 3.72 a 4.15 ab 4.78 a 10.67 a 10.47 a
-1 -1
NAA 0.005 mg L + Kinetin 1 mg L 3.67 a 4.77 b 6.00 b 13.76 a 13.82 a
-1 -1
NAA 0.010 mg L + Kinetin 1.5 mg L 3.80 a 5.01 b 5.37 ab 12.86 a 12.70 a
-1 -1
NAA 0.015 mg L + Kinetin 2 mg L 3.76 a 4.81 b 5.27 ab 13.18 a 13.07 a
Values on the same column. followed by different letters. are significantly different (p < 0.05).
Table 2. The average of root growth. root number. root length of potato plantlets after 40 days.
Treatments Root growth (day) Root number Root length (cm)

-1 -1
IAA 0.005 mg L + Kinetin 1 mg L 7.42 a 3.92 b 5.85 b
-1 -1
IAA 0.010 mg L + Kinetin 1.5 mg L 8.95 abc 3.46 ab 4.99 a
-1 -1
IAA 0.015 mg L + Kinetin 2 mg L 9.66 bc 3.12 a 4.78 a
-1 -1
NAA 0.005 mg L + Kinetin 1 mg L 7.84 ab 4.04 b 6.00 b
-1 -1
NAA 0.010 mg L + Kinetin 1.5 mg L 9.45 abc 4.04 b 5.37 ab
-1 -1
NAA 0.015 mg L + Kinetin 2 mg L 10.18 c 3.65 ab 5.27 ab
Values on the same column. followed by different letters. are significantly different (p < 0.05).
Table 3. The average value of length of shoot and leaf number at acclimatization stage of potato
plantlets after 4 weeks.
Treatments Shoot length (cm) Leaf number

-1 -1
IAA 0.005 mg L + Kinetin 1 mg L 5.23 7.25
IAA 0.010 mg L-1 + Kinetin 1.5 mg L-1 7.00 8.17
IAA 0.015 mg L-1 + Kinetin 2 mg L-1 6.83 6.92
NAA 0.005 mg L-1 + Kinetin 1 mg L-1 8.88 10.92
NAA 0.010 mg L-1 + Kinetin 1.5 mg L-1 7.03 10.72
NAA 0.015 mg L-1 + Kinetin 2 mg L-1 6.75 8.96
Table 4. The average of mini-tuber diameter. mini-tuber weight and number of mini-tubers after 4
weeks planting.
Mini-tuber diameter Mini-tuber Number of

Treatments
(mm) weight (g) mini-tuber
IAA 0.005 mg L-1 + Kinetin 1 mg L-1 18.10 4.71 3.00
IAA 0.010 mg L-1 + Kinetin 1.5 mg L-1 22.55 8.64 6.50
IAA 0.015 mg L-1 + Kinetin 2 mg L-1 19.00 6.58 3.58
NAA 0.005 mg L-1 + Kinetin 1 mg L-1 27.07 17.14 10.56
NAA 0.010 mg L-1 + Kinetin 1.5 mg L-1 24.34 11.51 7.67
NAA 0.015 mg L-1 + Kinetin 2 mg L-1 21.57 6.85 4.33
Plantlets acclimatization growth of the plantlets produced the highest yield

in the NAA and Kinetin combination with a low
Treatment NAA 0.005 mg L-1 + Kinetin 1 concentration.
-1
mg L provides the best results on the plant height
and number of leaves on acclimatization. This Mini-Tubers production
shows that the treatment of NAA and kinetin with
low concentrations increase the vitality and growth Mini-tubers resulted from MS medium
of potato plantlets in acclimatization. However. the with NAA 0.005 mg L-1 + Kinetin 1 mg L-
Page | 365
PROCEEDINGS
1
provides the best growth and production (table References
4). The treatment gives the best results in all
parameters of good observations on tuber [1] Chaudhary. B and P. Mittal. 2014. The effects
diameter. tuber weight and number of potato of Different Concentration and Combination
tubers. Although. IAA treatment of 0.005 mg L-1 of Growth Regulators on the Micro
+ Kinetin 1 mg L-1 provides the lowest results in Propagation Of Potato (Solanum tuberosum
all parameters. Based on data. the combination of L.).International Journal of Education and
NAA and Kinetin give better result than IAA and Science Research (IJESRR).. 1 (4) : 65-70.
Kinetin combination in all parameters.
[2] Hoque. M. E. 2010. In-Vitro Regeneration
4. Conclusion Potentiality Of Potato Under Different
Hormonal Combination. World J. of Agric.
Growth regulator NAA 0.005 mg L-1 + Kinetin 1 Sci.. 6 (6): 660-663.
mg L-1 consistently deliver outstanding results in
the induction phase of the shoot. root induction. [3] Sultana. R.S.. 2001.Callus Induction And
the acclimatization phase and the production phase Evaluations In Potato (Solanum Tuberosum
mini- tubers. Therefore. for efficient production of L.) M.Sc. Thesis. Rajshahi Univ. Rajshahi.
mini- tubers of potato cultivars ―Granola Bangladesh.
Kembang‖ (GK) we recommend using a
combination of NAA 0.005 mg L-1 + Kinetin 1 mg [4] Badoni. A. and J. S. Chauhan. 2009. Effect of
L-1. Growth Regulators On Meristem Tip
Development And In-Vitro Multiplication Of
Acknowledgment Potato Cultivar ‗Kufri Himalini‘. Nature and
Sci.. 7 (9): 31-34.
We are grateful to Ministry of Research.
[5] Murashige T.1977. Plant Propagation Through
Technology and Higher Education of the Republic
Tissue Culture. Annual Rev. Plant Physiol.
of Indonesia for financial support through ―PUPT‖
25: 135 – 166.
program. Many thanks to ―Plant improvement‖
UMM Biotechnology laboratory for providing [6] George. F.E.. M.A. Hall. G.J.D. Klers. 2008.
plantlets. methods and technical assistance. Plant Propagation by Tissue Culture 3rd
Edition. Springer. Netherlands.
Page | 366
PROCEEDINGS
IDENTIFICATION OF ARBUSCULAR MYCORRHIZAE FUNGI

ASSOCIATED WITH RAUVOLFIA SERPENTINA(L.)
BENTH.EXKURZ FROM SEVERAL AREAS IN JAVA-INDONESIA
Sulandjari1*, Widyatmani Sih Dewi2,Endang Yuniastuti1

1.
.Agrotechnology Studies Program, Agriculture Faculty of Sebelas Maret University;
2.
Soil Science Studies Program, Agriculture Faculty of Sebelas Maret University
Biotechnology and Biodiversity Research Center ,Sebelas Maret University, Ir. Sutami
36a,57126,Surakarta,Indonesia
E-mail: sulandjari@staf.uns.ac.id
Abstract
The root of Rauvolfia serpentina contains more than 50 different alkaloid such as resepina, yohimbina,
serpentina and ajmalina which has potential to treat wide range of disease. According to CITES (the
Convention on International Trade in Endangered Species of Wild Fauna and Flora) and IUCN (The
International Union for the Conservation of Nature), Rauvolfia serpentina is classified as appendix II and
categorized as endangered species.. The aim of this study is to identify AMF species that lives under teak
tree which asssociated with Rauvolfia serpentina's root infection from KPH Saradan, Tekil Wonogiri and
Randublatung forests in Jawa. To identify the types of AMF, we performed morphological analysis
towards mychorrhyzal rhizosphere and RFLP analysis. The microscopical analysis showed that
Rauvolfia serpentina's root from Randublatung was infected by Glomus spp whereas KPH Saradan and
Tekil Wonogiri by Glomus spp and Gigaspora spp. RFLP analysis showed that Rauvolfia serpentina from
Randublatung has one type of AMF whereas KPH Saradan and Tekil Wonogiri infected by three and four
different types of AMF. The conclusion : 1) Environmental factors of Rauvolfia serpentina in habitat
Randublatung, Saradan and Wonogiri not differ. 2) Types of mycorrhizal rhizosphere Rauvolfia sepentina
in general is a group of Glomus and Gigaspora
Keywords: Identification; Mycorrhizae; Rauvolfia serpentina
1. Introduction Arbuscular Mycorrhiza Fungi (AMF) is a

symbiotic relationship between fungi with plant
Rauvolfia serpentina is one of the medicinal plants roots have been found the first time more than 400
that have been declared endangered because they million years ago (Redecker et al. [3]; Remy et al.
were taken directly habitat regardless of the power [4]. Smith and Read[5]. In the symbiosis, AMF
of regeneration and in Indonesia until now the help plants provide nutrients and protect them
efforts of cultivation has not done. Biodiversity from various abiotic and biotic stress (Newsham et
conservation can be reached by way of in-situ and al. [6]; Smith and Read[5]). Therefore, AMF plays
ex-situ. The best strategy for long-term an important role in most terrestrial ecosystems.
preservation is the preservation in situ, but for rare Nonetheless, symbiotic efficiency depends on
species and has pushed the population needs to be environmental and genetic factors of both
a strategy of ex-situ primarily to plants in the symbionts (Giovannetti and Gianinazzi-Pearson
category of critical [1-2]. Endemic microbiota is [7]).Some research shows that the presence
expected to solve the above problem with the R.serpentina living under a teak (Tectona grandis)
ability to symbiotically with plants R. trees also associated with the AMF (Sulandjari et
serpentinathe ecological services that support the al. [8-9]. Understanding the ecological factors that
growth and increase the yield. influence of AMF on R.serpentina rhizosphere is
veryimportant as an effort to plant domestication at
outside their habitat.
Page | 367
PROCEEDINGS
The existence and diversity of AMF at further cuts electrophoresed on 2% agarose gel
R.serpentinarhizosphere are affected by soil type with TAE buffer and visualized under UV light
or other environmental factors, it is still unknown. after staining with ethidium bromide. Furthermore
The aim of this study is to identify AMF species clones that have different RFLP profile selected
that lives under teak tree which asssociated with for further sequencing.
Rauvolfia serpentina's root infection from KPH
Saradan, Tekil Wonogiri and Randublatung forests 3. Results and Discussion
in Java.
The researchindicatesthathabitatSaradan,
2. Methods WonogiriandRandublatunghave a
conditionsimilarmicroclimates (Table.1).
In this studyhas beencarried outthe Sulandjari[8]in her researchshowsthat thelimiting
isolation growth factorsofR.serpentinais a light intensity.In
andidentificationofmycorrhizalrootRauvolfiaserpe theshadedensity of50%(4918 lux) up to 80%(1337
ntinaendemicin theareaunder thestands lux), they have higherlevels ofreserpina. than
ofTeakKPHSaradanEast Java, thedensity ofshade20%(8928 lux). However,in
andKPHRandublatung,Wonogiriin Central Java. contrast tothe dry weight ofroots.Lambersetal.
Identification of [9]stated thatplantsunderhigh light
Mycorrhizaesporescarriedbymorphologicalcharact intensityallocatephotosynthateinrootyieldas a
eristics.such assporeshape, arrangement ofspores, storageof food reserves. Neverthelessroot
hyphaeshape, size andcolor ofspores. In addition growthspeedvaries depending onthe environmental
tothe identification conditions[10], butlow-intensity lightstimulates the
ofmycorrhizaeconductedsoilanalysisalsoaims to formation ofsecondarymetabolitesinrootsin
determine thepresence ofmycorrhizaein whichthe response todefense.
ground state isgreatlyaffectedpopulations, Table 2. shows that the type and soil
colonization, and thetypes ofmycorrhizae.Endemic chemical properties in Saradan allows a higher
mycorrhizal identification by either taking soil nutrient availability than Wonogiri and
samples around the roots and root bark pieces of Randublatung. Soil pH at 6 easier for roots to
R. serpentina. Soil samples were taken at rhizosfer absorb soil nutrients and microorganisms that
a depth of 30 cm. Collecting spores carried support soil fertility will live better. Sulandjari
premises casting method-filter (wet sieving) of [12] stated that the type of soil affect to root dry
Gardemann & Nicholson. weight, but had no effect on levels of reserpina.
Identification of spores was observed For the growth and yield R. serpentina,they growth
using a dissecting microscope with a magnification at latosol soils better than growth at regosol. The
of 100-400 x. Decoration, color, surface shapes, difference in the two types of soils should not
sizes and color changes in spores caused a reaction affect the levels of resrerpina. As an alkaloid, is a
with the dye Melzer basis to distinguish one type backup storage N reserpina dumped and no longer
to another[6-7]. Identification include the type and metabolized (Hashimoto and Yamada, 1994),
density of mycorrhiza.PCR products of the 45 therefore the availability of N is sufficient,
samples analyzed further restriction fragment resulting in the synthesis of amino acids as a
polymorphisms using restriction enzymes AluI and precursor of the alkaloid also increased.
HhaI simultaneously (double digest). Results of
Tabel 1: Geographicaland climatic of thelocation habitat Rauvolfia serpentina
No Plant origin/ Co ordinates Altitude Temperature Average Light

o
Habitat (meters ( C) rainfall per intensity
a.s.l.) annum (mm) (lux)
0
1 Saradan Latitude 7 37’ 30’’ S 548 25-31 563-3.303 6.456
0
longitude 111 31’44’’ E
0
2 Wonogiri Latitude 7 46’ 16’’ S 348 26-32 557-2.476 6.755
0
longitude111 15’17’’ E
0
3 Randublatung Latitude 7 05’ 10’ S 248 29-32 670-2072 7.477
0
longitude 4 40’44’’ E
Page | 368
PROCEEDINGS
Tabel 2. Soil type and chemical of the habitat Rauvolfia serpentina
No Plant origin Soil total Phosphorusavaila Potassiumexchan Cation Acidit

Type Nitroge ble ged exchangecapacity(m y
n (ppm) (me%) e%) (pH)
(%)
1 Saradan latosol 0.25 16.32 0.28 24.05 6.10
2 Wonogiri mediteri 0.15 12.21 0.19 20.22 4.82
an
3 Randublatu grumoso 0.20 11.44 0.20 20.22 4.32
ng l
Figur 1-3 shows that the results of isolation and Characteristics: Glomus
morphological identification conducted in Saradan Sporesellipticaltranslucentbrown. Sporesurfaceis
and Randublatung obtain mycorrhizal genus notsmooth, has a style. Sporewallis not clear.
Glomus and Gigaspora while on location Wonogiri
has identified the genus Glomus. The type and Gigaspora Glomus [7]
characteristics of the spores were found to have RANDUBLATUNG
differences ranging from the shape, color, texture
and size. From the results of the identification of
the genus Glomus spores are found in all locations.
This suggests that the tolerance level and Glomus
has high adaptability to the environment both in
acidic and neutral soils. Figure 3. Mycorrhizal genus obtained
inlocation of Randublatung
Characteristics: Gigaspora, sporesare

blackandround. Sporesurfacesmooth, has
Glomu nopattern. Sporewallis unclearanduneven. Glomus,
sGigaspora[7] Orange-yellow spores, sporewallis
SARADAN clear.shapedsporesround, smoothsporesurface,
withfeatures such asthorns, have stalksspores
Figure 1. Mycorrhizal genus obtained inlocation
of Saradan.
M R S W M
Characteristics : Glomus, sporesblackish brown,

withblack spotson thespores. Sporewallis notclear.
Gigaspora, sporesare blackandround.
Sporesurfacesmooth, has nopattern. Sporewallis
unclearanduneven.
Glomus[7]
WONOGIRI
Note: : M = Markers. R= Randublatung. S =
Figure 2. Mycorrhizal genus obtained inlocation Saradan.W = Wonogiri
of Wonogiri.
Figure 4. Analysis of RFLP R. Serpentina.
Page | 369
PROCEEDINGS
Four-hundred- million-year-old vesicular-

The results of RFLP analysis using the arbuscularmycorrhizae. Proc Natl Acad Sci
restriction enzyme AluI and HhaI (double digest) USA 91:11841–11843
is shown in Figure 2. From this figure, it is seen
that the Randublatung location, Pulepandak plant [5] Smith SE, Read DJ (1997) Mycorrhizal
is infected by one type of the AMF, while on symbiosis. Academic, San Diego
Saradan and Wonogiri infected by 3 and 4
different types of AMF, respectively. Based on the [6] Newsham KK, Fitter AH, Watkinson AR
RFLP pattern shows that Randublatung site (1995) Arbuscular mycorrhiza protect an
infected by AMF different types with two other annual grass from root pathogenic fungi in the
locations, but for the Wonogiri and Saradan sites field. J Ecol 83:991–1000
there are several types of AMF are the same and
[7] INVAM. International Culture Collection of
some are different. From these results indicate that
(Vesicular) Arbuscular Mycorrhizal Fungi.
the environment in which plants grow determines
West Virginia University.2014
the types of AMF that can infect of R. serpentina
[8] Sulandjari .2005. Mikroklimatrelationshipwith
4. Conclusion the contentreserpinapulePandak(Rauvolfia
serpentinaBenth.).Journal of Tradisional
1. Environmental factors of Rauvolfia Medicines. 10(33):34-38
serpentina in habitat Randublatung.
Saradan and Wonogiri not differ [9]Lambers H., H. Poorter.1992. Inherent
2. Types of mycorrhizal rhizosphere Variation in Growth Rate between
Rauvolfiasepentina in general is a group of Higherplants: a Search for Physiological
Glomus and Gigaspora Causes and Ecological Consequences.
Adv.Ecol.Res. 23:187-261
References
[10]Fitter,A.H. and R.K.M.Hay,
[1]Zhang JT, Ru WM, Li B (2006). Relationships 1991.Environmental Physiology of Plants.
between vegetation and climate on the Loess Academic Press.Inc.(London)Ltd.
Plateau in China. Folia Geobot. 41: 151-163.
[11]Herms, D.A., W.J. Mattson. 1992. The
2]Zhang JT, Ru WM (2010). Population Dilemma of Plants : to Growth or Defend. Q
characteristics of endangered species Taxus Rev. Biol. 67:283 – 335
chinensis var. mairei and its conservation
strategy in Shanxi, China. Popul. Ecol. In [12] Sulandjari.2006. Effect ofseason
press. DOI andorganicfertilizerto the results roots
andreserpina(Rauvolfia serpentinaBenth).J.
[3]Redecker D, Kodner R, Graham LE Agrin. 10(2):113-118
(2000)Glomalean fungi from the Ordovician.
Science 289:1920–1921 [13]Hashimoto and Y. Yamada.1994. Alkaloid
Biogenesis: Molecular Aspect. Annu.Rev. Plant
[4] Remy W, Taylor TN, Hass H, Kerp H (1994) Physiol.Plant Mol.Biol.
Page | 370
PROCEEDINGS
THE EFFECTS OF SUBSTRATE AND NUTRITION ON CHILLI

(CAPSICUM ANNUUM)HYDROPONICS
Dwi Harjoko1), Samanhudi2), W.S. Dewi2), andBambang Pujiasmanto2)

1)
Graduated Student in Sebelas Maret Unversity, Surakarta, Indonesia
2)
Department of Agrotechnology. Faculty of Agriculture. Sebelas Maret University, Surakarta, Indonesia
E-mail : dwifpuns@yahoo.com
Abstract
This study aimed to determine the best substrate and nutrition as well as their interaction on the growth
and yield of chilies. Hydroponic substrate is a modern farming system using media aside soil such as
husk, broken tiles, broken bricks, palm fiber, sand, and steamed rice husk. Standard nutrition as a main
source of nutrients in a hydroponic substrate, the addition of NPK nutrients used to support the standard
nutrient for growth and yield of chili. This study aims to determine the best substrate and nutrition as well
as their interaction on growth and yield of chili. Research conducted at screen house Faculty of
Agriculture, Sebelas Maret University using a completely randomized design with 2 factors, substrates
and nutrients. The data analysis used F test level of 5% and if it‘s significant continued with DMRT
(Duncan Multiple Range Test) level of 5%. The results showed that treatment sand substrate and nutrients
AB mix with the addition of NPK showed the best results and were able to increase plant height, number
of leaves, number of flower, fruit weight and number of fruit.
Keywords: husk, broken tiles, broken bricks, palm fiber, sand, NPK
1. Introduction hydroponics is an important factor that affects

growth because it serves in the supply of water and
Chili (Capsicum annuum L.) are commodities nutrients for plants (Nugroho 2013). The foremost
that are important and much needed in Indonesia to requirement for hydroponic media should be light
fulfill the needs of society. Frequent price and porous. The use of hydroponic media can
increases chilli are very volatile and needs in the utilize wastes include rice husk, broken tiles,
market is not sufficient for consumers in broken bricks, palm fiber, sand and chaff steamed
Indonesia. Fresh chili production in 2014 Planting medium is assumed not containthe
amounted to 1.075 million tons. Compared to the macro and micro nutrients, thus requiring nutrient
year 2013, there was an increase production of solution is essential for plant growth (Mas'ud
61.73 thousand tons (6.09 percent). The use for 2009). The addition of NPK at a low price
household needs 0.38 million tonnes is fulfilled, considered able to support the availability of
but for non-household or industrial and other still macro elements for plants. This study aims to
deficiencies (BPS 2015). This happens because of determine the best substrate and nutrition as well
several factors, including growth that strongly as their interaction on growth and yield chilli.
influenced by less precise chili cultivation
techniques, environmental conditions, and pests 2. Research Methods
such as aphids.
Hydroponics is one of the modern system of This research was conducted in October 2015
cultivation by using media besides soil until February 2016 in the screen house B, Faculty
(Mugundhan et al. 2011). The use of hydroponics of Agriculture, University Sebelas Maret,
system knows no season and does not require a Surakarta. Materials used are chili seeds
large area compared to the culture of the land to (Capsicum annuum L.) F1 Hybrid Hot Pepper,
produce the same unit productivity. Media husk, broken tiles, broken bricks, palm fiber, sand,
and husk steamed, mix a solution of AB
Page | 371
PROCEEDINGS
(standard), and Phonska NPK fertilizer. The tools According Harjoko (2009) that the media is a
used polybags (30 x 35 cm), grinding machines, place roots to stand and help the establishment of a
measuring cups, analytical balance, water drums, plant so that the conditions and the nature of
mixers nutrients, buckets, sprayer, EC meter and a different media it will influence the growth and
metered. development of different plants. High yield the
The study design used was completely best crop was obtained on a substrate of sand. The
randomized factorial design comprised two factors. nature of sand with fine particles capable of
The first factor is the substrate with 6 levels (S0 = helping the establishment of the plant is better than
husk, S1 = tile fragments, S2 = fractional bricks, the other substrate so as to create strong roots and
S3 = fiber palm, S4 = sand, and S5 = husks absorb water and nutrients to the
steamed and the second factor is a nutrient with 2 optimum.According Purwadi (2007), the pepper
levels (N1 = the solution mix AB, and N2 = plant can grow well with a variety of substrates
solution mix AB plus Phonska NPK). each hydroponic nutrition when appropriate so that
treatment was repeated 5 times. The observations certain elements are not toxic.
of variables in terms of height, the number of fresh
leaves, the number of axillary branches, the dry Number of leaves
weight of the canopy, root length, root volume,
weight offruit accumulation and the number of The leaves are part of the plant that serves as
fruit accumulation. The data were tested using the the site of photosynthesis. The leaves are very
F test level of 5%. If then continued with Duncan related to the content of chlorophyll which is a
Multiple significant level of 5%. green dye. The more green color of leaves, the
chlorophyll content the higher the better so that the
3. Results and Discussion process of photosynthesis (Fitriany et al. 2013).
Plant height
Growth is a process of cell division
(increasing the number) and cell enlargement
(increasing the size) that result in changes in the
size of the larger plants (Gardner et. al
1991).Treatment sand substrate showed high
growth curly pepper plants are better than the other
treatments. Perwtasari et al. (2012) stated that an
increase early plant that will slowly increased in a Information:
certain phase and after reaching the point of 1. S0: Charcoal Husk, S1: Fractional tiles, S2:
maximum growth speed will decrease. The Fractional bricks, S3: Palm fiber, S4: Sand, S5:
imbalance of macro and micro elements in a Husk Steamed
medium will affect plant growth (Laureano et al. 2. Values followed by the same letter show no
2013). significant difference in the level of 5% DMRT
Figure 2. Effect of the substrate on the amount

of fresh leaves chilli.
Based on Figure 2 are known substrates

influence on the amount of fresh leaf chili and the
best results seen on the substrate husk. Husk
having good porousitas so aerase impartial and
drainage (Silvina and Syafrinal 2008). The ability
of the media in providing nutrition is very
Information: influential in the growth of plants, including the
1. S0: Charcoal Husk, S1: Fractional tiles, S2: formation of shoots. Not only the macro elements,
Fractional bricks, S3: Palm fiber, S4: Sand, S5: micro elements should also be available to plants.
Husk Steamed According to research Astolfi et al. (2004) that
2. Values followed by the same letter show no Cadmium (Cd) in hydroponics systems can affect
significant difference in the level of 5% DMRT plant growth Avena sativa. Excess Cadmium can
Figure 1. Effect of substrate on plant height hinder growth and metabolic processes of plants.
chilli. Such conditions also involve other elements such
Page | 372
PROCEEDINGS
as C, N, and S. Lack of availability of nutrients for plantswill form a productive branch when nutrient
plants will affect the process of photosynthesis and needs can be met properly.
plant growth causing impaired. This can be seen in Based on Figure 3 are known influence of the
the difference in the number of fresh leaves in a substrate on the number of axillary branches and
variety of treatments. The ability of palm fiber the best results seen on the substrate husk
substrate provides nutrients that are low in impact (control). The particle size of the substrate which
growth in the number of fresh leaves. Besides is used as a medium affects the availability of
palm fibers are susceptible to fungus triggers nutrients for plants that need the use of nutrition
disruption making process nutrients by plant roots. with the right composition in the cultivation
In addition to the environmental conditions also hidropnik (Rolot and Seutin 1999). According
affect the amount of fresh chilli leaf curl. Silvina and Syafrinal (2008) properties of rice
Temperatures that are too high will cause the husk which has good porousitas the availability of
leaves to wilt and water shortages due to water and oxygen to the roots can be met so that
respiration were too high so that the leaves turn the optimal plant growth. Meanwhile, palm fiber
yellow and dry quickly. This will reduce the has the lowest result since it is easily malleable
amount of fresh leaves are counted each week. and fungus that disrupts the growth of roots in the
absorption of water and nutrients.
Number of axillary branches
Preservation armpit chili branch will affect
the growth of plants because of chili will bear fruit
in the armpit branch (Hatta 2012). Underarm
branches will form new shoots and grow into
branches. According to Gardner (1985) the
establishment of branches is an effective way to
increase leaf area per plant and will have an impact
on the process of photosynthesis of a plant.
Information:
1. N1 : Mix AB, N2 : Mix AB + NPK
2. Values followed by the same letter show no
significant difference in the level of 5% DMRT
Figure 4. Effect of nutrition on the number of

axillary branches chilli.
Based on Figure 4 can be seen the influence

of nutrition on the number of axillary branches
Information: chilli. The additionof NPK can increase vegetative
1. S0: Charcoal Husk, S1: Fractional tiles, S2: growth of the plants that can be seen from the
Fractional bricks, S3: Palm fiber, S4: Sand, S5: number of axillary branches. According to the
Husk Steamed Lingga (2005) of nitrogen (N) was instrumental in
2. Values followed by the same letter show no the vegetative phase of this because it serves
significant difference in the level of 5% DMRT stimulate growth in the vegetative phase,
especially on the stems and leaves. Nitrogen can
Figure 3. Influence of the substrate on the be absorbed by plants in the form of NO3-
number of axillary branches chilli. (nitrates) and NH4+ (ammonium). Effect of nutrient
availability for plants plays an important role in
Observation number of axillary branches the vegetative growth of plants. Shortage of
need to be done because the chili plants to bear nutrients for plants can lead to slower growth and
fruit at the armpit curly branches not shoot. So by less than the maximum.
knowing the number of axillary branches, the
results obtained can be estimated. Likely the more
axillary branches then the result is also increasing.
According Safuan et al. (2013) that the chili
Page | 373
PROCEEDINGS
Canopydry weight According Pramanik et al . (2000 ) root growth is

also affected by temperature and irradiation
The dry weight of the end product due to the received by the plant .A supportive environment,
efficiency of absorption and utilization of solar the growth and development of plant roots would
radiation provided by the plant canopy. The be optimal.
presence of absorption of solar radiation by leaves
more and more time to make the production of dry
weight hence higher stover (Adimihardja et al.
2013). The use of different media can affect the
growth of plants such as fresh weight and dry
weight. According Dewir et al. (2005 ) substrates
that have aerase and good moisture can promote
the growth of plants. Hydroponics uses perlite with
proper nutrition is able to show a good response to
the plant Spathiphyllum compared to other media.
Information:
1. S0: Charcoal Husk, S1: Fractional tiles, S2:
Fractional bricks, S3: Palm fiber, S4: Sand, S5:
Husk Steamed
2. Values followed by the same letter show no
significant difference in the level of 5% DMRT
Figure 6. Effect of the substrate on root length.
Information: Media that have a high porousitas then it will

1. S0: Charcoal Husk, S1:Fractional tiles, S2: cause nutrients provided directly flows to the
Fractional bricks, S3: Palm fiber, S4: Sand, S5: bottom. It is seen in the 3 treatment results in
Husk Steamed figure 6 is the longest husk charcoal, palm fiber
2. Values followed by the same letter show no and husks steamed because it has a cavity on the
significant difference in the level of 5% DMRT edge of the medium so that the nutrients easily
undrained down. Elongated root system will grow
Figure 5. Effect of substrate to canopy dry to meet the needs of water and nutrients for plants.
weight of chilli. According Guritno Sitompul (1995) that the plants
growing in a state of lack of water, it forms the
root longer with a lower yield than the plants
Based on known figure 5 best result on the enough water. This is supported by the statement
substrate of husk charcoal (control) because the Mas'ud (2009) the planting medium with proper
husk charcoal has porousitas that is better able to nutrition will provide optimal growth of plant roots
provide enough water and nutrients to plants. The and extends to meet the nutrient needs of plants..
condition affects plant growth media. The nature
of the media that is able to meet the nutrient and Volume of roots
water will support plant growth. A medical
condition that can hold water, capable of Characteristics and condition of the medium
supporting roots and is able to provide nutrients it very influenced the plant roots. Sand shows the
will increase the weight of the wet and dry weight results of the root volume is the highest compared
of a plant for optimal growth (Wasonowati 2011). to other substrates 67.5 ml. Sand is a media that
have poreslarge enough so fast wet or dry
Length roots sand.The use of sand as biofilters able to support
the availability of oxygen to the roots and
Roots are very important organs of the plant microbes in media (Minett et al.2013). It can be a
because it deals directly with the ground and good medium for the growth of root hairs that look
serves to absorb water and nutrients. Conditions on a substrate of sand has a good root distribution.
root growth is strongly influenced by
environmental factors growth (Syarief 1998).
Page | 374
PROCEEDINGS
Information:
1. S0: Charcoal Husk, S1: Fractional tiles, S2:
Fractional bricks, S3: Palm fiber, S4: Sand, S5:
Husk Steamed Information:
2. Values followed by the same letter show no 1. S0: Charcoal Husk, S1: Fractional tiles, S2:
significant difference in the level of 5% DMRT Fractional bricks, S3: Palm fiber, S4: Sand, S5:
Husk Steamed
Figure 7. Effect of substrate on the root volume. 2. N1: Mix AB, N2: Mix AB + NPK
Figure 8. Graph of the accumulated weightof

The availability of nutrients in the fertilizers chilies.
applied to support the growth of roots. Absorption
of water and nutrients that is effective on the
ground can be seen from the increase in the The highest yield seen in the treatment of
volume root (Ngakumalem et al. 2013). Nutrient sand and nutrient substrate mix AB with the
needs for the plant is an important factor for addition of NPK (S4N2). Sand also has good
optimal growth. Macro and micro nutrients must aeration and porous, but has a cumulative surface
be met in a balanced way. One of the essential area is relatively small, so the ability to store water
nutrients are calcium (Ca), which is very is very low or the soil dry faster (Fahmi 2013).
influential in the meristem or growing point of the Lowest yield seen on the substrate palm fiber and
root end so that the root volume to grow and nutrients mix AB (S3N1). Conditions were
stimulate growth (Sutiyoso 2004). watered palm fiber nutrients make the media is
always moist so that the oxygen content is reduced
to rooting.It can inhibit the growth of plants and
Fruit weight accumulation affect the crops. According Harjadi (1979) that the
establishment and fruit filling is influenced by the
Hydroponics is performed in an enclosed nutrients (N, P and K) to be used in the process of
space such as a greenhouse, capable of reducing photosynthesis, namely as a constituent of
disease and environmental influences more carbohydrates, fats, proteins, minerals and
controllable so as to increase fruit production vitamins that are forwarded gets fruit storage. The
(Galvez et al. 2014). Weight of fruit each period is more the number of fruit will affect the weight of
not always increased because it is influenced by the fruit.
plant growth. In this study, administration of NPK
able to increase the weight of the fruit crop.
According Safuan et al. (2013) in his study that the Number ofaccumulated fruit
administration of N and K as well as its
combination with gliokompos able to provide a Differences of materials used as substrates
real influence on the growth of plant height, of different media will result in environmental
number of branches, number of fruits and fruit conditions different media thus affecting the
weight. production and nutritional value of fruits (Palencia
et al. 2016). The level of temperature, aeration and
humidity media will vary from one media to the
other media suitable material used as a medium.
The more productive branches , the amount of fruit
will increase (Surtinah 2007).
Page | 375
PROCEEDINGS
1. There is no interaction between the

substrate and the nutrients provided. The
best results in the treatment of substrates
and nutrients mix sand with the addition
of NPK AB able to increase growth and
yield of chilli compared to other
treatments that looks at variable plant
height, weight of the fruit, and the amount
of fruit.
2. The substrate of sand is able to provide
most excellent influence on the growth
and yield of hydroponic chilli compared
to other substrates.
3. Treatment mix AB plus NPK nutrients
Information: better and be able to increase the growth
1. S0: Charcoal Husk, S1: Fractional tiles, S2: and results of chilli hydroponic nutrient
Fractional bricks, S3: Palm fiber, S4: Sand, S5: mix compared to AB.
Husk Steamed
2. N1: Mix AB, N2: Mix AB + NPK b. Suggestions
Figure 9. Graph of the accumulated amount of Suggestions given to research is necessary
chilies. combination of the substrate with a certain ratio
and the addition of NPK on nutrient mix AB
should be done with multiple doses so as to know
Treatment of sand and nutrient substrate mix which combinations of substrates and doses of
AB with the addition of NPK (S4N2) produces the NPK right so increasing the growth and yield of
largest amount of chilies. While the lowest result chilli can look very significant.
occurred in the treatment of palm fiber substrate
and nutrient mix AB (S3N1). The use of different References
media will produce different effects on plant
growth. The nature and condition of the media will [1] Adimihardja SA, Hamid G dan Rosa E. 2013.
play a role in the process of absorption of water Pengaruh Pemberian Kombinasi Kompos Sapi
and nutrients that are used for plant growth. The Dan Fertimix Terhadap Pertumbuhan Dan
availability of water and nutrients are needed for Produksi Dua Kultivar Tanaman Selada
the plant. According Nurjannah et al. (2012) in his (Lactuca sativa L.) Dalam Sistem Hidroponik
research the amount of N, P and K enough for a Rakit Apung. J Pertanian 4 (1 : 6-20)
red pepper plant so it can produce more fruit than
other treatments. It is also reinforced Lingga [2] Astolfi S, Zuchi S, and Passera C. 2004.
statement (1999) that the growth of the fruit also Effects of cadmium on the metabolic activity
require nutrients, especially nitrogen, phosphorus of Avena sativa plants grown in soil or
and potassium. Nitrogen is required for the hydroponic culture. J Biologia Plantarum 48 (3
formation of chlorophyll which is useful in the : 413-418). DOI :
process of photosynthesis, but it works in the 10.1023/B:BIOP.0000041095.50979.b0
formation of proteins and fats. The element
phosphorus is useful to stimulate root growth, [3] Badan Pusat Statistik. 2015. Produksi Cabai.
helps assimilation and respiration as well as http://bps.go.id. Diakses pada tanggal 13 Mei
accelerate flowering, fruit formation and ripening 2016.
fruits and seeds.
[4] Dewir YH, Chakrabarty D, Ali MB, Hahn EJ,
and Paek KY. 2005. Effects of hydroponic
4. Conclusions and Suggestions solution EC, substrates, PPF and nutrient
scheduling on growth and photosynthetic
a. Conclusion competence during acclimatization of
micropropagated Spathiphyllum plantlets. J
he conclusion that can be drawn from this Plant Growth Regulation 46 (241–251). DOI
study are as follows: :10.1007/s10725-005-0161-1
Page | 376
PROCEEDINGS
[5] Fahmi ZI. 2013. Media Tanam sebagai Faktor sand-based laboratory-scale constructed
Eksternal yang Mempengaruhi Pertumbuhan biofilters. J Ecological Engineering 58 (414-
Tanaman. Balai Besar Perbenihan dan Proteksi 422). DOI : 10.1016/j.ecoleng.2013.06.028
Tanaman Perkebunan Surabaya.
[18] Mugundhan MR, Soundaria M, Maheswari V,
[6] Fitriani L, Toekidjo dan Purwanti S. 2013. Santhakumari P And Gopal V. 2011.
Keragaan Lima Kultivar Cabai (Capsicum ―Hydroponics‖- a novel alternative for
annuum L.) Di Dataran Medium. J Vegetalika geoponic cultivation of medicinal plants and
2 (2 : 50-63). food crops. International Journal of Pharma
and Bio Sciences, 2 (Issue 2: 286-296). URL :
[7] Galvez FL, Allende A, Salcedo FP, Alarcon JJ, www.ijpbs.net P - 287
and Gil MI. 2014. Safety assessment of
greenhouse hydroponic tomatoes irrigated with [19] Ngakumalem S, Rasdanelwati, dan Eviza A.
reclaimed and surface water. International 2013. Pengaruh Berbagai Jenis Zat Pengatur
Journal of Food Microbiology 191 (97-102). Tumbuh Auksin dan bahan Tanam Setek Pucuk
DOI : 10.1016/j.ijfoodmicro.2014.09.004 Terhadap Pertumbuhan dan Produksi Cabai
merah Hibrida. J Penelitian Lumbung, 12 (1 :
[8] Gardner PF, Pearce RB, and Mitchell RL. 103-113)
1991. Fisiologi Tanaman Budidaya
(diterjemahkan dari: Phisiology of Crop Plants, [20] Nugroho AW. 2013. Pengaruh komposisi
penerjemah : Herawati Susilo). Penerbit media tanam terhadap pertumbuhan awal
Universitas Indonesia. Jakarta. 428 hal. cemara udang (Casuarina Equisetifolia Var.
Incana) pada gumuk pasir pantai (effect of
[9] Guritno B dan Sitompul SM. 1995. Analisis planting media composition on Casuarina
pertumbuhan tanaman. Yogyakarta. Gadjah equisetifolia var. Incana growth in the coastal
Mada University Press. sand dune). Forest Rehabilitation Journal, 1 (1 :
113-125). URL : http://forda-mof.org.pdf.
[10] Harjadi SS. 1979. Pengantar Agronomi.
Jakarta. Gramedia. [21] Nurjannah IY, Santoso E, Anggorowati D.
2012. Pengaruh Beberapa Jenis Pupuk
[11] Harjoko D. 2009. Studi Macam Media Dan Kandang Terhadap Pertubuhan dan Hasil
Debit Aliran Terhadap Pertumbuhan Dan Hasil Tanaman Cabai Merah Pada Tanah Gambut.
Tanaman Sawi (Brassica juncea L.) Secara Fakultas Pertanian Universitas Tanjungpura
Hidroponik NFT J. Agrosains11(2): 58-62. Pontianak.
[12] Hatta M. 2012. Pengaruh Pembuangan Pucuk [22] Palencia P, Bordonaba JG, Martínez F, and
dan Tunas Ketiak Terhadap Pertumbuhan dan Terry LA. 2016. Investigating the effect of
Hasil Tanaman Cabai. J. Floratek 7: 85 – 90. different soilless substrates on strawberry
productivity and fruit composition. J Scientia
[13] Laureano RG, Nogales AG, Seco JI, Horticulturae 203 (12-19). DOI :
Rodríguez JGP, Linares JC, Martínez F, and 10.1016/j.scienta.2016.03.005
Merino J. 2013. Growth and maintenance costs
of leaves and roots in two populations of [23] Perwtasari B, Tripatmasari M, dan
Quercus ilex native to distinct substrates. J Wasonowati C. 2012. Pengaruh Media Tanam
Plant Soil 363 (87–99). DOI : 10.1007/s11104- Dan Nutrisi Terhadap Pertumbuhan Dan Hasil
012-1296-2 Tanaman Pakchoi (Brassica juncea L.) Dengan
Sistem Hidroponik. J Agrovigor, 5 (1: 14-25).
[14] Lingga P. 1999. Petunjuk Penggunaan Pupuk.
Jakarta. Penebar Swadaya. [24] Pramanik MHR, Nagai M, Asao T, and
Matsui Y. 2000. Effects of temperature and
[15] Mas‘ud H. 2009. Sistem hidroponik dengan photoperiod on phytotoxic root exudates of
nutrisi dan media tanam berbeda terhadap cucumber (Cucumis sativus) in hydroponic
pertumbuhan dan hasil selada. Media Litbang culture. Journal of Chemical Ecology 26 (8:
Sulteng 2 (2: 131-136). 1953-1967). URL :
http://download.springer.com/static/pdf/58/art
[16] Minetta DA, Cook PLM, Kessler AJ, and
%253A10.1023%252FA%253A100550911031
Cavagnaro TR. 2013. Root effects on the
7.pdf?origin
spatial and temporal dynamics of oxygen in
Page | 377
PROCEEDINGS
[25] Purwadi. 2007. Formulasi Ratio Kalium Dan Produksi Tanaman Cabai Merah (Capsicum
Natrium (K/N) Hara Larutan Hidroponik annuum L.). J Agroteknos, 3 (3 : 127-132)
Sistem Substrat Untuk Tanaman Lombok
(Capsicum annum). J Pertanian Mapeta, 10 (1: [28] Silvina F dan Syafrinal. 2008. Penggunaan
66-71). Berbagai Media Tanam dan Konsentrasi Pupuk
Organik Cair pada Pertumbuhan dan Produksi
[26] Rolot JL and Seutin H. 1999. Soilless Mentimun (Cucumis sativus) Secara
production of potato minitubers using a Hidroponik. J Sagu, 7 (1 : 7-12).
hydroponic technique. Potato Research 42
(457-469). URL: [29] Syarief HF. 1998. Fisika Kimia Tanah
http://link.springer.com/article/10.1007/BF023 Pertanian. Bandung : Pustaka Buana.
58162
[30] Wasonowati C. 2011. Meningkatkan
[27] Safuan LO, Rakian TC, dan Kardiansa E. Pertumbuhan Tanaman Tomat (Lycopersicon
2013. Pengaruh Pemberian Berbagai Dosis esculentum) dengan Sistem Budidaya
Gliokompos Terhadap Pertumbuhan dan Hidroponik. J Agrovigor, 4 (1 : 21-2
Page | 378
PROCEEDINGS
GENETIC ANALYSIS OF ORCHID HYBRIDS (DENDROBIUM)

WITH RANDOM AMPLIFIED POLYMORPHIC DNA(RAPD)
Agus Budiyono1, Sri Hartati2, and Ongko Cahyono 3

1.3
Agriculture of Faculty University of Tunas Pembangunan Surakarta, Indonesia 57138
2
Departement of Agrotechnology Faculty of Agriculture University of SebelasMaret Surakarta.
Indonesia, 57126
tatik_oc@yahoo.com
Abstract
The study was done to prove natural Orchid hybrids of Dendrobium by RAPD technique and to determine
the relationship of natural hybrids of Dendrobium with both parental. Isolation of DNA carried by CTAB
method with modifications and amplification carried out by PCR. Hybrids and parental relationship was
obtained from Jaccard similarity coefficient and displayed in a Dendogram (family tree). Proof of the
natural hybridD. biggibum x D.liniale and D. mirbelianum x D.linialecan be done by the RAPD
technique using the primers OPB 12, OPB 17, OPB 18
Analysis RAPD primers produced 36 amplified fragments varying from 250 bp to 2000 bp in size. 90,04
% of the amplification bands were polymorphic. The dendrogramresult indicated a considerable level of
the molecular RAPD analysis showed genetic diversity parent 60 – 70% and can to conclude present a
new variation in hybrid ♀D. mirbelianum x ♂D. liniale was 38%, hybrid ♀D. biggibum x ♂D. liniale was
33% and hybrid ♀D. liniale x♂D. biggibum was 25%..
Keyword: Dendrobium, Genetic, Hybrid, Orchids, RAPD
1. Introduction F1 cross orchid results ♂ D. liniale x ♀ D.

biggibum , ♀ D. biggibum x ♂ D.liniale, ♀ D.
Orchids which have good quality and superior mirbelianum x ♂ D.liniale with moleculer RAPD
can be obtained from the results of a cross. In (Random Amplified Polymorphic DNA.
addition, the mixture of orchid is also done to add
new genetic diversity 2. Methods
RAPD analysis of one of the methods that
can be used to set and view the characteristics used Plant material
to analyze the phylogenetic relationship between
plant species and genetic diversity [1]. Orchid Materials orchids D. liniale , D. biggibum
plant is a plant that has a distinctive pattern of high dan D. mirbelianum collection of Bogor Botanical
diversity [2] Garden LIPI. Group result of crosses between
Research[3] on the plant Vanda Hybrid compared hybrid ♂ D. liniale x ♀ D. biggibum , ♀ D.
with the parent, with the RAPD analysis has been biggibum x ♂ D.liniale, ♀ D. mirbelianum x ♂
successfully used for interspesies as well as D.liniale. The chemicals used in this study is,
between species. From the dendrogram can CTAB (Cetyltrimethyl Ammonium Bromide) 10%,
distinguish wild orchids, hybrids, species from PVPP (polivinilpolipirilidon), Tris-HCl buffer 1
each other with three different levels. M, 0.5 M EDTA, 5 M NaCl, CIAA (Chloroform
The study was done to prove natural Isoamyl Alcohol), isopropanol, ethanol 70%, the
Orchid hybrids of Dendrobium by RAPD extraction buffer, TE buffer (Tris HCl EDTA),
technique and to determine the relationship of TAE buffer, loading buffer, sodium acetate,
natural hybrids of Dendrobium with both parental primers, PCR master mix (H2O, Stoffel buffer,
and to determine the genetic diversity of the new dNTPs, MgCl2, and Taq polymerase enzyme),
Page | 379
PROCEEDINGS
agarose, gel loading, and EtBr (ethidium bromide). ensure the reproducibility of RAPD. PCR products
primers OPB 12, OPB 17, OPB 18. were visualized in 2% agarose gel electrophoresis
for 60 min at 50 Volt. This was followed by EtBr
DNA extraction staining (0.15 µl mL-1) before photographed in gel
documentation system (AttoBioinstruments) and
Genomic DNA was extracted following the 100 bp ladder (Promega) was used as DNA
methodology described by Doyle and Doyle marker.
(1987), with some modifications. DNA Isolation
was conducted from 1 g of young leaves then Statistical analysis
suspended in 20 ml, of Extraction buffer (20 nM
EDTA at pH 8.0, 100 nMTris-HCl at pH 8.0, 1.5 The amplification products were analysed by
M Nacl, 2% CTAB and 1% merkaptoethanol 1% 5 marking their presence (1) or absence (0) for each
µL. Thesuspension was mixed well, incubates at DNA fragment generated. The data obtained were
600C for 45 min, followed by chloroform isoamyl analyzed with the NTSYS-PC (Numerical
alcohol (24:1) extraction and precipitation with 0.6 Taxonomy andMultivariative Analysis System)
volume of isopropanol at 200C for 1 h. The DNA version 2:02 Unweight pair group method with
was pelleted down by centrifugation at 12.000 rpm arithmetic method (UPGMA) function SIMQUAL
for 10 min andwas then suspended in TE buffer (Qualitative Similarity) and utilized to obtain the
(10 mMTris-HCl and 1 mMEDTA pH 8.0). The genetic similarity matrix using Dice coefficient
DNA was purifed from RNA and protein by [5] , The UPGMA (Unweighted Pair Group
standart procedures 15 and its concentration was Method using Arithmetic Average) clustering
estimated by agarose and electrophoresis and method was used to construct a dendrogram.
staining with ethidium bromibe. Isolated DNA was
visualized for its quantity and quality by running 3. Results and Discussion
them in 1% Agarose gel electrophoresis.
The intensity of DNA bands in each
RAPD amplification primary amplification product is affected by the
purity and concentration of DNA template . It
DNA amplification was performed in Takara allows not all that RAPD markers can be amplified
Thermocycler [4] with total volume of PCR in plants and the hybrid parent plant. The results
reaction of 15 µl consisting of 0.2 nMdNTPs; 1X are then analyzed the tape, the tape showed only
reaction buffer; 2mM MgCl2; 10 ng of DNA amplification used for scoring and for analysis
sample; 0.5 pmole of single primer; and 1 unit of further [1] . Several DNA bands appearing on the
Taq DNA polymerase (Promega). Fifteen RAPD hybrid but not found in the parent is likely to occur
primers obtained from Operon Technologies, USA due to recombination or mutation. Instead
were tested initially with randomly selected crossovers chromosomes during meiosis can lead
individuals from populations. Eleven primers that to loss of the primary side so that the primary
showed clear and reproducible result were use in amplified by parent but not amplified in hybrid [6].
the analyses. PCR reaction was conducted twice to
Table 1Primer sequences.polymorphic bands and the percentage of polymorphism in RAPD

analysis
No Primer Squence 5’ to 3’ Size (bp) Total band Polimorfict %
band Polimorfirs
1 OPB-12 CCTTGACGCA 250-1200 30 10 100
2 OPB-17 AGGGAACGAG 250-2000 37 10 100
3 OPB-18 CCACAGCAGT 250-800 41 5 71.4
∑ 108 25 271.4
Rata-rata 36 8.3 90.04
Page | 380
PROCEEDINGS
Identification of a mixture of results on criteria of polymorphic..

these studies using three primer RAPD (Random UPGMA cluster analysis resulted in a
Amplified Polymorphic DNA), namely: OPB-12, dendrogram depicting the genetic relationship
OPB-17, OPB 18, showed the bands was between all accessions tested RAPD analysis. [8]
polymorphic 90.04 %, the resulting bands is a also explained that based on RAPD markers can be
total of 36 with the bands amplified by an average seen that the DNA of Dendrobium hybrid is the
of 8.3 bands per primer. Polymorphism is a picture result of a combination of the two parent. The
obtained by amplification of the DNA fragment technique RAPD that can be used to confirm the
differences were observed and scored as the hybrid nature [9]. The low level of interspecific
presence or absence of sequence differences that differentiation compared to the intraspecific
indicate the presence or absence variation [7] This differentiation level showed relatively high genetic
study used six markers at both interchanges with similarity [10]
OPB-17 and OPB-18 showed 100% into the
OPB-12 OPB 18
Figure. 1 Amplification DNA with primer OPB-12 dan OPB-18: D. mirbelianum (1).D. biggibum
(2). D. liniale (3). ♀D. biggibum x ♂D.liniale (4-5) ♀D.liniale x ♂D. biggibum (6-7). ♀D.mirbelianum
x ♂D.liniale (8-9).
Figure 2.Dendrogram of RAPD with 3 primer OPB 12. OPB 17 dan OPB 18 on parent
D.mirbelianum (1).D. liniale (2). D. biggibum (3). Hybrid ♀D. biggibum x ♂D.liniale (4-5).
Hybrid ♀D.liniale x ♂D. biggibum (6-7) and hybrid ♀D.mirbelianum x ♂D.liniale (8-9).
Page | 381
PROCEEDINGS
Identification of the hybrid can be plolymorphism amplified by arbitrary

confirmed by looking at the specific bands in both primers are useful as genetic markers.
types of parents inherited by individual Nucleic Acid Research, 18(22): 6531-6535.
derivatives. [11] . The appear bands owned by
hybrid, but not owned by the two parents, and [5] Rohlf. 1998. NTSYS-pc Numerical Taxonomy
bands that appear only on one of the parents only, and Multivariative Analysis Syersion
doesn‘t appear on the hybrid and the other parents Version 2,02. Exertersorfware. New York.
[12] . It was found in this study in the figure 2 of
dendrogram 0.60 (60% ) shows the first cluster [6] Tiyagi BR, Ahmed T, Bahl JR.1992.
consists only of parents D. mirbelianum and D. Cytology, genetics and breeding of
liniale, the second cluster is composed of parents commercially important Mentha species.
D. bigibbum and all individuals F1 result of hybrid Curr Res Med Arom Plants 14 : 51-56
♀D. biggibum x ♂D. liniale and individuals F1
result of hybrid ♀D. mirbelianum x ♂D. liniale. [7] Gregor, Mc., C.E., C.A. Lambert, M.M.
The third cluster consists of individual result of Grylic, J.H. Louw, and L. Warnich. 2000. A
hybrid ♀D. lineale x♂D. biggibum. [3] on Vanda comparison assessment of DNA finger
hybrid plants with parent, RAPD analysis has been printing technique (RAPD, ISSR, AFLP, and
successfully used for intraspecies and interspecies. SSR) in tetraploid potato (Solanum
Results dendogram can distinguish wild orchids, tuberosum L.) germplasma. Euphytica 113:
hybrids, species from each other with three 135 – 144.
different levels.
[8] Inthawong S, Weenun B, Nuttha K and
Pimchai A. 2006. Analysis of Intersectional
4. Conclusions Hybrid of Dendrobium by RAPD Technique.
Genetic diversity parent 60 – 70% and can Kasetsart Journal, 40(2): 456-461.
to conclude present a new variation in hybrid ♀D.
mirbelianum x ♂D. liniale was 38%. hybrid ♀D. [9] Zhang F, Ge YY, Wang WY, Shen XL and Yu
biggibum x ♂D. liniale was 33% and hybrid ♀D. XY. 2012. Assessing genetic divergence in
liniale x♂D. biggibum was 25%. interspecific hybrid of Aechmea gomosepala
and A. recurvata var. recurvata using
Reference inflorescence characteristic and sequence-
related amplified polymorphism markers.
[1] Arya V, Yadav S., and JP Yadav. 2011. Intra Genetic and Molecular research, 11(4): 4169-
Specific Genetic Diversity Of Different 4178.
Accessions Of Cassia Occidentalis By RAPD
[10] Nielsen LR, Siegismund HR (1999)
Marker. Gen. Eng. and Biotech. J., 1 (22) : 1-
Interspecific differentiation and hybridization
8
in Vanilla species (Orchidaceae). Heredity
[2] Khosravi, A.R., Kadir M.A, Kadzemin S.B, 83: 560–567
Zaman F.Q, And De Silva A.E. 2009. RAPD
[11] Shasany, A.K, M.P. Darokar, S. Dhawan,
Analysis Of Cholchicine Induced Variation
A.K. Gupta, S. Gupta, A. K. Shukla, N.K.
Of The Dendrobium Serdang Beauty. Afr.
Patra, and S. P. S. Khanuja. 2005. Use RAPD
Journal Of Biotech., 8 (8): 1455-1465
and AFLP Markers toIdentify Inter- an
[3] Tanee Tawatchai Piyawadee Chadmuk, Intraspesific Hybrids of Mentha. Journal of
Runglawan Sudmoon, Arunrat Chaveerach Heredity.96(5): 542-549
and Kowit Noikotr, 2012. Genetic analysis
[12] Dhillon, R.S, M.S. Hooda, M.Jattan,
for identification, genomic template stability
V.Chawla. M.Bhardwaj and S.C. Goyal.
in hybrids and barcodes of the Vanda species
2009. Development and Molecular
(Orchidaceae) of Thailand. Afr. J. of
Characterization of Interspesific Hybrid of
Biotech., 11(55), 11772-11781
Jatropha curcas x J. integerrima. Indian
[4] Williams JGK, Kubelik AR, Livak KJ, Journal of Biotechnology. 8: 384-390
Rafalsky JA, Tingley SV. 1990. DNA
Page | 382
PROCEEDINGS
CHARACTERIZATION OF SALAK (SALACCA ZALACCA

(GAERTNER (VOSS)BASED ON CHROMOSOME. STOMATA
AND MOLECULAR
Nandariyah
Agrotechnology of Agriculture Faculty Sebelas Maret University
email nandar.suroso@yahoo.com
Abstract
Salak (Salacca zalacca (Gaertner (Voss)) is a kind of fruit plant nature of Indonesia. People like this fruits
because of its specifically delicious taste and reach of nutrition. Fruits salak has an economic important
value of domestic and a broad market. Breeding program to find a new superior must be done conform
with demand need. Early activities of breeding program is study diversity of salak. Research aimed was
to know the genetic diversity of salak based on growing nature by study of chromosome stomata and
molecular characters and to find out the genetic relationship among salacca cultivars that can be selected
as parental material for breeding program. Materials used for molecular analysis were salak Pondoh
Super, Kembangarum, Madu, Bejalen (Java), Bali, and Enrekang (Sulawesi). Ten primers used to DNA
molecular analysis in order to characterize and clustering of salak genotypes. Chromosome and stomata
analysis was observed of Bali, Padang sidempuan, Pondoh super and Gading salak. The dendogram by
molecular analysis showed varieties of salak was not distinct about growing nature but tend to quality of
fruit taste. Salak cultivars has same chromosome number (2n=2x= 28). Types of chromosome salak are
belong to metacentric and sub metasentric. There was a difference carryotipe formula among three
cultivars of salak. Bali and Gading have carryotype formula 2n = 11 m + 3 sm, salak Padang Sidempuan
and salak Pondoh have 2n = 9 m + 5 sm. Salak Bali has the narrowed asimetri intra chromosome and
index chromosome. There were the difference of stomata number and formed of three cultivars of salak.
Salak Bali has 76 stomata /mm2. Salak Padang Sidempuan has 78 stomata/mm2, salak Pondoh has 68
stomata /mm2 and salak Gading has 80 stomata/mm2. Salak Gading (S. zalacca cv gading) has the bigger
stomata than Salak Bali. The dendogram of six cultivar salak showed cluster divided on four part based
on growing nature of salak plant.
Keyword: Salak, chromosome, stomata, molecular
1. Introduction Salacca in Padangsidempuan and its near regions,

the Salacca zalacca in Java, Madura, Bali,
Salak or Salacca (Salacca zalacca Gaertner. Voss) Sulawesi and Ambon, and the Salacca wallichiana
is an originally tropical plant of Indonesia, belong in Thailand (Mogea,1982).
to Palmae group, divisio of Spermatophyta, class
of Monocotyledoneae, ordo of Spadicifloreae, 2. Materials
genus of Salacca, species of Salacca edulis
(Mogea, 1982). Ashari (1995) proposed the Materials used was Sumatrana salacca (Padang
possibility of salacca plant was originated from Sidempuan or Red Salak), Java Salak (Pondoh
Indonesia, since its wild type still could be found Super, Gading, Madu, Bejalen), Bali Salak and
in West Java region until South of Sumatera and in Enrekang (South Sulawesi Salak). Descriptif
Kalimantan forests. The Salacca genus consist of analysis followed by cultivars clustering
21 species spread naturally in regions of based on molecular analysis.
Malesiana, from Myanmar, Thailand, Malaysia,
Filipina, and Indonesia specially in Kalimantan,
South of Sumatera and West Java. Three species of
salacca plant have been cultivated: the Sumatrana
Page | 383
PROCEEDINGS

a. Chromosome
Figure 1 Chromosome of salak Bali (a). Padang Sidempuan (B). Pondoh (C) and Gading (D).
Number of chromosome salak species are Sidempuan Pondoh is 2n = 28 = 9m + 5sm

same: 2n = 28. Carriotype formula of Bali and (m=metacentric, sm=sub metacentric).
Gading salak are 2n = 28 = 11m + 3sm, Padang
b. Stomata
Figure 2. Number of stomata.
The result of characterization revealed that there species Salak are: Bali 76, Padang Sidempuan 78,
was variation in number of stomata in leaves. This Pondoh 68 and Gading 80 /mm2.
is the number of stomata/picture areas among
c. Molecular
Figure 3.Profiles of 6 cutivars salak DNA bands with primers:OPA-7. OPA-13. OPA-17.
Page | 384
PROCEEDINGS
P.madu
P.super
K.arum
Bali
Enrekang
Bajelen
0.56 0.62 0.68 0.74 0.81

Coefficient
Figure 4. Cluster of 6 salak cultivars based on molecular marker.
Based on RAPD analysis (Fig 5) with correlation 4. Conclusions

coefficient value 0,65 there were 3 group. Group A
are Salak Pondoh Madu, Pondoh Super, Kembang 1. There were the diversity of salak cultivars
Arum, dan Bali. Group B is salak Enrekang and difference in morphology, citology and
group C is salak Bajelan. In accordance with the molecular-DNA
research Nandariyah (2012) Salak Pondoh Madu, 2. Cluster analysis showed 6 cultivars
Pondoh Super and kembang arum has low level divided in 3 group depend on taste of fruit
tannin. Salak that have low tannin content lies in a
group together in Group A. This suggest that
tannin level is responsible for clustering 6 cultivars References
but not entirely. Nandariyah (2012) said that the
primers use of a limited number will affect the [1] Ashari, S. 1995. Hortikultura Aspek
outcome of salak accession grouping. Increasing Budaya. UI Press. Jakarta
the number of primers in DNA amplification of [2] Mogea, JP. 1982. Salacca zalacca, the
salak accessions will result grouping and specific correct name for salak palm. Principes
markers are more accurate. 26a[2]: 70-72
[3] Nandariyah, Haryati S, Wartoyo, Pardono.
2013. RAPD Clustering Based On Tannin
Contentof Various Salak (Salacca zalacca
Gaertner Voss) Accessions. In 1st
International Conferences on Suistainable
Agruculture and Environment
Page | 385
PROCEEDINGS
GROWTH FOR ORCHID HYBRIDS

COELOGYNE ASPERATA X COELOGYNE PANDURATA
WITH NAA AND ORGANIC MATTER IN VITRO
Sri Hartati1) and Erika Maharani2)

1.2.
Departement of Agrotechnology, Faculty of Agriculture, Sebelas Maret University Surakarta (UNS)
Jl. Ir. Sutami 36A Surakarta Central Java Indonesia 57126
E-mail:tatik_oc@yahoo.com
Abstract
Orchids is one of the flowering plants is much preferred by consumers. Orchids is very interesting as it
varies greatly in form, color and style flowers. To add new genetic diversity in orchids it is necessary to
crossbreeding. The result of crossing of orchids can be propagated by tissue culture. Multiplication in
tissue culture of orchid are strongly influenced by the composition of the medium used. This research
aimed to get the best medium composition that is able to optimize the growth orchids derived from cross
pollination of Coelogyne asperata and Coelogyne pandurata. The results showed that addition of sweet
potato gave a positive influence on the time of root appearance, heigh of planlet and number of shoots.
The addition of coconut water gave a positive influence on the time of shoot appearance, number of
shoots and heigh of planlet. The addition of potato could increase heigh of planlet. The coconut water,
potato and sweet potato could multiply the number of shoots. The combination of 1 ppm NAA aphthalene
Acetic Acid (NAA) and sweet potato could increase number of leaves.
Keywords: crossing, Invitro, medium , NAA, Orchid.
1. Introduction Mechanical propagation in vitro (tissue culture)

is a conservation effort to prevent these problems.
Orchidaceae is the largest and most diverse Such techniques may provide new plants and new
family of the flowering plants, consisting of species are fast with good quality and quantity.
35,000 species under 800 genera [1]. Due to poor Propagation techniques culture in vitro is a way to
hybridization barrier, more than 1,50,000 hybrids increase the production of orchid Coelogyne new
already have been produced and registered, many species. Plant growth regulator is the important
of which are multigeneric [2]. Orchid new type of media component to supporting growth of
crossbred have a great diversity of nature, which explants. Kinds and concentrations of plant growth
gives the opportunity to choose the best derivative regulator used determine the direction of crop
and then propagated in bulk [3]. growth in tissue culture. Then by modifying the
Various rare orchid species supposedly media through the provision of combination
abundant in primary forests of Borneo. So that a treatments NAA (Naphthalene Acetic Acid) with
specific orchid species in Borneo is feared to be the organic compound complex so as to optimize
extinct in connection with the clearing of forests the growth of the orchid.
for plantations, transmigration settlements, and The organic material to be used as a treatment
also due to the expansion of the timber industry. that coconut water, bananas, potato and sweet
Production large scale of ornamental plants has potato. According Tulecke et al. [5] coconut water
been achieved successfully using tissue culture contain beneficial substances or materials such as
techniques. Some workers have used a variety of nutrients, vitamins, amino acids, nucleic acids and
explants and culture medium and tissue culture growth substances such as auxin and gibberellic
methods were introduced to the regeneration of acid that serves as stimulating tissue proliferation,
orchids [4]. accelerate metabolism and respiration. Extract of
Page | 386
PROCEEDINGS
potato used because it contains elements that are two factors obtained 20 combinations treatment of
needed such as calcium, phosphorus, iron, vitamin each treatment was repeated five times repetitions.
B1, vitamin B2, vitamin C and niacin which The data obtained were analyzed using ANOVA, if
encourages increasing the number of leaves. there is a significant difference continued with
Mashed banana in tissue culture, according Duncan Multiple Range Test level of 5% and
Widiastoety and Bahar [6] banana extract is added regression test.
to the tissue culture medium can stimulate cell
division and promotes the differentiation of cells. 3. Results and Discussion
Sweet potato is a source of carbohydrates, protein
and vitamin A, vitamin C and other nutrients. Tissue culture is the technique of plant
While the use of growth regulators such as NAA propagation in sterile conditions or a controlled
because it is one type of synthetic auxin that is environment, which is often to produce clones.
used to increase the ratio of root growth in Tissue or cell parts of plants can be grown under
vitro.This will encourage the formation of new conditions conducive to the growth and
roots on a certain lapse of concentration. The multiplication. Cells, protoplasts, leaves and roots
concentrations used in accordance with the of plants can be used to produce new plants
statement Untari and Murti [7] that an increase in through tissue culture which was grown in a
NAA concentrations up to 20 ppm lead to culture medium with a supply of nutrients and
impaired growth of explants. plant hormones needed [8].
This study uses the results of a cross Based on Table 1 shows the number of the
pollination orchid plantlets of Coelogyne asperata variables that influence is not real, but there is also
and Coelogyne pandurata, which aims to get the a significant effect. Research carried out does not
right medium for the growth of orchids result of always get the results in accordance with the
cross pollination of Coelogyne asperata and theory due to many factors, both factors of the
Coelogyne pandurata with culture techniques in plant and outside the plant. Although theoretically
vitro qualitative and quantitative can be done by all cells in plants are totipotensi, but not all parts of
modifying the media through the addition of the the plant have meristematic cells so that it is less
organic compound complex so as to optimize the supportive of success in tissue culture. Success in
growth of the orchid. This research was conducted tissue culture is also determined by the
in order to obtain the effect of planlet growth to the circumstances of growing media, growing
treatment plant growth regulator that NAA at a environment (humidity, temperature and light) and
concentration of 0 ppm, 1 ppm, 3 ppm and 5 ppm sterilization that absolutely must be guaranteed.
with a variety of organic materials, namely Then the genetic influence of each plant explants
coconut water, banana, potato and sweet potato. also vary widely depending on the species,
varieties, and plant origin such explants [9]. Based
2. Methods on the data obtained that some explants result of a
subculture of dying after a couple days of planting,
This study was conducted in April 2015 until it is possible because the subculture is done with
January 2016 at the Laboratory of Plant the cleaning of the roots before planting in a
Physiology and Biotechnology, Faculty of culture bottle so the explants were injured when
Agriculture, Sebelas Maret University (UNS) metabolically less support there will be browning.
Surakarta. The materials used in this study, are: the The death of culture due to cutting the roots that
plantlet orchid result of a crossbreed Coelogyne cause browning. Browning namely the process of
pandurata x Coelogyne rumphii, Knudson C spending phenolic compounds from the plant
medium, organic materials (coconut water, banana, tissue is injured during the initiation. The phenol
potatoes and sweet potato), Naphthalene Acetic compound is toxic, inhibiting the growth of tissue
Acid and some nutrients are used in the explants can be deadly [10].
manufacture of Knudson C medium. The
experimental design used was Completely
Randomized Design (CRD) with two factors. The
first factor is the concentration of Naphthalene
Acetic Acid which consists of four levels, is 0
ppm, 1 ppm, 3 ppm and 5 ppm. The second factor
is the type of organic material that consists of five
levels, namely the media without any organic
material, coconut water is 250 ml/l, banana 150
g/l, potato 200 g/l and sweet potato 150 g/l, of the
Page | 387
PROCEEDINGS
Table 1 Summary of 5% F-test effect of NAA

30 24,89c
concentration and organic matter to 25
22,35bc 22,67bc
20,24ab
the variable growth orchid plantlets 20 17,04a
of crossbred Coelogyne asperata and 15
Coelogyne pandurata 10
5
Variable Organic 0
Observation NAA Matter Interaction
tanpa BO Air Pisang Kentang Ubi Jalar
Media Coconut Banana Potato Sweet
The time of shoot ns * ns without OM Kelapa
water Ambon potato
appearance
The number of ns * ns
shoots Figure 1 Influence of organic matter against the
The time of root * * ns time of shoot appearance (DAP) interchanges
appearance result orchids of Coelogyne asperata and
The number of ns ns ns Coelogyne pandurata.
roots
The root lengt ns ns *
The heigh of ns * ns The number of shoots
planlet
The number of ns * ns Based on Figure 2 the provision of media such
leaves as bananas, potatoes and sweet potatoes can
Note: ns: non significant; *: significant at 5% F-test; stimulate the increase of the number of shoots so
**: highly significant at 1% F-test that the media can be used as additional media.
This is supported by statements Saranjeet et al.
The time of shoot appearance [17] the percentage of regeneration increased by
the addition of organic growth supplements such
Based on Figure 1, organic matter treatment of as bananas, potatoes and sweet potatoes in a
coconut water can stimulate the appearance of medium. This is also supported by the opinion of
buds because it contains cytokines that stimulate Bhojwani and Razdan [18] which states that the
cell division, it is supported by a statement of rate of multiplication of shoots through axillary
Admin [11] coconut water contains diphenyl urea branching, can be enhanced by boosting the
that has resembled the effectiveness of cytokines. growth of shoots on a medium containing
Coconut water is rich in potassium (up 17%), cytokines. Shoots are formed due to continuous
sugar (1.7 to 2.6%), vitamins, minerals, amino availability of cytokines that arise from a aksilar
acids. Coconut water has a chemical composition grow and develop into new shoots. Thereby
that is unique from sugars, vitamins, minerals, granting the additional media bananas, potatoes
amino acids and phytohormones [12]. Similarly, and sweet potatoes for allegedly containing
the study revealed the ability of shoot regeneration cytokines can stimulate the increase of buds.
is increased by adding organic matter coconut
water [3].
Banana can accelerate the appearance of shoots 3
2,5 2,28c 2,23bc 2,16bc
this is supported by a statement Fitriani [14] it is
2 1,56ab
possible that the high carbohydrate content in 1,09a
1,5
organic material medium banana given on plant
1
growth. According to Gauchan [15], the addition 0,5
of a source of carbohydrates to the culture medium 0
influence the metabolic processes and the MediaBO Coconut
tanpa Air Banana Kentang
Pisang Potato UbiSweet
Jalar
transformation of the energy required to plant cell without OM water
Kelapa Ambon
potato
growth. Gnasekaran et al. [16] revealed than as a Figure 2 Influence of organic matter against the
source of carbohydrate, addition of organic number of shoot interchanges result orchids of
compounds into the culture medium also contains Coelogyne asperata and Coelogyne pandurata.
vitamins, phenols, growth hormones, fiber and
proteins that affect the growth of the plantlets. The time of root appearance
Root is the heart of a plant (in addition to the
stem and leaves), which had no color green,
usually whitish. Root of the plant has the task to
strengthen the establishment of the plant and
Page | 388
PROCEEDINGS
absorb nutrients, and therefore the appearance of The number of roots

the root is essential for plant growth [19].
Based on Figure 3 shows that treatment Based on the analysis of variance test F 5%
without giving NAA is able to accelerate the time orchid root number of crossbred orchids of
appeared roots because the content of auxin Coelogyne asperata and Coelogyne pandurata the
endogenous the explant has memcukupi, thereby media into the NAA administration did not
granting the NAA at 5 ppm concentrations most significantly affect the amount of roots, as well as
binding when the emergence of roots. It ini the treatment of organic materials do not provide
accordance with the opinion of Salisbury and Ross any real effect, and the provision of NAA
[20] that the concentration of growth regulator that treatment combined with organic material provides
is too high for a particular plant species will no real effect. Award NAA and organic material
encourage the synthesis of ethylene which then on the result of crossbreed orchids of Coelogyne
inhibits rootelongation. asperata and Coelogyne pandurata not spur the
Based on Figure 4, the organic matter of sweet growing number of roots because the roots of
potatoes spur the emergence of roots in plants. orchids are epiphytes that will be very vulnerable
This is supported by statements Untari and if the cutting of roots inculture in vitro of orchids.
Puspiraningtyas [21] that the amount of vitamin Subcultures orchids should not eliminate the roots
B1 (thiamine), Fe, Ca, niacin, vitamin A and and only allowed to clean the roots are exposed in
riboflavin contained in sweet potatoes can order to be because if the roots of orchids will be
stimulate root formation. Thiamine including eliminated age disubkultur will again be young
vitamin B1 which serves to accelerate cell division orchids or small again. This is supported by
the root meristem. statements Vitri and Handini [22] that the root
pruning is not recommended at a magnification of
plantlets in vitro.
The root lengt

Long roots indicates employment growth
regulators and nutrients available in the media
work optimally. Long roots show wide uptake of
nutrients by plants so as to meet the nutritional
needs of plants, other than that the longer the root
of it is expected that the plantlets are already
strong for acclimatized [23].
Concentration of Based on the analysis of variance test F 5%
NAA root length orchid result of crossbreed orchids of
Figure 3 Influence of NAA concentration Coelogyne asperata and Coelogyne pandurata the
against the time of root appearance (DAP) NAA administration did not significantly affect the
interchanges result orchids of Coelogyne amount of roots, as well as the treatment of organic
asperata and Coelogyne pandurata. materials that do not provide any real effect, and
the provision of NAA treatment combined with
organic matter also provides no real effect. It is
20 alleged that the administration of NAA and
16,27b 16,1b 15,91b 17,06b
organic matter in the media of crossbred orchids of
15 Coelogyne asperata and Coelogyne pandurata
9,91a
10 inhibit the elongation of roots because the roots of
orchids are epiphytes that will be very vulnerable
5 if the cutting of roots inculture in vitro of orchids.
0 Subcultures orchids should not eliminate the roots
Media
tanpa Coconut
BO Air Kelapa Banana
Pisang Potato
Kentang Sweet
Ubi jalar and only allowed to clean the roots are exposed in
without OM water Ambon potato order to be because if the roots of orchids will be
eliminated age disubkultur will again be young
Figure 4 Influence of organic matter against the orchids or small again.
time of root appearance (DAP) interchanges
result orchids of Coelogyne asperata and
Coelogyne pandurata.
Page | 389
PROCEEDINGS
The height of planlet

Added height plantlets caused by two
processes, namely the division and cell elongation.
Both of these processes occur in the meristem
tissues, i.e. at the growing point of the stem [24].
Based on Figure 5 the provision of organic
materials such as coconut milk, potatoes and sweet
potatoes have compounds that could stimulate the
growth of plant height. Media content of coconut
milk, potatoes, and sweet potatoes can be used as
an additional medium to high accretion spur Concentration of NAA
y(media without organic matter) = 0,1675x2 - 0,654x + 4,5131 R² = 0,6372
orchid. Percentage regeneration increased by the y(coconut water) = -0,2798x2 + 0,4367x + 11,138 R² = 0,3939
addition of organic growth supplements such as y(banana) = -0,3073x2 + 1,2099x + 5,6065 R² = 0,9561
y(potatoes)= 0,0481x2 - 0,4673x + 10,093 R² = 0,3645
coconut milk, potatoes and sweet potatoes in a y(sweet potatoes) = -0,3553x2 + 1,322x + 9,1242 R² = 0,2402
medium [17].
2 1,6b
1,59b
1,5
1,38b 1,31ab 4. Conclusions
1
0,89a Based on the research that has been carried out,
it can be concluded:
0,5 1. The addition of sweet potato gave a positive
influence on the time of root appearance, heigh
0 of planlet and number of shoots. The addition
tanpa BO Air Kelapa Pisang Kentang Ubi Jalar of coconut water gave a positive influence on
Media Coconut Banana
Ambon Potato Sweet
without OM water potato the time of shoot appearance, number of shoots
and heigh of planlet. The addition of potato
Figure 5 Influence of organic matter against the could increase heigh of planlet. The coconut
heigh of planlet interchanges result orchids of water, potato and sweet potato could multiply
Coelogyne asperata and Coelogyne pandurata. the number of shoots
2. The combination of 1 ppm NAA and sweet
potato could increase number of leaves
The number of leaves Reference
Based on Figure 6, award NAA concentration of 1
[1] Singh MK, Sherpa AR, Hallan V, Zaidi AA, A
ppm and sweet potato extract is thought to be a
potyvirus in Cymbidium spp. in Northern
combination of auxin and organic ingredients that
India, Austr, Plant Dis, 2007 p. 11-13.
are beneficial to the growth of leaves. This is
supported by statements Kong et al. [25] that [2] Tsavkelova EA, Cherdynseva TA, Lobakova
administration of auxin NAA and organic FS, Kolomeitseva GL, Neutrosov AI.
materials inculture in vitro can promote the Microbiota of the orchid
development of shoots and roots that affect the rhizoplane,microbiology. 2001 p. 492-497.
number of leaves. The media's treatment of sweet
[3] Martin KP, Geervarghese J, Joseph D,
potato to give effect to the amount of leaf
Madassery J, Indian J Exp Biol. XL3 (2005)
presumably because the protein content of organic
280-285.
material medium [26]. Naphthalene Acetic Acid
compounds can be given in medium culture at [4] Shapoo A Gowhar, Zahoor A, Kaloo, Singh,
lower concentrations, ranging between 0,1-2,0 Ganie Padder H, International J. Advan Res.
mg/l [27]. The addition of NAA in the low I10 (2013) 291-295.
concentration of 1 ppm into the culture medium is
[5]Tulecke W, Weinstein LH, Rutner A, Laurencot
optimum concentration for growth leaves orchid
HJ. The biochemical composition of coconut
results crosses C. asperata and C. pandurata.
water (coconut milk) as related to its use in
plant tissue culture. New York, Plant Res Inc,
1961.
Page | 390
PROCEEDINGS
[6] Widiastoety, Bahar FA , Horti J. V3 (1995) 76- [18] Bhojwani SS, Radzan MK, Plant tissue
80. culture: theory and practice, New York (US):
Elvisier Science Publishing Company, 1983.
[7] Untari, Murti D, J Bio.VII3 (2006) 344-348.
[19] Tjitrosupomo K. Morphology of plants,
[8] Idowu PE, Ibitoye DO, Ademoyegun OT,
Yogyakarta, Gadjah Mada University Press,
African J Biotech. VIII16 (2009) 3782-3788.
2007.
[9] Jonah PM, Bello LL, Lucky O, Midau A,
[20] Salisbury FB, Ross CW, Plant physiology,
Moruppa SM. Global J. Sci Frontier
California (US): 4rd Ed. Wadsworth
Research. XI5 (2011) 21-27.
Publishing Company, 1995.
[10] Yusniati, Tissue culture the efficient method
[21] Untari R, Puspitaningtyas DM, J.
for multiply planlet, AgroMedia Library,
Biodiversitas. VII3 (2006) 344-348.
Jakarta, 2003.
[22] Vitri R, Handini E, Bul Kebun Raya
[11] Admin, Coconut water hyper growth and
Indonesia. XIV2 (2011).
flowering orchids, URL: http:
langitlangit.com, 2007. [23] Agnestasia D, Effect concentration extracts of
sweet potato and fish emulsion to growth
[12] Yong J, Liya G, Yan F, Swee N, J Molec. 14
orchid plantlets Dendrobium alice noda X
(2009) 5144-5164.
Dendrobium tomie and Phalaenopsis, Vanda
[13] Manawadu I, Dahanayake N, Gamini S, J. tricolor pinlong cinderella on Medium Vacin
Agri Sci Tech. IV (2014) 219-223. And Went, Thesis Faculty of Agriculture
UNS, Surakarta 2010.
[14] Fitriani, Concentrations of BAP and NAA
study against multiplication plant Artemisia [24] Heddy S, The plant hormones, Jakarta, CV
annua L. In vitro,Thesis Faculty of Rajawali (1991).
Agriculture UNS, Surakarta, 2008.
[25] Kong, Yuan, Vegvari, International Horti J.
[15] Gauchan DP, Kathmandu University J Sci Sci. XIII1 (2007) 61-64.
Eng Technol. VIII1 (2012) 119-124.
[26] Megayani S, Enggal. Bul Agro. I4 (2013) 94-
[16] Gnasekaran P, Rathinam X, Sinniah UR, 100.
Subramaniam S, J Phytol. II1 (2010) 029-
[27] Lee JS, Lee JM, So IS, Kang K, J. Korean
033.
Soc Hort Sci. XL6 (1999) 742-746.
[17] Saranjeet K, Bhutani K, J. Flor Ornaments
Biotech. V1 (2011) 50-56.
Page | 391
PROCEEDINGS
GROWTH AND BIOLOGICAL EFFICIENCY OF WHITE OYSTER

MUSHROOM(PLEUROTUS SP.)
Erny Ishartati,Syarif Husen, and Sukardi
Biotechnology Development Center, University of Muhammadiyah Malang,

Jl. Raya Tlogomas 246 Malang (65144) Indonesia
Email: ishartati.erny@gmail.com
Abstract
White oyster mushroom is one type of mushroom that can be consumed because it contains
carbohydrates, protein, fat, crude fiber, Ca, Fe, thiamin, riboflavin high. The purpose of this study was to
examine the growing power and efficiency of biological types of seeds F1, F2 and F3 White Oyster
Mushroom (Pleurotus ostreatus). The experiment was conducted in a mushroom house owned by farmers
in the village Pendem, Malang. The method used the factorial randomized block design, consisting of 2
factors and 3 replications. Each treatment combination comprised 10 baglog as sample. The first factor is
the type of oyster mushrooms: T1: White Oyster strain Florida and T2: White Oyster strain Ostern. The
second factor is the type of seed: F1: F1 Seeds, F2: F2 Seeds, and F3: F3 Seeds. Results showed that the
interaction between the type of mushroom and the type of seeds to the thickness mycelium of the lowest
in treatment T1F1, the total number of clumps of fruiting bodies on T2F1 treatment, and the highest
biological efficiency in the treatment T1F2 and T2F2. Separately, the type of mushroom effect is not
significant to the speeds growing of mycelia, weight of fruiting body, stalk of mushrooms, harvesting
time, frequency of harvesting, while the treatment of seed types influential not significant almost in all the
parameters of observation, except on the parameters weight of fruiting body which F1 seed treatment
types have for the lowest weight
Keywords: Mushroom, Pleurotus, sp.,Grwoth,Efficiency.
1. Introduction viability of seed will cause bioconversion and

decrease the mushroom production. The seeds
Mushroom is one of the horticultural commodities must be obtained from a pure culture and free of
which has been developed in Indonesia. There are contamination, it is must have superior genetic
10 types of fungi that can be consumed, one of traits in order to provide optimal results [4]. The
them is white oyster mushroom (Pleurotus sp.). high quality of F0 seeds mushroom is needed to
White oyster mushroom belongs to wood produce high quality of F1 seeds. The
mushrooms because it grows on rotting wood characteristics of good quality F1 seeds can be
media. This fungus grows in subtropics, temperate seen from its mycelium which grows white and
climate, and the tropics area with ideal thick on PDA media. The mycelium is also free of
environment. White oyster mushroom grows by contamination. The mushroom farmers are rarely
forming clump on the media. Each clump has to conduct potential tests or biological efficiency
numerous branches and it can be stored longer. for the used mushroom seeds, they just believe the
Many people like to consume this kind of seed sellers although there is no clear information
mushroom since it has a unique taste. White oyster on the making process and no certificate.
mushroom contains protein, phosphorus, fat, iron, Therefore, this experiment was aimed to study the
riboflavin and lovastatin which are very good for growth of the seed types (F1, F2 and F3) and to
health [1-2-3]. examine the mushroom biological efficiency in
The use of high quality seeds determines converting sawdust waste into fresh of white
the mushroom production success since it can oyster mushroom.
reduce the high level of contamination. The low
Page | 392
PROCEEDINGS
2. Methods in the range of 24 0C – 28 0C and the humidity was

between 70 % - 95 %.
The experiment was conducted in a 6. Cultivation: The cultivation was done by
mushroom house owned by farmers in Pendem setting the temperature and humidity. The
village, Malang. The equipment used in this temperature was between 24 0C – 26.5 0Cwhile the
experiment was: a drum for sterilization, plastic humidity was between 70% - 84 %.
bag in the size of 18x35 cm with 0.03 mm 7. Harvesting: : The harvesting was done after the
thickness (2 kg), cotton, gas stove, thermometer, mushroom reached an optimum growth. The
ose needle, millimeter paper, PVC ring, hand mushroom was quite big but it was not fully
sprayer, and sieve with hole size 3mm x 3mm. The bloomed. The harvesting was performed by pulling
materials used included: Albizia chinensis sawdust, the entire of the clumps.
clean water, agricultural lime, SP36 fertilizer, bran, In this experiment, there were several
corn flour, alcohol 70%, water, formaldehyde 2%, observation parameters. Those were: 1. Mycelium
CaCO3, and white oyster mushroom seeds (F1, F2 growth rate, 2 Mycelium thickness, 3. Total
and F3). number of fruiting body clumps, 4. Fruiting body
This experiment was a factorial experiment weight, 5. Maximum length of the stalk, 6.
which used a randomized block design consisting Harvesting time, 7. Harvesting frequency, 8.
of two factors and three replications. Each Biological efficiency, 9.The level of baglog
combination treatment comprising 10 baglog as contamination.
sample observations. Each treatment combination
comprised 10 baglog as sample. The first factor 3. Results and Discussion
was oyster mushrooms consisting of two types:
T1: White Oyster strain Florida and T2: White Based on Analysis of Variance (ANOVA)
Oyster strain Ostern. The second factor was the of these following variables; the mycelium
type of seeds consisting of: F1: F1 Seeds, F2: F2 thickness, the total number of clumps of fruiting
Seeds, and F3: F3 Seeds. bodies, and the biological efficiency, the results
The steps in conducting this experiment showed the significant interaction in the treatment
were described as follows: given to the type of oyster mushroom and the type
1. Growing Media PreparationThe composition of seeds (Table 1).
of the growing media consisted of sawdust, bran, In the mycelium thickness, treatments of
corn flour, TSP, CaCO3 and water (80 Kg, 16 Kg, oyster strain Florida and F1 seed [T1F1], the
8 Kg, 0.5 Kg, 0.5 Kg and 65%). The growing observation showed the lowest mycelium thickness
media were mixed evenly and composted by when compared to other treatments. The reason
covering it with plastic for 3 days. The level of was the contamination. Because of the
water mixture or compost was arranged under the contamination, the mycelium spreading process
 65 % condition and a pH of 6.5.. was hampered. This is in accordance with [7] who
2.Media Making: The mixed media were put in states that if the oyster mushroom seeds have been
plastic bags and then it was compacted by using contaminated with other fungi, it can lead to
bottles. After that the tips of the plastics and PVC competition to get the nutrients substrate, so that
ring were joined. Next, it was shaped like a bottle the spreading process is hampered or even
and given a hole in the middle as a place for failsresultingthe fruit does not grow. The level of
mushroom seed. Lastly, it was covered with cotton contamination in this study was relatively low,
and plastic coated. because from the 30 baglog samples used, only 2
3. Media Sterilization: The sterilization was done samples were contaminated at the age of 50 days
in a drum for 8 hours. Then, the growing media after inoculation. There were several causes of
were chilled for 24 hours before the inoculation. contamination in baglog media, such as: (a) the
4. Inoculation: The inoculation was done by steaming time which was not long enough to
pricking the middle part of the media through the prepare the media and to kill thecontaminating
rings, 15 cm from the height. A wooden stalk by 1 microbes and fungi simultaneously, as well as the
cm in diameter was used to make a hole. Then, the heating temperature which was not optimal (the
hole was filled with mushroom seeds which have ideal temperature for steaming is > 90 °C), if the
been mashed. The media that have been filled with temperature is <90oC or unstable (fluctuating), the
seeds were covered with cotton and plastic. possibility of contamination is quite big although
5. Incubation: The incubation was performed by the steaming is done in a relatively long time,
storing the media which have been filled with (b)insects such as mosquitoes, flies and spiders
seeds in particular condition to grow the that were found in kumbung, because the spreading
mushroom mycelium. The needed temperature was process of the contaminating fungus spores could
Page | 393
PROCEEDINGS
be hampered by the spider webs, which dead fungi. Other types of fungi that attacked the
finally stuck in baglog and became a disease, (c) mushroom growth media were Coprinus sp. and
the standard operating procedures (SOP) , the Penicillium sp. The types of fungi that
essential proceduresto follow in orderto achievethe contaminated the substrate part of sawdust
smallest percentage of failures (0%), which was wereAspergillus sp. and Penicillium sp., while the
not applied, such as; the use of masks when type of fungus that attacked the mycelia was
working inside kumbung, sterilization of the Paecillomyces sp.
equipment with alcohol and the use of fire (a The total number of fruiting bodies of the
Bunsen burner or candle) in the work space oyster strain Ostern and F1 seed [T2F1] showed
(especially when the seeds were inoculated into the the lowest number of fruiting bodies when
production log), and (d) the unproper process of compared with other treatments, which were 63.53
composting the media, because composting was a clumps. The total number of clumps of fruiting
natural way to rot the materials, especially sawdust bodies became one of the observation variables
as the main ingredient of baglog. The heating because from the number of fruiting bodies, the
process usually occurred in the first until the fifth effect of treatments on the growth and the
day as a result of fermentation process. The development of the white oyster mushroomcould
temperature might reach 65 °C or more. This be known. The total of fruiting bodies in one
natural heatinghelped rot the media and killed clump is not equal to the weight of fruit, although
pathogenic microbes (which cause disease), eggs the numbers of fruiting bodies in one clump per-
of insects and other organisms. One type of harvest are many,but the fruiting bodies in one
contaminating fungi that usually attacked the clump per-harvest are many,but thetotal numbers
oyster mushroom baglog was Trichoderma sp. of the fresh weight obtained are not always high.
This fungus caused green spots, especially on the
Table 1. Mean of Mycelium Thickness, Total number of clumps of fruiting body, Biological
Efficiency
Parameter Mycelium Thickness Total number of clumps Biological Efficiency
(Cm) of fruiting body (%)
Seeds Type
F1 F2 F3 F1 F2 F3 F1 F2 F3
Mushroom Type
Oyster strain 1.00a 1.13b 1.20b 71.25b 65.73b 71.87b 53a 66b 52a
Florida (T1)
Oyster strain 1.23b 1.27b 1.10b 63.53a 68.65b 71.13b 49a 64b 50a
Ostern (T2)
Note: Numbers which are followed by the same letter in the same colum have no significance difference based on
BNJ 5% Test
The biological efficiency of oyster strain type treatment variable, F1seed showed the lowest
Florida andF2 seed [T1F2], and the type of oyster total fruit weight when compared to other
strain Ostern and F2 seed T2F2] showed high treatments, which was 605.00 (g). Fresh weight
biological efficiency. According to [5] the high showed the water content in tissues or organs other
and low mushroom biological efficiency varies than organic materials. Fresh weight was the
depending on the media and the maintenance growth result influenced by the moisture and the
during the formation of basidioma. temperature at that time. In this study, the weight
Separately, the fruit weight, types of of Oyster strain Florida and Oyster strain Ostern
mushroom seeds showed significant differences, statistically showed no significant results, but the
whilethe percentage of mycelium growingspeed, weight of oyster strain florida tended to be heavier
stalk length, harvest age and harvest frequency compared to oyster strain Ostern. This trend was
showed no significant differences (Table 2). due to the characteristics of oyster strain florida;
On the fruit weight of themushroom type having higher water content than oyster strain
treatment variable showed no significant Ostern. In the seed type treatment, F1 seed showed
difference of fruit weight, whereas for the seed low fruit weight because of the presence of
Page | 394
PROCEEDINGS
contamination. In the oyster mushroom the growth of mushroom fruiting bodies the
cultivation,it needed suitable media in order to get optimum temperaturewas 22-25oC [8]. Supported
maximum yield. There were some nutrient content by [9] who states that the faster the spread of the
required by the oyster mushrooms for growth, mycelium is, the sooner the formation of fruit
which were lignin, carbohydrates (cellulose and bodies will be. The growth rate of the mycelium in
glucose), protein, nitrogen, fiber, P (phosphorus), oyster mushroom was influenced by the nutrient
K (potassium), Ca (Calcium) and vitamin [6]. [7] contents available in the growing media used.
states that the fresh weight of mushrooms Nutrition was the key factor in the growth of fungi
produced is determined by the media fertilityand that was required for various metabolic processes
the nutrients such as carbohydrates and proteins. of the cells in order to produce high ATP energy
Fresh weightwas associated with the mycelium for growth. White oyster mushrooms required
growth percentage in baglog (%). The higher the nutrients containing a source of carbon, nitrogen,
percentage of mycelium growthwas, the higher the minerals and vitamins. The good mycelium growth
fresh weight that was produced. Similarly, the high (fast-growing)was caused by the growing medium
frequency of harvest caused the high numbers of which wasdecomposed properly, so that the
fresh weight fruiting body. nutrient contents in the media, such as C, N, P, and
In these variables; the percentage of K could be absorbed by the mushrooms well.
mycelium growing rate, fruit stalk length, harvest Nutrients which were rapidly absorbed by the
age and harvest frequency, the fungus type and the fungus would cause the mycelium grows and
seed type, there was nosignificance difference. develop rapidly [10]. The research conducted by
This mycelium growth speed was greatly [11] revealed that the spreading speed of the of
influenced by the characteristics of the mycelium was affected by temperature, humidity
baglogmedia;baglog water content, moisture, pH, of incubation and seed quality used.So, to support
kumbung temperature, the level of contamination the growth of mycelium in the oyster mushrooms,
and pests attacks, so if those characteristics were ideally the incubation space should be of 24-290C
fulfilled, the optimum growting speed of the and 90-100% humidity.In addition, the level of
mycelium can be achieved. This was in accordance baglog density also affected the spread of
with Maryati [2] who states that during the growth mycelium. If baglogwas too dense, the mycelium
of mycelium air humidity of 60-75% and a would also be difficult to spread to the entire
growing medium with water content of about 65% baglog surface. Therefore, in fillingbaglog it
are required [2]. In addition, the optimum should be arranged not too dense and not too
temperature required was about 28oC, whereas for tenuous.
Table 2. Mean of Mycelium Growth Rate, Fruiting Body Weight, Stalk Length. Harvesting Period,
andHarvesting Frequency
Fruiting Stalk Harvesting Harvesting

Mycelium Growth
Mushroom Type Body Length Period Frequency
Rate (%)
Weight (g) (Cm) (Days) (Days)
Oyster strain
43.67a 655.78a 2.60a 72.76a 5.62a
Florida (T1)
Oyster strain
43.53a 654.44a 2.59a 66.91a 5.71a
Ostern (T2)
Seeds Type
Seed F1 [F1] 43.53a 605.00a 2.55a 67.50a 5.73a
Seed F2 [F2] 42.80a 689.00b 2.62a 70.77a 5.60a
Seed F3 [F3] 44.47a 671.33b 2.60a 71.23a 5.67a
Note: Numbers which are followed by the same letter in the same column have no significance difference based on
BNJ 5% Test
Page | 395
PROCEEDINGS
The length of the stalk generally ranged [3] Chang, S.T. and J. Buswell , 1996.
from 10-15 cm. The media were very influential to Mushroom Nutriceuticals. World J.
the mushroom growth. On the growth of fungi, Microbiology Biotech., 12:473-476.
there were two important components that were
very influential, namely oxygen and carbon [4] Oei, P., 1996. Mushroom Cultivation with
dioxide. The carbon dioxide which was too much Special Emphasis on AppropriateTechniques
on the growing processmightcause the stalk to for Developing Countries. Tool Publications,
growtoo long and the the formatiom of the hood to Leiden,Netherlands.
be abnormal. Therefore when it had entered a
period of growth, the environmental conditions [5] Quimio. TH. 1986. Gide to Low Cost
must be concerned and adjusted to the growing Mushroom Cultivation in
media, which was high humidity and low light. TheTropics.University of Philiphines Los
The harvesttime was relatively same since Banos. College Language.
the oyster strain Florida and Ostern were the type
of white oyster mushroom that, genetically, was of [6] Cahyana, Mukhrodji, Bakrun, 2006. Jamur
no significance difference in the life span, so Tiram. Penebar Swadaya. Jakarta.
wasits harvest frequency. The harvest frequency
[7] Budianto, Aprih. 2004. Pengaruh Macam
wasgreatly influenced the planting medium. A
Media dan dosis Bekatul terhadap
medium was one of the important aspects that
PertumbuhanJamurTiram Putih. Fakultas
determined the success rate of white oyster
Pertanian. Surakarta: Universitas Sebelas
mushroom cultivation. The white oyster
Maret Surakarta.
mushroom media used must contain the nutrients
needed for growth and productivity, which [8] Djuariah, D dan E. Sumiati.
werelignin, carbohydrates (cellulose and glucose), 2008.Penampilan Fenotipik Tujuh
protein, nitrogen, fiber, calcium, glucose, nitrogen, SpesiesJamur Kuping(Auricularia
protein, and fats and vitamins [6] spp.)diDataran Tinggi Lembang. J.
Hort.18(3):255-260.
4. Conclusion
[9] Sumiati, E., E Suryaningsih dan Puspitasari,
1. There was significant interaction between the 2005, Perbaikan Jamur Tiram Putih Pleurotus
type of oyster mushrooms and types of seed ostern strain Florida dengan Modifikasi
on the thickness of the mycelium, the total Bahan Baku Utama Substrat, J.Hort 16 (2)
number of clumps of fruiting bodies, and the 96-17.
biological efficiency.
2. On the mycelium thickness and the total [10] Yuniasmara, C., Muchrodji dan M.
number of clumps of fruiting bodies, F1 seed Bakrun.1999. Jamur Tiram. Penebar
showed a low yield, while the biological Swadaya,Jakarta.
efficiency of F2 seeds showed a high yield.
3. Separately, almost all parameters observed [11] Steviani, Susi. 2011. Pengaruh Penambahan
were of no significant differences, except on Molase dalam Berbagai Media Pada Jmaur
the fruit weight, F1 seed parameters that Tiram Putih (Pleurotus ostreatus). Skripsi.
showed low yield. Surakarta: Universitas Sebelas Maret
References
[1] Surawaria, 2002. Budidaya Ling Zhi dan

Maitake Jamur Berkhasiat Obat. Jakarta:
Penebar Swadaya.
[2] Mujiati,N.,2000, Pengaruh Berat

MediaTumbuh dan Jumlah Sayatan
padaPolybag Terhadap PertumbuhanHasil
Jamur Tiram Putih, LaporanPenelitian,
Jurusan Pertanian, FakultasPertanian,
Universitas BrawijayaMalang.
Page | 396
PROCEEDINGS
SCREENING AND CHARACTERIZATION OF CELLULASE

ENZYME IN SWEET ORANGE (CITRUS SINENSIS) JUICE
CLARIFICATION
Esti Widowati1), Rohula Utami1), Edhi Nurhartadi1) , Restio Rahadyan Megawiranto
Putro1)
1)
Department of Food Science and Technology, Faculty of Agriculture, Sebelas Maret University
Jl. Ir. Sutami 36A Kentingan Jebres Surakarta 57126 Central Java Indonesia
Research Group of Biotechnology and Food Microbilogy, Faculty of Agriculture, Sebelas Maret
University
Jl. Ir. Sutami 36A Kentingan Jebres Surakarta 57126 Central Java Indonesia
Email : esti_widowati@yahoo.com
Abstract
The cellulose compound makes the orange juice cloudy in appearance. Clarification using cellulase
enzyme is to be done to remove the cloudiness. Celullase enzymes obtained from cellulolytic bacterial
isolated from vegetable waste and pineapple peel waste. The aimed of this research was to isolate and to
characterize the cellulolytic bacteria from vegetable waste and pineapple peel waste, to determine the
characters of cellulase enzyme (pH, temperature, KM, Vmax) and to determine the effect of cellulase
enzyme in sweet orange juice clarification. From seventeen selected bacterial isolates, three isolates
selected that produce enzymes are the best in the sweet orange juice clarification process that was isolates
S4, S6, and S8. Isolate S4, S6, and S8 optimum at pH 9.0, Isolate S4 and S8 optimum at temperature 40 0C
meanwhile isolate S6 optimum at 350C. Isolate S4, S6 and S8 stable in the pH range 3.0-9.0 and stable at
temperature 40-600C. KM values for Isolate S4, S6 and S8 simultaneously 0.0018 mg/ml; 0.0016 mg/ml;
0.0036 mg/ml, whereas Vmax values simultaneously 0.1172 U/ml; 0.1162 U/ml; 0.1193 U/ml.
Keywords : cellulose, cellulase enzyme, isolate, juice clarification, sweet orange juice
1. Introduction in visual after extraction process. This problem

effect to filtration process in industry. Cellulase
Sweet Orange (Citrus sinensis) representing has wide application potency at processing of
one of the popular sweet orange type in Indonesia. food. Juice fruit production and vegetable require
Among its group, sweet orange has the sweetest extraction, clarification, and better stabilization.
taste. Orange as horticulture commodity has Cellulase also has important application as part of
perishable characteristic. Inappropriate handling in enzyme weared for the extraction of fruit juice
orange post harvest cause decrease of fruit quality clarification and and vegetable ( Kuhad, al et.,
(vision, weight and degradation of nutritional 2011).
value) ( Mulyadi, 2011). This research aimed to isolate and to
Fruit juice, that is clear or cloudy, is fruit characterize cellulolytic bacteria isolate of
dilution which not ferment and obtain from fruit vegetable waste and pineapple husk waste, to
extraction with mechanical process, and have characterize cellulase enzyme and to improve
color, aroma and flavor as its natural fruit. quality of clear orange juice, high concentration,
Included in juice group is fruit concentrate that has decreasing viscosity of orange juice with treatment
characteristic and sensory quality equal to fruit of clarification by cellulase enzyme.
juice from natural fruit ( Syamsir, 2010).
Orange juice has cloudy and viscous in its
characteristic. Juice could perform gel or viscous
Page | 397
PROCEEDINGS
2. Materials and methods Step research

First step was bacteria isolation and morphological
Materials and biochemical characteristic of cellulolytic
Yeast extract, natrium hydrogen phosphate bacteria (Gram staining, endospore staining,
(Na2HPO4), potassium dihydrogen phosphate catalase test, cell measurenment). Second step was
(KH2PO4), magnesium sulphate (MgSO4), determination of isolate, determination of growth
potassium chloride (KCl), carboxyl methyl curve of isolate, determination of protein enzyme
cellulose (CMC), bacteriological agar, Gram A concentration, and determination of specific
(Aniline crystal violet), Gram B ( Lugol'S Iodine), activity of enzyme (viscosity, total soluble solute
Gram C ( Alcohol Acetone), Gram D (Safranin), and transmittance). Third step was production,
3,5-Dinitrosalisilat Acid (DNS), natrium chloride extraction, partial purification and characterization
(NaCl), natrium acetate (CH3COONA), acetic acid of cellulolytic enzyme (optimum temperature and
(CH3COOH), tetrahidrat kalium-natrium-tartrat pH, KM and Vmax).
(KNAC4H4O6.4H2O), hydrogen peroxide (H2O2), 3. Result and Discussion
malachite green, and sulphate amonium sulphate
((NH4)2SO4).
Hemocytometer (Neubaeur Assistant),
Isolation and chracterizationof
refractometer hand (ATAGO), binoculer cellulolytic bacteria
microscope (Yazumi), waterbath (Memmert),
spectrophotometer of UV-VIS 1240 (Shimadzu), Bacteria isolate which was used in research
vortex mixer (Heidolph), analytic balance (Mettler represent bacteria which grow dominant and have
Toledo), centrifuge (Hettich), viscometer different colony morphology among others.
(Ostwald), incubator shaker, laminar air flow Colony morphology characterization result of
(Labconco), autoclave (Selecta), incubator form, form from side, elevation, structure inside
(Selecta), and equipments of glass that common colony, color, and colony diameter of isolat from
used in laboratory.. each;every chosen bacteria colony can be seen at
(Table 1) Overall of chosen bacteria colony from
Research design isolation have form of irregular or circular. For
isolate with code of S11 has form of spindle. Most
This Research used 2 times sample repliction and colony have form of form of side and entire or
2 times analiysis replication. Morphology colony undulate. For isolate with code of S6 have form of
character and bacterium cell analysed qualitative. form of side lobate. Colony elevation most flat and
Standard curve of isolate, cellulase enzyme raised. Colony color most turning white. For the
activity, KM and Vmax determined with linear isolate of N2 and S3 chromatic of cream. While for
regretion. Factor in this research was influence of the isolate of rust colored S13. ( Table 2.) showing
cellulase enzyme in sweet orange juice cell morphology characterization and test of
clarification. catalase, overall of obtained isolate have Gram
negative characteristic. From result of test of
endospore, most of isolate do not have endospore.
Isolates that have endospore were S5 isolat, S9,
S12 and S13. From result of test of catalase,
overall of isolat represent bacteria of aerob.
Page | 398
PROCEEDINGS
Table 1. Morphology of Cellulolytic Bacteria Colony
Isolate Colony Morphology

Form Form of Elevation Stucture Inside Color Diameter
Side (cm)
N1 Irregular Undulate Flat Translucent White 0.05
N2 Circular Entire Raised Opaque Cream 0.099
N3 Circular Entire Flat Transparant White 0.008
N4 Circular Entire Flat Translucent White 0.01
S1 Irregular Entire Flat Tranclucent White 0.04
S2 Circular Entire Flat Translucent White 0.008
S3 Circular Entire Raised Translucent Cream 0.03
S4 Irregular Entire Raised Translucent White 0.4
S5 Circular Entire Flat Opaque White 0.06
S6 Irregular Lobate Flat Transparant White 0.09
S7 Circular Entire Raised Translucent White 0.03
S8 Circular Entire Flat Transparant White 0.01
S9 Circular Entire Flat Opaque White 0.02
S10 Irregular Undulate Flat Translucent White 0.096
S11 Spindle Entire Flat Transparant White 0.14
S12 Irregular Undulate Flat Transparant White 0.15
S13 Circular Entire Flat Translucent Yellow 0.07
Boldness :
N : Pineapple husk waste
S : Vegetable waste
Circulair : domed ; Entire : slippery ; Irregular : irregular ; Convex : convex ; Effuse : flatten ;
Opaque : is not translucent ; Translucent : rather clear
Table 2. Morphology Characterization and Catalase Test of Cellulolytic Bacteria
Isolate Cell Morphology

Form Colony Size of cell Gram Endospore Catalase
(μm)
N1 Bulat Rantai 1.9 - - +

S1 Bulat Rantai 2.1 - - +
S2 Bulat Rantai 1 - - +
S5 Bulat Rantai 0.5 - + +
S11 Bulat Rantai 1 - - +
Note :
N : Pineapple husk waste
S : Vegetable waste
Determination of isolate juice based on decreasing value of viscosity,

transmittance;level total soluble solute in orange
From 17 isolat selected only 3 best isolat at orange juice clarification and of CMC liquid 1 %. This
juice clarification, that was isolate S4, S6 and S8. election based on ability of the isolat in orange
Election of isolat for the clarification of orange juice clarification and its enzyme activity which is
high to be compared to the other isolat (Table 3).
Page | 399
PROCEEDINGS
Table 3. Selection Test Isolate
Isolate Enzyme Final Cell Orange Juice CMC liquid 1%

Activity Count
(Unit/ml) (Cell/ml)
Viscosity %T TSS Viscosity %T
0
(cp) ( Brix) (cp)
5
S4 0.0062 1.06 x10 1.156 0.9 7 0.86 92.0
5
S6 0.0061 2.08 x10 1.198 0.9 7 0.69 92.2
5
S8 0.0056 2.00 x10 1.173 0.8 7 0.75 94.7
Control (without enzyme) 1.4710 0.7 8 1.33 87.6
Determination of growth curve of remain partial enzyme in cellophane membrane

isolate and enzyme activity of cellulase used for the dialysis. Concentration protein
enzyme determined by using test of Lowry by
Among amount of cell with enzyme activity using standard curve of Bovine Serum of Albumin
compare to diametrical or along the increasing of ( BSA).
amount of cell hence enzyme activity also
experience of improvement. Time produce enzyme c. Cellulase Enzyme Characterization
each;every isolat determined final in logarithm
phase before entering phase of stationer isolat. Characterization of cellulase enzyme was done for
Isolate S4, S6 and S8 showed logarithm phase at partial purified enzyme after dyalisis stage. This
time 10 hours process included determination of optimum
temperature, optimum pH, atabilization of oH and
Production, Extraction, Purification temperature and enzyme kinetics analysis.
and of Characterization of Cellulase 1). Optimum of pH
Enzyme
pH effect enzyme activity in catalyze reaction.
a. Production of Cellulase Enzyme Optimum pH different for each enzyme that is
between pH 3,8-9,0 depend on enzyme source and
Enzyme of cellulase produced by 10% inoculum type (Joshi., et.al, 2011). Enzyme of isolate with
stok that was inoculated to CMC media. This code of S4, S6 and of S8 optimum [at] pH 9,0 (
production media was then agitated with speed 144 Figure 1).
rpm until logarithm phase according to growth
curve of isolate S4, S6, and S8. The production
time was 10 hours.
b. Extraction. Purification and Concentration

Protein Enzyme of Cellulase
After culture reached logarithm phase, media was

centrifugated at temperature 4°C with speed 6.000
rpm during 15 minute. Supernatan then was
precipitated with ammonium sulphate using (a
fracsination 10-90% to dissociate enzyme. )
Precipitate protein represent dissociation with
dissolve protein conversion to insoluble situation,
which later then can be eliminated variously.
Presipitation can be used to eliminate component
in cell culture media able to bother with method
purification of downstream ( Harrison, 1993).
Precipitation of isolate S4 and isolate S6 by using
fraction 40%. Isolate S8 with fraction using
ammonium sulphate 50%. Dialysis used to
eliminate intruder ions and salt which not lose
during process of presipitation so that will only (b)
Page | 400
PROCEEDINGS
(c) (c)
Figure 1. pH with Activity Enzyme of Isolat S4 Figure 2. Temperature with Activity Enzyme of
(a). Isolat S6 ( b) and Isolat S8 ( c). Isolate S4 ( a). Isolate S6 ( b) and Isolate S8(C).
2). Optimum Temperature of Enzyme 3). Enzyme Stability of pH
Cellulase has optimum temperature 30-50°C ( Enzyme of isolate S4, S6 and S8 stable at pH 3,0-
Akinyele, al et., 2013). According to Figure 2, 9,0 and inactive at pH 11 and temperature 50°C.
optimum temperature for the enzyme of isolate S4 Cellulase enzyme stable at pH 3,0-8,0 ( Viet, al et.,
and isolate S8 was 40°C while for S6 was 35°C. 2013). ( Figure 3).
(a) (a)
(b) (b)
Page | 401
PROCEEDINGS
(
c) (c)
Figure 3. Stability of Enzyme at pH of Isolate Figure 4. Stability of Enzyme Temperature of

S4 ( a). Isolate S6 ( b) and S8 Isolate (c) at S4 ( a). S6 isolat ( b) and S8 isolat ( c) at pH 5.0.
temperature 50°C.
5). Analysis of Enzyme Kinetics
4). Stability of Temperature
KM and Vmax S4 were 0,0018 mg / ml and 0,1172
Enzyme activity will increase while temperature U / ml. KM value and Vmax S6 were 0,0016 mg / ml
increase. Each enzyme has optimum temperature. and 0,1162 U / ml. KM value and Vmax S8 were
Higher than that caused denaturation of enzyme 0,0036 mg / ml and 0,1193 U ml. Cellulytic
protein and enzyme activity will decrease enzyme of S6 was accepteable in sweet orange
progressively. Finally, enzyme become inactive. juice clarification.
All enzyme ware stable at temperature 30-60°C
and decrease at temperature 70°C ( Figure 4). All 4. Conclusion
enzyme was inactive at temperature 100°C.
a. 17 cellulolytic bacteria isolate isolated from
pineapple husk waste and vegetable waste. The
isolate are S4, S6 and of S8 in assay. The
isolate is circular, Gram negative, non sporing
and catalase positive. Genus of the isolates are
Neisseria based on those assay.
b. Enzyme from third the isolat can decrease
viscosity of orange juice and of CMC liquid
1%, increasing brightness of orange juice
through increase value of transmitance and
increase total soluble solute of orange juice and
of CMC liquid 1%.
c. Enzyme of isolate S4, S6 and of S8 optimum at
(a) pH 9,0 and temperature 40°C. Enzyme of S4,
S6 and of S8 stable at pH 3,0-9,0 and inactive
at pH 11,0. Enzyme of S4, S6 and of S8 stable
at temperature 30-60°C and begin to perform
degradation of activity at temperature 70°C and
inactive at temperature 100°C. Value KM of
isolat S4, S6 and of S8 are 0,0018 mg / ml;
0,0016 mg / ml; 0,0036. and. Vmax isolate S4,
S6 and of S8 are 0,1172 U / ml; 0,1162 U / ml;
0,1193 U / ml.
(b)
Page | 402
PROCEEDINGS
Acknowledment [4] Kuhad, R.C., R. Gupta., and A.Singh.

Microbial Cellulases and Their Industrial
Researcher would thanks to Sebelas Maret Applications. University of Delhi South
University Surakarta from Incentive of Start-Up Campus. New Delhi, 2011.
Fund PNBP UNS 2010
[5] Mulyadi, A. Aplikasi Edible Coating untuk
Menurunkan Tingkat Kerusakan Jeruk Manis
References (Citrus sinensis). APTA. Malang.2011.
[1] Akinyele, Juliet Bamidele. Fabunmi, [6] Syamsir, E. Penanganan Sari Buah Beku di
Abimbola Olapeju. Olaniyi, Oladip Oladiti. Jasa Boga. Majalah Kulinologi Indonesia,
2011. Effect of Variations in Growth 02/vol.II/2010.
Parameters on Cellulase Activity of
Trichoderma viride NSPR006 Cultured on [7] Viet, Tran Quoc. Minh, Nguyen Phuoc. Dao,
Different Wood-Dusts. Malaysian Journal of Dong Thi Anh. Immobilization of Cellulase
Microbiology Vol 9(3) pp 193-200. Malaysia. Enzyme in Calcium Alginate Gel and Its
Immobilized Stability. American Journal of
[2]Harrison, R.G. Protein Purification Process Research Communication Vol 1(12). USA.
Engineering. New York: Marcel Dekker, 2013
115-208.2013.
[3] Joshi V.K, P. Mukesh, and R. Neerja. 2011.

Purification and Characterization of
Pektinase Produced from Apple Pomace and
Evaluation of Its Efficacy in Fruit Juice
Extraction and Clarification. Indian Journal
of Natural Product and Resources Vol. 2 (2).
June 2011, pp 189-197.
Page | 403
PROCEEDINGS
TOPIC FIELD: INDUSTRIAL

BIOTECHNOLOGY
Page | 404
PROCEEDINGS
DETERMINATION OF MASS TRANSFER COEFFICIENT OF

NICOTINE SOLID LIQUID EXTRACTION WITH ETHANOL
SOLVENT IN PACKED BED EXTRACTOR
Risky Azlia Edrina1,Misri Gozan1, Yuswan Muharam1

1
Chemical Engineering Department, Faculty of Engineering, Universitas Indonesia,
Depok, 16424, Indonesia
E-mail :Misri Gozan. mgozan@che.ui.ac.id
Abstract
Today‘s national tobacco production is still dependent on cigarette production which actually the
government desires to be reduced. The reduction of cigarette production in Indonesia, however, will
disturb the prosperity of tobacco farmer. On the other hand, tobacco plant in which contains alkaloid
compound is already treated, with a simple method, as a raw material for natural pesticides. Nicotine is a
neurotoxin which able to effectively kill pest, particularly agricultural pest. This toxic will be dangerous
in a massive amount, but in a moderate amount nicotine can be very useful. An extraction method with
ethanol solvent is used because several prior experiments have proven that utilizing ethanol results in
maximum number of yield. In this research, extraction experiment and modelling is done to get mass
transfer coefficient of nicotine solid-liquid extraction from tobacco leaf with etanol solvent in packed bed
extractor. The highest yield resulted from the velocity of the solvent is 3ml/minute and the diameter of the
particle is 0.45mm. Otherwise, the lowest yield resulted from the velocity of the solvent is 5ml/minute
and the diameter of the particle is 0.9mm The mathematical model is simulated by ComsolMultiphysics
5.2. The mass transfer coefficient is obtained by constantly formulating the coefficient value to achieve
the result curve which alligns with the experiment. There are three obtained coefficients from three
different variations those are 9x10-8m/s; 6.5 x10-8m/s; 1.5 x10-8m/s. From those coefficients, the
Reynold, Schmidt, and Sherwood numbers could be counted, therefore, the correlation between these
numbers could be acquired. The result of the correlation from this research is
Sh=3x10-5 Re-0,77Sc 1/3 .
Keywords:Tobacco, Nicotine, Ethanol,Comsol Multiphysics 5.2, Extraction, Solid-Liquid Extraction,

Modelling, Mass Transfer Coefficient.
1. Introduction compound that have already widely known. It is a

major compound in tobacco that have alkaloid
Tobacco is one of the major commodities in chain. Nicotine can be extracted from tobacco and
Indonesia. Total production from tobacco farming used as a raw material in natural pesticide or
in Indonesia increase year by year. In 2014 total biopesticide cause its activity as a neurotoxin. A
production of tobacco reach up until 166.262 ton research onnicotine explainsthat nicotine is really
[1]. Unfortunately, the major product of tobacco, effective to kill severe insects such as Aphis sp.
particularly in Indonesia is cigarette. Cigarette is and Myzussp[2].Small amount of nicotine in
dangerous because it can cause may disease for biopesticide can effectively kill pest. Also its
human‘s body. If the government want to decrease residue is far less than chemical pesticide.
the production of cigarette we have to find Therefore,this biopesticide is environmental
alternative product for tobacco supply. One of friendly and save for human.
promising product from tobacco is biopesticide.
Tobacco contain approximately 2500
chemical compound, included nicotine, a
Page | 405
PROCEEDINGS
2. Experimental
Materials
Dried tobacco leaf from Ponorogo, East
Java, Indonesia. This tobacco then heated at a
temperature of 1200 C to damage tobacco cells.
Thereafter, obtaining tobacco leaves mean
diameter of 0,45mm and 0,9mm. Ethanol that used
in this research has 99% purity.
Apparatus
The apparatus used in the experiment is a
packed bed extractor as shown in Figure 2. Ratio
of diameter and height of packed bed arranged to
Figure 1. Tobacco Plants. have a value of 10 so that radial mass transfer can
A common method to isolate nicotine from be ignored.
tobacco is extraction. Extraction of nicotine from
tobacco had been done in several researches, one
of them used maceration technique with some
different organic solvent and concluded that
ethanol 95% perform the highest nicotine
concentration in extract, 13,47 ±0,66% w/w [5].
This also because solubility of nicotine in ethanol
is relative high, 50mg/ml [6].
In this research, tobacco extraction with
ethanol solvent with different apparatus will be
studied. Among several extractors, one that
commonly used in industries is packed bed
extractor due to its simplicity.Hence, this
experiment will be done with ethanol solvent in
packed bed extractor. Furthermore, experiment
data will be inserted in kinetic modelling
simulation. From that simulation we can see
internal process of nicotine that happened and find
mass transfer coefficient of this process. Until this
time, internal mass transfer modelling of nicotine
extraction is very rare.
This mechanism of mass transfer process
consists of two main steps: extractor scale
(external) and particle scale (internal). Internal
transfer is the diffusion of bioactive compound Figure 2. Apaaratus (1. Solvent container, 2. Packed
(nicotine) from pores to surface then goes through bed extractor, 3. Beaker glass, 4. Klem, 5. Statif, 6.
film to liquid phase. External transfer is when Sand, 7. Tobacco, 8. Glasswool).
particle able to cross particle film then travel to
fluid phase and diffuse within the flow of fluid 3. Method
phase.
Firstly, glasswool inserted to extractor
In this work, experimental study and an
and managed to have 3cm thickness to prevent
integrated mass transfer modelling in finding not
leaked particles. Afterwards, tobacco leaves
only mass transfer correlation, but also its own
particles placed in the apparatus up to as high as
correlation, have been done. Publication for mass
30cm. It weighted 59g for diameter 0,45mm and
transfer correlation for nicotine extraction is also
54,5g for 0,9mm. Then sands placed above the bed
very scarce. Appropriate models and the kinetic
to maintain solvent flow so that the entire surface
parameters can be utilized to facilitate the scale-up
of bed has an equal solvent flowrate. Experiments
from laboratory data into industrial design
were performed with 2 variation of solvent
flowrate (3ml/min, 5ml/min).
Page | 406
PROCEEDINGS
The extract is then analysed with high The extraction yield as plotted against
performance liquid chromatography (HPLC) to extraction time to obtain an extraction curve as
obtain nicotine concentration in extract. Analysis shown in Figure 3.
for this experiment used C18 column with
methanol 100% as mobile phase that has
0,6ml/min flowrate. UV detector used with 260nm
wavelength. Nicotine standard prepared with five
different concentrations (200ppm, 600ppm,
800ppm, 1000ppm) to make standard curve.
Experimental result
Extraction process consist of three periods of
extractions [7,8,9]
a.Contant extraction rate (CER): At this period.

extraction of easily accessible oil accurs. Figure 2. Extraction yield.
Therefore, the highest extraction rate is In Figure 3, extraction curve indicates
achieved at this period as represented by the that this experiment still in CER period. That can
highest slope compared with slopes in other be seen at constantly increasing yield of nicotine
regions. Mass transfers mainly depend on until 6000s. Extraction curve also shows that
solute solubility on those particular operating particle diameter and solvent flowrate are some
conditions factor that affect extraction result. Variation one
b. Falling extraction rate period (FER): The with solvent flowrate 3ml/min and particle
extraction rate begins to decelerate due to diameter 0,45 able to extract the highest nicotine.
depletion of the easily accessible oil at early On the other hand, when the solvent flowrate is
stage of the fixed bed column. higher and the particle diameter is bigger, nicotine
c. Diffusion—controlled period (DC): Solvent yield decreases. Therefore, it is important to
diffuses into porous particle to dissolve the maintain optimum operation condition to get
compounds trapped in the solid substratum, maximum yield of nicotine in extract.
and then back –diffuses the dissolved
compounds to the solvent. DC period is
continued until the entire bioactive compounds
in the solid particle is extracted. Low
extraction rate is observed as represented by a
flat line (almost constant extraction rate).
Figure 3. Extraction Mechanism.
Page | 407
PROCEEDINGS
Extraction mechanism
According to Figure 4, process that occurs is as
follows [10]:
a. Transfer of solutes from solid to particle

pores
b. Then solvent carries nicotine in particle
pores to the surface
Figure 4. Particle Scale Volume Control.
c. Solutes which have been dissolved
diffuse from solid particle to bulk through
film Then mass transfer model can be obtained by
d. Finally, solutes past film and carried by applying Fick‘s law of diffusion
solvent to bulk phase/liquid phase
Mathematical modelling
The following assumptions were used to develop (3)
the process models [11]: (i) Uniform pepper
particle size in spherical shape was used. (ii) All Divide eq. (3) by then rearrange it
the components to be extracted behave similarly in
the mass transfer and therefore could be described
by a single component called the ―solute‖ (iii) (4)
Ethanol flows uniformly through every section of
the extractor. Pressure drop within the column
were neglected and system maintained isothermal.
Taking the limit as ∆r→0. gives the final
(iv) Volume of concrete remains the same. (v)
internal mass balance equation in eq. (5)
Nicotine in mobile phase is the function of time
and height of the extraction. Mathematical
modelling derived into two main mechanism:
extractor scale and particle scale mass transfer
model. (5)
1. Particle Scale Model

Apply the mass balance theory 2. Extractor Scale Model
This model also applied mass balance theory
(1)
Because there is no mass balance

equation during the process, thereforee rate of (6)
generation of solute mass equal zero.
Mass transfer in extractor scale consist of two
process: mass transfer of solute from the surface of
(2) particle to the solvent by convection and diffusion
of nicotine in the bulk flow of solvent. Because
This mass balance equation then applied to the L/d of extractor equal 10, it can be assumed that
control volume in Figure 5 only diffusion to axial direction is significant.
Page | 408
PROCEEDINGS
Initial and boundary condition

Initial Condition
t=0 → 𝐶𝑏 = 0
𝐶𝑝 = 0
𝑞 = 𝑞0
(8)
Boundary condition extractor scale:
It applied to the control volume in Figure 6 z = 0 → 𝐶𝑏 = 0
𝜕𝐶
z = L→ 𝐷𝐿 𝑏 =0
𝜕𝑧 𝑧=𝐿
Boundary condition particle scale:

𝜕𝐶𝑝
Atr = 0 → 𝜕𝑟 𝑟=0
=0
𝑑𝐶
Atr = rp→ 𝐷 = 𝑘 (𝐶𝑝 − 𝐶𝑏)
𝑑𝑟
Mass transfer coefficient

Molecular diffusion coefficient can be calculated
with Wilke and Chang equation [14].
Figure 5. Extractor Scale Volume Control.
(13)
Then rearranged and becomes:

Where is solvent viscosity (cP). is solvent
molar mass (g/mol). x is solvent association
coefficient. and is solute molal coefficient
(cm3/mol). Diffusion coefficient with liquid
(9) solvent is among 10-11-10-7 m2/s[11]. Effective
diffusion coefficient can be calculated with eq.
Where Sb is specific area with the (14)
following equation
𝐷𝑒 = (𝑑𝑝 )4/3.𝐷𝑝𝑒 (14)
(10)
Divide eq. (3) by 𝜋𝑟𝑟 2∆𝑧 then Determination of mass transfer

rearrange it coefficient and correlation
Mathematical model solved by
ComsolMultiphysics 5.2. Operation condition and
(11) parameter that entered can be seen in Table 1.
Taking the limit as ∆z→0 and applied

Fick‘s law.
(12)
Page | 409
PROCEEDINGS
Table 1. Operation condition and Process Parameter

Operation Condition
Temperature (T) 298 K
Solvent volumetric 3ml/minute and
flowrate (Qb) 5ml/minute
Superficial flowrate 7.072x10-5 m/s and
(uz) 1.18x10-4
Interstitial flowrate (u) 2.811x10-4 m/s and
4.720x10-4m/s
Parameter
Ethanol molar mass 0.04607 kg/mol
Ethanol Density (250C) 0.001095 kg/m.s
Nicotine viscosity (250) 789 kg/m3 Figure 7. Validation Curve (Qb=5ml/min;
dp=0,9mm).
Nicotine molar mass 0.1622 kg/mol
Initial concentration of 4.2 mol/m3
nicotine in solid
Bed porosity 0.25
Bed height 0.3 m
Internal diameter of 3x10-2 m
column
Column cross-sectional 7.07x10-4 m2
area
Mass transfer coefficient in a simulator is

maintained until simulation curve fit with
experiment curved. That is when we achieve Figure 8. Validation Curve (Qb=3ml/min;
correct mass transfer coefficient. Fit curve method dp=0,9mm).
can be seen in figure 7 – Figure 9.
Mass transfer coefficient that had been achieved
can be seen in Table 2.
Table 2. Mass Transfer Coefficient

No Qb (ml/min) dp T k (m/s)
(mm) (0C)
1 3 0.45 25 9x10-8
2 5 0.9 25 1.5x10-8
3 3 0.9 25 6.5x10-8
Table 2. shows different mass transfer coefficient

in each operation condition. Mass transfer
coefficient that had been achieved in some
research with supercritical fluid range between 10-
Figure 6. Validation Curve (Qb=3ml/min; 4 - 10-6 [7,15,16]. On the other hand, mass
dp=0.45mm). transfer coefficient that is obtained in this research
is smaller (10-8). That is because the resistance of
mass transfer with supercritical fluid solvent is
smaller than liquid solvent. Therefore, mass
transfer process with supercritical fluid is more
optimum and has a smaller mass transfer
coefficient.
Page | 410
PROCEEDINGS
Nicotine concentration in bulk

Nicotine concentration in bulk at several time can
be seen in Figure 10. Ethanol as solvent enter the
extractor from up to bottom, so at the top of the
bed, nicotine concentration is always zero, and this
shows that the solvent is still flowing through the
bed. Ethanol extracting nicotine then take it
through the bottom of bed to the outlet
(a) (b)
Figure 11. Nicotine Concentration in Particle at

several time (x=0.5; y=0; z=0).
Figure. 11point out that nicotine concentration
(c)
decrease alongside radius of particle at 6000 s.
(d)
Figure. 12 shows concentration of nicotine in
particle in function of time. Reduction of nicotine
concentration occure in particle because of
nicotine mass transfer process. Reduction of
nicotine concentration in particle has a significant
number from 0s to 1000s, with concentration 4,2
mol/m3 to 1,2 mol/m3. Then concentration of
nicotine in particle decrease relatively constant.
Figure 9. Nicotine Concentration in Bed (a. 0s b. Mass transfer correlation

1000s c. 2000s d. 6000s).
There are several correlations which suggested to
describe mass transfer correlation between fluid
Nicotine concentration in particle and solid in packed bed. One of them (eq. 15)
proposed by Lim et al.
Sh= f (Re.,Sc, Gr) (15)
On the other hand, if forced convective mass

transfer is the controlling factor. Grashof number
is no longer significant and mass transfer
correlation can be simplified as shown in eq. (16)
Sh = f (Re, Sc) (16)
Some studies suggested that generally the

Figure 10. Nicotine concentration in particle (x=0.5; correlation of Sherwood, Reynold and Schmidt
y=0; z=0). numbers can be expressed as follows [17.18]
Sh = f (Re. Sc) (17)
Whereas :
uz xdp x ρ
Re=
εxμ (18)
Page | 411
PROCEEDINGS
μ phenomenon that in process with Reynold number

Sc= ranges between 0.0092 – 0.31 and Schmidt number
ρ x Dab (19) 16.5 that mass transfer process is slower than its
flowrate. The slower the flowrate of solvent is, the
k x dp more optimum the extraction process gets.
Sh=
Dab (20)
3. Conclusion
Flow chart to find this correlation can be seen in
Figure 10. From this research, it can be concluded that :
1. Yield from this extraction method influenced

by particle diameter and velocity of solvent.
The highest nicotine concentration obtained
with dp = 0.45mm and superficial velocity
3ml/min.
2. Constant extraction rate occured until 6000s
or 100 minute. The number of solute still
increase constantly
3. Mathematical model from simulation process
with Comsol Multiphysics 5.2 contained
internal and external mass balance equations.
4. Mass transfer coefficient that have obtained
from experiment and simulation are around
10-8 (Table. 2)
5. Mass transfer correlation that have obtained
is this equation is
valid for process with Reynold number range
between 0.092 – 0.31 dan Schmidt number
16.5.
Nomenclature
Cb = Nicotine concentration in bulk phase (mol/m3)

Cp = Nicotine concentration in particle pore(mol/m3)
D = Diffusion coefficient (m2/s)
De = Effective diffusion coefficient (m2/s)
L = Bed height (m)
k = Mass transfer coefficient (m/s)
q0 = Nicotine initial concentration in particle (mol/m3)
Figure 12. Flow Chart. r = Bed radius (m)
rp = Particle radius (mm)
Because there is no temperature variation in this
Re = Reynold number
experiment, Schmidt number becomes constant.
Sc = Schmidt number
Therefore, degree of Schmidt number in this
Sh = Sherwood number
correlation is taken from correlation from Garner
t = Time (s)
and Keey (Sc1/3). Correlation is obtained by
T = Temperature (K)
Newton method that calculated in excel. That is
u = Interstisial velocity of solvent (m/s)
shown in eq. (21)
z = Axial cordinat of extractor (m)
Sh = 3x10-5Re-0.77Sc1/3 (21)
Z = Dimensionless axial coordinat (z/L)
This correlation is valid for process with Reynold ε = Bed porosity (-)
number ranges from 0.092 to 0.31 and Schmidt
εp = Particle porosity (-)
number 16.5.
μ = Viscosity(kg/m.s)
Generally, in several correlations, Reynold number ρ = Density (kg/m3)
has positive degree or directly proportional with
Sherwood number. That is because when the
solvent flowrate is increasing, therefore amount of
solute that can be dissolved, which exit extractor
outlet is greater. This correlation has shown a
Page | 412
PROCEEDINGS
References: [9] Meireles MA. Extracting bioactive

compounds for food products: theory and
[1] Pertanian, P. D. d. S. I., 2014. Outlook applications. London: CRC Press, 2008.
Komoditi Tembakau, Indonesia: Sekjen
Kementrian Pertanian 2014. [10] Tamara, A., 2014. Permodelan Ekstraksi
Betakaroten dari Buah Aprikot Kering
[2] Badan Litbang Pertanian, 2015. Efektivitas dengan CO2 Superkritis di Dalam Ekstraktor
Ekstrak Nikotin Formula 1 Terhadap Unggun Diam, s.l.: Tesis Departemen Teknik
Mortalitas Sundapteryx Biguttula (Ishida) Kimia Universitas Indonesia.
(Homoptera;Cicadelidae), Jakarta:
Kementrian Pertanian. [11] Bird, R. B., Stewart, W. E. & Lightfoot, E.
N., 2006. Transport Phenomena. 2nd
[3] Dawitri, E., 2013. Pembuatan Biopestisida penyunt. New York: John Wiley & Sons Inc.
dari Daun Tembakau dengan Metode
Pirolisis, Depok: Universitas Indonesia. [12] Henningfield, J. E., London, E. D. & Pogun,
S., 2009. Nicotine Psychopharmacology. 1st
[4] Subyakto, S., 2014. Mudah Membuat Pestisida penyunt. Berlin: Springer.
Nabati. Jakarta: Agromedia.
[13] Tassew, C., 2015. Levels of Nicotine in
[5] Puripattanavong, J., Songkram, C., Lomlim, Ethiopian Tobacco Leaves. Springerplus,
L. & Amnuaikit, T., 2013. Development of Volume 4, p. 649.
Concentrated Emulsion Containing Nicotiana
tabacum Extract for Use as Pesticide. Journal [14] Wilke, C. & Chang, P., 1955. Correlation of
of Applied Pharmaceutical Secience, Volume Diffusion Coefficient in Dilute Species.
3, pp. 16-21. A.I.C.h.E Journal, pp. 264-270.
[6] NCBI, 2015. PubChem Compound Database. [15] Araus K, Uquiche E, del Valle JM. Matrix
[Online] Available at: effects in supercritical CO2 extraction of
http://pubchem.ncbi.nlm.nih.gov/compoundni essential oils from plant material. J Food Eng
cotine#section=Top [Accessed 15 12 2015]. 2009;92:438–47
[7] Lin, T. M., Ping, T. S., Saptoro, A. & Freddie, [16] Reverchon E. Mathematical modelling of
P., 2014. Mass Transfer Coefficients and supercritical extraction of sage oil. AIChE J
Correlation of Supercritical Carbon Dioxide 1996;42:1765–71.
Extraction of Sarawak Black Pepper.
International Journal of Food Engineering, [17] Çengel YA. Heat and mass transfer a
Volume X, pp. 1-15. practical approach, 3rd ed. Singapore:
McGraw-Hill Education (Asia), 2006.
[8] Ferreira SR, Meireles MA. Modeling the
supercriticalfluidextraction of black pepper [18] Welty JR, Wicks CE, Wilson RE, Rorrer GL.
(Piper nigrum L.) essential oil. JFood Eng Fundamentals of momentum, heat and mass
2002;54:263–9. transfer, 5th ed. New Jersey: John Wiley &
Sons, 2008.
Page | 413
PROCEEDINGS
TOPIC FIELD: MEDICAL

BIOTECHNOLOGY
Page | 414
PROCEEDINGS
TOXICITY TEST OF HUMAN CD34+ STEM CELLS IN SPRAGUE

DAWLEY RATS (PRELIMINARY STUDY)
Basuki Supartono1,2
1.
Orthopedic Department, National Sport Hospital of Indonesia, Jalan Jambore Raya No. 1, Cibubur,
Jakarta, 13720, Indonesia
2.
Stem Cell Research and Tissue Engineering Center, University of Pembangunan Nasional " Veteran"
Jakarta,Jalan RS Fatmawati, Pondok Labu, Jakarta, 12450, Indonesia
E-mail: drbasuki@gmail.com
Abstract
Toxicity of CD34+ allogenic stem cell therapy in cartilage defect remains to be evaluated. We
investigated the toxic reaction of CD34+ stem cells intervention in non engineered Sprague Dawley (SD)
rats. Three male SD Rats were divided into 3 treatment; treatment 1 received intraarticular injection of
CD34+ cells (105 cells) from human peripheral blood, treatment 2 received intraarticular injection of
CD34+ cells (105 cells) human cord blood combined with hyaluronic acid and growth factors, and
treatment 3 received intraarticular injection of CD34 + cells (106 cells) human cord blood combined with
hyaluronic acid and growth factors. All rats were performed hematologic examination, blood chemistry
examination, liver histopathology examination, and kidney histopathology examination. All rats showed
good condition. There are non significant increased in hematologic and blood chemistry examination in
all treatment. The liver and kidney histopathology examination showed normal condition. There is no
hiperacute (edema, and systemic bleeding) and no acute rejection. In conclusion, human CD34 + cells did
not induced toxicity reaction on SD rats.
Keywords:Tissue engineering, toxicity, CD34+ cells, hyaluronic acid, growth factors
1. Introduction CD34+ cell, was not limited by sample collection.

Stem cells was able differentiated into
Tissue repair with tissue engineering chondrocytes and grown in a layer of cartilage [2,
techniques utilized cells, scaffolds and signaling 5, 8-16]. Signaling molecules used are growth
molecules [1-8]. Either cell line or scaffold alone factors (TGF-β1, IGF-1, FGF) which triggered a
used in tissue engineering. Moreover, tissue cell response and the extracellular matrix
engineering also performed with combination of production [1,6,7,17]. Scaffolding is an artificial
cells and scaffold, or combination of cells, environment where cells lived, developed, and
scaffolds and growth factors [7]. produced extracellular matrix [1,6]. Scaffold made
Stem cells had differentiation potential to from natural materials, synthetic or a mixture of
produce tissue regeneration as cartilage layer in the both. Natural scaffolds are fibrin, silk, agarose,
knee joint. There are two kind of stem cells alginate, collagen, chitosan, and hialuronan
embryonal and tissue stem cells. Application [1,6,9,18,19]. The toxicity of all materials used in
embryonal stem cells limited by ethics and tissue engineering should be minimized. Tissue
teratoma risk, so tissue stem cells is more engineering must be secure for the patient, without
applicable. There are two type of tissue stem cells, morbidity and minimum side effects [6,7].
which are mesenchymal and hematopoietic stem Tissue engineering research initiated with
cells. Mesenchymal stem cells were first animals experimental. Nowdays, tissue
considered as a potential source but their engineering research with animal experimental
application was limited by sample collection and studied in engineered immune system animal. Also
cell characteristics. Alternatively hematopoetics studied in animal with immune system suppressing
stem cells (HSC), which its major population was drugs treatment, which suppressed the toxic
Page | 415
PROCEEDINGS
reaction and immune rejection. Utilization Isolation of cord blood from umbilical
engineered animals for study, had a lot of cord
obstacles. The animal were expensive, high death
risk during the shipment, need special cage, and
need costly treatments. The application of Cord blood isolation from umbilical cord
experimental animals with immune system were carried out after the baby was borned. The
suppressing drugs proned to infection and bone umbilical cord was clamped and cut as close to the
disorders. Given the importance of tissue baby. Decontaminated points needling area with
engineering research, we were attempted to 70% alcohol. Puncture the needle to the veins, and
examine the possibility of using normal non- let blood flow to collection bags Let the blood
engineered animals for tissue engineering study. flow until 80-120 ml. Store cord blood at 4ºC.
The admission of human stem cells and its
combination with scaffolds and growth factors in Isolation of mononuclear cells (mnc)
experimental animals, needs to be evaluate. from peripheral blood and cord blood
Therefore, the objective of our study is to evaluate
the toxicity potential of CD34+ allogenic stem cell Blood specimens from peripheral blood or
therapy in knee cartilage defect on SD rats. cord blood, were diluted with PBS + KCl solution,
filtrated with Ficoll and centrifuged. Buffy coat
2. Methods layers were taken and washed, then supernatant
was removed, only mononuclear cells (MNC) were
This study was conducted at Pusat Studi collected. The MNC viability was checked.
Satwa Primata (Primate Study Center), IPB, Bogor
after obtaining the ethical approval from the Selection of CD34+cells from peripheral
Animal Care and Use Committee of PT Bimana blood and cord blood
Indomedical. Animals purchased from Indonesian
Food and Drug Administration, Jakarta. Three SD
male rats, 7 months, weighing 285 ± 18.5 gr. CD34+ cells were not cultured in advance because
Animals adapted and maintained in accordance culture altered the character of the cell and risk of
with the principles of animal welfare. Each animal contamination. Therefore, our study used the
was given suspension for toxicity test. CD34 cells which freshly isolated from human
Hematology, blood chemistry, liver and kidney peripheral blood or human cord blood.
tissue examination, were performed for all rats. CD34+ cells were isolated with MACS
Examination were performed on day 28 for rats 1 CD34 microbeads kit (Militenyi). MNC cells were
(received intraarticular injection of 105 CD34+ washed and labeled by adding 300 µl of buffer
cells from human peripheral blood), day 60 for rat solution, 100 µl of Fc receptor blocker and 100 µl
2 (received intraarticular injection of 105 CD34+ of CD34+ microbeads, and then incubated for 30
cells from human cord blood combined with minutes at 2-
hyaluronic acid and growth factors), and day 60 solution was added to cell suspensions and
for rat 3 (received intraarticular injection of 106 centrifuged. The supernatant was removed and
CD34+ cells from human cord blood combined cells were re-
with hyaluronic acid and growth factors). were separated with separator column. Five-
hundred microliter of buffer was added into the
column along with the cell suspension. The
Isolation of human peripheral blood column was washed with 500
three times. CD34+ cells retained in the column
Human peripheral blood was collected from were pushed with a syringe into a tube. Cell
healthy donors. About 200 ml intravenous blood suspensions were centrifuged, and the supernatant
was collected from the donor. The donors had was removed. Pellet cells were suspended and
knowingly signed informed consent. The donors counted. CD34+ cells were counted for viability.
had no history of hepatitis, HIV (human immune-
deficiency virus), malignancy orbone marrow
disease, and never had chemo- or radiotherapy. All Preparation of interventional
blood samples were examined in the laboratory for suspensions
HIV detection, hepatitis B detection, liver function
and kidney function. CD34+ cells used to prepare the
interventional suspension. Three suspensions were
used: 1) 105 cells of human peripheral blood
Page | 416
PROCEEDINGS
CD34+ cells, 2) 105 cells of cord blood CD34+ cells DiaSys-Indonesia), with SGOT,SGPT, ureum and
with hyaluronic acid (Adant Dispo) 250 g/ 25 L. creatinin from control (HumaTrol N-Jerman). The
TGF-β1 (Biovision) 1 g/ 5 L. IGF-1 (Sigma) 1 comparison conducted by photometer machine
g/5 L and fibronectin (Sigma) 2 g / 10 L. 3) automatically. Analysis of blood chemistry level
106 cells ofcord blood CD34+ cells with hyaluronic was conducted according to reference [20].
acid (Adant Dispo) 250 g/ 25 L. TGF-β1
(Biovision) 1 g/ 5 L. IGF-1 (Sigma) 1 g/5 L Histopatology of liver and kidney
and fibronectin (Sigma) 2 g / 10 L. Each examination
suspensions werediluted 50 L in total. Store the
solution at 4ºC. To evaluate the toxicity effect of CD34+
cells on SD rats, we performed histopatology
examination of liver and kidney of SD rat.
CD34+ cell transplants Specimens were fixed with 4 % paraformaldehyde
and 70 % alcohol alternatively for 24 hours at 4 ○C.
Transplantations were performed by Then encased the specimen in paraffin and
injecting interventional suspension into the the sectioned in 5 µm thick slices. Dissolve paraffin
rat‘s knee joint. An injection needle penetrated the with xylol, and then returns the humidity of
patellar tendon to reach the space between joint. specimen by dipping the preparation to alcohol
Interventional suspension were suspended in total with graded concentration. Then, washed the
50 L and injected into one right knee with a 26- preparat with aquadestand stained with
gauge needle under anesthesia with ketamine and Hematoxylin and Eosin (HE).Dehydration and
xylazine. clearing were done at the end of stage, followed by
the mounting process. Qualitative and quantitative
Hematology examination examinations were performed using a light
microscope and microphotography tools.
To determine the effect of CD34+ cells on
blood parameters, we performed hematology 3. Results and Discussion
examination. Blood from rat were taken from tail
vein, and store in 5 ml blood tube with EDTA. General condition of the animals
Blood is inserted into the blood examination
machine (Sysmex) automatically. Then the results
of blood tests is printed. Analysis of blood There were no ill, deformed or dead rats,
examination was conducted according to reference until the end of the toxicity test research. The rats
[20] walked, climbed, eat, drink and moved as usual.
Administration of CD34+ stem cell to the non
engineered rats did not interrupt the rat‘s weight
Blood chemistry examination addition. The rat‘s weight increased like the model
rat, during the toxicity test. Even though, the
To determine the toxicity of CD34+ cells on weight increased among the toxicity test rats were
blood chemistry levels, we performed blood not the same. The weight of rats received CD34+
chemistry examination.Theblood chemistry cells (106 cells) combined with hyaluronic acid
examinations were SGOT, SGPT, urea and and growth factors, was the same as the weight of
creatinine examination. SGOT,SGPT,ureum and model rat. While the rat received only CD34+ cells
creatinin examination were performed by was lighter than the model rat. The increase of
comparing the level SGOT,SGPT, ureum and rat‘s weight was shown in Table 1.
creatinin from rat (added with reagen from
Page | 417
PROCEEDINGS
Table 1. Rat’s Body Weight Before and After Administration of Toxicity Test
Group Initial Weight (grams) Final weight (grams) Increase of Weight

(grams)
Rat 1 264 275 11
Rat 2 338 348 10
Rat 3 297 318 21
Note:
Rat 1 = rat received intraarticular injection of 105 CD34+ cells from human peripheral blood.
Rat 2 = rat received intraarticular injection of 105 CD34+ cells from human cord blood, combined with hyaluronic
acid and growth factors
Rat 3 = rat received intraarticular injection of 106 CD34+ cells from cord blood combined with hyaluronic acid and
growth factors
Blood hematology level level in the blood of the rat 1 and rat 2 but it
changed the blood hematology level of the rats 3,
Administration of human CD34+ stem cell namely the hemoglobin, leucocytes contents and
to the naive rats did not change the hematological counts.
Table 2. Rat Hematology Profile After Toxicity Test
Parameter Normal value Rat 1 Rat 2 Rat 3

Hb (g/dl) 14.0-15.6 16.5* 14.7 13.6*
Hematocrit (%) 41.1-51.1 46.1 46.3 42.9
Erythrocyte (x1012/L) 7.21-8.45 8.78 7.81 7.35
Thrombocyte (x103 uL) 200-1.500 709 605 439
Leucocyte (x109/l) 7300-12.700 4.900* 9.000 7.800
Netrophil (%) 8.5-40 65* 33 36
Eosinophils (%) 0.4-3 2 0 0
Lymphocytes (%) 53.7-88.5 31* 65 63
Monocyte (%) 0.5-4.5 2 2 1
Note:
Rat 1= rat received intraarticular injection of 105 CD34+ cells from human peripheral blood.
Rat 2 = rat received intraarticular injection of 105 CD34+ cells from human cord blood, combined with
hyaluronic acid and growth factors
Rat 3 = rat received intraarticular injection of 106 CD34+ cells from cord blood combined with hyaluronic
The hemoglobin content increased a little Blood chemistry levels

bit from the normal score 15.6 to 16.5 on rat 1.
The leucocytes content decreased from the normal The giving of human‘s CD34+ stem cell to the
score 7300 to 4900. The Netrophil proportion naive rats changed the blood chemistry levels. The
increased from the normal score 40 to 65. The SGOT, SGPT and Ureum of rat 1 was increased.
lymphocyte decreased from 53.7 to 31. The results The SGOT, SGPT of the rat 1 and 3 did not
of hematology level in blood is shown in Table 2. increased. There was non significant increasein the
ureum and creatinine for all rats. The results of
blood chemistry level in rat‘s blood are shown in
Table 3.
Page | 418
PROCEEDINGS
Table 3. Rat’s Blood Chemistry Profile After Toxicity Test

Parameter Normal value Rat 1 Rat 2 Rat 3
SGOT (IU/L) 36-72 518* 43 10*
SGPT (IU/L) 21-43 676* 23 20*
Ureum (mg/dl) 12-31 48.7* 64* 52*
Creatinine (mg/dl) 0.4-0.5 0.6* 1.2* 1.6*
Note:
Rat 1 = rat received intraarticular injection of 105 CD34+ cells from human peripheral blood.
Rat 2 = rat received intraarticular injection of 105 CD34+ cells from human cord blood, combined with
hyaluronic acid and growth factors
Rat 3 = rat received intraarticular injection of 106 CD34+ cells from cord blood combined with hyaluronic
Microscopic of liver and kidney This study is the first study to report the
absence of toxic reactions in normal mice given
Administration of human stem cell to the human hematopoietic stem cells either CD34+
non engineered rats did not cause any abnormal cells, or CD34+ cells combined with scaffolding
microscopic changes to the liver and kidney organs and growth factors. Administration of CD34+
(Fig.1).Examination of liver and kidney showed cells from human peripheral blood and cord blood,
that the appearance of the cells and tissues were in SD rats with no immune suppressant drug,
still within normal value. showed no toxic reaction, hyperacute and acute
rejection. Administration of CD34 cells did not
interfere with weight growth and activity.
Parameter hematology and blood chemistry had
changed, but showed no damage cells and tissues
of the liver and kidneys.
Transplantation of human cells in animals
will lead to immune rejection mechanisms.
Reaction occured when the T cell antigen donor
cells recognize the recipient as foreign objects
recipient, triggered the T cell cytotoxic cells,
macrophages, neutrophils to kill donor cells, and
caused tissue damage [21-26]. Immunodeficient
animals (engineered animals) or immune
suppressant animals were being used to overcome
the immune rejection [21, 27-29].
The absence of toxic reaction in engineered
Figure1. Microscopic examination of liver and experimental rat causes it to become advantageous
kidney for stem cell transplantation research. However,
after administration of human stem cell. engineered rats are susceptible to disease [21].
Note: While application of immune-suppressing drugs to
(A-B) Rat 1. Tissue of rat 1 liver and kidney non engineered rat, contained infection risk and
observation was within normal limits, bone disorders formation. Matsumoto and
5
after 1 month administration of 10 Terayama, utilized atimic rat for their study on
+
CD34 cells from human peripheral bone regeneration. They used human CD34+ stem
blood.
cells from peripheral blood for bone regeneration
(C-D) Rat 2. Tissue of rat 2 liver and kidney
observation was within normal limits. [30,31]. Another study on lung cancer therapy,
after 2 month administration of 10
5 administration of umbilical cord matrix stem cells
+ to non engineered mice with no immune
CD34 cells from cord blood,combined
with hyaluronic acid and growth suppressant drug,showed no rejection and positive
factors. result [32]. Liechty proved infusion of human
(E-F) Rat 3. Tissue of rat 3 liver and kidney mesenchymal stem cells to sheep did not cause
observation was within normal limits. immune rejection [25]. In this study, extra doses of
6
after 2 month administration of 10 CD34+ cells from cord blood gived no toxic
+
CD34 cells from cord blood, combined
reaction and immune rejection. These results are
with hyaluronic acid and growth
factors consistent with the characteristic of cord blood,
Page | 419
PROCEEDINGS
which had low imunogenisity level. Besides the [3] Grayson LW, Martens PT, Eng MG, Radisic
stem cell from cord blood was still immature, M, Vunjak GN, Semin Cell Dev Biol. 20
therefore the antigen still immature [26]. In this (2009) 665-73.
study demonstrated that administration of human
CD34 stem cells from peripheral blood and cord [4] Burdick JA, Novakovic GV, Tissue Eng Part
blood in normal rat did not cause toxic reactions or A. 15 (2009) 205-219.
rejection.
There is no morbidity and mortality among [5] Gelse K, Schneider H, J.Addr. 58 (2006) 259-
the rats. The activity was normal like climbing, 284.
walking, playing, eating and drinking. After 28
days of interventions, all groups showed no [6] Chiang H, Jiang CC, J. Formos Med Assoc.
significant changes in all types of examinations. 108 (2009) 87-101.
Hematology levels of the samples revealed that all
rats had a normal value for every score. In the [7] Haleem, AM, Chu CR, Optechorthopaedics. 20
other hand, the blood chemistry levels revealed a (2010) 76-89.
different result. Rat 1, which had only 105 CD34+
cells from human peripheral blood, had abnormal [8] Chen FH, Rousche KT, Tuan RS, Nat Clin
scores for SGOT, SGPT, ureum and creatinine. Pract Rheumatol. 2 (2006) 373-382.
The other rats had normal scores for blood
chemistry level examination. But the results of Rat [9] Richardson JB, Lim JTK, Hui JHP, Lee EH.
1 in blood chemistry level examination have not Stem cells and cartilage. In :Bongso A, Eng
been proven by microscopic examination. The HL, editors. Stem Cell from Bench to Beside.
histopathology of its liver and kidney showed no Singapore :World Scientific Publishing Co.
significant changes and so the other rats. The Pte. Ltd., 2005, p. 466 - 493.
injection of CD34+ stem cells of the peripheral
blood and human‘s umbilical cord blood did not [10] Raghunath J, Sutherland J, Salih V, Mordan
cause any toxic reaction on experimental rat. N, Butler PE, Seifalian AM, JPRAS. 63
(2010) 841-847.
4. Conclusions
[11] Milljkovic ND, Cooper GM, Marra KG,
This study proved that the administration of OARSI. 16 (2008) 1121-1130.
human CD34, either CD34+ alone, or combined
with scaffolds and growth factors in non- [12] Saw KY, Hussin P, Loke SC, et al,
engineered mice, did not cause a toxic reaction. Arthroscopy. 25 (2009) 1391-1400.
These results paved the way for researchers to use
non engineered rat for human stem cell study. [13] Kelly DJ, Prendergast PJ, J Biomech. 38
Further research should be included more samples (2005) 1413-1422.
and provided the basic score for every sample as a
comparison. [14] Dennis JE, Caplan AI. Bone marrow
mesenchymal stem cells. In: Sell S, editor.
Acknowledgements Stem Cells Handbook. New Jersey. Humana
Press, 2014, P.107-117.
We thank Prof. Sarwono Waspadji for his [15] Murphy JM, Fink DJ, Hunziker EB, Barry FP,
invaluable help. We thank Mrs.Diah Iskandriati for Arthritis Rheum. 48 (2003) 3464-3474.
facility support and immunohistochemistry. We [16] Koga H, Shimaya M, Muneta T, et al,
thank Ns. Latifah, Mr.Muhammad Faiz, Mrs.Andri Arthritis Res Ther. 10 (2008) 1-10
Pramono for technical support.
[17] Han Y, Wei Y, Wang S, Song Y, JBSpin.77
References (2010) 27-31.
[1] Kim BS, Park KI, Hosiba T, et al, J [18] Choi KH, Choi BH, Park SR, Kim BJ, Min
Progpolymsci. 36 (2011) 238-68. BH, Biomaterials. 31 (2010) 5355-5365.
[2] Khan WS, Malik AA, Hardingham TE, J [19] Muzzarelli RAA, Carbohydrate Polymers. 76
Perioper Pract. 19 (2009)130-135. (2009) 167-182.
Page | 420
PROCEEDINGS
[20] Mitruka BM, Rawnsley HM. Clinical cells immune rejected by MHC class I- and
Biochemical and hematological reference class II-mismatched recipient mice. 106
values in normal experimental animals and (2005) 4057-4065.
normal humans. 2nd ed. USA; Masson
Publishing, 1987, p.163-164. [27] Maurya DK, Doi C. Kawabata A. et.al. BMC
Cancer. 10 (2010) 590.
[21] Chen T. Cellular therapy products and
immune rejection: Preclinical perspective. [28] Ullich TR, Castillo J del, Yi ES, et al. Blood.
CIRM Webinar: Immune response in stem 78 (1991) 645-650.
cell-based therapy. 2012.
[29] Kelly S, Bliss TM, Shah AK, Sun GH, Ma M,
[22] Juliana IM, Loekman JS. Komplikasi paska Foo WC, et al. Transplanted human fetal
transplantasi ginjal. 8 (2007) 79-90. neural stem cells survive, migrate, and
differentiate in ischemic rat cerebral cortex.
[23] Setiawan M, Sardjono CT, JKM. 9 (2009) 76- 101 (2004) 11839-11844.
84.
[30] Terayama H, Ishikawa M, Yasunaga Y, et al,
[24] Blanc KL, Ringden O. Immunobiology of J Tissue Eng Regen Med. 5 (2011) 32-40.
human mesenchymal stem cells and future
use in hematopoietic stem cell [31] Matsumoto T, Kawamoto A, Kuroda R, et al,
transplantation. Biologi of blood and marrow Am J Pathol. 169 (2006)1440-1457.
transplatantion II, 2005, p.321-334.
[32] Yocum GT, Wilson LB, Ashari P, Jordan EK,
[25] Otto WR, Wirght NA, Otto and Wright Frank JA, Arbab AS. Effect of human stem
Fibrogenesis & Tissue Repair. (2011) 4-20. cells labeled with ferumoxides-Poly-l-lysine
on hematologic and biochemical
[26] Eliopoulos N., Stagg J. Lejeune L, Pommey measurement in rats. Radiology. 235
S, Galipeau HJ. Allogeneic marrow stromal (2005)547-552.
Page | 421
PROCEEDINGS
POMELA (POMEGRANATE DERIVED ELLAGIC ACID): A

NATURALSODIUM GLUCOSE CO-TRANSPORTER 2 INHIBITOR
FOR TYPE 2 DIABETES TREATMENT
Suryaningtyas Margi Utami1, Mila Ulfia1, Aninditya Verinda Putrinadia1, Rafi Amanda Rezkia
Amradani1 and Dono Indarto2.3
1
Medical Student. Faculty of Medicine, Sebelas Maret University, Surakarta, Indonesia; 2Physiology
Department.
Faculty of Medicine, Sebelas Maret University, Surakarta, Indonesia; 3Biomedical Laboratory, Faculty
of Medicine.
Sebelas Maret University, Surakarta, Indonesia
E-mail: donoIND323@gmail.com
Abstract
Type 2 diabetes mellitus (T2DM) has become a public health problem in the world since the prevalence
of T2DM significantly increases in the last decade. Recent diabetes management relies on using oral
diabetic drugs to keep normal blood glucose level. Normally, sodium glucose co-transporter 2 (SGLT2)
which is expressed in the proximal kidney tubules is responsible for 90% glucose reabsorption. In some
diabetic patients, SGLT2 gene mutation increases glucose reabsorption, leading to severe hyperglycemia.
SGLT2 inhibitor has recently marketed in Indonesia so that the effectiveness and safety of this drug for
the long term use have not been clinically tested. Many medicinal plants grow in Indonesia but a few
plants have just been used for treating some human diseases including T2DM. Therefore, the aim of this
study was to investigate natural SGLT2 inhibitors that were derived from Indonesian medicinal plants.
Exploration of the SGLT2 inhibitors was performed using AutodockVina software 1.1.2 version and
dapaglifozin was used as a standard ligand. Binding sites of phytochemical-SGLT2 complexes was then
analyzed using PyMol 1.7 and Chimera 1.9 software. Ellagic acid was the best candidate of SGLT2
inhibitor and found in peel and seeds of the pomegranate fruit (Punica granatum). Extraction of
pomegranate peel and seeds was used methanol, a combination of ethanol and diethyl eter or ethyl
acetate. Inhibition of SGLT2 activity by crude extracts of pomegranate fruit was biochemically tested
using Vero cell line. Interaction between dapagliflozin and SGLT2 produced -9.0 kcal/mol binding
energy and structurally has binding sites at Asn75, Gly79, and His80 residues. Ellagic acid has a lower
binding energy (9.2 kcal/mol) than dapaglifozin and binding sites at Gly79, His80 and Gln457 residues
125 and 250 ppm administration of all crude extracts of pomegranate peel decreased proliferation rate of
Vero cells in 72 hour incubation. In contrast, proliferation rate of Vero cells decreased after treated with
125 ppm of pomegranate seeds extracted using ethyl acetate or a combination of ethanol and diethyl ether
for 48 hour incubation. In conclusion, ellagic acid might become a natural SGLT2 inhibitor in silico.
Pomegranate peel sand seeds are potential sources of ellagic acid. High purity of ellagic acid is required
for further investigation of its biological properties to treat T2DM.
Keywords: dapaglifozin, ellagic acid, pomegranate, SGLT2 inhibitor, type 2 diabetes mellitus
1. Introduction million to 642 million in 2040 [2]. In Indonesia,

the prevalence of DM also increases from 1.1% in
In the last decade, diabetes mellitus (DM) has 2007 to 2.1% in 2013 [3]. Additionally,
become one of health public problems around the Indonesia will become the sixth country with the
world [1]. According to the International Diabetes highest number of people with DM in 2035 [4].
Federation in 2015, the prevalence of DM is Type 2 diabetes is the most common disease and
globally estimated to increase 1.65 folds from 415 strongly associated with obesity [2].
Page | 422
PROCEEDINGS
Based on the consensus of DM management, life officinalis [12]. Indonesia has at least 30,000
quality of patients with DM can be improved by species of medicinal plants which are potentially
modification of lifestyle like regular exercise, diet developed to treat DM [13]. In addition, the
and smoking cessation [5]. However, there is only existing herbal medicine for DM treatment
10% patients with DM who successfully control consists of crude extracts of some medicinal plants
their blood glucose level and 90% patients rely on and lacks of scientific evidence [14]. Therefore,
using antidiabetic drugs [5]. Administration of the aim of this study was to investigate Indonesian
antidiabetic drugs for long time frequently causes medicinal plants that are able to inhibit SGLT2
some adverse effects [6]. Kumari and Chetia activity.
(2013) reported that use of antidiabetic drugs
effectively reduced blood glucose level in 25-50% 2. Methods
patients with DM [7]. Therefore, many other Homology modeling with SWISSMODEL
factors contribute in the pathogenesis of DM. (swissmodel.expasy.org) was used in this study
SGLT2 protein is expressed in some human because molecular structure of human SGLT2
bodies including the kidney. Physiologically, this protein has not been established yet. The bacterial
protein is commonly found in the kidney tubules SGLT2 with 3HD4 PDB access number was used
which reabsorb > 90% glucose after filtration in as the template [15]. Dapagliflozin was a standard
the kidney glomerulus [8-10]. In pathological of SGLT2 inhibitor and obtained from ZINC
condition, mutation of the SGLT2 gene enhances database with ZINC03819138 access code.
hyperglycemia in some DM patients. In recent Phytochemicals of Indonesian medicinal plants
years, it has been marketed a new synthetic were found in a database
SGLT2 inhibitor (dapagliflozin) and used as the (herbaldb.farmasi.ui.ac.id) and selected using
first line therapy when it is unresponsive to the criteria of Lipinski‘s rule of five (Table 1).
standard of antidiabetic drugs [8,10]. Molecular structure of the selected phytochemicals
Unfortunately, administration of SGLT2 inhibitor was obtained from a public database
can trigger ketoacidosis and increase bone (pubchem.ncbi.nlm.nih.gov). All phytochemicals
fractures in some DM patients [11]. were then molecularly docked three times on
Herbal medicine has been used for DM human SGLT2 model protein by using
treatment in some countries including Indonesia. AutodockVina 1.1.2 software. Phytochemical-
Metformin, for instance, is an antidiabetic drug SGLT2 binding complexes were finally analyzed
which is derived from a medicinal plant, Galega using PyMol 1.7 and Chimera 1.9 softwares.
Table 1. The Characteristics of selected phytochemicals using Lipinski’s rule of five

Compound H bond donor H bond Compound’slipophilicity Molecularweight(<500)
(<5) acceptor (<10) (XlogP <5) (g/mol)
Dapagliflozin 4 6 2.3 408.8726

Ellagic acid 4 8 1.1 302.19264
Actinodaphnine 2 5 2.4 311.33188
Boeravinone F 3 7 2.7 326.2571
Based on the result of molecular docking, at Tyr150. Whilst hydrogen binding occurred at
ellagic acid was the best candidate of SGLT2 Asp75 (Figure 1b).
inhibitor. This phytochemical was extracted from Table 2. Binding Energy and Interaction Site of Three
peel and seeds of pomegranate fruits (Punica
Selected Phytochemicals.
granatum), used a maceration method. Each Compound Interaction
Binding Average
fraction of pomegranate extracts was then tested its energy (kcal/mol Site
proliferative effect by using monkey kidney cell
line (Vero) in the presence of 20% (v/v) glucose.
Dapagliflozin
©
©
©
y
y
l
3. Results and Discussion Asn75, Gly79, His80

:b°
Human SGLT2 model protein was

validated using dapagliflozin and average of its Ellagic acid -9,2 -9,2 -9,2 Gly79, His80,
binding energy was -9.0 kcal/mol (Table 2). -9,2 Gln457
Dapagliflozin interacted with SGLT2 at Asn75,
Gly79, His80, Tyr150, dan Lys154 residues Actinodaphnine -9,1 -9,1 -9,1 Gln457
-9,1
(Figure 1). Vander Wall binding occurred between Boeravinone F -9,8 -9,8 -9,8 457
O atom of dapagliflozin and N atom of SGLT2 at Gln
-9,8
Gly79, His80 and Lys154 and O atom of SGLT2
Page | 423
PROCEEDINGS
boeravinone F did not. As a result, ellagic acid

might become a candidate of SGLT2 inhibitor in
silico
(a) (a)
(b)
Figure 1. Validation of dapagliflozin-SGLT2
binding complexes. (a) Three dimensional
structure of SGLT2. (b) Visualization of
binding sites of dapagliflozin and SGLT2 using
PyMol 1.7 software. Green color indicated C
atom. red color for O atom. blue color for N
atom and white color for H atom. Dashed line
indicated interaction between dapagliflozin and
SGLT2 and black circle indicated amino acid
sequence.
As can be seen from Table 2, there were

three phytochemicals that had lower binding
energy but they had different binding sites,
compared with dapagliflozin. Although
(c)
boeravinone F had the lowest binding energy, its
binding site was totally different from
Figure 2. Visualization of phytochemical-
dapagliflozin, just one residue at Gln457. A similar
binding site at Gln457 was observed in SGLT2 binding complexes using Chimera
actinodaphnine but its binding energy was higher software. (a) Interaction between dapagliflozin
than boeravinone F and slightly lower than (green), ellagic acid (blue,) and SGLT2 (red
dapagliflozin. In terms of binding energy and ribbons) (b) Interaction between boeravinone F
interaction site, ellagic acid was similar to (blue) and SGLT2(red ribbons) (c) Interaction
dapagliflozin but Asn75 was substituted by Gln475
between actinodaphnine (blue) and SGLT2 (red
In Figure 2, it showed that ellagic acid ribbons). Gly79, His80 and Gln457 indicated
had similar structure with dapagliflozin but amino acid number of SGLT2.
Page | 424
PROCEEDINGS
In general, pomegranate peel produced more

crude extracts than pomegranate seeds except
extraction using ethyl acetate solvent (Table 3). A
mixture of methanol and water was the most
effective solvent to extract pomegranate peel and
seeds (121.15 and 98.03 gr), followed by a mixture
of ethanol, diethyl eter and water solvents (59.47
and 49.14 gr) and ethyl acetate solvent (0. 33 and
0.53 gr). In contrast to extraction with mixtured
solvents, the ethyl acetate solvent produced a
higher crude extract of pomegranate seeds than
pomegranate peel.
Table 3. The result of extraction of pomegranate

peel and seeds with three different solvent
Solvent Peel extract Seed extract

(gr) (gr)
Methanol:water 121.15 98.03
(70%:10%)
Ethanol:diethyl 59.47 49.14
eter:water
(8:1:1)
Ethyl acetate 0.33 0.53
In this study, proliferation assay was used to

evaluate the inhibitory effect of crude extracts of
pomegranate peel and seeds in the monkey kidney
cells. 1.14 mM of dapagliflozin was used as a
positive control and the presence of 4.5 % glucose
in cell medium was a negative control. In figure 3,
low dose (125 ppm) of ethanol and diethyl eter
extract and ethyl acetate extract of pomegranate
seeds inhibited Vero cell growth during 48 hour
incubation but stimulated Vero cell growth after 72
hour incubation (Figure 3B&C). A similar pattern
of cell inhibition occurred in Vero cells which
were treated with 1,000 ppm of crude extract of
pomegranate seeds using ethyl acetate solvent Figure 3. Proliferative effect of pomegranate
(Figure 3C). In the other hand, 125 ppm seed extracts in Vero cell line in the presence of
administration of methanol extract of pomegranate 20% glucose. (a) Various doses of seed extract
seeds stimulated Vero cell growth during 48 hour using methanol and water solvents. (b) Various
incubation and inhibited Vero cell growth during doses of peel extracts using ethanol, diethyl eter
72 hour incubation (Figure 3A). and water solvents and (c) Various doses of peel
extracts using ethyl acetate solvent. Absorbance
values were generated in triplicate and
presented as mean.
In figure 4, administration of less than and

equal 500 ppm of pomegranate peel extracts was
able to inhibit the proliferation rate of Vero cell
during 72 hour incubation. In addition, three
different mixtured solvents of peel pomegranate
extraction had comparable effect in inhibition
ofVero cell proliferation. The inhibitory effect of
methanol crude extract in Vero cells was observed
in 125-500 ppm doses (Figure 4D). Whilst,
Page | 425
PROCEEDINGS
administration of ethanol, diethyl eter and water worker reported that ellagic acid in pomegranate
extract had as same as the inhibitory effect of ethyl peel is higher than ellagic acid in pomegranate
acetate extract in Vero cells in only two doses (125 seed (0.59% vs 0.01%) by using high performance
and 250 ppm) (Figure 4E&F). liquid chromatography (HPLC) [16]. In the
previous study, use of ethanol, diethyl eter and
water for pomegranate extraction is the effective
solvent to obtain punica gallin, gallic acid and
ellagic acid [17]. Our result study confirmed the
Singh‘s study in term of using a mixture of
solvents because the use of these solvents will
modulate the polarity of ethanol to solubilize
ellagic acid [17]. Since pomegranate crude extracts
contains some secondary metabolites such as
catechin, epigallocatechin gallate, quercetin and
antosianidin, it will probably interfere ellagic acid
during proliferation assay. In addition, we were
unable to ensure the homogeinity and viability of
Vero cell number treated with pomegranate
extracts.
4. 4. Conclusion
Ellagic acid might computationally become a
new SGLT2 inhibitor due to lower binding energy
and similar binding sites, compared with
dapagliflozin. Pomegranate fruit is an important
source of ellagic acid. Combination of ethanol,
diethyl ether and water provides a good method for
extraction of pomegranate fruits. Further research
will be required for purification of ellagic acid in
pomegranate fruits in order to explore its
inhibitory effect on SGLT2 activity. This research
study can be used as a scientific basis for drug
development of SGLT2 inhibitor derived from
Indonesian medicinal plants in future.
Acknowledgment
Researchers would like to thank the Directorate
General of Higher Education of the Republic of
Indonesia who has given Grant Research of
Student Creativity Program 2016
References
[1.] Tag HP, Kalita P, Dwivedi AK, et al. Herbal
Figure 4. Proliferative effect of pomegranate medicines used in the treatment of diabetes
peel extracts in Vero cell line in the presence of mellitus in Arunachal Himalaya, northeast,
20% glucose. (d) Various doses of peel extract India. J Ethnopharmacology. 2012; 141(3):
using methanol and water solvents. (e) Various 786-95.
doses of peel extract using ethanol, diethyl eter
[2.] International Diabetes Federation.
and water solvents and (f) Various doses of peel
Globalhttp://www.idf.org/WDD15-
extract using ethyl acetate solvent
guide/facts-and- figures.html. 2015 -
accessed onAugust 2016.
Absorbance values were generated in
triplicate and presented as mean.The result of this [3.] Research and Development Centers of
study is opposite with Zhou‘s study because our Indonesian Health Ministry. Basic Health
study just used crude extracts. Zhou and team Research.http://www.depkes.go.id/resources/
Page | 426
PROCEEDINGS
download/general/Hasil%20Riskesdas%2020 [12.] Bailey CJ, Day C. Metformin: its

13.2013 - accessed on June 2016. botanicalbackground. ractical
DiabetesInternational. 2004; 21(3): 115-
[4.] Aguiree F, Brown AC, Nh Dahlquist G. IDF
117.
Diabetes Atlas. www.idf.org/diabetesatlas.
2013. - accessed on Juni 2016. [13.] Health Minister of Republic Indonesia.
Decision of health minister of Republic
[5.] Bilous R, Donelly R. Buku Pegangan
Indonesia No. 381 / Menkes / SK / III / 2007
Diabetes Edisi ke-4. Jakarta:Bumi Medika;
about traditional and national medicine
2004; pp: 85-93.
policy. 2007
[6.] Nakka S and Guruprasad L. Structural
[14.] National Agency of Drug and Food Control.
insights into the active site of human sodium
Getting to know some of the plants used as
dependent glucose co-transporter 2:
antidiabetika.http://www.pom.go.idmobileind
Homology modelling, molecular docking,
ex.phpviewb erita74Mengenal-Beberapa
and 3D-QSAR studies. Australian Journal of
Tanaman-yang- Digunakan-sebagai
Chemistry. 2012; 65(9).
Antidiabetika.html. 2005. - accessed on
[7.] Safavi M, Foroumadi A and Abdollahi M. Oktober 2015.
The importance of synthetic drugs for type 2
[15.] Biasini M, Bienert S, Waterhouse, Arnold
diabetes drug discovery. Expert opinion on
K,Studer G, Schmidt T, Kiefer F, et al.
drug discovery. 2013; 8(11): 1339-63.
Swiss- model: modelling protein
[8.] Wilding JPH. The role of the kidneys in tertiary andquaternary structure using
glucose homeostasis in type 2 diabetes: evolutionary information. Nucleic Acids Res.
Clinical implications and therapeutic 2014; 42(1): 252-258.
significance through sodium glucose
[16.] Zhou Q, Zhong Z, Zhi YZ. Comparative
co¬transporter 2 inhibitors. Metabolism.
study of chemical composition of
2014; 63(10): 1228-37.
pomegranate peel pomegranates inside and
[9.] Chao EC. SGLT-2 inhibitors: A new pomegranate seeds. 2013; 38 (13) :
mechanism for glycemic control. Clin 2159¬2162.
Diabetes. 2014; 32(1): 4-11.
[17.] Singh M, Jha A, Kumar A, Hettiarachchy N,
[10.] Abdul-Ghani MA, Norton L and DeFronzo Rai AK, Sharma D (2014). Influence of the
RA. Role of sodium-glucose cotransporter 2 solvent on the extraction of major phenolic
(SGLT 2) inhibitors in the treatment of type 2 compound (punicalagin, ellagic acid, and
diabetes. Endocr Rev. 2011; 32(4): 515-31. gallic acid) and their antioxidant activities in
pomegranate aril. Journal Food Science
[11.] Taylor, S.I., Blau, J.E. and Rother, K.I. Technology, 51(9): 2070 - 2077.
Possible adverse effects of SGLT2 inhibitors
on bone. Lancet Diabetes Endocrinol. 2015; 3(1),
pp.8-10.
Page | 427
PROCEEDINGS
HEALING OF DIABETIC FOOT ULCER USING AUTOLOGOUS

PERIPHERAL BLOODMONONUCLEAR STEM CELLS
(STUDY CASE)
Basuki Supartono1,2, Prita Kusumaningsih3, Muzayyana Sakinah3
1
Orthopaedic Department, National Sport Hospital of Indonesia, Jalan Jambore Raya No. 1,
Cibubur, Jakarta, 13720, Indonesia
2.
Stem Cell Research and Tissue Engineering CenterUniversity of Pembangunan Nasional "
Veteran" Jakarta, Jalan RS Fatmawati, PondokLabu, Jakarta, 12450, Indonesia
3
RSU Al-Fauzan, Jalan Pedati no 3, Jakarta Timur, 13540, Indonesia
Email: drbasuki@gmail.com
Abstract
Diabetic foot ulcer is the most dreaded complications of Diabetes Mellitus (DM), wound healing in
patients with DM is a very important issue. Here, we report a case study of stem cell therapy on unhealed
diabetic wound. The mononuclear stem cells (MNC) were isolated from patient‘s peripheral blood with
Ficol gradient.Topically MNC stem cells administration on 47 years old female patient for 2 months,
triggered the formation of granules in the cells of the surrounding wound. Eventually, wound were healed
completely. In conclusions, MNC stem cells therapy healed end stage diabetic foot wounds, without
surgery.
Keywords: diabetic foot ulcer, mononuclear stem cells.
1. Introduction neuropathy and vascular disturbances. Several

factors contributed for non-healed wound were
Diabetic foot ulcer was the most dreaded impaired cellular activity, deficient extracellular
complications of Diabetes Mellitus (DM), wound matrix (ECM) synthesis, growth factor expression
healing in patient with DM was very difficult. reduction, and local neovascularize
Wound healing was a complex process, involving diminution[3,4].
various aspects for integrity returning and The current standard care are debridement,
functions of the tissue. Any disruptions in wound blood flow restoration (in peripheral arterial
healing process caused chronic ulcer, moreover disease), pressure elimination from the ulcer, and
developed into severe. Several factors played a antibiotic administration [3]. Unfortunately,
role in delaying of wound healing, namely vascular diabetic foot ulcer sometimes occurs in elderly
insuf-ficiency, chronic disease like diabetes, renal patient which have impairment in most of body
disease, local pressure and advanced age [1]. function. The management of diabetic foot ulcer
Approximately 15 - 25% DM patients will particularly focused on lower limb amputation
undergo diabetic foot ulcer, with the most prevention [5]. Recent therapies developed, such
frightening complication was amputation [2]. as negative pressure therapy, hyperbaric oxygen
Despite current clinical care protocols for ulcer therapy, and growth factors therapy, had limited
treatment have been developed, an amputation rate success.
remained high. Hence, there is an urgent need for Tissue engineering has developed new
new intervention [3]. strategy for diabetic wound repairment. Cell based
Delayed or non-healed wound in diabetes therapy offered a new treatment strategy to cure
mellitus resulted from dysregulation of the normal non-healed diabetic wound, and prevent
healings process. The diabetic wound was amputation. [3]. Stem cells therapy have been
complex, that usually associated with infection, issued successfully, to treat both chronic and acute
Page | 428
PROCEEDINGS
wounds [1]. Basic science and cinical studies had ulcer on her right foot . There was no
showed that these therapies provided a improvement on her ulcer, and worsen since 4
comprehensive solution by addressing multiple months before. On physical examination, we found
factors (cell proliferation, extracellular matrix an ulcer with eight like shaped on the dorsal side,
synthesis, growth factor release, and untill interdigital space III-IV on the distal plantar
vascularization) during wound healing process [4]. of the right foot. The size of the ulcer was 10 cm
Application of stem cell was promising as lenght, 3 cm width, and 1 cm depth. There was
treatment for diabetic foot ulcer [4]. sign of soft tissue infection without bone
Stem cells are considered the master cells, involvement. Soft tissue infection marked by
capable of both self-renewal and multi-lineage hyperaemia, discoloration of the foot, swelling,
differentiation. Stem cells have ability to and fragrant odorand pus production from the
regenerate, forming cells and constituent body ulcer. Surgeon at the previous hospital planned
tissue of organism [6,7]. Stem cell obtained from foot amputation, to prevent infection extension
embryonal cells or human body tissues isolation. and further tissue death, which threatened patient‘s
Tissue stem cell especially MNC cell, obtained life. The patient refused foot amputation. Patient
from solid tissue (skin) and liquid tissue (bone has controlled type-2 diabetes mellitus with routine
marrow aspiration and blood) isolation [8]. oral hypoglycaemic drug consumption. The patient
The objective of this study was to evaluate had no history of heart disease and peripheral
MNC stem cells therapy usefulness on non- arterial disease (PAD).
healed diabetic foot ulcer patient. The patient had knowingly signed informed
consent. The procedure consists of patient‘s
2. Methods peripheral blood collection, MNC isolation, wound
toilet, MNC application topically and performed
In this case, we administrated suspension of wound dressing. The evaluation was performed
autologous peripheral blood mononuclear stem weekly for 8 weeks. Totally we applied five times
cells (MNC) on end-stage diabetic wound. peripheral blood MNC into the wound, with
Suspension applied topically on the wound every various cell counts, and viabilities (Table 1).
1-2 weeks. Patient also received oral antidiabetic and oral
antibiotic, and also antibiotic injection when
Patients details necessary.
We treated a 47 years old woman who
suffered type-2 Diabetes Melitus for 12 years. She
Table 1. Characteristic of MNC cell

No Administration Cell count (106) Viability (%)
1 I 33 91.6
2 II 46 90
3 III 88 92
4 IV 40 92
5 V 37.9 97
Collection of patient’s peripheral blood only mononuclear cells (MNC) were collected.
The MNC cell amount and viability was checked.
Blood was collected from patient, about 50
ml. The donor had knowingly signed informed Wound toilet
consent before the procedure held.
Regular wound care was done before and
Isolation of MNC after every MNC administration. The wound
cleaned before administration normal saline (NaCl
Blood specimens from peripheral blood, 0.9%), and H2O2 solution and / or povidone
were diluted with PBS + KCl solution, filtrated iodine dressing occasionally. Any necrotic and
with Ficoll and centrifuged. Buffy coat layers were potential infection tissue were removed, to ensure
taken and washed, then supernatant was removed, the wound free from infection.
Page | 429
PROCEEDINGS
Topical Administration of MNC

MNC stem cell are instilled topically on the
ulcer. Three ml syringe and 22G needle are used to
deliver the stem cell by dripping liquid filled cell
to the entire surface of the wound. Liquid cell also
added to mixed dressing solution.
Wound Dressing
After the wound cleansing and MNC stem
cells administration, the wound was dressed with a
gauze dressing, impregnated with the antibiotic
framycetin sulphate (sofra-tulle), honey, antibiotic
solution and finally covered with sterile gauze.
Wound was left closed in order to maintain the
wound moisture and dressing were changed every
week. All procedure was done by orthopaedic
surgeon.
Figure 1. Comparison of ulcer before and after MNC
Evaluation therapy. A and B: before MNC therapy; C and D:
after two months of MNC therapy.
Evaluation of treatment was done weekly,
treatment is marked with some sign such as:
1. Healing and decrease in the ulcer size
2. Present of fresh granulation tissue
3. No sign of further infection
4. No sign of further indication for any surgical
treatment especially amputation

The result was very satisfying. The wound
improved progressively week by week and healed
completely after 60 days. The improvement of the
wound marked by the absent of soft tissue
infection, narrowing wound size, present of
granulation tissue, and closure of the wound
exactly. The surgical intervention such as surgical
debridement, skin graft, even amputation, was not
necessary in this case. The early appearance of the
wound indicated for amputation, due to wide skin
loss and marked infection. But until the end of
wound care, no amputation was done. This proved
that MNC stem cell therapy healed severe diabetic
foot ulcer and prevent amputation. During two
months of treatment, we did not found any adverse
effect, allergic reaction, related to stem cell Figure 2. Wound healing progress. A. The wound
administration. The following pictures and table appearance before stem cell administration. B. After
showed the course of disease during stem cell 1st MNC administration. C. After 2nd
administration, related to parameters evaluation administration. D. After 3rd administration. E.
After 4th administration. F. After 5th administration
(Figure 1, 2, Table 2).
or 2 months of treatment, the ulcer is completely
recovered.
Page | 430
PROCEEDINGS
Table 2. Course of Wound Healing During MNC Cell Administration Related to Parameter Evaluation
Healing/ decrease ulcer

Time Granulation tissue Infection Surgical indication
size
0 day (-) (-) (+) (+)
6 days (-) (-) (+) (+)
9 days (-) (+) (-) (-)
23 (+) (+) (-) (-)
days
30 (+) (+) (-) (-)
days
37 (+) (+) (-) (-)
days
44 (+) (+) (-) (-)
days
58 (+) (-) (-) (-)
days
Our result is in line with recent study. In Ruiz-Salmeron et al. [10] performed intra-arterial
our result the healing time is shorter than two autologous MNC transplantation in 20 diabetic
others. Many recent study showed that MNC stem patients with peripheral artery disease. After 3 to
cell therapy is promising in diabetic wound 12 months, all patients exhibited clinical
recovery (Table 3). Kirana et al. [9] in their improvement with a significant vascular network
randomized clinical controlled trial on 30 diabetic escalation.
patients, conclude that MNC cells improved the
microcirculation and supported wound healing.
Table 3. Comparison Between Study of Autologous MNC Stem Cell for Diabetic Foot Ulcer
Author Average Healing

Source
Type of number Route of time
s of Subject Result
study of cells Application
MNC 6
(10 )
Kirana et RCT BM 30 + 306.8 I.m.gastrocn 10 - 13
wound
al. PAD emius months
healed
Ruiz- Prospectiv BM 20 + 266.2 Intra-arterial 3 – 12
Wound healed
Salmeron e PAD months
+ increase
vascular
network
Basuki Case study PB 1 50 Topical 2 months wound
healed
Note: RCT: Randomized Controlled Trial; BM: bone Marrow, PB: Peripheral Blood, PAD: Peripheral
Arterial Disease; i.m: intramuscular.
Page | 431
PROCEEDINGS
There is similarity and also diversity among 4. Conclusion

their study. Three studies above use the same
autologous MNC, but derived from different In this case we proved that administration
sources. Two studies utilized bone marrow of autologous PB MNC stem cells can healed
aspiration, whereas our study utilized MNC from diabetic foot ulcer without operation.
peripheral blood. This is reflected in the number of
cells produced, BM aspiration produced more MNC Acknowledgement
cells. However, it does not take the PB MNC
inferior although cell number is fewer, but wound We thank Ns. Latifah, Mr. Muhammad
healing time of PB MNC in our study is shorter than Faiz, Mrs. Andri Pramesyanti for technical
bone marrow. Possible reason is no PAD support.
complication in our patient.
Many study on peripheral blood MNC References
therapy have been published but the mechanism
remains debatable. Some studies proposed about [1] N. Ojeh. I. Pastar. M.T. Canic. O.
elevated expression of angiogenic growth factors, Stojadinovic. Int. J. Mol. Sci 16 (2015).
others suggest that MNC cells suppressed
inflammation. One explained about biological [2] Z. Liu. O. Velazquez. Mary. Ann. Lie
mechanism in which that progenitor cells circulate in 10(2008) 11.
the blood and differentiate into cells or tissues. PB
MNC contains a various multipotent progenitor cell, [3] A. O‘Loughlin. T. O‘Brien in: A.
potential to differentiate into various tissue cell such Gholamrezanezhad (Ed). Stem Cells in Clinic
as blood cells, muscle cells, epithelial cells, neural and Research. InTech. Rijeka. 2011.
cells, or fibroblast under appropriate conditions [4,
11]. Colecting sources MNC cells from PB is easier [4] M. Yang. L. Sheng. T. R. Zhang. Q. Li.
than BM, the collection is not invasive and Biomed. Res. Int (2013).
comfortable for patients. Patient should not undergo
any operative procedure like bone marrow aspiration [5] N. M. Schaeffer. J . Art-case 111 (2004) 2.
collection [11]. So PB MNC is promising therapy
for unhealed diabeltic foot ulcer. [6] S. Sell. In: S. Sell (Ed). Stem Cells
Stem cells research still developing, to full-fill Handbook. Humana Press Inc. New Jersey.
blank notes in stem cells aplication. The aplication 2004.
of PB MNC seems to show bright spot, likely in this
case report however, many question still haunted the [7] C. Ming. M. Przyborowski. F. Berthiosme.
usefulness of stem cell therapy. Several questions PMC (2009).
namely the characteristics of donor, collecting the
the sources, isolation method, characterists of cells, [8] B. Supartono. Dissertations. Faculty of
the effective dose, and the parameter evaluatios. Medicine. Universitas Indonesia. Indonesia.
And also the role of each related factors such as 2013.
blood sugar level, vascular patency, level of
infection etc. All of these should be considered as [9] S. Kirana. B. Stratman. C. Prante. W.
interrelated factors in the succesfull of the therapy. Prohaska. H. Koerperich. D. Lammers. M. H.
Therefore, more advanced basic and clinical trials Gastens. T. Quast. M. Negrean. D. A.
are required in order to explore the efficacy, and Stirban. S. G. Nandrean. C. Gotting. P.
safety of MNC stem cells therapy for diabetic foot Minartz. K. Kleesiek. D. T. Schoepe. The.
ulcer. Int. J. of. Clin. Pract 4 (2012) 66.
[10] R. Ruiz-Salmeron. A. Cuesta-Diaz. M.

Constantino-Bermejo. I. Perez-Camacho. F.
Marcoz-Sanchez. A. Hmadca. B. Soria. J.
Cell. Trans (2011).
[11] M. Zhang. B. Huang. J. Stem Cell. Res. Ther

3 (2012) 48.
Page | 432
PROCEEDINGS
THE EXPRESSION ANALYSIS OF TGF-Β1. IGF. AND FGF

ON SUPERFICIAL AND DEEP OSTEOCHONDRAL DEFECTS OF
KNEE JOINT IN SPRAGUE DAWLEY RATS (PRELIMINARY
STUDY)
Basuki Supartono1.2
1
Orthopedic Department, National Sport Hospital of Indonesia, Jalan Jambore Raya No.1,
Cibubur, Jakarta, 13720, Indonesia
2
Stem Cell Research and Tissue Engineering Center, University of Pembangunan Nasional "
Veteran" Jakarta, Jalan RS Fatmawati, Pondok Labu, Jakarta, 12450, Indonesia
E-mail: drbasuki@gmail.com
Abstract
The growth factor is one of the elements that contribute to healing and regeneration of osteochondral
defects in knee joint. Stem cell work together with growth factors to produce tissue regeneration. The
timing of growth factor expression is very important to determine the timing of observation, during stem
cell intervention in osteochondral defect. Here, we showed that TGF-β1, IGF and FGF expressed on
chondrocyte cells in osteochondral defect of Sprague Dawley rats temporally. Early expression was
observed after 7 days post defect, and disappeared on day 28th . Macroscopic examination exhibit
improvement on day 7. The morphogical improvement stayed until day 28th post defect. Taken together,
the osteochondral defect induced the expression of TGF-β1, IGF, and FGF temporarily.
Keywords: Growth factors. TGF-β1. IGF. FGF. chondrocyte cells
1. Introduction intervention stem cell therapy, the release time of

growth factors on the mechanical stimulation like
Signal molecules were one of the factors that osteochondral defect, was very important. The
triggered the cell response and the production of stem cell intervention that accompanied by the
extra-cellular matrices hyaline cartilage. The signal release of growth factors on appropriate time,
molecules can be growth factors like TGF-β1, initiated regeneration of cells. The objective of our
IGF-1, FGF, BMP [1-6] or mechanical study was to observe the timing of growth factor
stimulation[2]. TGF-β1repaired cartilage, and expression during cell regeneration in
triggered chondrogenesis [4]. TGF-β1 receptor osteochondral defect of the knee joint.
was large quantities found in chondrocyte and
cartilage [7]. IGF-1 played a role in the 2. Methods
proliferation and cartilage formation. Together,
IGF-1 and TGF-β1 triggered chondrogenesis Rats and study design
sinergically [1]. FGF induced cell regeneration, Using an animal model, we examined the
chondrocytes proliferation and cartilage formation expression of growth factors in knee osteochondral
[7]. defect. Two male and two female non-engineered
Research showed that mechanical stimulation SD rats were purchased from Indonesian Food and
triggered the differentiation of progenitor cells, Drug Administration, Jakarta. Rats at 11 weeks of
albeit without the help of growth factors external
addition [8-9].This is because the mechanical Animal Laboratory at Research and Health Care
stimulation triggered the release of growth factors Development Center, Indonesian Ministry of
internally, that served to regenerate cells. In the Health, Jakarta and undergone adaptation with
Page | 433
PROCEEDINGS
twelve-hour lighting cycle and free access to food observe the repair tissue of the defect, then
and tap water. Each rat was manipulated with two documented using Olympus SLR E-620 The
defects including superficial defect in proximal macroscopic evaluation used a macroscopic score
trochlear and deep defect in distal trochlear region according to Nishimori‘s modification [12].
in the right knee joint at one time (Figure. 1).
Establishment two defects in one knee has been Microscopic evaluation, histology,and
done to minimize the number of rats being used immunohistochemistry (TGF-β1,
and to minimize the operating procedures which
IGF,and FGF) examination
are painful to the experimental animals.These were
consistent with the ethical principle for animal To confirm regeneration tissue of the defect and
experiment[10]. The preliminary study of defect expression of growth factors we performed
modeling showed that osteochondral defect model histology and immunohistochemistry examination.
with two types of defect (superficial and deep Specimens at day 1, 7 and 28, were fixed with 4 %
defect) can be made on one trochlear of rat without paraformaldehyde and 70 % alcohol alternatively
damaging the bone, deformity formation, pain and for 24 hours at 4 ○C, decalcified with Plank
death (data not shown). Superficial defect was &Rychlo for 10 days, dehydrated with alcohol
produced by drilling right trochlear with 1 mm th
stopper end which had 1.1 mm diameter (30% thick slices and stained with Hematoxylin and
trochlear width). The depth of superficial defect Eosin (HE), TGF-β1, IGF, and FGF staining [13].
was created according to the reference [11]. Deep The miscroscopic evaluation score was performed
defect was produced by drilling superficial defect according to Pineda‘s modification [14]..
with 0.8 mm K wire until it reached subchondral The specimens used for
bone. Then, the knee joints were irrigated with immunohistochemistry TGF-β1, IGF, and FGF
saline solution. After the surgery, rats were
examinations were deparaffinized, rehydrated with
returned to their cages and could move freely. The
running water, and washed in aqua. Then each
rats were fed as needed and received paracetamol
slides incubated in a sequence with protein blocker
300 mg/kg bodyweight and amoxicillin at 150
(BIOCARE‘s Background Sniper solution from
mg/kg body weight subcutaneously for 5 days.Rats
BIOCARE Medical, combined with normal horse
were randomexecuted on day 1, 7 and 28.
serum), and only one antibody, anti rat TGF-β1
Treatment with superficial defect and deep defect
antibody (Abcam), anti rat IGF antibody (Abcam),
were given in all rats on day 0. Macroscopic and
anti rat FGF antibody (Abcam)), BIOCARE‘s
microscopic evaluations performed.
Trekkie Universal Link solution (Starr Trek
Animal care and use statement Universal HRP Detection System from BIOCARE
All procedures had been approved by Medical), and BIOCARE‘s TrekAvidin-HRP
Animal Care and Use Committee (ACUC) Bimana (Starr Trek Universal HRP Detection System from
the Ethical Committee Centre for Non-human BIOCARE Medical). After incubations, the
Primate, Bogor Agricultural University, Number specimens were washed with PBS and diamino
R.03-12-IR. The procedures involving animal benzidine (DAB) solution, then counterstained
model SD rats in this study were conducted strictly with hematoxylin. For the last procedures, the
based on the recommendation in the Guide for the specimens were washed again with aqua,
Care and Use of Laboratory Animals of the dehydrated, cleared and mounted. Qualitative and
National Institutes of Health[10]. All surgery was quantitative examinations were performed using a
performed concordance with surgery in human light microscope and microphotography tools.
which is sterile and aseptic. Anesthetic has been
done using ketamine and xylazine in anesthetic 3. Results and Discussion
dose. The euthanasia was performed at the end of
the study, using pentobarbital lethal dose. All General condition of the animals
procedures involving animal model were
conducted under supervision of a veterinarian and There were no ill, deformed or dead rats,
were made to minimize suffering from surgery. until the end of study. The rats walked, climbed,
eat, drink and moved as usual. The rat‘s weight
Macroscopic evaluation decreased non significantly on day 7, and regained
Each defect was examined macroscopically in on day 21 (Figure 1).
day 1, 7 and 28. Rats were sacrificed by
euthanized with pentobarbital intraperitoneally.
We performed morphological evaluation to
Page | 434
PROCEEDINGS
Figure 2. Deep defect and superficial defect

model of Sprague Dawley Rats.
Figure 1. Rat’s weight mean. Note:

(A) Day 1: The superficial defect demonstrated no
Macroscopic evaluation bleeding. The deep defect demonstrates bleeding
(yellowarrow). No bone destruction. (B) Day 7: Surface
defects and defect area boundary were the same as day
Scoring and macroscopic examination
1. (C) Day 28: Surface defects covered by transparent
successfully performed on all defects on days 1, 7,
layer boundary defects began to faint.
28. There were no signs of infection and allergies
in all defect. Surface and boundary defects were
There was no different between margin
changed. Superficial defects surface was changed
defect score of superficial defect and margin defect
until day 28, while the deep defects surface
score of deep defect. Macroscopis score from male
unchanged on day 28. Superficial defect surface
rat and female rat were the same on day 7 and 28.
covered with a transparent layer. Superficial and
(Tabel 1).
deep defect margin changed on day 7 and 28
(Figure 2).
Table 1. Macroscopic Scores of Superficial Defect and Deep Defect on Day 1. 7 and 28
Time Day 1 Day 7 Day 28

M F M F M F
Superficial defect
Sign of infection 0 0 0 0 0 0
Sign of allergy 0 0 0 0 0 0
Defect surface 3 3 3 3 2 2
Defect margin 3 3 2 2 2 2
Total 6 6 5 5 4 4
Deep defect
Sign of infection 0 0 0 0 0 0
Sign of allergy 0 0 0 0 0 0
Defect surface 3 3 3 3 3 3
Defect margin 3 3 2 2 2 2
Total 6 6 5 5 5 5
Note : infection (no=0, yes=1), allergy (no=0, yes=1), surface (normal=0, whittish layer=1, transparent=2, not
covered=3), margin (cannot differentiated=0, difficult to differentiated=1, easy to differentiated=2, clearly
differentiated=3). M = Male, F = Female.
Page | 435
PROCEEDINGS
Microscopic evaluation Superficial defect Deep defect
HE staining was successfully performed

days 1, 7 and 28. Staining was successfully
illustrate the shape and regenerated tissue tissue of
the defects(Figure 3).
Superficial defect Deep defect
Figure 4. TGF-β1 immunohistochemistry

staining of rat osteochondral defect on day 1, 7
and 28.
Note:
(A-B) Day 1 : There is no sign of TGF-β1.
Chondrocyte cell did not absorbed brown staining
(blue arrow) on superficial defect and deep defect.
(C-D) Day 7 :. Chondrocyte cell absorbed brown
staining (black arrow) on superficial defect and
deep defect.
(E-F) Day 28 : The expression of TGF-β1
dissapeared. Chondrocyte cell did not absorbed
brown staining (blue arrow) on superficial defect
Figure 3. Microscopic HE staining images of and deep defect. Magnification = 100 x.
rat osteochondral defect on day 1, 7 and 28.
Superficial defect Deep defect
Note:
(A-B) Day 1: Neither superficial defect or deep
defect were filled with regenerated tissue. (C-D)
Day 7 : Superficial defect and deep defect were
begin to fill with regerenared tissue. (E-F) Day 28
: Superficial defect and deep defect were filled
with fibrous tissue. N = Normal tissue. R =
Regenerated. TissueBar = 0.1 mm.
Expression of growth factor evaluation

Immunohistochemical staining to analysis
the growth factor TGF-β1, IGF and FGF
expression, successfully carried out day 1, 7, and
28. Growth factor expression was observed in Figure 5. IGF immunohistochemistry staining
chondrocyte cells on cartilage defects, the of rat osteochondral defect on day 1, 7 and 28
expression began appeared on the day 7 and
disappeared on from to day28 (Figure 4-6). Note:
(A-B) Day 1 : There is no sign of IGF.
(C-D) Day 7 :. Chondrocyte cell absorbed brown
staining (black arrow) on superficial defect and
deep defect.
(E-F) Day 28 : The expression of IGF dissapeared.
Magnification = 100 x.
Page | 436
PROCEEDINGS
proliferation reduction, in line with the need of

extracellular matrix proteoglycans formation [16].
4. Conclusions
The study proved the expression of growth

factors TGF-β1, IGF and FGF in line with
regeneration tissue of the osteokondral defect of
knee joints in SD rat.
Acknowlegment
We thank Prof. Sarwono Waspadji for his
invaluable help. We thank Mrs.Diah Iskandriati for
facility support and immunohistochemistry. We
thank Ns. Latifah, Mr.Muhammad Faiz, Mrs.Andri
Pramono for technical support.
References
Figure 6. FGF immunohistochemistry staining
of rat osteochondral defect on day 1. 7 and 28
[1] Khan, W.S.,D.S. Johnson, T.E.
Note: Hardingham,Knee17(2010) 369-374.
(A-B) Day 1 : There is no sign of FGF. Chondrocyte cell
did not absorbed brown staining (blue arrow) on [2] Kim BS, Park KI, Hosiba T, et al, J
superficial defect and deep defect. (C-D) Day 7 :. Progpolymsci. 36 (2011) 238-68.
Chondrocyte cell absorbed brown staining (black arrow)
on superficial defect and deep defect. (E-F) Day 28 : [3] Han Y, Wei Y, Wang S, Song Y, JBSpin.77
The expression of FGF dissapeared. Chondrocyte cell (2010) 27-31.
did not absorbed brown staining (blue arrow) on
superficial defect and deep defect. Magnification = 100 [4] Chiang H, Jiang CC, J. Formos Med Assoc. 108
x.
(2009) 87-101.
Macroscopic scores began to decline on the
7th day and decreased on day 28. The macroscopic [5] Haleem, AM, Chu CR, Optechorthopaedics. 20
score changes showed morphological changes (2010) 76-89.
from time to time. The macroscopic score showed
[6] Bessa PC, Cerqueira MT, Rada, et al, Protein
that tissue repairment or regeneration process,
Expr Purif 63 (2009) 89-94.
started from the 7th day. This is in line with the
expression of TGF-β1, IGF, and FGF which
[7] Doll BA, Einhorn TA, Hollinger JO, Sfeir C,
occurred on day 7, and ends on day 28. This is also
Bone tissue engineering, http://www.scribd.com
consistent with the microscopic data, which
/doc/51217314/11/Signaling-Molecules-for-
showed fibrous tissue formation in the defect. This
Tissue-Engineering.
fact occurred in male and female rats. This showed
that rat‘s knee had internal ability repairment,
[8] Burdick JA, Novakovic GV, Tissue Eng Part A.
when knee‘s tissue defect was occurred. 15 (2009) 205-219.
These results indicate that the growth factor
has a temporary expression. Temporary expression [9] Orr AW, Helmke BP, Blackman BR, Schwartz
of growth factor occured because cartilage tissue MA, Dev. Cell. 10 (2006) 11-20.
were damage . When cartilage damage, a lot of
chondrocyte cell died. Cell proliferation and [10] Institute of Medicine. Guide for the Care and
regeneration occured 7 after the the tissue Use of Laboratory Animals, 8th edition. 2011.
damage [15]. The growth factors induced the http://www.ncbi.nlm.nih.gov/books/NBK54050
chondrocyte proliferation [1,3-5,7]. After weeks
later, chondrocyte proliferation decreased and at
the end dissapeared [15]. Chondrocyte
Page | 437
PROCEEDINGS
[11] Shinomiya, R., M. Ochi, N. Adachi, H. [14] Pineda, S.,A. Pollack, S. Stevenson, V.
Hachisuka, K. Natsu& Y. Yasunaga, Goldberg& A. Caplan. ActaAnat (Basel)143
ActaOrthop 75 (2005) 920-926. (1992) 335-340.
[12] Nishimori, M.,M. Deie, A. Kanaya, H. Exham, [15] Schulz RM, Bader A, EurBiophys J. 36 (2007)
N. Adachi& M. Ochi, J Bone Joint Surg Br.88 539-568.
(2006) 1236-1244.
[16] Bos PK, Van Osch GJVM, Frenz DA, Verhaar
[13] Hewitt, S.M.,F.A. Lewis, Y. Cao, et al., Arch JAN, Verhoef HLV, OARSI 9 (2001) 382-389.
Pathol Lab Med.132 (2008) 1929-1935.
Page | 438
PROCEEDINGS
GENE CLONING ENCODING OMP 31-SOD PROTEINS OF

BRUCELLA INTO pPIC9K VECTOR USING ESCHERICHIA COLI
HOST SYSTEM
Arizah Kusumawati1, Sri Kartika Wijaya1, Ulfatul Husnaa1, Yana Rubiyana1, Adi
Santoso1
1
Indonesian Institute of Sciences (LIPI), Cibinong, Kabupaten Bogor, Jawa Barat 16911
E-mail: ariz001@lipi.go.id
Abstract
The study on Brucella outer membrane proteins (OMPs) and its intracellular components confirms the
presence of some protective antigens that have immunogenic activity and potential to be developed as
recombinant vaccines. Recently, recombinant vaccine to combat brucellosis is under ongoing research
and has not yet commercially available. The major aim of this study is construction of OMP31-SOD
recombinant fusion proteins. The synthetic gene of OMP31-SOD (1275 bp) was ligated to pPIC9K linier
vector (9294 bp) and followed by transformation into Escherichia coli Top10F' competent cell using heat
shock. The transformation results were grown on LB plate medium that contain ampicillin as antibiotic
selection. Many positive transformants were observed. Verification on positive transformants to verify the
presence of recombinant plasmid inside the cell host was done through miniprep technique then followed
by restriction analysis. Gene cloning of OMP31-SOD in E. coli Top10F' has been successfully carried out
and the clones that were containing recombinant plasmid pPIC9K+OMP31-SOD (10.569 bp) were
obtained. These results will be used as preliminary results of the future approach to obtain the OMP31-
SOD vaccine candidates.
Keywords: Brucella sp., OMP31, SOD, pPIC9K, Escherichia coli.
1. Introduction melitensisRev1, B. abortus S19 dan B. abortus

RB51. However, live attenuated vaccine has major
Brucellosis is infection disease caused by drawbacks, such as its side effects, low efficacy,
gram-negative pathogen bacteria, which is low quality diagnosis, and causing abortion to
commonly known as Brucella sp. The Brucella pregnant cattle (Yang et al., 2005). On the other
infection spread out worldwide, in some cases are hand, killed vaccine, which is developed from
zoonotic to human. Brucella sp. has wide range of strain B. melitensis H38, is found less effective in
hosts, which are sheep and goat (B.melitensis), inducing immune response compared to live
cow (B. abortus), swine (B. suis), rat (B. attenuated vaccine (Cassataro et al., 2005).
neotomae), goat (B. ovis), dog (B. canis) (Franco et Furthermore, the use of killed vaccine was
al., 2007; Delpino et al., 2007). Among those restricted due to local lesion caused by killed
Brucella species, four of them (B. melitensis, B. vaccine injection (Guilloteau et al., 1999). Thus,
abortus, B. suis, and B. canis) are found to cause the needs of saver and highly effective
infection to human (Cloeckaert et al., 2001). After recombinant vaccine become ultimate in the
all, it is well noted that Brucella infection prevention of brucellosis infection.
contributes to economic loss to farmers due to its Brucella species has many outer membrane
effect on livestock‘s abortion, infertility and proteins and intracellular components that already
premature birth (Sauret dan Vilissova 2002). well characterized recently. Some of them are
Recently, Brucella infection is controlled recognized as protective antigens that are
through live attenuated and killed vaccines. Live immunogenic and valuable to be developed as
attenuated vaccine is developed from B. recombinant vaccine, i.e ribosomal L7/L12
Page | 439
PROCEEDINGS
proteins (Oliveira and Splitter, 1994; Luo et al., into host Escherichia coli Top10F' was carried out
2006), Cu-Zn superoxide dismutase/SOD (Onate by mixing 15 µl of ligation product and 100 µl of
et al., 2003; Gee et al., 2005: Piddington et al., E. coli Top10F' competent cells. The
2001), sitoplasm p39 protein (Al-Mariri et al., transformation mix was transformed using heat
2001), lumazine synthase (Velikovsky et al., shock methods for 42ᵒC 90 seconds, then followed
2003), GroEL & GroES (Oliveira et al., 1996), and by incubation at 37ᵒC 200rpm after addition of
YaJC (Vemulapalli et al., 2000). There are also 400µl sterile liquid LB media. Transformation
some well-known major outer membrane proteins productswere grown on solid LB media, with
(OMPs) includes the Omp25 (25-27 kDa), Omp2b ampicillin (100 μg/mL) as antibiotic selection.
(36-38 kDa) dan Omp31 (31-34 kDa) (Cloeckaert Sample was spreaded on solid LB in 20 µl, 50 µl,
et al., 2002).The OMP31 protein is a conserved 80 µl and 350 µl. Negative control was prepared
protein on B. abortus, B. melitensis, and B. suis using empty competent cells.
strains and pathogenic to human (He dan Ziang First line selection of positive transformants
2010). On the other hand, the Cu-Znsuperoxide was on solid LB containing ampicillin. The
dismutase (SOD) protein is one of Brucella successfull clone which grew on the solid LB
abortus strain 2308 component, which is situated plates represent successfull transformation, which
in the periplasm. The SOD rules its function as a means that every single clone was carrying the
bacteria protector of oxidative killing and the recombinant plasmid so does resistant to
macrophage respiratory burst, so does the bacteria ampicillin. Further verification was taken through
manage to survive inside the macrophage (Gee et plasmid isolation using high speed plasmid mini
al., 2005). This research will focus on construction kit (Geneaid and restriction analysis using the
of fusion gene OMP31-SOD into pPIC9K vector cutting enzymes (EcoRI dan XbaI). Visualization
as vaccine candidate against brucellosis infection. of captured DNA from plasmid isolation and
The OMP31 and SOD proteins were fused to digestion enzyme was seen on 1% agarose gel. The
obtain higher immune response, thus will gives chosen transformants were then sequenced with α-
protection to livestock. factor foward and AOX1 reverse primers.
2. Methods 3. Results and Discussions
The genes for OMP31 and SOD protein were The OMP31-SOD genes were manufactured
obtained through artificial gene synthesis by IDT, 1st base company in attachment with
manufactured by IDT, 1st base company. We used pIDT vector. The decision to order a synthetic
Escherichia coli Top10F' host, pPIC9K vector gene of OMP31-SOD was based on its difficult
(Invitrogen), EcoR1 and Not1 restriction enzymes, handling, which need to be processed in Biosafety
T4 DNA polymerase enzyme, T4 DNA polimerase room level 3 (Perkins et al., 2010; Avila-Calderón
and H buffers along with agarose gel DNA et al., 2013). The synthetic gene‘s arrangement
extraction kit (Roche), high speed plasmid mini kit was set to have OMP31 gene at the –N terminal
(Geneaid) to conduct the cloning. Furthermore, followed by G4S linker then ended with SOD – 6X
additional reagents such as ampicillin, agarose, His – stop codon. Two restriction enzymes, EcoR1
1kb DNA marker, DNA loading buffer, TAE, and Not1 were placed at the –N and –C terminal
ddH2O and nuclease free water were also required respectively. The OMP31-SOD gene were
during cloning and assesment of the cloning optimized using online tools before expression in
product. Pichia pastoris to optimized protein expression.
First step on cloning method was carried out As previously explained, we had the
through restriction of pPIC9K vector and OMP31- synthetic gene (OMP31-SOD) attached into pIDT
SOD gene with EcoRI and NotI restriction vector from the manufacture. Thus, specific
enzymes. Restriction products were purified using restriction enzymes are needed to cut the gene.
agarose gel DNA extraction kit prior to ligation. We used EcoRI and NotI to cut at the –N of
The ligation process was done using T4 DNA OMP31-SOD gene was collected after enzymes
ligase enzyme, for overnight at 4ᵒC temperature. restriction. The insert gene was then ligated into
Ligation was performed in a total volume of 30 µl lineared pPICK9K vector (figure 1C) to build
contains 28 ng/µl of DNA insert and 88 ng/µl recombinant plasmid of pPIC9K+OMP31-SOD
vector. (figure 2).
The following step was transformation into
cell host. The transformation of ligation product
Page | 440
PROCEEDINGS
A . pIDT vector B. pIDT vector after digestion C. pPIC9K vector

with EcoRI dan NotI
Figure 1. The electrophoresis result of pPIC9K vector and pIDT+OMP31-SOD.
Figure 2. Plasmid mapping of pPIC9K+OMP31-SOD recombinant.
Ligation process was done at 4ᵒC temperature There were abundant transformant grew on
for overnight. Ligation results were transformed LB plates on the day-2 after transformation
into E. coli competent cells through heat shock process. Numerous clones grown on the LB
method for the ease, simple and its effective selection plates(Figure 3). The ligation products
results. Furthermore, the transformation products were shown to have efficient ligation process.
were grown on LB plates contain ampicillin About 5 transformants were randomly selected for
antibiotic selection. verification through plasmid isolation. The results
showed that all those 5 random selected clones
were carrying the plasmid target (data not shown)
Figure 4. The electrophoresis results of

restriction analysis pPIC9K + OMP31-SOD
recombinant plasmid cut EcoRI and XbaI.
(4ᵒC ligation overnight temperature) (M) Marker DNA 1 kb; (1) Clone 1; (2) Clone 2;
Figure 3. The transformant grown on LB plates (3) Clone 3; (4) Clone 4; (5) Clone 5;
containing ampicillin. (M) Marker DNA 1 kb.
Page | 441
PROCEEDINGS
Plasmid isolation results of 5 transformants OMP31-SOD will be prepared for biologic test as
(clone 1; clone 2; clone 3; clone 4; clone 5) were a vaccine candidate to combat brucellosis in
analysed with EcoRI dan XbaI enzymes then livestock.
followed by agarose DNA analysis to confirm the
presence of the gene of interest. The results were 4. Conclusion
shown on figure 4, the gene of interest was found
at 2079 bp (OMP31-SOD 1275 bp + 804 bp part of We succesfully conduct the cloning for
pPIC9K from NotI-XbaI), whereas pPIC9K vector OMP31-SOD of brucella into PICK9K vector in a
was found at 8490bp. Escherichia coli Top10F' as the host. As much as 5
We narrow down the samples by choosing 2 clones were recovered and selected to be isolated.
samples (clone 1and clone 5)to be processed with The isolatiotion results were processed further for
sequencing method as a final confirmation of restriction analysis using EcoRI dan NotI enymes.
succesful transformational cloning. Sequencing The sequencing analysis of 2 selected samples
method is a common and robust technique used to reveals that one mutation occured on 1 sample,
identify mutation which is sometimes happened while other 1 samples show a correct nucleotide
during the cloning, and also the possibility of sequence.
unwanted insersion and deletion at the –N and –C
terminal ends as connection sites between the gene Acknowledgements
of interest and the plasmid vector. The sequencing
The authors would like to thank the Kegiatan
results were analysed using Multalin and
Unggulan LIPI 2016 project financed by
authenticate 1 samples (clone 5) were having
Indonesian Institute of Sciences.
correct insertion while 1 sample (clone 1) was
found to have 1 point mutation at the at the very
end of –C terminal site (NotI restriction site) (data References
not shown).
E.coli TOP10F‘ cell host was seen to have a [1] Al-Mariri, A., A. Tibor, P. Mertens, X. De
good compatibility carrying the recombinant Bolle, P. Michel, J. Godefroid, K. Walravens,
plasmid pPIC9K+OMP31-SOD, which is shown J.J. Letesson. 2001. Protection of BALB/c
by the numerous clones seen on the LB selection mice against Brucella abortus 544 challenge
plates. E.coli TOP10F‘ host contains by vaccination with bacterioferritin or P39
recombination A gene (recA gene) and deficient on recombinant proteins with CpG
endonuklease A gene (endA gene). RecA gene is oligodeoxynucleotides as adjuvant. Infect.
well known for supporting homology Immun. 69:4816-4822.
recombination (Lusetti & Cox 2002) and cell [2] Avila-Calderón, E.D., A. Lopez-Merino, N.
division (Cox et al., 2008). RecA gene deficiency Sriranganathan, S.M. Boyle, A. Contreras-
will supress the bacterial growth, eventhough the Rodríguez, 2013. A history of the
presence of RecA deficient gives advantages in development of Brucella vaccines. Biomed
minimizing the non-specific recombination which Res Int.1-8.
can cause unwanted insertion or deletion on DNA
clone. Previous scientif journals had reported some [3] Borgi, I., and A. Gargouri. 2008. A
spontaneus deletion occured on plasmid pGEX- spontaneous direct repeat deletion in the
4T-1 vector which is then associated to the pGEX fusion vector decreases the expression
presence of Rec a gene (Borgi dan Gargouri, level of recombinant proteins in Escherichia
2008). Furthermore, the presence of lacI q gene will coli. Protein Expr Purif. 60(1):15-9.
help to control gene expression that potentially [4] Cassataro, J., C.A. Velikovsky, S. de la
toxic to the cell host. However, the facts that there Barrera, S.M. Estein, L. Bruno, R. Bowden,
was enermous clones grown on the LB plates had K.A. Pasquevich, C.A. Fossati, G.H.
show nto us that the inserted genes were not toxic Giambartolomei. 2005. A DNA vaccine
to the cell host. coding for the Brucella outer membrane
In the future, the recombinant plasmid will be protein 31 confers protection against B.
transformed into Pichia pastorisfor protein melitensis and B. ovis infection by eliciting a
expression. Pichia pastoris expression system was specific cytotoxic response. Infection and
chosen as an expression host due to its easeness on immunity. 73(10); 6537-46.
its genetic manipulation, robust growth, post-
translational modification and its ability to secrecy [5] Cloeckaert, A., J.M. Verger, M. Grayon, J.Y.
the protein prudoct to the culture media (Fickers, Paquet, B. Garin-Bastuji, G. Foster. 2001.
2014). As a final, purified recombinant protein of Classification of Brucella spp. isolated from
marine mammals by DNA polymorphism at
Page | 442
PROCEEDINGS
the omp2 locus. Microbes Infect. 3:729-38. 100.

[6] Cloeckaert, A., N. Vizcaino, J.Y. Paquet, [16] Mallick, A.I., H. Singha, S. Khan, T. Anwar,
R.A. Bowden, P.H. Elzer. 2002. Major outer M.A. Ansari. 2007. Escheriosome-mediated
membrane proteins of Brucella spp.: past, delivery of recombinant ribosomal L7/L12
present and future. Vet. Microbiol. 90:229- protein confers protection against murine
247. brucellosis. Vaccine. 25: 7873-7884.
[7] Cox, J.M., H. Li, E.A. Wood, S. Chitteni- [17] Moriyon, I., M.J. Grillo, D. Monreal, D.
Pattu, R.B. Inman, M.M. Cox. 2008. Gonzalez, C. Marin, I. Lopez-Goni, R.C.
Defective dissociation of a "slow" RecA Mainar-Jaime, E. Moreno, J.M. Blasco. 2004.
mutant protein imparts an Escherichia coli Rough vaccines in animal brucellosis:
growth defect. The Journal of biological structural and genetic basis and present
chemistry. 283(36):24909-24921 status. Vet Res. 35(1):1-38.
[8] Delpino, M.V., J. Cassataro, C.A. Fossati, [18] Onate, A. A., Cespedes, S., Cabrera, A.,
F.A. Goldbaum, P.C. Baldi. 2006. Brucella Rivers, R., Gonzalez, A., Munoz, C., . . .
Outer Membrane Protein Omp31 is a Andrews, E. (2003). A DNA vaccine
Haemin-binding Protein. Microbes Infect. 8: encoding Cu,Zn superoxide dismutase of
1203-1208. Brucella abortus induces protective immunity
in BALB/c mice. Infect Immun, 71(9), 4857-
[9] Franco, M.P., M. Mulder, R.H. Gilman, H.L.
4861.
Smits. 2007. Human brucellosis. Lancet
Infect Dis. 7:775-786. [19] Oliveira, S.C., J.S. Harms, M. Banai, G.A.
Splitter. 1996. Recombinant Brucella abortus
[10] Fickers P. 2014. Pichia pastoris: a workhorse
proteins that induce proliferation and gamma-
for recombinant protein production. Curr Res
interferon secretion by CD4+ T cells from
Microbiol Biotechnol. 2(3): 354-363
Brucella-vaccinated mice and delayed-type
[11] Gee, J.M., M.W. Valderas, M.E. Kovach, hypersensitivity in sensitized guinea pigs.
V.K. Grippe, G.T. Robertson, W.L. Ng, J.M. Cell. Immunol. 172:262-268.
Richardson, M.E. Winkler, and R.M. Roop.
[20] Perkins, S.D., S.J. Smither, H.S. Atkins.
2005. The Brucella abortus Cu,Zn
2010. Towards a Brucella vaccine for
Superoxide Dismutase Is Required for
humans. FEMS Microbiol Rev. 34:379-394.
Optimal Resistance to Oxidative Killing by
Murine Macrophages and Wild-Type [21] Piddington, Debra L., Fang, Ferric C.,
Virulence in Experimentally Infected Mice. Laessig, Tracey, Cooper, Andrea M., Orme,
Infect Immun. 73(5): 2873-80. Ian M., & Buchmeier, Nancy A. (2001).
Cu,Zn Superoxide Dismutase of
[12] Guilloteau, L.A., K. Laroucau, N. Vizcaino,
Mycobacterium tuberculosis Contributes to
I. Jacques, G. Dubray. 1999. Immunogenicity
Survival in Activated Macrophages That Are
of recombinant Escherichia coli expressing
Generating an Oxidative Burst. Infect Immun,
the omp31 gene of Brucella melitensis in
69(8), 4980-4987. doi:
BALB/c mice. Vaccine. 17:353-361.
10.1128/IAI.69.8.4980-4987.2001
[13] He Y., and Z. Xiang. 2010. Bioinformatics
[22] Rush, C., T. Mitchell, P. Garside. 2002.
analysis of Brucella vaccines and vaccine
Efficient priming of CD4+ and CD8+ T cells
targets using VIOLIN. Immunome Research.
by DNA vaccination depends on appropriate
6(1): 1-12.
targeting of sufficient levels of
[14] Luo, D, Ni, B, Li, P, Shi, W, Zhang, S, Han, immunologically relevant antigen to
Y, Mao, L, He, Y, Wu, Y & Wang, X 2006, appropriate processing pathways. J.
'Protective immunity elicited by a divalent Immunol. 169:4951-4960.
DNA vaccine encoding both the L7/L12 and
[23] Sauret, J.M., and N. Vilissova. 2002. Human
Omp16 genes of Brucella abortus in BALB/c
brucellosis. J. Am. Board Fam. Pract. 15:
mice', Infect Immun, vol. 74, no. 5, pp. 2734-
401-406.
41
[24] Velikovsky, C.A., F.A. Goldbaum, J.
[15] Lusetti, S.L., and M.M. Cox. 2002. The
Cassataro, S. Estein, R.A. Bowden, L. Bruno,
bacterial RecA protein and the
C.A. Fossati, G.H. Giambartolomei. 2003.
recombinational DNA repair of stalled
Brucella lumazine synthase elicits a mixed
replication forks. Annu Rev Biochem. 71:71-
Th1-Th2 immune response and reduces
Page | 443
PROCEEDINGS
infection in mice challenged with Brucella kilodalton outer membrane protein of

abortus 544 independently of the adjuvant Brucella abortus. Clin. Diagn. Lab Immunol.
formulation used. Infect. Immun. 71:5750- 7:114-118.
5755.
[26] Yang, X., M. Hudson, N. Walters, R.F.
[25] Vemulapalli, R.S., C.L. Cravero, T.E. Bargatze, D.W. Pascual. 2005. Selection of
Calvert, N. Toth, S.M. Sriranganathan, O.L. protective epitopes for Brucella melitensis by
Boyle, Rossetti, G.G. Schurig. 2000. DNA vaccination. Infect. Immun. 73: 7297-
Characterization of specific immune 7303.
responses of mice inoculated with
recombinant vaccinia virus expressing an 18-
Page | 444
PROCEEDINGS
ANTIBIOTIC SUSCEPTIBILITY EVALUATION OF BACILLUS

AMYLOLIQUEFACIENS ISOLATED FROM LOCAL PIG
GASTROINTESTINAL TRACT AS POTENTIALLY PROBIOTIC
CANDIDATE
Jap Lucy1, Johannes Nicolaus Wibisana1, Tan Steven Ryan Susanto1, and Reinhard Pinontoan1
1.
Department of Biology, Universitas Pelita Harapan, Jl. M.H. Thamrin Boulevard, Tangerang, 15811
E-mail: jap.lucy@uph.edu
Abstract
The downside of the application of antibiotics as growth promoters in livestock includes the domination
of spontaneous resistant mutants and bacteria that have acquired resistance from other bacteria by genetic
transfer. To attend to this problem, countries restrict the addition of several common antibiotics as growth
promoter in feed. The administration of probiotics is sought as a better alternative. However, potential
candidates for probiotics needs to be compatible to the livestock of interest and further evaluated for their
antibiotic susceptibility as to provide host protection. Four strains of Bacillus amyloliquefaciens isolated
from healthy local pig gastrointestinal tract are being evaluated for their antibiotic susceptibility.
Susceptibility test against 23 antibiotics, commonly added to feed or prescribed by physicians for
common illnesses, were conducted using disc diffusion method in Müller Hinton agar. Performance
Standards for Antimicrobial Susceptibility Testing (M100-S24) provided by Clinical and Laboratory
Standards Institute (CLSI) was used as reference breakpoints. All isolates demonstrated variations in
susceptibility against variation of antibiotics employed. However, they did not have any absolute
resistance against any of the antibiotic tested. In conclusion, Bacillus amyloliquefaciens isolates tested
could be of potent probiotics candidate to support growth of livestock.
Keywords: probiotics, antibiotic, Bacillus amyloliquefaciens, livestock, susceptible, resistance
1. Introduction accumulation of mutant pathogen with extensive

antibiotic resistance which may contaminate
As early as in the 1940s, the uses of products derived from those livestock and post risk
antibiotics in veterinary are not restricted to only to their consumers [6] . Therefore, alternatives to
protect livestock from pathogens but as growth replace the application of antibiotics as growth
enhancer as well [1-2] . These antibiotics were promoters need to be recognized.
either consciously added into feed or has been part Probiotics are live microorganisms which
of the feed given to the animals [3] . The effect is aid in the establishment of intestinal population.
achieved through the alteration of intestinal They are identified to be beneficial to the livestock
microbial population which in turn improves and hazard to pathogen. Probiotics in general
digestion along with absorption of feed and stimulate the improvement of immune system,
alleviating metabolism of nutrients [4-5] . provide competition to pathogens, increase the
The downside of the application of efficiency of feed and promote the production of
antibiotics in livestock includes the domination of favorable fatty acids [7] . Administration of
spontaneous resistant mutants and bacteria that probiotics in replacement of antibiotics to ensure
have acquired resistance from other bacteria by wellbeing of livestock yields promising outcome.
genetic transfer. Remaining residue of low dosage Prescription of probiotics to improve weight gain
antibiotics left unabsorbed by the intestinal wall in [8] , intestinal immune system and reduce post-
the long run will nurture the development of weaning diarrhea in pigs is proven to be effective
resistant microorganisms. This could give rise to [9] .
Page | 445
PROCEEDINGS
Several antibiotics commonly used as Disc diffusion method

growth promoter in pig feed include: tetracyclines,
beta-lactamase sensitive penicillins, Antimicrobial susceptibility was studied by
cephalosporins, quinolones, sulfonamides, employing the method as described by Liofilchem
macrolides, lincosamides, tiamulin and manual [14] with several modifications.
aminoglycosides [10-11] . Countries start to select Microorganisms from glycerol frozen stocks were
antibiotics to be used in livestock feed and banned sub cultured in nutrient agar at 37°C until single
the use of antibiotics that overlaps with those that colonies were seen. The Müller Hinton agar was
are commonly administered to human [12] . prepared on plates (90 mm in diameter) to
Without the use of growth promoting antibiotics, approximately uniform thickness. Suspensions
over-breeding of livestock to reach the levels of were adjusted to McFarland standards 0.5 and 100
production attained by the current practices or μl of the suspensions were disseminated on the
increase livestock production cost is necessary surface of the plates with swabs in one direction,
[13]. multiple times until the microorganisms are spread
Four isolates of Bacillus amyloliquefaciens evenly on the plate. Antibiotic discs were placed
obtained directly from local piglet gastrointestinal on the surface of the agar (4-6 discs in each plate)
track were evaluated as potential probiotics and the plates were incubated for 24 hours at 37°C.
candidate to be given to pig. It is important for The disc diffusion method was performed twice
probiotics candidates to be safe, beneficial and and means inhibition zones diameters were
able to withstand the nature of gastrointestinal measured after incubation was calculated.
tract.
Disc diffusion test were conducted to
ensure that these isolates do not contain tested
antibiotic resistance gene that can be transferred to
other commensals or pathogens to support their Disc Diffusion Method
growth.
Growth of the isolates observed in Müller
2. Methods Hinton agar was satisfactory for this study. The
growth on the agar was mostly considerably
Microorganisms and growth conditions regular and the halos were measurable.
There are currently no available antibiotic
The microorganisms used in this study were breakpoints standard for Bacillus
four isolates of Bacillus amyloliquefaciens (IS1.6, amyloliquefaciens, therefore susceptible range data
R12, KS1.8 and JA3.3) previously isolated from obtained from of other species listed in
local piglet gastrointestinal tract. Performance Standards for Antimicrobial
All the microorganisms were stored in Susceptibility Testing (M100-S24) [15] provided
glycerol at -30°C. Prior to the assays, the by Clinical and Laboratory Standards Institute
microorganisms were sub cultured in nutrient agar. (CLSI) and range of susceptibility and resistance
inhibition zone diameter were adopted for this test
Antimicrobial agents as breakpoints reference..
Susceptibility test against 23 antibiotics
were conducted. These antibiotics possess different
modes of actions. They are inhibitors of protein
synthesis (tiamulin, erythromycin, tylosin,
kanamycin, neomycin, streptomycin, gentamicin,
chloramphenicol, lincomycin, clindamycin, and
tetracycline), cell wall synthesis (amoxicillin,
ampicillin, vancomycin, methicillin, oxacillin,
cefoxitin), folic acid synthesis (sulfonamide), RNA
polymerase (rifampicin), DNA gyrase (nalidixic
acid, ofloxacin, ciprofloxacin), and cell wall and
protein synthesis (bacitracin) were used tested
against isolates. The drugs were in form of discs
from Liofilchem, Italy.
Page | 446
PROCEEDINGS
Table 1. Diameters of the inhibition zones obtained from four Bacillus amyloliquefaciens isolates
spread on Müller Hinton agar and tested with cell wall synthesis inhibition mode of
action antibiotics
Class Cell Wall Synthesis Inhibition
FOX (30
AML (20 μg) AMP (2 μg) VA (30 μg) MET (5 μg) OX (1 μg)
Strain μg)
JA3.3 30/34 32/32 24/27 32/32 24/24 41/44

R12 30/30 30/28 27/27 25/27 18/21 35/39
KS1.8 32/31 32/31 24/24 30/27 21/21 36/39
IS1.6 29/31 26/31 22/26 28/31 21/23 41/46
Susceptible
≥17-24 ≥17-24 ≥17 - ≥13-20 ≥18-28
Range
Resistance
13-18 13-18 14 - 10-17 14-24
Range
Results obtained from two readings. All measurements are taken in millimeters (mm). AML: amoxicillin;
AMP: ampicillin; VA: vancomycin; MET: methicillin; OX: oxacillin; FOX: cefoxitin. (-): no range available.
Methicillin resistance is a common problem All antibiotic disc (Cell Wall Synthesis
encountered when testing for S. aureus. CLSI Inhibition) selected produced inhibition zone on all
recommends the usage of cefoxitin when using the isolates beyond susceptible measurements of other
disk diffusion method to determine resistance species listed by CLSI.
against methicillin [16]. The recommended
resistance and susceptibility breakpoints for the 30
μg cefoxitin disk test used to detect mecA-
mediated resistance in S. aureus are ≤ 21 mm and
≥ 22 mm, respectively.
Table 2. Diameters of inhibition zones obtained from four Bacillus amyloliquefaciens isolates spread
on Müller Hinton agar and tested with protein synthesis inhibition mode of action antibiotics
Protein Synthesis Inhibition

Class
T E TE TY K S CN N C
MY CD
Strain (30μ (15μ (30μ (30μ (30μ (10μ (10μ (30μ (30μ
(2μg) (2μg)
g) g) g) g) g) g) g) g) g)
JA3.3 11/15 12/14 31/30 22/24 34/28 30/29 31/29 25/24 30/27 29/24 37/35
R12 15/15 13/13 30/29 23/21 21/20 28/27 31/28 26/23 26/26 26/25 35/32
KS1.8 13/15 14/15 30/29 23/22 21/21 28/29 27/29 18/22 28/26 30/25 31/32
IS1.6 13/13 15/15 28/30 23/23 30/32 26/28 30/27 22/22 25/28 24/25 33/34
[1
Susceptibl ≥15 ≥16- ≥21- ≥19- ≥15- ≥16- ≥18-
8] [17] ≥18 ≥15 ≥15 ≥16
e Range 19 23 21 38 19 29
Resistanc [18] 8- 13- 14- 11- 12-
9 [17] 8-11 13 11 12 13
e Range 11 15 15 30 25
Results obtained from two readings. All measurements are taken in millimeters (mm). MY: lincomycin. T:
tiamulin. E: erythromycin. CD: clindamycin. TE: tetracycline. TY: tylosin. K: kanamycin. S: streptomycin.
CN: gentamycin. N: neomycin. C: chloramphenicol. [17] :Jones et. al.. 2002; [18] : Bassiri. 2013.
Page | 447
PROCEEDINGS
Inhibitory disc diffusion of isolates the second measurement (14 mm and 13 mm,
exhibited intermediate state of resistance of all respectively). Tiamulin, tetracyclines, tylosin and
isolates against against tiamulin [17] (All lincomycin are commonly used in veterinary
measurements fell in the range of 12-15 mm, S: practice especially in swine [10, 19-20] .
≥16-19 mm, R: 8-11 mm) and lincomycin [18]. All antibiotic discs selected (Protein
(All measurements fell in the range of 11-15 mm, Synthesis Inhibition) produced inhibition zones on
S: ≥15 mm, R: 9 mm). JA3.3 and R12 exhibited all isolates beyond susceptible measurements of
slight resistance on one of the measurement: 11 other species listed by CLSI except tiamulin and
mm (R: 8-11mm) and intermediate resistance on lincomycin.
Table 3. Diameters of inhibition zones obtained from four Bacillus amyloliquefaciens isolates spread
on Müller Hinton agar and tested with DNA gyrase. Folic acid pathway. RNA
polymerase. and combined cell wall and protein synthesis inhibition mode of action
antibiotics
Folic Acid Cell Wall and Protein

DNA Gyrase Inhibition RNA polymerase
Class Pathway Synthesis Inhibition
Strain OFX CIP NA S3
RD (5μg) BA (10μg)
(5μg) (5μg) (30μg) (300μg)
JA3.3 35/38 34/40 29/32 34/36 24/24 19/21
R12 32/36 39/40 26/26 30/34 22/23 20/19
KS1.8 32/34 40/39 26/32 30/37 22/28 15/19
IS1.6 35/38 44/35 28/32 27/31 23/25 17/19
Susceptible
≥16-31 ≥21-41 ≥19 ≥17 ≥19-25 >13
Range
Resistance
12-24 15-32 13 12 16-19 -
Range
All measurements are taken in millimeters (mm). OFX: ofloxacin, CIP: ciprofloxacin, NA: nalidixic acid, S3:
sulfonamide, RD: rifampicin, BA: bacitracin.
Antibiotic discs selected to represent modes provided by Clinical and Laboratory Standards
of actions of folic acid synthesis (sulfonamide), Institute (CLSI) were used as reference
RNA polymerase (rifampicin), DNA gyrase breakpoints. All isolates demonstrated varied
(nalidixic acid, ofloxacin, ciprofloxacin), and cell susceptibility against a variation of antibiotics
wall and protein synthesis (bacitracin), exhibit employed. However, they did not have any
inhibition zone measured within or beyond absolute resistance against any of the antibiotic
susceptible range. Bacitracin is also common tested. In conclusion, Bacillus amyloliquefaciens
antibiotics growth promoter applied in swine [11, isolates tested could be of potent probiotic
21] . All isolates were susceptible on inhibition by candidates to support growth of livestock.
bacitracin.
Amoxicillin and ciprofloxacin are the most Acknowledgement
commonly prescribed antibiotics to outpatients
[22] . The isolates showed susceptibility to these We would like to thank Indonesian
antibiotics conferring safety to livestock product Directorate General of Higher Education (DIKTI)
consumers. to sponsor the study with funding obtained through
Hibah Bersaing DIKTI number
4. Conclusions 788/K3/KM/SPK.LT/2016.
Susceptibility test against 23 antibiotics, References

commonly added to feed or prescribed by
physicians for common illnesses, were conducted [1] P.R. Moore, A. Evenson, T.D. Luckey, E,
using disc diffusion method in Müller Hinton McCoy, E.A. Elvehjem, E.B. Hart, J. Biol.
media. Performance Standards for Antimicrobial Chem. 165 (1946) 437.
Susceptibility Testing (M100-S24)
Page | 448
PROCEEDINGS
[2] T.H. Jukes, E.L.R. Stokstad, R.R. Taylor, T.J. [13] S. Sneeringer, J. MacDonald. N. Key, W.
Combs, H.M. Edwards, G.B. Meadows. McBride, K. Mathews, Economics of
Arch. Biochem. 26 (1950) 324. Antibiotic Use in U.S . Livestock Production,
U.S. Department of Agriculture, Washington
[3] U.S. Food and Drug Administration, Consumer D.C., 2015.
Updates - Phasing Out Certain Antibiotic Use http://www.ers.usda.gov/media/1950577/err2
in Farm Animals, U.S. Department of Health 00.pdf
and Human Services,
http://www.fda.gov/ForConsumers/Consumer [14] Liofilchem, Antibiotic Disc, LIOFILCHEM
Updates/ucm378100.htm, 2013. s.r.l.,
http://www.liofilchem.net/login/pd/pi/AD.pdf
[4] D. B. Anderson, V. J. McCracken, R. I. , 2016.
Aminov, J. M. Simpson, R.I. Mackie,
M.W.A. Vestegen, H. R. Gaskins, Pig News [15] Clinical and Laboratory Standards Institute,
Inf. 20 (1999) 115. Performance Standars for Antimicrobial
Susceptibility Testing, Twenty-Fourth
[5] J.J. Dibner, J.D. Richards, Poult. Sci. 84 (2005) Informational Supplement, Clinical and
634. Laboratory Standards Institute, Wayne, 2014.
[6] H. Hao, G. Cheng, Z. Iqbal, X. Ai, H. I. [16] N.M. Broekema, T.T. Van, T.A. Monson,
Hussain, L. Huang, M. Dai, Y. Wang, Z. Liu, S.A.Marshall, D.M. Warshauer, J. Clin.
Yuan, Z. Front Microbiol. 5 (2014) 1. Microbiol. 47 (2009) 217.
[7] S. Parvez, K. A. Malik, S. Ah Kang, H.Y.J. [17] R.N. Jones, M.A. Pfaller, P.R. Rhomberg,
Kim, Appl. Microbiol. 100 (2006) 1171. D.H.Walter, J. Clin. Microbiol. 40 (2002)
461.
[8] A. Zeyner, E. Boldt, J Anim Physiol Anim
Nutr (Berl). 90 (2006) 25. [18] E. Bassiri, Antibiotic Sensitivity Testing,
University of Pennsylvania School of Arts &
[9] D. Taras, W. Vahjen, M. Macha, O. Simon, J Sciences,
Anim Sci. 84 (2006) 608. http://www.sas.upenn.edu/LabManuals/biol2
75/Table_of_Contents_files/10-Antibiotics-
[10] R.H. Dunlop, S.A. McEwen, A.H. Meek, New.pdf, 2013.
R.A. Friendship, R.C. Clarke, W.D. Black,
Can Vet J. 39 (1998) 87. [19] S.A. McEwen, P.J. Fedorka-Cray, Clin.
Infect. Dis.34 (2002) S93.
[11] World Health Organization, Impacts of
antimicrobial growth promoter termination in [20] D.G.S. Burch, In: S. Giguère, J.F.Prescott,
Denmark, World Health Organization, P.M. Dowling, (Eds.), Antimicrobial Therapy
Geneva, 2003, p.53. in Veterinary Medicine. 5th ed., Blackwell
Publishing, Ames, 2013, pp. 553.
[12] U.S. Food and Drug Administration, The
Judicious Use of Medically Important [21] T.B. Murdiati, WARTAZOA. 6 (1997) 18.
Antimicrobial Drugs in Food-Producing
Animals, U.S. Department of Health and [22] Centers for Disease Control and Prevention,
Human Services, Rockville, 2012. Outpatient antibiotic prescriptions, Centers
http://www.fda.gov/downloads/AnimalVeteri for Disease Control and Prevention,
nary/GuidanceComplianceEnforcement/Guid http://www.cdc.gov/getsmart/community/pdf
anceforIndustry/UCM216936.pdf s/annual-reportsummary_2012.pdf, 2012.
Page | 449
PROCEEDINGS
OPTIMIZATION OF BLUE SEPHAROSE AFFINITY

CHROMATOGRAPHY CONDITIONS FOR RECOMBINANT
HUMAN ERYTHROPOIETIN (RHUEPO) PURIFICATION
Yana Rubiyana1, Adi Santoso1, Endah Puji Septisetyani1, and Fathia Maulida1
1.
Research Center for Biotechnology, Indonesian Institute of Science, Cibinong Sains Center,
Jl Raya Bogor Km.46, Cibinong, 16911, Indonesia
E-mail: yana.rubiyana@gmail.com
Abstract
One of the techniques for purification recombinant Eritrhopoietin (rhuEPO) is using affinity
chromatography with blue Sepharose beads. Blue Sepharose containing cibacron blue dye can bind
rhuEPO proteins by affinity. This study was conducted to determine the amount of blue Sepharose beads
and optimal incubation time for rhuEPO purification. In this study the amount of beads used was 250 µl,
500 µl and 1 ml to purify 5 ml of the rhuEPO supernatant. The ratio between the beads and the sample
was 1:20, 1:10, and 1: 5. The incubation time for purification was 0 hours, 0.5 hours, 1 hour, 2 hours, 3
hours, and 6 hours. These results indicate that the optimal ratio between the resin and the sample for
rhuEPO purification was at 1:10 and optimal incubation time for rhuEPO purification was at 0.5 hours
Keywords : affinity chromatography. blue sepharose. erythropoietin. purification.
1. Introduction resins, lectin affinity resins, affinity

chromatography on immobilized DNA or on
Erythropoietin (EPO) is a glycoprotein immobilized nucleotides and on group-specific
hormone that controls red blood cell production adsorption agents [6, 7]. In this study, the amount
[1]. Decreased content of EPO in the body can of blue sepharose beads and optimal incubation
cause anemia due to low process of time was studied.
erythropoiesis. rHuEPO has been used for clinical
treatment of patients with anemia caused by 2. Methods
cancer, HIV infection, kidney failure, and bone
marrow transplantation [2]. Therapy with Cell Culture. Protein concentrate was produced
recombinant EPO can decrease the need for blood by CHO cells as a sample of rHuEPO purification.
transfusion, thus reducing the risk of coming CHO cells grew in Dulbecco's Modified Eagle's
down with illness such as viral hepatitis or HIV medium (DMEM) (Gibco) supplemented with
AIDS [3]. 10% Fetal Bovine Serum (FBS) (Gibco) and 1%
One of the EPO purification method is Penicillin-Streptomycin (Gibco).
Affinity Chromatography. Affinity
chromatography is a separation method based on Clarification and diafiltration. Supernatant was
a specific binding interaction between an filtered through 0.45 μm membrane using a sterile
immobilized ligand and its binding partner [4, 5]. syringe filter (Corning) to remove the remaining
The degree of purification can be quite high cells and debris. After the clarification, filtrate
depending on the specificity of the interaction. was concentrated by TFF (tangential flow
Affinity chromatography can be conducted by filtration) system using a 10 kDa cut-off
conventional commercially available resins. By membrane (Millipore) to about 10 fold volume
way of example, Heparin Sepharose, Hitrap Blue reductions.
HP columns (Cibacron Blue F3G-A), Blue
Sepharose (Cibacron Blue F3G-A), Optimization of incubation time. 0.5 mL bluesepharose
peptide/ligand affinity resins, antibody affinity beads were centrifuged to remove the storage solution,
then the beads were equilibrated with a 20 mM phosphate
Page | 450
PROCEEDINGS
buffer solution of pH 8. For incubation time of 0 hours, reach its maximum at the point where the bead can no
the beads directly inserted into the glass column (inner longer bind to the target protein. Sample ratio of 1:10 and
diameter of 10 mm and a length of 100 mm), then added 1: 5 have not showed the protein bands on the
5 mL sample into the column. The column was washed flowthrough fraction which means no protein EP wasted.
with a solution of 20 mM phosphate buffer pH 8. EPO
protein was eluted with 20 mM phosphate buffer + 1.5 M
NaCl. For the incubation time of 0.5 hours; 1 hour; 2
hours; 3 hours and 6 hours. Samples and beads inserted
into 15 ml tube, then incubated for 0.5 hours; 1 hour; 2
hours; 3 hours and 6 hours on a rotary shaker, with a
temperature of 4 0C. The column was washed with a
solution of 20 mM phosphate buffer pH 8. EPO protein
was eluted with 20 mM phosphate buffer + 1.5 M NaCl..
Optimization of ratio between the beads and the Figure 1. Slot Blotting Of purification rhuEPO.
sample.250 mL, 500 mL and 1 ml of beads FT: Flow Through; WH: Washing; E1-E5:
bluesepharose inserted into the tube 15 ml, then Elution Fraction 1- 5
add 5 ml of the supernatant containing EPO
protein. Then incubated for 0.5 hours. Further To clarify the results of this optimization
samples and beads was added to the glass column. was carried out by measuring of the thickness
The column was washed with a solution of 20 mM (density) of band using ImageJ software. The
phosphate buffer pH 8. EPO protein was eluted results of this measurement will be the value of
with 20 mM phosphate buffer + 1.5 M NaCl.. area under the curve (AUC). The AUC value is
proportional to the density of band on each
Slot blotting and Image-J software analysis. fraction. The thicker the protein bands, the greater
Slot blot analysis was performed to detect each AUC values and on the contrary the smaller the
fraction of protein after purification. Protein protein bands, the smaller AUC values. The
placed on Hybond nitrocellulose membrane (GE measurement results using ImageJ software can be
Healthcare) by using vacum pump system. seen in Table 1. Based on the AUC exhibited the
Immunodetection was achieved by using anti- result as on Figure 2. The result showed the
hEPO antibody (Calbiochem) as primary antibody optimum ratio to purify EPO protein at 1:10. It
and anti-rabbit IgG peroxidase conjugate (Biorad) means that 1 ml blue sepharose beads can purify
as secondary antibody. The band was visualized the maximum EPO protein supernatant at 10 mL
by NBT-BCIP staining reaction and The density
of rhEPO bands was calculated based on Area Table 1. Measurement of Area Under Curve
under the Curve (AUC) determination by ImageJ (AUC) for optimization of blue sepharose
software. beads
3. Result and Discussions Ratio of AUC AUC Average

Beads &
Optimization of ratio between the beads and the of AUC
Sample 1 2
sample. Optimization amount of bead conducted of
varying the ratio of bead to sample is 1:20; 1:10 and 1: 5. 1:20 191610 142777 167194
The purpose of the research is to determine the optimal
number of blue sepharose bead that used to purify EPO 1:10 230793 219858 225326
protein. We expect that the little amount of bead can
purify the protein sample in large number without the 1:5 233826 219925 226876
target protein wasted only a little wasted. The
optimization results can be seen in Figure 1. The sample
ratio of 1:5 and 1:10 show the better result of purification
than ratio 1:20. Sample ratio of 1:20 exhibited EPO
protein band in the flowthrough fraction. This may
indicate a protein EPO wasted or not bound to the beads
of blue sepharose. It relates to the capacity of blue
sepharose bead to bind of EPO protein. The higher of
amount or volume of protein sample, the higher the
protein to be bound in blue sepharose bead [8] and It will
Page | 451
PROCEEDINGS
Table 2. Measurement of Area Under Curve

Incubat AUC AUC AUC Averag
ion 1 2 3 e of
time AUC
(hour)
16331 17717 15696
0
4 7 2 165818
24513 29012 26373
0,5
6 0 4 266330
27298 24184 27607
1
4 9 9 263638
Figure 2. Grafic average of Area Under Curve 26701 25115 25879
2
(AUC) for optimization of blue sepharose 8 6 0 258988
27015 26917 27463
beads. 3
0 5 3 271319
29177 22502 29368
Optimization of incubation timeThe process of EPO 6
4 4 1 270160
purification is a process of interaction between the EPO
protein in the sample with cibacron blue dye contained in
blue sepharose beads [9]. The longer the interaction, the
greater the possibility of EPO protein bound by cibacron
blue dye. However, if too long the interaction were not
good because ineffective in workmanship and cause
proteins damaged or proteins degradation [10, 11].
Therefore, optimization incubation time was done to get a
short incubation period to bind EPO protein optimally. In
this study the variation of incubation time is 0, 0.5, 1, 2 , 3,
and 6 hours. The incubation time optimization results can
be seen in Figure 3. The EPO protein bands at 0 hours of
incubation show thinner than other protein bands on
incubation time. This is possible because the interaction
between the sample and the blue sepharose beads Figure 4. Grafic average of Area Under Curve
relatively short, so cibacon blue dye binding to the EPO (AUC) for optimization of incubation time
protein was also not optimal.. Based on AUC values are
obtained the results as on Figure 4 where the visible result
of the optimal incubation time to purify the EPO protein 4. Conclusions
is at 0.5 hours.
The optimal ratio between the resin and the sample
for rhuEPO purification was at a ratio of 1:10 and
optimal incubation time for rhuEPO purification
was at 0.5 hours.
References
[1] A.J. Sytkowsky. Erythropoietin. Wiley-VCH,
Weinheim, 2004, p.117.
[2] J.H. Park, C. Kim, W.B. Kim, Y.K. Kim, S.Y.

Lee, J.M. Yang. Biotechnol Appl Biochem
32 (2000) 162-172.
[3] J. Egrie. J Pharmacotherapy 10 (1990) 3s-8s
[4] R. Surabattula, K. Rao, R. Polavarapu. J

Research in Biotech 2 (2011) 58-74.
Figure 3. Slot Blotting Of purification rhuEPO.
FT: Flow Through; WH: Washing; E1-E5: [5] J. Travis, J. Bowen, D. Tewksbury, D.
Elution Fraction 1- 5 Johnson, Pannell R. J Biochem 157 (1976)
301-306.
Page | 452
PROCEEDINGS
[6] S. Magdeldin, A. Moser. Affinity [9] S. Subramaniana, P.D. Ross. J Critical

Chromatography: Principles and Reviews in Biochemistry 16 (2008) 169-205.
Applications. Intech, Croatia, 2012, p.10
[10] I. Amadeo, L. Mauro, E. Ortí, G. Forno.
[7] I. Lascu, H. Porumb, T. Porumb, I. Abrudan, Biotechnol Progress 27 (2011) 724–732
C. Tarmure, I. Petrescu, E. Presecan, I.
Proinov, M. Telia. J Chromatogr. 283 (1984) [11] S Wathon, S. Budiarti, P. HWisnuwardhani,
199-210. N Herawati, A Santoso, R.A. Ningrum. Int. J.
Res. Pharm. Sci 6 (2015) 312-320
[8] G.E. Lamkin, E.E. King. Biochemical and
Biophysical Research Communications 72
(1976) 560-565
Page | 453
PROCEEDINGS
THE COMPARISON OF BATCH AND COLUMN BASED

AFFINITY CHROMATOGRAPHY IN RECOMBINANT HUMAN
ERYTHROPOIETIN (rhEPO) PURIFICATION
PopiHadi Wisnuwardhani, Yana Rubiyana, Endah PujiSeptisetyani, andAdiSantoso
Research Center for Biotechnology, Indonesian Institute of Sciences

Jl. Raya Bogor KM 46, Cibinong, Bogor, Indonesia
*Email : popihww@gmail.com
Abstract
Protein purification techniques can be divided into three categories, i.e. capturing, intermediate and
polishing. Affinity purification by using 6 Ni-NTA His Tag is high specific chromatography which is
based on polihistidine binding site. This study was aimed to compare bacth and column approaches in
rhEPOpurification by using affinity chromatography. The protein under study, rhEPO that contained 6 -
His Tag was produced in CHO-K1 cells. Comparison was performed on the ratio among histrap FF
column, histrap HP column, resin beads column, and Ni-NTA batch method. The result showed that the
area under curve based analysis of Western blot bands from batch method gave the best score, suggesting
that the rhEPO purification bacth method was the best choice.
Keywords : CHO K1.Afinity Chromatography. rhEPO
1. Introduction clinical purposes. Purification techniques

commonly referred to as purification can be
Pharmaceutical protein erythropoietin divided into three categories, namely categories
(EPO) is a glycoprotein that an important role for that capture technique for the separation is done by
establish to red blood cells (Ashley et al., 2002). molecular weight, so that impurities can be wasted
Clinical therapies using EPO is needed to resolve rough. The capture technique used is Tangential
anemia in kidney failure patients where EPO Flow Filtration filter (TFF). The second category
provided a recombinant protein (rhEPO) which is intermediate, the separation of impurities with
controls 25.3% of the market of recombinant molecular weight of medium size, the usual
pharmaceutical proteins. The human EPO gene is techniques such as affinity , histag , GST , FF
expressed mostly in the kidney tissue and the liver coloumn , and the batch method. The third
as a response (Yin & Blanchard 2000). Clinical categories is polishing, purification is performed to
needed of recombinant EPO are available in large remove small impurities by means of affinity
quantities in mammalian cell expression in CHO usually conducted using HP and Histag coloumn
cells (chinese hamster ovary) (Egrie 1990). It is (Ayyar , V. B et al . , 2012).
because CHO cells are relatively easy to use in this The advantage of using using 6 - Histag
study of protein expression technology and has a Ni - NTA is because the resin can specifically bind
good track record, glycosylation machinery in histidine sample, so that non target protein can be
CHO cells also resemble the pattern of excluded. In addition, this purification technique is
glycosylation in humans (Bragonzi et al, 2000). very efficient to use and easily regenerated (
The next step is takes proper purification Porekar , VG and Menart , V. 2001) . Therefore, in
techniques to obtain pure protein more about the this study, this type of affinity chromatography
chemical structure of recombinant EPO has technique was applied.
produced. This study was conducted to compare
the methods of purification of 6-Histag rHEPO
with using Ni-NTA Beads, affinity
chromatography column and batch method as a
Page | 454
PROCEEDINGS
2. Methods Resin beads column method

Material Before purification, 10 ml sample was
centrifuged and followed by the addition of 1/10
CHO-K1 cells and a plasmid vector volume of 200nm sodium phosphate buffer pH 8
pcDNA3 was obtained from Prof. Kawaichi, Nara to the sample. Agarose resin preparataion was
Institute of Science and Technology (NAIST), done in 2ml tube. Following centrifugation at
Japan. Cells were grown in F12 medium (Sigma) 12000rpm for 5 minutes, 1 ml of starting buffer
with an additional 1% antibiotic penicillin / was added to the sample and centrifugation was
streptomycin (Invitrogen) and 10% fetal bovine continued for another 5 min at the same speed.
serum (FBS, Gibco) at a temperature of 370C and The pellet was taken and 10 ml supernatant was
5% of CO2. Transformant cells were grown using added and followed by spinning in a rotator for 4
the antibiotic G418 in the same medium, Ni-NTA hours at 40C temperature. The sample was then
Bead Agarose (Invitrogen, Cat. 30201). spinned at 6000 rpm for 5 min and the 1 ml
supernatant was applied to the column with the
rhEPO expression in CHO-K1 adherent size 10 cm in length and the FT was collected.
cells culture Following washing with 5 mL of washing buffer,
the coloumn was then eluted using 8ml of elution
CHO-K1 cells grown in cell culture dish buffer containing 10 mM sodium phosphate buffer
(10 cm in diameter containing 10 ml media) with a (pH 8) in 500mm NaCl imidazole. Fractions of
cell density of 5x104 cells/ml media. To make each 1 ml sample was collected.
sure that enough sample was available, as many as
10 dishes of cell culture were prepared. The cells Ni-NTA Batch Method
were incubated for 8 days in F12 medium
containing 1% penicillin/streptomycin, 10% FBS All samples were adjusted to pH 8 before
and G418 (1%) at a temperature of 370C with subsequent treatment by adding 200 nm sodium
level of CO2 is 5%. Culture medium was collected phosphate buffer pH8 as much as one tenth of the
and followed by purification and Western blot sample volume. To investigate whether amounts
analysis. of bead used had effects on the protein yield
produced, three different amount of bead were
Purification of rhEPO applied, i.e.: 50, 40, and 20 ul of bead. Sample
buffer was then added and followed by incubation
Methods Column Histrap FF and HP in a rotator at 40C over night. The next day,
samples were pelleted at 12000 rpm for 2 minute,
(Amersham Biosciences)
followed by addition of 500ul of 20 mm imidazole.
As much as 10 ml of samples were Finally, the samples were dilluted to 1 ml..
collected and purified using nickel chelating resin
matrix system. In this process, the matrix coloumn Analysis rhEPO with Western Blot
was equilibrated in binding buffer (phosphate
buffer) pH 8:0 containing sodium phosphate Supernatant samples were analyzed by
20mm, 20mm imidazole and 500mm NaCl. In FF electrophoresis of the purified system using 12%
histrap coloumn, prior to purification, the sample SDS-PAGE followed by transfer to nitrocellulose
was treated with or without pH adjustment. membrane. Proteins that have been attached to the
Samples (10ml) was applied to the column which membrane will be analyzed by western blot.
had been equilibrated and followed by washing Specific antibodies against rhEPO is the primary
using binding buffer. Flow through was kept for antibody (polyclonal anti-human EPO antibody)
subsequent analysis. Elution was performed using and secondary antibody-containing enzyme
elution buffer containing 20 mm sodium alkaline phosphatase (anti-rabbit IgG alkaline
phosphate, 500mm imidazole and 500mm NaCl. phosphate-linked whole antibody). Signal protein
Eluents were collected in five tubes with the staining performed with NBT and BCIP
volume of 1 ml each. Purification in HP coloumn (Promega).
was the same as of FF, except the sample was
adjusted to pH 8.
Page | 455
PROCEEDINGS
3. Result and Discussion data shows the comparison between columns

Histrap purified sample in FF with and without pH
rhEPO purification using a column of adjusted to pH 8. Figure 2 (A) shows that the AUC
of FT with or without pH adjustment. The FT
Ni-NTA FF Histrap with and without
obtained from sample without pH adjustment was
pH adjustment. higher than that of with pH adjustment. Inversely,
data in Figure 2 (B) shows that the protein resulted
Purification using HiTrap Ni-NTA column
from pH adjusted sample was higher than that of
has several important stages that must be
non adjusted one.
considered including coloumn quilibrarion and
sample applications. At this stage the resin is
equilibrated with pH 8 phosphate buffer containing
20 mM sodium phosphate and 500 mM NaCl. The
sample was conditioned slightly alkaline to pH
around pH 8 with the goal not to protonote
histidine residues and imidazole. According
Porekar and Menart (2001), that there is interaction
between the metal ions with imidazole or histidine
residues, N atoms of histidine or imidazole should A
not be protonated form (nonproton), this form can
occur in neutral or slightly alkaline pH. Therefore
the use of phosphate buffer pH 8 to saturate the Ni-
NTA column histrap. Addition of NaCl salt was
aimed in reducing non-specific electrostatic
interactions..
B
Figure 2. (A) AUC comparison chart between
FT purified histrap FF column with and
without pH adjustment ; (B) AUC comparison
chart between histrap column FF eluate
purification with and without pH adjustment.
These result are supported by the AUC

calculation graph of the eluate bands. Figure 2 (B)
shows that AUC of pH adjusted sample was higher
than that of without pH adjustment. The result
showed that purification using prepacked column
of histrap FF with pH adjustment had better
performance than that of without pH adjustment.
Figure 1. (A) Purification by using prepacked Samples that were conditioned (adjusted) to pH 8
FF column with pH adjustment. M : Marker; deprotonate histidine side chain imidazole
1: Elution 1. 2: Elution 2. 3: Elution 3. 4: negatively charged so as to form a coordinated
Eluation 4.and 5: Elution 5. (B) Purification by bond with Ni-NTA resin, while samples that were
using prepacked FF column without pH not conditioned pH, will still have a pH in
adjustment. M : Marker; 1: Elution 1. 2: accordance with the condition of the sample media
Elution 2. 3: Elution 3. 4: Eluation 4.and 5: which was about 6-7, in which in this condition,
Elution 5. (C) Flow Through (FT) purification there was possibility of only 50% of the protonated
by using column prepacked FF. M: Marker; 1. histidine so that only about 50% of the protein that
FT without pH adjustment.2. FTwith pH can bind to the Ni-NTA resin.
adjustment. This result is in line with previous research
done by Porekar and Menart (2001) in which there
Western blot bands in Figure 1, the density is interaction between metal ion and histidine
of the band were analyzed using Image J software, residue or imidazol..
resulting calculation area under the curve (AUC)
to describe the density of western blot bands. This
Page | 456
PROCEEDINGS
Tabel 1. AUC value of prepacked columnsof Tabel 2. AUC value of prepacked columns of
histrap FF purification with pH 8 adjustment histrap FF and HP purification with pH 8
and without pH 8 adjustment. adjustment.
Treatment Area Under Curve Treatment Area under curve

(AUC) (AUC)
FT column FF without Flow Through with column
11626.32 10616.439
adjusment pH HP
FT column FF with Flow Through with column
8107.004 8107.004
adjustment pH FF
Total eluat column FF Total eluat column HP 24717.635
20661.265
without adjustment pH Total eluatcolumn FF 39292.691
Total eluatcolumn FF with
35820.943
adjustment pH
Purification of rhEPO using Ni-NTA FF

Histrap and Ni-NTA HP Histrap coloumns
Histrap column (pre-packed) Ni-NTA both

types FF (Fast Flow) and HP (High Performance)
is widely used for protein purification, where both
have advantages such as easy to use, high
selectivity and regenerate easily. The fundamental
differences between these two columns is a
column matrix where the ones used in HP histrap
column matrix designed for high performance
while histrap FF column was designed for high-
speed purification.
Figure 4. (A) AUC comparison chart between

FT purified histrap FF column and histrap HP
with pH adjustment ; (B) AUC comparison
chart between histrap column FF and column
HP eluate purification with pH adjustment.
The data in Figure 4. (A) shows that the

AUC Flow Through (FT) of histrap HP column is
Figure 3. (a) Western blot by using prepacked greater than that of FF column, its indicates that
HP column histrap purification. (M) Marker. the binding of the protein in FF columns is better
(1) Eluate 1. (2) Eluate 2. (3) Eluate 3. (4) Eluate the ones in HP‘s. These results are supported by
4. (5) Eluate 5. (b) Western blot by using the results of the calculation of the AUC eluate in
prepacked FF column histrap purification. (M) which result of the sample purified by HP coloumn
Marker. (1) Eluate 1. (2) Eluate 2. (3) Eluate 3. was less intense compared to that of FF column.
(4) Eluate 4. (5) Eluate 5. (c) Western blot of Equally, the yield of purified protein using FF
Flow Through (FT) by using prepacked colomn coloumn was higher than that of HP‘s.
FF and HP histrap purification (M) Marker. (1) This difference its because to differences in
FT by column HP histrap. (2) FT by column FF the column matrix. HP column is designed
histrap. specifically for high performance so it is not
suitable for purification that are still in the stage of
Table 2 shows the AUC of Western blot analysis capture or intermediates. HP histrap column is
of FF histrap and HP histrap coloumns. suitable for purification of the final stage
(polishing) to obtain high purity. Meanwhile, to
get the amount (yield) of high protein more
suitable for histrap FF column.
Page | 457
PROCEEDINGS
Comparison of purification methods of The data in Figure 6 shows the Western

NI-NTA IMAC Histrap column (pre- blot analysis of the FT. It shows that he FT of Ni-
NTA batch method was the cleanest meaning that
packed) FF and a conventional IMAC all of the protein may bound to the resin. Based on
resin Ni-NTA agarose (batch and these results, in this study, it is safe to say that the
gravity). Ni-NTA purification batch method showed the
best performance among the compared purification
The results in Figure 5 showed the Western methods. It is possible that the strong performance
blot analysis of NI-NTA IMA.C column histrap in bacth method. This may be due to the batch
(pre-packed), NI-NTA batch method and the NI- method performed incubation shaker that cause
NTA column gravity purification methods, Seen maximum interaction between proteins with Ni-
from the thickness of the bands, Histrap column NTA resin compared with the column whose
and NI-NTA batch methods showed good results. interaction is limited only by the force of gravity..
These results show that the EPO protein was
bound to so well in the NI-NTA resin, so it needs
to be analyzed about amount of EPO protein
contained in the flow through step.
Figure 7. (a). Western blot by using various

Figure 5. (A). Westren blot by using batch beads with incubation time for 4 hours. (1)
purification method with pH 8 addjustment and beads 50ul.. (2) beads 100ul.. (3) beads 150ul..
various beads (20uL. 40 ul). (M). Marker. (1-3) (4) beads 200ul. (b) AUC value charts western
Incubation O/N with 20uL beads. Eluat 3. eluat blot with various beads sample purification by
2. eluat 1; (4-6) Incubation for 4 hour. Eluat 3. using Ni-NtA batch method.
eluat 2. eluat ; (B). Westren blot by using Ni-
NTA purification with gravity column. The data in Figure 7 shows the optimization
M(Marker).. (1) Eluat 5.. (2) Eluat 4.. (3) Eluat amount of resin used. With increasing amount of
3.. (4) Eluat 2 and (5) eluat 1. (C) Westren blot resin the intensity of the band also increased until
by using batch purification method coloumn FF finally the maximum density was achieved
with pH 8 addjustment. (M) Marker. (1) Eluat suggesting that the yield obtained was also at the
5. (2) Eluat 4. (3) Eluat 3. (4) Eluat 2 and (5) highest. The highest band density was reached
Eluat 1. when 150 ul of resin was applied..
4. Conclusion
Overall, the data obtained using Western
blot analysis showed that the rhEPO protein
purification by way of bacth method was better
that of the column method, this might indicate that
the binding of the resin containing Ni-NTA
molecules in the bacth methods works better in
CHO-K1 supernatant that contained rhEPO
Figure 6. Westren blot from Flow Trought protein molecules.
(FT). (M) Marker. (1-3) Westren blot by using
Ni-Nta batch method. (4-5) Westren blot by
using Ni-Nta purification with gravity column.
(6) Westren blot by using purification HP
coloumn. (7) Westren blot by using purification
FF coloumn without pH adjustment. and (8)
Westren blot purification FF Coloumn with pH
addjustment.
Page | 458
PROCEEDINGS
References Gygcoproteins, Biochim. Biophys.Acta 1474:

273-282.
[1] Ayyar, V.B., S Arora, C Murphy, and
O‘Kennedy, R. 2012. Affinity [4] Egrie J. 1999. The cloning and production of
Chromatography as A Tool for Antibody recombinant human
Purification. Elsevier, Methods 56 (116-129). erythropoietin.Pharmacotherapy 10:3s-8s.
[2] Ashley RA, ZH Dubuque, B Dvorak, and et [5] Porekar V,G and Menart V. 2001.
al. 2002. Erythropoietin stimulates Perspectives of Immobilized-Metal Affinity
vasculogenesis in neonatal rat mesenteric Chromatography.
microvascular endothelial cells. Pediatric Elsivier.J.Biochem.Biophys. Metohds 49.
Research 51:472-478. 335-360.
[3] Brangonzi A, G Distefano, LD Buckberry, and [6] Yin H, Blanchard KL. 2000. DNA
et al. 2000. A New Chinese Hamster Ovary methylation represses the expression of the
Cell Line Expressing 2,6-sialyltransferase human erythropoietin gene by two different
Used as Universal Host for The Production of mechanisms. Blood 95(1):111-119.
Human-Like Sialylated Recombinant
Page | 459
PROCEEDINGS
EFFECT OF LYSINE AND HISTIDINE RESIDUES ON

NANOPARTICLE FORMATION OF PALMITOYL-BASED
LIPOPEPTIDE AS TRANSFECTION REAGENT FOR NON-VIRAL
GENE DELIVERY VEHICLE
Tarwadi1), Jalal A. Jazayeri2), and Colin W. Pouton3)
1)
Centre for Pharmaceutical and Medical Technology-The Agency for the Assessment and Application of
Technology.
2)
School of Biomedical Science, Faculty of Science-Charles Sturt University, Albury, New South Wales
2640, Australia
3)
Department of Pharmaceutical Biology and Pharmaceutics, Victorian College of Pharmacy, Monash
University, 381 Royal Parad, Parkville, Victoria 3052, Australia
4)
. E-mail: tarwadi@bppt.go.id
Abstract
Compared to viral delivery, non-viral delivery systems are relatively safe but inefficient in their current
form. The main obstacle in using non-viral gene delivery system approach is to transport the gene of
interest in cytoplasm and subsequently entering into cell nucleus. To do so, the gene of interest has to be
packed into small, stable and positively charge particle in order to be taken up by cell surface poly-anions
before it transports in the cytoplasm and cell nucleus. In this research, palmityol – based lipopeptides
have been designed and its ability to form nanoparticle of a stable DNA – lipopeptide complex were
evaluated to be used as non-viral gene delivery vehicle. The lipopeptide molecules are composed of alkyl
chain of palmitoyl (C-16), and amino acid residues of cysteine (C), lysine (K), and histidine (H). The
particle size (nm) and zeta
It was revealed that prolonging incubation time of the complex composing of DNA and Pal-CK2H3
(charge ratio of 1.5) more than 2 hours tend to increase the size up to 300 nm. In addition, increasing
was still relatively stable at less than 400 nm. As the number of lysine residue on lipopeptide is increased,
the particle size is tend to decreased. However, the particle size is increased as the number of histidine
residue on lipopeptide is increased. It was also shown that increasing charge ratio of the nanoparticle
complex resulted in an increased zeta potential but lowering the particle size. Transfection efficiency of
the nanoparticle on COS-7 had shown that the lipopeptide has potency as non-viral gene delivery vehicle.
To conclude, the lipopeptide composing of alkyl chain of palmitoyl and amino acid residues form a
nanoparticle and having potential characteristics to be further explored as non-viral gene delivery vehicle.
Keywords: non-viral gene delivery, palmitoyl-based lipopeptide, charge ratio, transfection efficiency,
nanoparticle, particle size and zeta potential.
1. Introduction transfection, with only a few hundred reaching the

nucleus (Tachibana et al., 2002). This is due to
To-date, several novel non-viral delivery several physical, chemical, and metabolic barriers
systems have been developed for transfection of that restrict delivery to the perinuclear area. This
dividing cells in research laboratories. However, is in addition to the barrier presented by the
few have reached clinical trials, because these nuclear membrane, which has been shown to be a
transfection systems lack the attributes to deliver major impediment to gene delivery. Successful
DNA to the nuclei of non-dividing cells in vivo. It delivery of DNA expression vectors therefore
has been estimated that approximately 106 plasmid requires transfection agents capable of evading
DNA molecules are needed for one cell these barriers in such a way that intact DNA can be
Page | 460
PROCEEDINGS
delivered to the nucleus in vivo as well as in vitro.. facilitate dimerization of the lipopeptide molecules
The first step in design of an effective in the presence of DNA templates in manner
pharmaceutical DNA delivery system is to produce analogous to the strategy used in previous work
condensed particles of DNA with a chemically (Blessing et al., 1998; Dauty et al., 2001; Lleres et
defined transfection agent, which allows cellular al., 2001). The positively charged amino acid,
uptake and delivery to the cytoplasm (Pouton and lysine, was used to: (a) provide an initial ionic
Seymour, 1998). Existing transfection agents interaction between lipopeptide and the negatively
include cationic lipids, cationic polymers, peptide, charged DNA phosphate backbone, and (b)
or lipopeptide-based vectors. One problem compact DNA molecules into small and stable
encountered with typical cationic lipid/DNA particles. The size and charge of particles are
complexes or polymer/DNA complexes is that critical to cell uptake and intracellular trafficking
they tend to aggregate into highly poly-disperse (Pelisek et al., 2006; Ross and Hui, 1999a). A
mixtures, which are difficult to characterise and number of histidine moieties were also included in
have very limited activity in vivo. We have the lipopeptide structure to provide an endosomal
investigated monomeric peptide-based non-viral escape mechanism, which prevents lysosomal
delivery systems, which we believe offer enzymatic degradation (Kumar et al., 2003;
pharmaceutical advantages, such as ease of Midoux and Monsigny, 1999; Pichon et al., 2000).
manufacture, low-cost, and high purity. These This is analogous to the use of imidazole-
agents could also result in improved control of containing compounds as an endosome-lytic agent
complexation, and can overcome one of the (Ihm et al., 2003; Pack et al., 2000). The weakly
intracellular barriers to DNA delivery, namely basic histidine residues were designed to behave in
escaping the lysosomal degradative pathway. The a way that is analogous to the ‗proton sponge
general structure of these lipopeptides (Figure 1) effect‘ that is thought to contribute to the
includes an alkanoyl chain (linked as an amide to transfection efficiency of PEI (Florea et al., 2002).
the N-terminal amino acid); a cysteine residue However, the imidazole functional group was
(providing a free thiol group, -SH); and short chosen for its specific pKa value (~6.0), which we
blocks of lysine and histidine residues, the believe is a better strategy than to rely on the broad
numbers of which can be varied to optimize spectrum of pKa values present in PEI, which is
lipopeptide transfection efficiency. the result of various degrees of coulombic
repulsion within the polymer. The typical of
lipopeptide transfection reagent structure used in
this study is presented in Figure 2. The particle
size, zeta potential and poly-dispersity of
lipopeptide-DNA complex was evaluated. The
effect of inclusion of histidine residues in the
lipopeptide on the particle size of DNA complexes
was found to be opposite to that of lysine.
Furthermore, in vitro transfection studies in COS-7
cells revealed that the efficiency of delivery of the
luciferase encoding plasmid, pCMV-Luc, mediated
Figure 1. General structure of lipopeptide based by lipopeptide construct was much higher than
transfection reagents. poly-L-lysine (PLL), which lacks an endosomal
escape mechanism, and was comparable to that of
The alkanoyl side chain is included to branched poly-ethylenimine (PEI) (Tarwadi et al.,
provide a hydrophobic effect which promotes 2008).
DNA condensation. Cysteine was included to
Figure 2. Typically structures of the lipopeptide-based transfection agents composed of palmitoyl

chain. cysteine. 2 molecules of lysine and histidine (Pal-CK2H2).
Page | 461
PROCEEDINGS
2. Materials and Methods initiate and provide hydrophobic interactions

between the lipopeptide and DNA. The cysteine
residue which bears a thiol group (-SH) was
Plasmid isolation intended to produce dimerization in the presence
The pCMVluc plasmid encoding luciferase of DNA molecules. The presence of lysine was
gene (Clontech, NSW, Australia), was cultivated believed to provide positive charge on the
in Eschericia coli str lipopeptide to interact mainly with the negatively
grown in Luria Broth (LB) media supplemented charged of sugar-phosphate backbone of the DNA
molecule. Histidine moiety was included in the
shaking incubator [Jiang et al., 1998]. The plasmid lipopeptide to be able to buffer the endosome
was isolated using a commercial Qiagen Maxiprep vesicle and escape from endosomal degradation
kit (Qiagen Pty. Ltd., VIC, Australia) in once the complex of the DNA-lipopeptide is taken
accordance with the supplier‘s protocol. The up by the cells and transported in cytoplasm.
quantity and purity of the plasmid DNA was Furthermore, the number of lysine and histidine
determined by spectrophotometric analysis at 260 was varied to optimize the lipopeptide transfection
and 280 nm as well as by running the plasmid on efficiency. The lipopeptides were constructed by
0.8 % agarose gel electrophoresis (1 hour, 90 volt). Auspep Pty. Ltd. (Parkville, Victoria, Australia).
Purified plasmid DNA was resuspended in Milli-Q The purities of the products were confirmed by
water (MQW) and frozen (-20oC) for storage. High Performance Liquid Chromatography
(HPLC) and were > 95%. The products molecular
Lipopeptide construction weights were confirmed by mass spectral analysis.
The basic structures of designed lipopeptides The lipopeptide and transfection reagents used in
are composed of an alkyl chain, cysteine and a this study are listed in Table 1. Polyethelenimine
number of histidine and lysine amino acid (Sigma Aldrich, VIC., Australia) and
residues. The inclusion of an alkyl chain of Lipofectamine® (Invitrogen, VIC., Australia).
palmitoyl (C-16) in the lipopeptide was intended to
Table 1. The Lipopeptide and Transfection Reagent Used for Nano Particle Formation and
Transfection Studies
Lipopeptide/Transfection Reagent Molecular Weight (Dalton) Number of proton/molecule

Pal-CKH2 761 1
Pal-CK2H2 889 2
Pal-CK2H3 1026 2
Pal-CK2H4 1163 2
Pal-CK2H5 1300 2
Pal-CK3H2 1017 3
Pal-CK3H3 1154 3
Polyethylenimine (PEI) 43*) 1

**)
Lipofectamine® 3332 15
*) +
Polyethylenimine (PEI), molecular relative of 1 unit ethylene 43 Da, 1 N /unit, commercially available.
**) TM
Lipofectamine (moleculare relative of 3332) is composed of 1 molecule of DOPE and 3 molecules of
+
DOSPA, 15 N /molecule, commercially available.
Page | 462
PROCEEDINGS
Charge Ratio (N/P) of

Lipopeptide/DNA Determination 7.4 then added in drop wise m
HGB pH 7.4 containing lipopeptide and (iii)
The charge ratio (C/R) refers to the number method 3: amount of DNA was added into
of proton (positive charge of the nitrogen residues)
of transfection reagent (including lipopeptide) in HGB pH 7.4 to obtain desired charge ratio. The
molecules per negative charge of the DNA sugar- mean particle sizes were measured at 0.05, 0.5, 1,
phosphate backbone. An average mass of DNA 2, 8, 30, 60 and 120 hours following complex
phosphate group (P) of 330 Dalton was used; formation. The effect of increased DNA
concentration on particle aggregation, at a charge
of anionic phosphate. For Poly-l-lysine (PLL) ratio of 1.5, was also studied. Amount of DNA
solution, an average mass per charge of 128.2 was
calculated. For example, to obtain a theoretical d, in dropwise
-
of DNA (3 nanomoles) was mixed to 384.6 ng of CK3H2, Pal-CK3H3, Polyethylenimine (PEI) or
PLL (3 nanomoles). Similar calculations were Lipofectamine, to obtain a final DNA
performed to obtain other charge ratios. Rather concentration of 7.6, 15.2, 30.4, 45.6, 60.8 or
than using charge ratio, the term of 121.6 nM respectively. The effect of increasing
nitrogen/phosphate (N/P) ratio was attributed to charge ratio on particle size and zeta potential was
the cationic polymer of Polyethylenimine (PEI)
which under physiological conditions the nitrogen
residue (N+) of PEI only partly protonated.
However, in general both terms, either C/R or N/P containing Pal-CK2H, Pal-CK2H2, Pal-CK3H2, or
ratio, refer the molar ratio between negative Pal-CK3H3 to obtain charge ratios of 0.5, 0.75,
charges of DNA sugar-phosphate backbone and 1.0, 2.0, 3.0, 4.0 or 5.0, respectively.
positive charges of the protonated nitrogen
residues of transfection reagents. Mammalian Cell Culture Transfection
Particle Sizing and Zeta Potential The mammalian cells of COS7 (African
The mean particle size (nm) and zeta Kidney Green Monkey Cell lines) were cultured in
-lipopeptide complexes DMEM media supplemented with 10 % FCS, 100
were determined with a Zetasizer Nano Series ml streptomycin in
(Malvern Instruments, Worcestershire, UK). T flasks. Cells were grown at 37oC in a humidified
Calibration of particle sizes was carried out with incubator with 5 % CO2. The day before
60 nm + 2.7 nm NIST/NanosphereTM (Duke transfection, cells were seeded at 5 x 104 cells/well
Scientific Corp. Palo Alto, CA, USA) standard in the 24-well plates. After reaching a confluency
polystyrene spheres. For zeta potential calibration, of ~ 60-70 %, cells were washed with PBS twice.
the -50 mV + 5 mV Zeta Potential Standard The media were replaced with Opti-MEM® before
Transfer was used. The DNA- -transfection reagents
lipopeptide/transfection agent samples were were added (charge ratio of 1.5). Cells were
prepared in HEPES glucose buffer pH 7.4. The harvested and centrifuged at 13000 g for 2 minutes
mean particle sizes were measured at 25 oC using
disposable cuvettes (1.5 mL), the zeta potentials supernatant was used to measure the amount of
were determined at 25 oC using the folded luciferase released from the samples using
capillary cell/Smoluchowski cell (Malvern luciferase detection kit (Promega, NSW,
Instrument, UK). Australia). The Quantilum Recombinant
To study the stability to aggregation of the Luciferase (QRL) (Promega, NSW, Australia) was
DNA-lipopeptide complex, used as a standard for luciferase assays. For
(pCMV-Luc) was complexed in separate cuvettes, protein assa
with each of Pal-CK2H2, Pal-CK2H3, Pal-CK3H2 to measure the total protein using Bradford
or Pal-CK3H3 (at a charge ratio of 1.5) in a total of Reagent (Sigma Aldrich, NSW, Australia). Bovine
serum albumin (BSA) was used as a standard for
were 3 (three) methods to prepare the complex of protein assays.
DNA-Lipopetide to obtain desired charge ratio: (i)
method 1: amount of lipopeptide was added into
HEPES Glucose Buffer pH 7.4, (ii) method 2:

Page | 463
PROCEEDINGS
3. Results and Discussion larger volumes and using mechanical mixing

devices. We did investigate three different ways
a) Particle size distribution of dna- of mixing the dissolved reagents (see methods
above) to explore the degree to which the particle
lipopeptide complexes in hepes
size was dependent on method of mixing. As
glucose buffer ph 7.4 shown in Figure 3, the DNA-lipopeptide complex
preparation either using method-2 (Figure 3 A) or
One might expect that the method used to mix
method-3 (Figure 3 B) was relatively stable until
the transfection agent and DNA would have an
more than 30 hours. The particle size of
influence on particle morphology, and the
lipopeptide-DNA complexes prepared with
subsequent transfection efficiency. As many
method-1 which formed an aggregation is not
academic laboratories involved in transfection
shown.
studies, we did not have large enough quantities of
reagents to consider investigating the
manufacturing process in detail, i.e. making use of
Stability of the DNA-Lipopeptide complexes in HEPES Glucose Buffer pH 7.4 Stability of the DNA-Lipopeptide complexes in HEPES Glucose Buffer pH 7.4 (m3)
5200
4800 PalCK2H2 1000
PalCK2H2
4400 PalCK2H3
4000 PalCK3H2 800
PalCK2H3
Particle size (nm)

Particle size (nm)
3600 PalCK2H4
PalCK3H3
3200 PalCK2H5
600
2800
PalCK3H2
2400
2000 400
1600
1200 200
800
400
0
0 0.05 0.50 1.00 2.00 8.00 30.00 60.00 120.00
0.05 0.50 1.00 2.00 8.00 30.00 60.00 120.00 140.00
Time(hour)
Time(hour)
A B
Figure 3. The complex stability of DNA-
-2), B.
-3);
The particle sizes were measured using Nanosizer (Malvern, UK) over the time. Data
are represented as mean + SD of triplicate measurements (n=3).
b) Effect of DNA concentration on N/P 9 for PEI), the particle size of the complex is
particle size getting bigger as DNA concentration is increased.
This is not the case for lipopeptide, especially for
Lipofectamine and PEI are the most Pal-CK3H2 and Pal-CK3H3 where although the
transfection reagents used for in vitro non viral DNA concentration was increased up to more than
gene delivery vehicles. However, as it is shown in 120 nmoles, their particle sizes are relatively stable
Table 2, although the charge ratio of transfection at approximately 200 – 400 nm.
reagents and DNA is kept constant (CR 1.5 and
Page | 464
PROCEEDINGS
Table 2. Effect of DNA concentration on the particle size (nm) of DNA-transfection reagent
*)
[DNA]. Particle sizes (nm). mean + standard deviation on Charge Ratio 1.5 at pH 7.4
nmoles
PalCK3H2 PalCK3H3 PEI (N/P) 9 Lipofectamine
7.60 355 + 10.7 224 + 8.8 493 + 3.9 855 + 10.0
15.20 305 + 2.6 266 + 33.8 553 + 22.9 2138 + 573.2
30.40 313 + 17.6 226 + 13.2 877 + 11.5 2480 + 23.5
45.60 255 + 9.6 184 + 2.2 4369 + 426.9 4590 + 29.9
60.80 400 + 4.9 184 + 0.9 6319 + 1033.1 5663 + 1574.9
121.60 397 + 28.6 275 + 10.2 9359 + 591.8 8490 + 69.8
NoteEffect of DNA concentration on the particle size of DNA-transfection reagent complexes at charge
30.40, 45.60, 60.80 or 121.60 nmoles DNA (method-2). The particle sizes were measured using Nanosizer
(Malvern, UK). Data are represented as mean + SD of triplicate measurements (n=3).
c) Effect of Charge Ratio on particle followed by dramatic decreased in particle size.

size and zeta potential Meanwhile, increasing charge ratio will be
followed by increasing zeta potential. As shown in
The present of amino acid of lysine in Figure 4. B, at charge ratio of 0.5, the zeta
lipopeptide is very crucial in compacting the DNA potential value is negative. In this point, the
as shown in Figure 4.A. Compared to other particle of DNA-lipopeptide would not be taken up
lipopeptides which have 2 or 3 lysine molecules, by the cells as cell surface is also negatively
the particle size of DNA-PalCKH2 is the largest charge. However, it should be considered that if
even in an increased charge ratio up to 5. This is the particle is too positively charge, it would bind
because, the lipopeptide has only one lysine to plasma protein as a result it would be cleared
molecule which has not efficient enough to from blood circulation very fast. In practice,
condense the DNA molecules which have particle complex of DNA-transfection reagent is
negatively charge. All lipopeptide molecules usually designed to be positively charge but should
which have 2 or 3 lysine molecules condensed not exceed + 20 mV in zeta potential value.
DNA molecules efficiently at low charge ratio.
However, an increased charge ratio up to 5 is not
A Effect of charge ratio on particle size on

DNA-transfection reagent complex formation
3000
2700 PalCKH2
2400 PalCK2H2
2100 PalCK3H2
Particle sizes (nm)
1800
PalCK3H3
1500
1200
900
600
300
0
0.50 0.75 1.00 1.50 2.00 3.00 4.00 5.00
Cha rge Ra tios
Page | 465
PROCEEDINGS
Effect of charge ratio on zeta potential of

B DNA-transfection reagent complex formation
30
25
20
15
Zeta potential (mV)
10
0
0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5
-5
Charge Ratios
-10
PalCKH2
-15
PalCK2H2
-20
PalCK3H2
-25 PalCK3H3
-30
Figure 4. A. Effect of charge ratio on particle size of the DNA-
containing lipopeptide (method-2).

B. Effect of charge ratio on zeta potential of DNA-
7.4 containing lipopeptide (method-2) to obtain 0.5, 0.75, 1.0, 1.5, 2.0, 3.0, 4.0, or 5.0 charge
ratios. The particle sizes and zeta potentials were measured using Nanosizer (Malvern, UK).
Data are represented as mean + SD of triplicate measurements (n=3).
d) Effect of histidine and lysine < Pal-CK2H4). The increasing size of the particle
inclusion on lipopeptide ability to is also followed by increasing polydispersity index
(PDI), meaning that the particle formed was tend
compact dna molecules to aggregate as the PDI value is getting bigger. In
contrast, the zeta potential value is decreased as
The histidine inclusion in lipopeptide structure
the number of histidine is increased (Pal-CK2H2 >
is aimed to provide the endosomal escaping
Pal-CK2H3 > Pal-CK2H4). Inclusion histidine
ability, since it has a weak base characteristic.
more than 4, causing the particle is forming
However, due to the bulkiness of the histidine, this
sediment, as the particle size is too big to be
inclusion resulted in an increased in particle size as
measured with the Zetasizer Nano ZS (Malvern,
shown in Table 3. It is very obvious that as
UK).
number of histidine is increasing, it is followed by
increasing particle size (Pal-CK2H2 < Pal-CK2H3
Table 3. Effect of histidine and lysine inclusion in lipopeptide structures on mean particle size. zeta
potential and polydispersity of DNA-lipopeptide complexes at a charge ratio of 1.5 in
HGB pH 7.4
Lipopeptide Particle size (nm) PDI Zeta potential (mV)
mean ± SD mean ± SD mean ± SD
Pal-CKH2 688 + 27.8 0.77 + 0.05 3.57 + 1.67
Pal-CK2H2 240 ± 4.1 0.31 ± 0.03 13.17 ± 0.74
Pal-CK2H3 254 ± 6.2 0.35 ± 0.04 5.44 ± 0.28
Pal-CK2H4 724 ± 317.0 0.67 ± 0.18 1.53 ± 0. 25
Pal-CK2H5 Sedimentation* - -
Pal-CK3H3 247 + 3.3 0.27 + 0.001 6.28 + 0.48
measurements (n = 3). *) Sedimentation; the complex solution quickly formed aggregates that sedimented,
therefore their mean particle sizes and other particle properties could not be measured with the Zetasizer
Nano ZS (Malvern, UK).
Page | 466
PROCEEDINGS
e) Transfection Efficiency of DNA- transfection efficiency results. Nevertheless, the

Lipopetide on COS7 Cell Lines complex of DNA-lipopeptide (charge ratio of 1.5,
To date, Lipofectamine (TM) is regarded as since this particle tend to aggregate (data not
the golden standard for in vitro transfection. As shown). We speculate that higher transfection
shown in Figure 5, the highest transfection efficiency of particle complex prepared by method
efficiency is given by Lipofectamin (TM), where it 1 compared to method 3 is due to the particle
was insensitive to mixing method and was complex of DNA-transfection reagents enter the
significantly more effective than PEI or the most COS7 cells when these cells are dividing. It might
effective Pal-CKmHn lipopeptide. However, it not happen when transfection process is carried out
should be noted that the transfection efficiency of in non-dividing cells where the aggregate particles
lipopeptide is comparable to those given by PEI. It will not be easy to enter the cell nucleus.
was clear that method 2 and 3 gave better
10 4
m1 m2 m3
ng luc/mg protein
10 3
10 2
10 1
PalCK2H2 PalCK2H4 PalCK3H2 PEI Lipofectamine
Transfection Reagents (Charge Ratio 1.5)
Figure 5. Transfection efficiency of DNA - lipopeptide particle on COS-7 at charge ratio 1.5 (DNA =
-1: Amount of transfection reagent is
added into DNA solution. Method- , then it
. Method-3: DNA was diluted in
+ SD of
triplicate measurements (n=3).
As shown in Figure 5, the transfection 4. Conclusion and Further Direction

efficiency of lipopeptide bearing 3 lysine residues
(Pal-CK3H2) is higher slightly compared to those The Palmitoyl-based lipopeptides have ability
lipopeptide bearing 2 lysine residues (Pal- to make a nanoparticle when it was complexed
CK2H2). Furthermore, the transfection efficiency with DNA plasmid. The lipopeptide has potency to
of Pal-CK3H2 is comparable to PEI. However, it be used as an efficient gene delivery vehicle by
is very obvious that the transfection efficiency of further optimizing the structure of lipopeptide. The
Pal-CK2H4 is significantly lower than Pal-CK2H2 addition of lysine residue on lipopeptide decreases
and Pal-CK3H2. It suggested that inclusion more the size of the complex, meanwhile addition of
histidine residues on lipopeptide make the histidine residue tend to increase the size of DNA-
transfection reagent less efficient partly due to the lipopeptide complexes as well as its zeta potential.
enlarging particle size and increasing The present of histidine residue on lipopeptide
polydispersity of the complex lipopeptide-DNA provide the complex to escape from endosomal
which hinder the cell uptake and subsequent gene degradation before it enters the cell nucleus. The
delivery process. transfection efficiency of palmitoyl-based
Page | 467
PROCEEDINGS
lipopeptide is comparable to that of branched PEI [7] Chesnoy S and Huang L (2000) Structure and
(poly-etyleneimine). function of lipid-DNA complexes for gene
The present of alkyl chain and amino acid delivery. Annu Rev Biophys Biomol Struct
residues have to be optimum in condensing DNA 29:27-47.
molecules in compact size yet it should release the
DNA molecules before entering cell nucleus. For [8] Dauty E, Remy JS, Blessing T and Behr JP
further research, in order the complex of (2001) Dimerizable cationic detergents with a
lipopeptide-DNA to enter cell nucleus especially in low cmc condense plasmid DNA into
non-dividing cells, the DNA should be coupled or nanometric particles and transfect cells in
complexed with a sequences such as nuclear culture. J Am Chem Soc 123(38):9227-9234.
localization sequence derived from
Cytomegalovirus (CMV) or trans-activating [9] Demeneix B, Behr J, Boussif O, Zanta MA,
transcriptional activator (TAT) from human Abdallah B and Remy J (1998) Gene transfer
immunodeficiency virus 1 (HIV-1) to improve the with lipospermines and polyethylenimines.
cell uptake. Adv Drug Deliv Rev 30(1-3):85-95.
[10]Dubruel P, Christiaens B, Rosseneu M,

Acknowledgement
Vandekerckhove J, Grooten J, Goossens V
This work was part of my PHD project which was and Schacht E (2004) Buffering properties of
funded by Australian Aid Scholarship (AusAIDS, cationic polymethacrylates are not the only
2002-2007. key to successful gene delivery.
Biomacromolecules 5(2):379-388.
References [11] Felgner JH, Kumar R, Sridhar CN, Wheeler
[1] Akinc A, Thomas M, Klibanov AM and CJ, Tsai YJ, Border R, Ramsey P, Martin M
Langer R (2005) Exploring polyethylenimine- and Felgner PL (1994) Enhanced gene
mediated DNA transfection and the proton delivery and mechanism studies with a novel
sponge hypothesis. J Gene Med 7(5):657-663. series of cationic lipid formulations. J Biol
Chem 269(4):2550-2561.
[2] Behr JP (1997) The proton sponge: a trick to
enter cells the virus did not exploit. Chimia [12] Florea BI, Meaney C, Junginger HE and
51:34-36. Borchard G (2002) Transfection efficiency
and toxicity of polyethylenimine in
[3] Blessing T, Remy JS and Behr JP (1998) differentiated Calu-3 and nondifferentiated
Monomolecular collapse of plasmid DNA into COS-1 cell cultures. AAPS PharmSci
stable virus-like particles. Proc Natl Acad Sci 4(3):E12.
U S A 95(4):1427-1431.
[13] Funhoff AM, van Nostrum CF, Koning GA,
[4] Boussif O, Lezoualc'h F, Zanta MA, Mergny Schuurmans-Nieuwenbroek NM, Crommelin
MD, Scherman D, Demeneix B and Behr JP DJ and Hennink WE (2004) Endosomal
(1995) A versatile vector for gene and escape of polymeric gene delivery complexes
oligonucleotide transfer into cells in culture is not always enhanced by polymers buffering
and in vivo: polyethylenimine. Proc Natl Acad at low pH. Biomacromolecules 5(1):32-39.
Sci U S A 92(16):7297-7301.
[14] Godbey WT, Wu KK, Hirasaki GJ and Mikos
[5]Boussif O, Zanta MA and Behr JP (1996) AG (1999) Improved packing of
Optimized galenics improve in vitro gene poly(ethylenimine)/DNA complexes increases
transfer with cationic molecules up to 1000- transfection efficiency. Gene Ther 6(8):1380-
fold. Gene Ther 3(12):1074-1080. 1388.
[6] Cheng J, Zeidan R, Mishra S, Liu A, Pun SH, [15] Hirsch-Lerner D, Zhang M, Eliyahu H, Ferrari
Kulkarni RP, Jensen GS, Bellocq NC and ME, Wheeler CJ and Barenholz Y (2005)
Davis ME (2006) Structure-function Effect of "helper lipid" on lipoplex
correlation of chloroquine and analogues as electrostatics. Biochim Biophys Acta
transgene expression enhancers in nonviral 1714(2):71-84.
gene delivery. J Med Chem 49(22):6522-
6531. [16] Huth S, Lausier J, Gersting SW, Rudolph C,
Plank C, Welsch U and Rosenecker J (2004)
Page | 468
PROCEEDINGS
Insights into the mechanism of [26] Ogris M, Steinlein P, Kursa M, Mechtler K,

magnetofection using PEI-based Kircheis R and Wagner E (1998) The size of
magnetofectins for gene transfer. J Gene Med DNA/transferrin-PEI complexes is an
6(8):923-936. important factor for gene expression in
cultured cells. Gene Ther 5(10):1425-1433.
[17] Igarashi S, Hattori Y and Maitani Y (2006)
Biosurfactant MEL-A enhances cellular [27] Pack DW, Putnam D and Langer R (2000)
association and gene transfection by cationic Design of imidazole-containing
liposome. J Control Release 112(3):362-368. endosomolytic biopolymers for gene delivery.
Biotechnol Bioeng 67(2):217-223.
[18] Ihm JE, Han KO, Han IK, Ahn KD, Han DK
and Cho CS (2003) High transfection [28] Pelisek J, Gaedtke L, DeRouchey J, Walker
efficiency of poly(4-vinylimidazole) as a new GF, Nikol S and Wagner E (2006) Optimized
gene carrier. Bioconjug Chem 14(4):707-708. lipopolyplex formulations for gene transfer to
human colon carcinoma cells under in vitro
[19] Kim TH, Kim SI, Akaike T and Cho CS conditions. J Gene Med 8(2):186-197.
(2005) Synergistic effect of
poly(ethylenimine) on the transfection [29]Pichon C, Roufai MB, Monsigny M and
efficiency of galactosylated chitosan/DNA Midoux P (2000) Histidylated oligolysines
complexes. Journal of Controlled Release increase the transmembrane passage and the
105(3):354-366 biological activity of antisense
oligonucleotides. Nucleic Acids Res
[20]Kumar VV, Pichon C, Refregiers M, Guerin 28(2):504-512.
B, Midoux P and Chaudhuri A (2003) Single
histidine residue in head-group region is [30] Pouton CW, Lucas P, Thomas BJ, Uduehi
sufficient to impart remarkable gene AN, Milroy DA and Moss SH (1998)
transfection properties to cationic lipids: Polycation-DNA complexes for gene delivery:
evidence for histidine-mediated membrane a comparison of the biopharmaceutical
fusion at acidic pH. Gene Ther 10(15):1206- properties of cationic polypeptides and
1215. cationic lipids. J Control Release 53(1-3):289-
299.
[21] Lleres D, Dauty E, Behr JP, Mely Y and
Duportail G (2001) DNA condensation by an [31] Pouton CW and Seymour LW (1998) Key
oxidizable cationic detergent. Interactions with issues in non-viral gene delivery. Adv Drug
lipid vesicles. Chem Phys Lipids 111(1):59- Deliv Rev 34(1):3-19.
71.
[32] Rejman J, Bragonzi A and Conese M (2005)
[22]Lucas P, Milroy DA, Thomas BJ, Moss SH Role of clathrin- and caveolae-mediated
and Pouton CW (1999) Pharmaceutical and endocytosis in gene transfer mediated by lipo-
biological properties of poly(amino and polyplexes. Mol Ther 12(3):468-474.
acid)/DNA polyplexes. J Drug Target
7(2):143-156. [33]Ross PC and Hui SW (1999a) Lipoplex size is
a major determinant of in vitro lipofection
[23]Midoux P, Mendes C, Legrand A, Raimond J, efficiency. Gene Ther 6(4):651-659.
Mayer R, Monsigny M and Roche AC (1993)
Specific gene transfer mediated by [34]Ross PC and Hui SW (1999b) Polyethylene
lactosylated poly-L-lysine into hepatoma cells. glycol enhances lipoplex-cell association and
Nucleic Acids Res 21(4):871-878. lipofection. Biochim Biophys Acta
1421(2):273-283.
[24] Midoux P and Monsigny M (1999) Efficient
gene transfer by histidylated polylysine/pDNA [35] Scarzello M, Chupin V, Wagenaar A, Stuart
complexes. Bioconjug Chem 10(3):406-411. MC, Engberts JB and Hulst R (2005a)
Polymorphism of pyridinium amphiphiles for
[25] Mishra S, Webster P and Davis ME (2004) gene delivery: influence of ionic strength,
PEGylation significantly affects cellular helper lipid content, and plasmid DNA
uptake and intracellular trafficking of non- complexation. Biophys J 88(3):2104-2113.
viral gene delivery particles. Eur J Cell Biol
83(3):97-111.
Page | 469
PROCEEDINGS
[36] Scarzello M, Smisterova J, Wagenaar A, efficient gene delivery. Bioconjug Chem

Stuart MC, Hoekstra D, Engberts JB and Hulst 19(4):940-950
R (2005b) Sunfish cationic amphiphiles:
toward an adaptative lipoplex morphology. J [41] Wasungu L and Hoekstra D (2006) Cationic
Am Chem Soc 127(29):10420-10429. lipids, lipoplexes and intracellular delivery of
genes. J Control Release 116(2):255-264.
[37] Sonawane ND, Szoka FC, Jr. and Verkman
AS (2003) Chloride accumulation and [42] Xu Y and Szoka FC, Jr. (1996) Mechanism of
swelling in endosomes enhances DNA transfer DNA release from cationic liposome/DNA
by polyamine-DNA polyplexes. J Biol Chem complexes used in cell transfection.
278(45):44826-44831.. Biochemistry 35(18):5616-5623
[38] Tachibana R, Harashima H, Ide N, Ukitsu S, [43] Zabner J, Cheng SH, Meeker D, Launspach J,
Ohta Y, Suzuki N, Kikuchi H, Shinohara Y Balfour R, Perricone MA, Morris JE, Marshall
and Kiwada H (2002) Quantitative analysis of J, Fasbender A, Smith AE and Welsh MJ
correlation between number of nuclear (1997) Comparison of DNA-lipid complexes
plasmids and gene expression activity after and DNA alone for gene transfer to cystic
transfection with cationic liposomes. Pharm fibrosis airway epithelia in vivo. J Clin Invest
Res 19(4):377-381. 100(6):1529-1537.
[39] Takei K and Haucke V (2001) Clathrin- [44] Zuidam NJ and Barenholz Y (1998)
mediated endocytosis: membrane factors pull Electrostatic and structural properties of
the trigger. Trends Cell Biol 11(9):385-391. complexes involving plasmid DNA and
cationic lipids commonly used for gene
[40] Tarwadi. Jazayeri JA, Prankerd RJ and Pouton delivery. Biochim Biophys Acta 1368(1):115-
CW (2008) Preparation and in vitro evaluation 128.
of novel lipopeptide transfection agents for
Page | 470
PROCEEDINGS
TOPIC FIELD: MICROBIOLOGY

BIOTECHNOLOGY
Page | 471
PROCEEDINGS
OPTIMIZATION OF CHITINASE PRODUCTION FROM

BACILLUS SP WS 4F
Nuur Faridatun Hasanah, Deden R Waltam, Siswa Setyahadi, Dewi Nandyawati,

Djamil, Farah Nabila
Center for Bioindustrial Technology, Laboratories for Technology Development of Agro-Biomedical

Industries,
(LAPTIAB)- BPPT, Puspiptek-Serpong #611, Tangerang Selatan 15314, Indonesia
Email:nuur.faridatun@bppt.go.id
Abstract
The aim of this study was to determine the optimum media composition for chitinase production
in laboratory scale. Optimization activity has been conducted for chitinase production on several media
by B.licheniformis WS 4F and chitinase activity assay has been evaluated. Laboratory scale test
production in 1 L of media was performed using M9 media which are consisted of some minerals such as
0,065 % of Na2HPO4, 0,15 % of KH2PO4, 0,025% of NaCl, 0,05% of NH4Cl, 0,012% of MgSO4 ,
0,0005 % of CaCl2 . And it was enhanced by chitin source using 40 mesh of dry shrimp shell and chitin
flakes by various concentration ( 2% dan 3%). Moreover, 40 mesh of N fish flour as nitrogen source was
also added as additional ingredients with a variety of concentration (0,5%, 1%, 1.5%, 2% and 3%). The
optimum temperature as operating condition for fermentation process were 37 0C and agitation rate by
150 rpm during 120 hours. The result showed that production media composition 1, which are consisted
of M9, 3% of intact shrimp shell and 3% of N fish flour, produced the optimum chitinase activity at 24
hours with 0,052 U/ml. While the production media composition 2 (M9, 3% of chitin flakes and 3% of N
fish flour) produced the best chitinase activity at 24 hours too with 0,064 U/ml. Furthermore,
confirmation for chitinase production on optimum media selected was conducted again during 24 hours
and 48 hours by 200 rpm agitation rate and it produced chitinase activity by 0,15 U/ml and 0,23 U/ml
respectively. The application of chitinase for obstructing Ganoderma lucidum growth on coconut palm
trees will be performed later.
Keywords : Chitinase, B.licheniformis, laboratory scale, chitin flakes, shrimp shell, agitation,
G.lucidum
1. Introduction nature, which suggests the existence of a biological

mechanism for its utilization that involves
Chitin is a most essential element of invertebrate chitinolytic enzymes. In the field of biotechnology,
exoskeletons. It is consists of a P-(1,4)-linked unit agriculture, health and environment, chitinases and
of the polymer of N- acetyl D-glucos-amine it‘s result from hydrolysis process has recently
(GlcNAc) which is commonly dispensed in nature, been applied frequently. As hydrolytic enzyme,
predominantly as a structural of polysaccharide in chitinase can degrade chitin to its mono-, di- and
fungal cell walls [1] . Chitin, in insects, is a oligomers [12]. Chitinases may be produced by
structure that support cuticle on epidermis and many bacterial strains which can be isolated,
trachea as peritropic matrix covers intestine characterized and purified for research application.
epitelium. Chitin may be degraded by using Those bacteria are members of species
chitinase enzyme that secreted by bacteria, fungi, Chromobacterium [11], Pseudomonas [18],
some plants and animals. Bacillus [20], Paenibacillus [19], Erwinia [5],
Chitinases are hydrolytic enzymes that break down Vibrio [10], and Streptomyces [ 15]. Most of them
chitin to its mono- and oligomers. Although chitin are members of genera Chromobacterium [5],
is hard to degrade, it does not accumulate in Paenibacillus [10], Erwinia [15], Vibrio [9],
Page | 472
PROCEEDINGS
Serratia [9], Pseudomonas [21], Bacillus [11,19 b) Refresh of bacteria

],and Streptomyces [20]. Fungal trains
Trichoderma harzianum and Aspergillus niger are LB (Luria Bertani) medium is used for
also prospective chitinase- producing strains [14, refreshing bacteria and production of chitinase
3]. Chitinolitic bacteria can produce enzyme with an addition of 3% chitin flakes
macromolecule degradative enzyme which can and shrimp shell waste water. LB media
break down the cell wall of fungi such as an containing 1% Pepton, 1% Yeast Extract and
extracellular enzyme, chitinase [23]. Chitinase 0.5% NaCl with an addition of 2% technical
work mechanism for hydrolysing chitin in agar powder for solid LB media. The media
pathogen fungi is related to chitin contained in the dissolved in RO water then set to pH 7. The
cell wall of fungi, so that it can be used by enzyme media then sterilized in an autoclave at 1210C
as a substrate [19]. for 15 minutes.
Microbial chitinase can be produced by submerge
fermentation, continuous fermentation, and fed- c) Making of calibration Curve of N-
batch fermentation. In addition, solid-state
fermentation and biphasic cell systems have also
Acetyl-glucosamine
been used for the chitinase production. The
production of chitinase conducted by extracellular The making of standard curve is based on
at certain condition is reported to be affected by absorbance value of NAG stock solution of
media compositions such as carbon sources, various concentrations. NAG concentrations
nitrogen sources, and agricultural residues [6]. used are 0; 0.05; 0.1; 0.15;0,2; 0.25; 0.3; 0.35;
0.4 and 0.5 mg/mL of NAG. The NAG
2. Materials andMethods concentration then dissolved with RO water to
reach total volume of 0.6 ml. Each
Materials: concentration then added with 0.6 ml of DNS
and incubated in boiled water during 15
WS 4F was isolated by screening of minutes and the absorbance measured at
B.licheniformis strains. Chitin flakes, dry shrimp X540nm.
shell, fish flour rich in nitrogen, cholloidal of
chitin, DNS (Di-Nitro-salicyl) reagen, M9 media d) Production of chitinase enzyme in
which are consisted of some minerals such as
0,065% of Na2HPO4, 0,15 % of KH2PO4, 0,025%
Laboratory Scale 1 ( 300 ml)
of NaCl, 0,05% of NH4Cl, 0,012% of MgSO4 ,
The bacteria isolate from slant agar were
0,0005 % of CaCl2 , and Spektrofotometer
inoculated by taking 2-3 loop into 5 ml of
Genesys.
liquid LB medium. The operation conditions
of incubation are at 370C, pH 7.0 and 150 rpm
Method : for 12 hours. After 12 hours of incubation, 1
ml of pre-culture were then inoculated into 10
a) Production of chitin colloidal ml of liquid LB medium and incubated in the
same operation conditions for 6 hours. The
Substrate of chitin colloidal was used
culture media were then inoculated into 100
for production media of chitinase and substrate
mL of production media that consist of 3%
of chitinase activity assay. Chitin colloidal
chitin flakes then incubated in the same
was made by Wen et al (2002) technique.
operation conditions for 3 days. Sample of
Production method of chitin colloidal substrate
supernatant were taken after centrifuged at
is explained as the following :
40C.and 6000 rpm for 15 minutes.
Total of 5g chitin flakes were stirred
slowly into 60 ml of 10N HCl at temperature
of 40C then stirred overnight. The suspension e) Production of chitinase laboratory scale
then added into 2L of 50% cold ethanol while of 1L
continuously stirred overnight at 250C. The
suspension then precipitate by centrifuged at Basically, the productions of chitinase in flask
40C and 5000 rpm for 20 minutes then washed of 1L were similar to 300 ml laboratory scale
by RO water until reach pH 7. except the media used. Optimization of M9
media were conducted with various
compositions of chitin and nitrogen source.
Chitin sources obtained by 40 mesh of dry
shrimp shell and various concentrations (2%
Page | 473
PROCEEDINGS
and 3%) of chitin flakes while Nitrogen source Figure 1. The comparison of chitinase acitivity
obtained by 40 mesh of N fish flour to be between M9 + 2% of shrimp shell andM9 + 3%
added as additional ingredients with various of shrimp shell production media at operating
concentrations (0.5%, 1%, 1.5%, 2% and 3%). condition : temperature 37 0C.pH 7.0 and
The optimum operating conditions for agitation rate by 150 rpm.
fermentation process were at 37 0C and 150
rpm during 120 hours. This experiment investigated how chitin
can affect the production of chitinase with the
f) Enzyme assay difference of chitin source percentage. Using
media composition M9 + 3% of shrimp shell,
Chitinase activity was measured by modified chitinase activity prompt to be higher than using
Miller method. The mixture of 0,3 mL of 1% 2% of shrimp shell. Optimization for incubation
colloidal chitin and 0.3 mL enzyme were period was conducted for 120 hours. There was no
incubated at 370C for 30 minutes. Reaction significant increasing in every 24 hour for both
then stopped by adding 0.6 mL of Di-Nitro- media composition variation.
Salicylic Acid Reagent. As for control, enzyme
was added after the addition of Di-Nitro-
Salicylic Acid. The mixture then centrifuged to
suspend chitin waste that has not been
hydrolyzed. It was then heated for 15 minutes
in boiling water bath and then cooled under
running tap water. The absorbance then
measured in spectrophotometer at X540nm.

The production of chitinase from
B.licheniformis WS4F was conducted through
extracellular fermentation at optimum condition
which the temperature for fermentation process
were 37 0C,pH 7,0 and agitation rate by 150 rpm.
The previous study by Wahyuntari et al, reported Figure 2. The comparison of chitinase acitivity
that WS4F isolate can produce an optimum between M9 + 2% of shrimp shell + 0.5 % of N
chitinase at 37 0C and pH 7,0. In this study, the fish flour and M9 + 3% of shrimp shell + 0.5 %
enhancement of chitinase activity can be obtained of N fish flour production media at operating
from composition optimization, incubation period condition : temperature 37 0C.pH 7.0 and
and increasing agitation rate. Optimization for agitation rate by 150 rpm.
chitinase production were carried out by several
media composition until we got an optimum As a source of nitrogent, fish flour rich in N
chitinase activity. The production of chitinolytic was added into M9 and 3% of shrimp shell. And
enzymes in bacteria is commonly stimulateed by chitinase activity increased by 10 %. The
the presence of chitin in the production media fermentation time was kept for 120 hours. From
(Monreal and Reese 1969). this result, nitrogent content in fish flour lead to a
rise of chitinase activity due to the reactivity
a) The effect of media composition and
towards other ingredients which can bind other
incubation periods for chitinase activity
substrate directly. In addition, nitrogen can
enhance cell mass in fermentation process.
Therefore, the microorganisme can grow
considerably and produce an optimum chitinase.
After getting an increase in chitinase activity by
adding nitrogen source, the production was
performed again by rising N fish flour respectively
by 1.5 %, 2% and 3%. The aim of this experiment
is to investigate the ability of nitrogen source to
enhance the activity of chitinase. And how it has
an effect on enzymatic reaction efficiency of
chitinase.
Page | 474
PROCEEDINGS
Figure 5. Tthe production of chitinase by using

M9 + 3% of shrimp shell + 3% of of Nfish flour
during 24 hours of fermentation time.
b) The effect of agitaftion level for chitinase

Figure 3. The comparison of chitinase acitivity activity
between M9 + shrimp shell + Nfish flour and
M9 + chitin flakes + N fish flour production After getting an optimum of production
media by various concentration of N fish flour media, an optimization of agitation level
at operating condition : temperature 3 7 0C.pH performed to investigate an enhancement of
7.0 and agitation rate by 150 rpm. chitinase activity.
Production media that consists of M9, 3%

of chitin flakes and 3% of of N fish flour showed
the highest of chitinase activity at 24 hours.
Overall, the variation on the increasing quantity of
N fish flour on this media optimization fluctuated
from 24 hours until 120 hours. Also, the trend
tends to be the same which always decrease after
24 hours.
The confirmation for the result for the
optimum media composition was carried out by
conducting chitinase production in 1 L scale by
using M9 + 3% of chitin flakes + 3% of of N fish Figure 6. Optimization of agitation level for
flour and M9 + 3% of shrimp shell. chitinase production, conducting by 200 rpm.
During 48 hours (run I), by increasing

agitation level (200 rpm), chitinase activity also
Chitinase Activity
rise by 25% compare to the 150 rpm level of

agitation. Agitation has an effect on enzymatic
reaction efficiency of chitinase. It can enhance
(U/ml)
reaction rate and lead to the reaction can move to

the production of chitinase.
Figure 4. Confirmation for production of

chitinase by using M9 + 3% of chitin flakes +
3% of of Nfish flour during 120 hours of
fermentation time.
Further experiment conducted for only 24

Figure 7. Confirmation of agitation level
hours based on the previous result which obtained
optimization for chitinase production.
the highest chitinase activity at 24 hours. It means
conducted by 200 rpm.
that the optimum fermentation period was 24 hours
for both media compostion variation.
Page | 475
PROCEEDINGS
Agitation rate optimization during 48 hours Aspergillus niger LOCK 62 and its
as confirmation for the second running showed potential role in the biological control. Curr.
that both on chitinase I and II, the highest enzyme Microbiol. 2012, 65, 666-672.
activity was reached at 12 hours. It increased as
86% of chitinase activity for enzyme I higher than [4] Brunner, F., Stintzi, A., Fritig, B.,Legrand,
run I . Whilst enzyme II rose as only 22.67%. M., Substrate specificities of tobacco
However, after 12 hours of fermentation periods, chitinases. Plant J. 1998, 14, 225-234.
the enzyme activity decreased as 55% in average. [5] Chernin, L. S., Winson, M. K., Thompson,
And the decline of activity for enzyme II was J. M., Haran, S. et al.,. Chitinolytic
about 31%. From this result, in conclusion, 200 activity in Chromobacterium violaceum:
rpm of agitation rate was an optimum operation Substrate analysis and regulation by
condition for chitianse production by the optimum quorum sensing. J. Bacteriol. 1998, 180,
media. In average, chitinase activity at 12 hours for 4435-4441.
running II agitation optimization, increased
aproximately 87% compare to the previous [6] Dahiya, N., Tewari, R.P., Hoondal,
running. Although, after 12 hours it decreased GS.2005. Chitinase from Enter obacter sp.
slightly about 57%. To summarise, 200 rpm NRG4: Its purification, characterization
agitation was optimum during 12 hours of and reaction pattern. Electronic Journal of
fermentation process. The cell bacteria was no Biotechnology Vol.8, 134-145.
longer active and had an optimum growth to
produce chitinase. [7] Jacobsen, S., Mikkelsen, J. D., Hejgaard, J.,
. Characterization of two antifungal
4. Conclusion endochitinases from barley grain. Physiol.
Plant. 1990, 79, 554-562.
a) Chitinolitic bacteria can produce chitinase [8] Junianto (2008). Process Design and
which are able to degrade chitin to its mono-. Enhancement Extraction Scale of Chitin
di- and oligomers. from Shrimp Skin Biologycally. Post
b) Media compostion have a significant effect on Graduate School of Bogor Institute of
the chitinase production. In addition. mineral Technology. Bogor (ID).
plays a pivotal role as cofactor which is
required for enhancing enzyme activity. [9] Kadokura, K., Rokutani, A., Yamamoto,
c) The optimum fermentation periods to produce M., Ikegami, T. et al., Purification and
the highest chitinase activity using optimum characterization of Vibrio parahaemolyticus
production media is 24 hours. extracellular chitinase and chitin
d) Agitation rate lead to increase chitinase oligosaccharide deacetylase involved in the
activity. The 200 rpm agitation was optimum production of heterodi saccharide from
during 12 hours of fermentation process. Then, chitin. Appl. Microbiol. Biotechnol. 2007,
the cell of bacteria was no longer active and did 75, 357-365.
not have an optimum growth to produce
chitinase. [10] Kao, P. M., Tsai, P, Liu, Y. C., Chang, YC.,
Optimization of cultivation conditions for
the production of chitinase from
References
Paenibacillus sp CHE- N1. J. Chin. Inst.
Chem. Eng. 2006, 37, 355-363.
[1] Adrangi, S. Paramarzi, M.A. From bacteria
to human: A journey into the world of [11] Mitsutomi, O., Isono, M., Uchiyama, A.,
chitinases. Research review paper. Nikaidov, N. et al., Chitosanase activity of
Biotechnology Advances. JBA- 06743; No the enzyme previously reported as P- 13-
of Pages 10. 14-glucanase from Bacillus circulans WL
12. Biosci. Biotech-nol. Biochem. 1998,
[2] Boot, R. G, Blommaart, E. F., Swart, 62,2107-2114.
E.,Ghauharali-van der Vlugt, K. et al.,
Identification of a novel acidic mammalian [12] Muzzarelli, R. A. A., Analytical
chitinase distinct from chitotriosidase. J. biochemistry and clinical significance of N-
Biol. Chem. 2001, 276, 6770-6778. acetyl-beta-D glucosaminidase and related
enzymes, in: Jolles, P, Muzzarelli, R. A. A.
[3] Brzezinska, M. S., Jankiewicz, U., (Eds.), Chitin and Chitinases, Birkhauser
Production of antifungal chitinase by Verlag, Basel 1999, pp. 235-247.
Page | 476
PROCEEDINGS
[13] Monreal, J. and E. T. Reese (1969). "The [19] Stoykov, YM. Pavlov, A.I. Krastanov, A.I.
chitinase of Serratia marcescens." Can. J. Chitinase biotechnology: Production,
Microbiol. 15 : 689-696. purification, and application. Engineering in
Life Science journal. ng. Life Sci. 2015, 15,
[14] Nampoothiri, K. M., Baiju, T. V, Sandhya, 30-38.
C., Sabu, A. et al., Process optimization for
antifungal chitinase production by [20] Takayanagi, T., Ajisaka, K., Takiguchi, Y,
Trichoderma harzianum. Process Biochem. Shimahara, K., Isolation and
2004, 39, 1583-1590. characterization of thermo stable chitinases
from Bacillus licheniformis X-74. Biochim.
[15] Pirhonen, M., Flego, D., Heikinheimo, R., Biophys. Acta 1991, 1078, 404-410.
Palva, E. T., A small diffusible signal
molecule is responsible for the global [21] Wang,S.L.,Chang,W.T.,Purification and
control of virulence and exoenzyme characterizationo two bifunctional
production in the plant pathogen chitinases/lysozymes extracellularly
Erwiniacarotovora. EMBO J. 1993, 12, produced by Pseudomonas aeruginosa K-
2467-2476. 187 in shrimp and crab shell powder
medium. Appl.Environ.Microbiol. 1997,
[16] Renkema, G.H.,Boot, R.G,Muijsers, A. 63, 380-386.
O.,Donker Koopman, W. E. et al.,
Purification and characterization of human [22] Watanabe, T., Kanai, R., Kawase,
chitotriosidase, a novel member of the T.,Tanabe, T. et al., Famly 19 chitinases of
chitinase family of proteins. J. Biol. Chem. Streptomyces species: characterization and
1995, 270, 2198-2202. distribution. Microbiology 1999, 145, 3353-
3363.
[17] Silva, W.O.B et al. 2005. Production and
Extraction of an extracellular kitinase from [23] Wahyuntari, B., Setyahadi, S.,
the entomopathogenic fungus Metarhizium Mangunwardoyo, W. 2008. Poster
anisopliae. Process Biochemistry Vol. 40 Presentation at The 4th Indonesian
p.321-326. Biotechnology Conference. Bogor 5th-7th
August.
[18] Suzuki,K.,Sugawara,N.,Suzuki,M.,Uchiya
ma,T.etal.,Chitinases A B and C1 of [24] Wen, C-M., Tseng, C-S., Cheng, C-Y., Li,
Serratia marcescens 2170 produced by Y-K. 2002. Purification, Characterization
recombinant E. coli: Enzymatic properties and Cloning of a chitinase from Bacillus sp.
and synergism on chitin degradation. NCTU2. Biotechnol. Appl.Biochem. Vol
Biosci. Biotechnol. Biochem. 2002, 66, 35, 213-219.
1075- 1083.
Page | 477
PROCEEDINGS
COMPARISON OF IMMUNOMODULATORY PROPERTIES

FROM THREE DIFFERENT INDONESIAN LOCAL ISOLATES
OF LACTIC ACID BACTERIA
Agustina Ika Susanti1, Tan Tjie Jan1, Merry Vidianti1, Jap Lucy1, Lisza1, Lulu
Florencia1, Christy1, Reinhard Pinontoan1
1.Department of Biology, UniversitasPelitaHarapan, JL. M.H. Thamrin Boulevard, Lippo Village

Karawaci, Tangerang 15810, Indonesia.
Email: agustina.susanti@uph.edu
Abstract
Today, the global consumer probiotics demand was estimated to amount to 7% of annual growth,
contributed by the growing market request in Asia and Europe continents. This has led to the expansion
of probiotics research in the proximity on the intention of promoting health. Host immune modulation by
different bacteria has always been a fascinating discovery, especially on the role played by lactic acid
bacteria in intervening various biological and health functions of the host. In Indonesia, LABs (lactic acid
bacteria) were isolated from indigenous animal, and investigated for their characteristics as potential new
probiotic strains. However, only a few studies focus on the immunomodulatory competency of bacteria
isolated. We hypothesized that isolated LABs from Indonesia local indigenous animal possess
immunomodulatory properties. Thus, the aim of this paper was to investigate the capability of LABs as
probiotic candidate (L. plantarum F75, P. pentosaceus D32, and E. hirae MD39) on their
immunomodulatory properties by the evaluation of phagocytic activity assay, haemagglutination assay of
total antibody and IgG, as well as the evaluation of TNF-α from mice blood sera. LABs were orally
administered to Balb/c mice for 14 consecutive days except on group Negative Controls. All groups were
challenged with 2% of SRBC. In phagocytic assay P. pentosaceus D32 shows a higher activity than E.
hirae MD39 and L. plantarum F75, with the percentage of inhibition to the growing of E. coli were 79,86
%; 63,03 %; 59,01 %, respectively. Based on haemagglutination assay on the measurement of total
specific antibody to SRBC and IgG on day 21, L. plantarum F75 has a higher antibody production than E.
hirae MD39, with the log2 titer were 11,44 vs 9,63 (for total specific antibody) and 4,82 vs 3,61 (for
IgG), while P. pentosaceus D32 showed the lowest on both total antibody titer or IgG. Interestingly,
TNF-α reflects a gradual increase only in P. pentosaceus D32 until D7. In conclusion from these result it
was suggested that oral administration of P. pentosaceus D32 stimulates innate immunity modulation,
whereas E. hirae MD 39, L. plantarum F75 induce adaptive immunity modulation.
Keywords: LAB, immunomodulatory, L. plantarum, P. pentosaceus, E hirae, antibody, TNF-α
1. Introduction immunomodulating effects. These bacteria can

play role against pathogens by competing for
Today, a global probiotic market analysis binding sites and interact with mucosal immune
is estimated for around 7% annual growth, shoved cells or epithelial cells lining the mucosa to
up by increasing request from consumer who live modulate specific functions of the mucosal
in Asia and Europe continents. This has led to rise immune system[3].
an intensified probiotic research in the area such as Among many strains of LAB, there are
promoting health [1]. Immune modulation of some strain which is a favourable LAB, such as
bacteria has been continued to be interesting study, Lactobacillus spp., Bifidobacterium spp.,
especially the role played by lactic acid bacteria in Enterococcus spp. and Lactococcus spp. etc., have
various biological and health functions of the host been used for probiotic preparation [5-6]. It has
[2]. Lactic acid bacteria are claimed to have been reported that P.plantarum P2 strains has an
Page | 478
PROCEEDINGS
ability to secrete higher amounts of TNF-a and IL- Animal group and feeding
12 when its co-cultured with macrophage cells. It
reflected that two cytokines could further regulate A total of 48 four-week-old male Balb/c
innate and adaptive immune responses [7]. mice were used in this research. The mice were
In Indonesia, LAB were also isolated and divided into 6 groups, each consisting of 8 mice
investigated from indigenous animal for their (Table 1). Probiotics were given orally for 14
characteristics as potential new probiotic strains. consecutive days except negative control group.
However, only a few studied focusing on Each week 2 mice from each group were tested.
immunomodulatory capability of those isolated The mice were feed with 7 gram feed a day and
bacteria. We hypothesized that isolated LAB from were exposed to 12 hours cycle of light and
Indonesia local indigenous animal also had darkness. The mice body weight was count
immunomodulatory properties. Thus, the aim of weekly.
this paper was to investigated the candidate
probiotic of LAB which has immunomodulatory Table 1. Group of treatment
properties. Furthermore, we compared Group Treatment Antigen
PediococcuspentosaceusstrainD32, Enterococcus sRBC
hirae strain MD 39 and Lactobacillus 1 L. plantarumF75 +
plantarumstrain F75 to determine their influence
(positive
on phagocytosis activity, antibody response and
cytokine levels. control)
2 Without probiotic -
2. Methods (negative
control)
Bacterial strains and growth conditions 3 Without probiotic +
4 P. pentosaceusD32 +
Probiotic strains of P. pentosaceusD32
and E. hiraeMD39 from pig intestine were 5 E. hiraeMD39 +
evaluated for their immunomodulating activity. + Group with given antigen sRBC. - group
Strains L. plantarumF75, a chicken gizzards without antigen sRBC.
isolate, was used as positive control for this
research due to its ability in modulating immune Preparation of antigen sRBC and
system of Balb/c mice [8]. All the bacteria strains immunization
were obtained from Laboratory of Biology,
PelitaHarapan University, Indonesia. The bacteria Fresh sRBC were obtained from
were maintained in -200 C in de Man, Rogosa, and Laboratory of Microbiology, University of
Sharpe (MRS) broth with 20% (vol/vol) glycerol. Indonesia. 2% of antigen sRBC were made by
Working cultures were prepared from frozen suspended 2% of packing cell sRBC in PBS pH
stocks by transfer in MRS agar at 370C for 24 to 7.4 and 1% BSA (Bovine Serum Albumin). All
48 hours in microaerophilic condition. Cultures mice (except negative control group) were
were refreshed in MRS broth for 2 or 3 times at challenged intraperitoneally with a single dose
370 for 24 hours in microaerophilic condition. administration (200μl/mL) of 2% antigen sRBC.
Antigen challenge were performed a day after 14
Colony forming units (CFU) bacteria consecutive days probiotic administration.
At 6 hours after bacteria inoculation (1% Immunological Test

vol/vol) in MRS broth medium, bacteria cell Bactericidal activity of cell splenocyte
growth was monitored by measuring OD600 and
colony forming units (CFU)/mL. Several 10-fold Mice spleen was excised aseptically and
dilution of the sample was performed. CFU the splenocyte‘s cells were isolated by teasing the
bacteria were estimated by counting the colonies tissue in PBS. The cells were stored in microtube
on MRS agar medium at 24 hours. Colony forming for 15 minutes at room temperature in vertical
units (CFU) bacteria were performed before condition. Supernatant was taken and centrifuged
bacteria oral administration to mice. at 2.000 rpm for 10 minutes. Splenocyte‘s pellet
was suspended in 400 μL of PBS. Meanwhile, E.
coli grown in Luria Broth (LB) medium for 16
hours at 37 was collected and centrifuged. The
Page | 479
PROCEEDINGS
pellet bacteria were suspended in 800 μL of PBS. blank well. Plate was incubated for an hour at
E. coli were incubated with splenocyte‘s cells with room temperature, and then washed for 3-5
ratio 1:2 (splenocyte: E.coli) for 1 hour at370 . times. 100 μL of Avidin-HRP in 1X assay diluent
Several 10-fold dilutions were performed for CFU was added to each well (except on blank well)
method. After 24 hours, colonies were counted on andincubated for 30 minutesinroom temperature.
each Nutrient Agar plate. Only E. coli spread plate Plate was washed by washing buffer for 6 times.
was taken as control. Percentage of bactericidal Then, 100 μL of substrate solution was added in
activity was determined by this equation:: well and incubated for 15 minutes in room
temperature. 50 μL of stopping solution was added
% Bactericidal activity = (CFU/mL in control – in well. Plate was read by ELISA reader at λ= 450
CFU/mL in test) x 100 / (CFU/mL in control) nm.
Haemagglutinatin antibody assay Statistical analysis

To assess the humoral immune response, All the results were expressed as mean.
blood was withdrawn by cardiac puncture method. The data tests were statistically analyzed using
Mice were tested on day 0 post probiotic IBM SPSS Statistic 22 version software. Data
treatments, day 7, 14, and 21 after sRBC distribution was analyzed using Kolmogorov-
challenge. Serum was separated and assayed by Smirnov test. Normal distribution data was
direct haemagglutination. For total antibody test, analyzed by one –way ANOVA test followed with
serum was inactivated at 560 C for 30 minutes. For Post Hoc test using Tukey and Bonferroni. Non-
IgG antibody titer test, inactivated serum was parametric data was analyzed using Kruskal-
added with 0,2 M 2-mercaptoethanol and Wallis and Wilcoxon Signed Rank Test.
incubated at 370 C for 30 minutes. Serial 2-fold
dilutions (with initial dilution 1:2) of serum were 3. Results and Discussion
performed on 96 well microplate u-bottoms.
Serum was diluted by PBS pH 7.4 and 0.05% Tabel 2. Average mice body weight
BSA. Plates were incubated at 370 C overnight. Group Body weight ± SD
Titer was described as the highest dilution which (N=8) (gram)
was capable of visible agglutination. Total
Negative control 19.41±3.53
antibody or IgG concentration in serum was
determined by this equation: L. plantarum F75 20.46±3.71
Antibody concentration or IgG = Log 2[T/(D⁄2)] No probiotic but sRBC 20.62±2.61

Whereas:
T= titer antibody P. pentosaceusD32 and 18.95±1.93
D= dilution factor sRBC
E. hiraeMD 39 and 21.15±3.18
ELISA TNF-α sRBC
Cytokines TNF-α concentration were Phagocytic activity

determined using Mouse TNF-alpha ELISA
Ready-Set-Go (e-Bioscience) kit. Each well of 96- The effect of L. plantarum F75, P. pentosaceus
well microplate (Corning Costar 9018) were D32 and E. hirae MD39 on phagocytic activity
coated with 100 μL capture antibody for TNF-α was assessed by phagocytosis bacteria in terms of
and incubated overnight at -40 C. The well was the numbers of colony forming unit (CFU). The
washed with washing buffer (1X PBS, 0.05% oral treatment of the three of LABs in general were
Tween 80) three times. The 1X assay diluent was enhanced of the phagocytic activity, in the other
added into each well and incubated for 1 hour at hand reduce the number of colonies.
room temperature. The well was washed using The influence LAB and phagocytic
washing buffer for once. The standard curve of activity can be seen in the graph 1..
TNF-α was made by Mouse TNF-α recombinant
protein. Serial 2-fold dilution (with initial cytokine
concentration 1000 pg/mL) was performed for well
A1 to A8. Plate was incubated at -4 for overnight
and washed for 3-5 times. Then, 100 μL of
detection antibody was added in all well on except
Page | 480
PROCEEDINGS
group negative control (no orally treatment

with probiotic and no sRBC immunization.
group with no orally treatment probiotic but
sRBCimmunization. group with orally
treatment L. plantarumF75 and
sRBCimmunization. group with orally
treatment P. pentosaceusD32 and sRBC
immunization, and group with orally E.
hiraeMD39 and sRBC immunization. Statistical
analysis using Wilconox Signed Ranks Test (p-
value < 0.05).
Fig 1.of phagocytic activity. Phagocytic

activity on day 0.Phagocytic activity on day 7. E.:
E. hirae
The group of animal which orally

treatment with P. pentosaceus D32 reduced the
number of colonies for 79.86% on 7 days after IP
treatment of sRBC. while L. plantarum F75.E.
hirae MD39 can reduce the number of colonies
slightly lower : 59.01% and 63.04%, respectively.
Fig 3.Effect of three different LABs on production

anti-sRBC IgG antibody titer on pre-
immnunization and post immunization 7th, 14th and
21st day.
group negative control (no orally treatment
with probiotic and no sRBC immunization.
group with no orally treatment probiotic but sRBC
immunization. group with orally treatment
Fig 2.Effect of three different LABs on production L. plantarumF75 and sRBC immunization.
anti-sRBC antibody titer on pre-immnunization group with orally treatment P. pentosaceusD32
and post immunization 7th, 14th and 21st day. and sRBC immunization. and group with
orally E. hiraeMD39 and sRBC immunization.
TNF-α ELISA Assay

Table 3. Mean of TNF-α concentration
Day Mean of TNF-α concentration (pg/mL) (N=2)
Negative Positive No probiotics but P. pentosaceusD32 withs E. hiraeMD39

control control sRBC RBC withsRBC
D0 17.98 30.32 29.71 34.27 45.59
D7 2.44 25.14 21.73 43.27 38.98
D14 19.14 5.98 72.18 19.48 34.68
D21 11.03 6.73 23.71 11.57 4.07
Page | 481
PROCEEDINGS
The effect of three different species of highest levels of antibody with Log2 titer was
Lactic Acid Bacteria (LAB) on the immune 4.82, followed by L. plantarum F75 group (1.35)
response was studied by direct the phagocytic and P. pentosaceus D32 group (0.3). Second
activity test, haemagglutination assay, and TNF-α highest increased levels of log titer antibodies total
Elisa assay.The phagocytosis is a form of innate was found in the mice without the probiotic group
immune response in which cells are ―engulf‖ and a group of mice with the administration of E.
foreign pathogen then processes of elimination of hirae MD39 with the total antibody titers of 4.82.
pathogens to prepare the adaptive immune The group of mice with the administration of L.
response [9-10]. The effect of the three Indonesian plantarum F75 showed levels of total antibody
Lactic Acid Bacteria on phagocytic activity was titers of 1.35. Groups of mice with the lowest
studied in terms of the number of colony forming levels of total antibody titer was observed in the
units (CFU). The lowest number of colony group of mice with the administration of P.
forming units (CFU) has been seen on day 7 pentosaceus D32 and its titer was account for 0.3.
compare to day 0, on the other hands the highest of It was clearly seen that control group which no
inhibition rate of phagocytic activity were obtained LAB administered was no response, but group
on day 7. In the circulation of the blood, with antigen challenge was almost as high as E.
monocytes have a lifespan of 1-3 days before hirae MD 39. According to Baxter (2007),
differentiated into macrophage cells [11]. adaptive immune response in eliminating
Furthermore, three to six days after infection, the pathogens usually takes 10-14 days after exposure
cells which are naïve macrophages migrate to the of an antigen.On21days of post challenge showed
spleen [12]. The spleen is the location where the group with L. plantarum F75 has the highest log2
cells which are naïve macrophages to mature and titer antibody, followed by E. hirae MD 39, and P.
ready to interact directly with the antigen [13]. pentosaceus D32, with the log 2 titer antibody
Giving known antigen provides splenomegaly were: 11.44, 9.63, 2.41, respectively. Interestingly,
conditions 2 to 3 days after infection. Conditions group with control has no antibody. It was clearly
gradually splenomegaly spleen macrophages that administration of probiotic could modulate an
recruited expansion of marginal zone [12]. adaptive immune system. The attachment of
Interestingly, group with treated with P. probiotics in the epithelial cells of the intestine and
pentosaceus D32 has shown the highest phagocytic M cells were able to induce the formation of
activity. Unlikely day 7, phagocytic activity has immunoglobulin [15] and lead the formation of
been decreased on day 14 (datas are not shown), specific antibodies or T cell mediated response to
on this period and adaptive immune system has produce systemic immunity [16]. L. plantarum in
worked properly, therefore the antibody can also the intestinal tract of gnotobiotic mice have the
trigger the macrophage and neutrophil to be more ability to induce the development of IgA, IgG and
active [9]. IgM [17]. The bacteria also able to induce different
It was found in that group was orally cytokine such as IL-1β, IL-10, IFN-γ and TNF-α
administered by E. hirae MD 39 has higher log as well as differentiation of T cells into th1 cells
titer than other groups in the day 7 and it was [14].
gradually increased on the next following weeks. L. plantarum bacteria in the intestinal tract
Anitbody‘sE. hirae MD 39 group observed on day of mice gnotobiotic by E. coli, have the ability
7 was 2.41, while group with orally administered immunomodulator such as the formation of high
of L. plantarum F75 and P. pentosaceus D32 has IgA, IgG , and IgM (Herias et al., 1999). The
no respond yet. This might be caused by two bacteria also have the ability to induce the
things, firstly the variety of species of the LAB formation of cytokines IL - 1β , IL - 10 , IFN - γ
which gave the different effect to stimulate the and TNF - α as well as having the ability to induce
immune response [14]. It can be seen in the study differentiation of T cells into Th1 cells [14]. Th1
conducted by Vissers et al (2010) that L. cells with the presence of IFN - γ to induce
plantarum can induced IL-2, IFN-γ and TNF-α maturation of B cells to produce immunoglobulin
better than L. acidophilus. Secondly, since B cell [9]. P. pentosaceus in bacteria known to trigger the
maturation takes about 5-10 days after exposure to formation of IgG and IgA antigens specific to the
an antigen (SRBC), therefore not all B cells has provision of S. rectivirgula bacteria that usually
differentiated into plasma cells to produce attacks the respiratory tract farmers [18].
antibodies, depend on the genetic of the host itself, Since LAB is known to enhance the
in this term is the genetic of mice. immune system by modulation of the immune
Log titer antibody has elevated in day 14 response of the host. Some strains of these bacteria
after antigen challenge among all groups. have the ability to stimulate the cell to release
Interestingly, E. hirae MD 39 group showed the proinflammatory cytokines such as TNF - α and
Page | 482
PROCEEDINGS
IFN- γ [19]. TNF - α is secreted by cells of [9] I. Todd, G. Spickett. Lecture notes:
macrophages, lymphocytes, neutrophils, and mast Immunology. 6th ed., Wiley-Blackwell,
cells, as a result of phagocytic activity during the United Kingdom, 2010.
innate immune response. Moreover, it also plays a
role in improving the expression of HLA class I, [10] R. Warrington, W. Watson, H. L. Kim, F. R.
stimulate acute phase response, and antitumor Antonetti, Allergy. Asthma. Clin. Immunol, 7
effect [9].In general, a decreasing of TNF - α (2001) S1.
levels are observed from the day 14 and to day 21
(table 3). This suggests that TNF - α is a [11] J. Yang, L. Zhang, C. Yu, X. F. Yang, H.
proinflammatory cytokine that plays a role in the Wang, Biomark. Res. 2 (2001) 1.
early phase of infection [20]and is related to cell
mediated responses. The concentration of TNF - α [12] B. A. Wu-Hsieh, G. S. Lee, M. Franco, F. M.
generally decreases during the acute stage of Hofman, Infect. Immun, 60 (1992) 4230.
infection. Decreasing the concentration of TNF - α
[13] N. Nikbakht, S. Shen, T. Manser, J. Immunol.
are usually offset by the increase in IL- 10 [20].
190 (2013) 4923.
4. Conclusion [14] Y. M. Vissers, J. Snel, P. F. Zuurendonk, B.

A. Smit, H. J. Wichers, H. F. Savelkoul,
The immune system can be optimized FEMS. Immunol. Med. Microbiol. 59 (2010)
through oral supplementation of Lactic Acid 60.
bacteria. From these result it was suggested that
oral administration of P. pentosaceusD32 leads to [15] B. Corthésy, H. R. Gaskins, A. Mercenier, J.
innate while L.plantarumF75 and E. hirae MD 39 Nutr. 137 (2007) 781S.
induce more likely an adaptive immunity.
However, further research needs to be done using [16] P. L. Ogra, H. Faden, R. C. Welliver, Clin.
antigens that are pathogens such as: viruses, Microbiol. Rev. 14 (2001) 430.
pathogenic bacteria or parasites.
[17] M. V. Herias, C. Hessle, E. Telemo, T.
Acknowledment: Midvedt, L. A. Hanson, A. E. Wold, Clin.
Exp. Immunol. 116 (1999) 283.
This research has been supported by HIBAH
[18] C. Duchaine, E. Israel-Assayag, M. Fournier,
FUNDAMENTAL RISTEK- DIKTI under
Y. Cormier, Eur. Respir. J. 9 (1996) 2508.
contract number: 157/LPPM-UPH/VII/2016
[19] J. R. Schoenborn, C. B. Wilson, Adv.
References Immunol. 96 (2007) 41.
1] B. Foligné, C. Daniel, B. Pot, Current Opinion [20] I. Marafini, I. Monteleone, D. D. Fusco, M. L.

in Microbiology, 16 (2013) 284. Cupi, O. A. Paoluzi, A. Colantoni, A.
Ortenzi, R. Izzo, S. Vita, E. D. Luca, G. Sica,
[2] G. Perdigón, R. Fuller, R. Raya, Current issues F. Pallone, G. Monteleone, PLoS. ONE. 10
in intestinal microbiology, 2 (2001) 27. (2015) 1.
[3] H. Hardy, J. Harris, E. Lyon, J. Beal, A. Foey,
Nutrients. 5 (2013) 1869.
[5] C. Chen, H. Tsen, C. Lin, L. Chuang, Y.

Chiang, J. Med. Microbiol. 62 (2013) 1657.
[6] L. Vitetta, D. Briskey, H. Alford, S. Hall, S.

Coulson, Inflammopharmacology. 22 (2014)
135.
[7] J. Feng, P. Liu, X. Yang, X. Zhao, World. J.

Microbiol. Biotechnol, 31 (2015) 1947.
[8] Marlina, Skripsi. UniversitasPelitaHarapan.

2014.
Page | 483
PROCEEDINGS
EXAMINATION OF CRISPR/CAS SYSTEM TYPE II-A IN

STREPTOCOCCUS THERMOPHILUS ISOLATED FROM LOCAL
DAIRY PRODUCT
Lisa Charisa Wijaya1, Charles1, Marcelia Sugata1, Jap Lucy1, Agustina Ika Susanti1,
and Tan Tjie Jan1
1.
Biology Department, Faculty of Science and Technology, Pelita Harapan University, M. H. Thamrin
Boulevard, Tangerang, 15811, Indonesia
E-mail: lisa-wijaya@hotmail.com
Abstract
Streptococcus thermophilus (St) belongs to the lactic acid bacteria (LAB) which is found
naturally in milk and traditionally used as starter cultures to ferment milk. Due to its positive traitsand
recently discovered to carry Cas9 gene, that prompted us to isolate local cow milk-derived St, and further
intending to study its CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) locus by
comparing it with the one from the known Ststrain (Christ Hansen, Denmark; coded as KJ2 for original
culture and SY2 for the one obtained after milk fermentation). By using M17 media, we were able to
identified one S. thermophilus isolate designated as CPY83 through studying its morphology and
biochemistry activities, and also 16S ribosomal RNA (16s rRNA) sequence-analysis. CPY83 is found as
agram-positive bacteria; endospore- and catalase-negative, presence of gamma-hemolytic activity, and
able to grow at 45°C.Based on molecular analysis of 16S rRNA, itrevealed that CPY83 is identical toS.
thermophilus strain MN-ZLW-002. Next we studied the DNA sequences of CRISPR area in CPY83, KJ2,
and SY2. Results showed that KJ2 and SY2 possess two separate independently functional CRISPR/Cas
systems; CRISPR1/Cas and CRISPR3/Cas that differ in their repetition and spacer sequences, while
CPY83 has only CRISPR1/Cas system. Furthermore, KJ2, SY2, and CPY83 have different length of
CRISPR locus which are the result of differences in length of sequences in repetition and spacer. It was
found that CRISPR1 and CRISPR3 has its own unique spacer sequences,and in these three isolates that
the spacer sequences were identically identified as plasmid and Stbacteriophage. And to prove if the
CRISPR/Cas system of CPY83 is still intact and capable to acquire new bacteriophage DNA, we infected
CPY83 with bacteriophage that contained and prepared from fresh milk from different collecting region.
The remaining phage-infected CPY83 are then amplified for its CRISPR1 locus to analyze for any new
spacers.Results showed that CPY83 CRISPR/Cas system is capable to acquire new spacers, and one of
them is derived from St phage Sfi19.
Keywords: Streptococcus thermophilus, CRISPR/Cas system, local dairy product, milk-derived

bacteriophage.
1. Introduction bacterial cell lysis and thus increasing the

fermentation time [2]. CRISPR/Cas system is an
Streptococcus thermophilus belongs to adaptive immune system in bacteria which offers a
lactic acid bacteria (LAB) which is found naturally protection against these foreign DNA infections. It
in milk as its habitat [1]. Together with has the ability to memorize, recognize and degrade
Lactobacillus bulgaricus, S. thermophilusare those specific foreign DNA, especially phages and
traditionally used as starter cultures to ferment plasmid [3].
milk for making yogurt, cheese and so on, hence it
CRISPR/Cas system is composed of two
is safe to be consumed. During the production
structural units: a locus called CRISPR (Clustered
process, LAB, including S. thermophilus, is Regularly Interspaced Short Palindromic Repeats)
vulnerable to foreign DNA (e.g. bacteriophage, which consists of a series of short repetitions and
plasmid) infection/attack that could lead to variation sequences (called spacer); and a set of
Page | 484
PROCEEDINGS
CRISPR-associated (Cas) genes. This system is Isolation and characterization based on

capable to acquire a specific sequence (called morphology, biochemistry activity, and 16s
protospacer) from a foreign DNA which will be rRNA molecular analysis of local milk-derived
integrated into the upstream of a CRISPR locus as Streptococcus thermophilus. Fresh cow milk was
a new spacer. These spacers represent bacteria‘s obtained from Cipayung, Indonesia, and retained
memories of infected phage and plasmid. If a in 8-10°C condition. By doing serial dilution using
spacer is found complementary to a foreign DNA, peptone saline water, fresh milk was inoculated on
a complex of Cas proteins will be activated and M17 agar (M17A) and incubated overnight at
cleave the foreign DNA directly [3,4]. 42°C in microaerophilic condition. All bacterial
Until now, there are several types of Cas colonies obtained from the assay were then
protein with different functions discovered within characterized based on its morphology,
the system. Uniquely, one of the proteins, Cas9, is biochemistry activity, and 16s rRNA molecular
found to have a high and simple nuclease activity; analysis. The morphology analyses included Gram
without the need to make a complex of Cas staining, cell and colony shape identification, also
subunits to cleave a certain foreign DNA [5]. endospore-forming test. Biochemistry activity
Hence, Cas9 is frequently developed to support analyses included catalase test, maltose and
some biomedical applications, like gene editing, sucrose fermentation, NaCl resistancy to
gene therapy, and so on. It was found that Cas9 concentration of 2%, and hemolytic activity test.
only presents in CRISPR/Cas system type II. In Hemolytic test was performed by inoculating S.
other studies found out [2,6] that type II system thermophilus isolate using blood agar media,
presents in S. thermophilus (classified as type II- incubated for overnight at 37°C, and observed for
A)posseses two separate types of locus: CRISPR1 any color changes. For 16s rRNA molecular
and CRISPR3; S. thermophilus could either analysis, all DNA genome of potential isolates
possess only one or both of the locus. were extracted and purified using Wizard®
Due to its positive traits, such as non- Genomic Purification Kit. Genome was then
pathogenic; enzymatic ability to convert lactose to amplified using primer 27F and 1492R, separated
lactic acid and able to digest protein into smaller and visualized by gel electrophoresis 100V for 30
health-benefited peptides in milk; and also recently mins with agarose concentration of 0.8%, also
discovered to carry Cas9 gene with diverse sequenced for further similarity comparison to
structure of CRISPR locus within the strain, that National Center for Biotechnology Information
prompted us to try to isolate local cow milk- (NCBI) database using BLASTn..
derived S. thermophilus, and further intending to
study its CRISPR locus. Besides, the exploration Bacterial preparation. All S. thermophilus
on CRISPR/Cas system in Indonesia is still rare. isolates were grown and incubated for 18 hours in
Here we report our experimental result: isolation M17 broth (HiMedia) at 42°C in microaerophilic
and characterization of S. thermophilus from local condition. Cultures were then used for genomic
dairy farm; analysis its CRISPR locus, CRISPR1 DNA extraction.
or/and CRISPR3, repetition-spacer sequence
pattern, origin of spacer sequences; comparing it Phage preparation. exposure. and infection.
with known commercial S. thermophilus (Chris Phages were prepared from 0,45 µm membrane-
Hansen, Denmark), which we designated here as filteredfresh milk which collected from Cibubur,
KJ2 for fresh freeze-dried derived culture and SY2 Indonesia, by using double layer plaque assay with
for the one obtained after fermentation in yogurt; top agar concentration of 0.7%, and basal agar
finally proving the dynamic nature of CRISPR/Cas concentration of 1.5%. All media used in this
system to acquire/incorporate foreign DNA by assay are M17 with addition of 10 mmol/L CaCl2
infecting with phages. and 0,75% glycine as described in [2, 8]. All the
visible plaques yielded from the assay are then
2. Methods propagated and infected to CPY83 by incubating
both in a single media; M17 broth with addition of
Here, we used local cow milk-derived 10 mmol/L CaCl2; for overnight at 37°C. After
Streptococcus thermophilus which collected from incubation, re-cultured infected CPY83 in M17
Cipayung, Indonesia and designated as CPY83. As broth, incubated overnight at 37°C, and re-infected
comparison, we also used known S. thermophilus once more with the same plaques as before. After
strain from Chris Hansen, Denmark, which overnight incubation at 37°C [2], culture was then
designated asKJ2 for original freeze-dried culture inoculated in M17 agar using spreading method to
and SY2 after undergone milk fermentation. harvest any remaining phage-infected CPY83 in
order to get bacterial colony with active protection
Page | 485
PROCEEDINGS
of CRISPR/Cas system as much as possible. The morphology and biochemistry analysis as follows:
remaining phage-infected CPY83 were then morphology of CPY83 is as a long-chain coccus,
extracted for its DNA genome and amplified for its gram positive and endospore-negative bacteria. On
CRISPR1 locus to analyze for any new spacers. biochemistry analysis we revealed that CPY83 is
catalase-negative and capable to ferment sucrose,
DNA sequencing of S. thermophilus CRISPR but incapable to ferment maltose (unfortunately,
locus. S. thermophilus genomic DNA was we are unable to proceed analysis using API or
extracted and purified using Wizard® Genomic Analytical Profile Index to get a complete
Purification Kit. CRISPR locus of each genomic fermentation profile). It could tolerate 2% NaCl,
DNA samples were then amplified using KAPA while hemolytic activity test did not show any
HiFi PCR kit and pairs of primer which specific color changes which could be conclude that
for amplifying each type of locus. According to CPY83 is a gamma hemolytic bacteria [7]. DNA
protocol previously described [6], CRISPR1 data obtained from 16s rRNA molecular analysis
amplification was performed with primer yc70 (5‘- found that CPY83 was 100% identical to S.
TGCTGAGACAACCTA GTCTCTC-3‘) and thermophilus strain MN-ZLW-002.
CR1-rev (5‘-TAAACAGAGCCTCCCTATCC-3‘),
while CRISPR3 was performed with primer CR3- Analysis of CRISPR Locus from
fwd (5‘-CTGAGATTAATAGTGCGATTACG-3‘) CPY83. KJ2. and SY2
and CR3-rev (5‘-
GCTGGATATTCGTATAACATGTC-3‘) which The identification of CRISPR locus type
target the promoter sequence called leader and a was done by amplifying the locus using specific
conserve sequence that located downstream of the primer for each type, CRISPR1 and CRISPR3,
CRISPR locus called trailer end. PCR cycle was which targets the leader and trailer end sequence
done as follows: 95°C 3 mins predenaturation; 25 [6]. The amplified product was then separated and
cycles of 93°C 1 min, 58°C (CRISPR1) or 54°C visualized by gel electrophoresis with agarose
(CRISPR3) for 45 secs and 72°C 3 mins; ended concentration of 1% (Figure 1).
with 72°C 7 mins for final elongation. Each
amplification products were then visualized using
bp
gel electrophoresis 100 V for 30 mins with agarose
concentration of 1% for identification and CRISPR
locus characterization and 1,5% for CPY83‘s
ability test in acquiring new spacer. All products
were then subjected to sequence and also
computational-analyzed.
Computational analyses. Computational analyses

conducted in this research; included type of
CRISPR locus, repetition and spacer sequences,
and the presence of new spacers that successfully
acquired by CRISPR/Cas system; were all done
using CRISPRFinder Online Program [9].
Identification of spacer origin was carried out by
comparing similarities to database sequences using
BLASTn at the NCBI and from previous research
by [6].
Figure 1 CRISPR locus amplification of S.
3. Results and Discussion thermophilus isolates.
Isolation and Characterization of Local A: 1 kb ladder. B: CRISPR1 locus of KJ2. C:

CRISPR1 locus of SY2. D: CRISPR1 locus of
Milk-DerivedStreptococcus CPY83.E: CRISPR3 locus of KJ2. F: CRISPR3
thermophilus locus of SY2.G: CRISPR3 locus of CPY83.
We successfully isolated and identified a Based on the result of gel electrophoresis
Streptococcus thermophilus which designated as [Figure 1], it was found that KJ2 and SY2 both
CPY83 from local dairy farm (Cipayung, West have separated CRISPR locus: CRISPR1 (column
Java, Indonesia). The determination is based on B & C respectively) and CRISPR3 (column E & F
Page | 486
PROCEEDINGS
respectively), while CPY83 has only CRISPR1 Analysis of Repetition Sequence in

locus with shorter length (column D). As can be
shown in Figure 1, there is no band for CRISPR3
CRISPR1 and CRISPR3
locus amplification for CPY83 (column G). For a Based on computational analysis using
precise analysis, we also did a computational CRISPRFinder, it was found that CRISPR1 and
analysis to all CRISPR loci that successfully CRISPR3 locus have their own repetition
amplified by using CRISPRFinder online program. sequence: 5´-
The results were showed in Table 1.. GTTTTTGTACTCTCAAGATTTAAGTAACTG
TACAAC-3´ and 5´-
Table 1. Computational analysis of CRISPR GTTTTAGAGCTGTGTTGTTTCGA
locus ATGGTTCCAAAAC-3´,respectively. In addition,
there was an unique repetition sequence located at
Name of Locus Number of Number of 3´, the downstream area of CRISPR1 locus called
isolate length* repetition spacer terminal repeat which was not found in CRISPR3.
(bp) sequence sequence Its last two nucleotide bases were found different
CRISPR1 Locus to CRISPR1 typical repetition sequence
(underlined): 5´-
CPY83 1.101 17 16 GTTTTTGTACTCTCAAGATTTAAGTAACTG
TACAGT-3´. However, these nucleotide base
KJ2 1.173 19 18 arrangements were also found to be the same
SY2 1.296 20 19 within the same type of locus eventhough it‘s
appeared in different strains of isolate (CPY83‘s
CRISPR3 Locus CRISPR1 locus have the same arrangement of
repetition sequence to KJ2 and SY2‘s).
KJ2 1.262 19 18
Analysis of Spacer Sequence in CPY83.
SY2 1.302 20 19
KJ2 and SY2
Note: *: CRISPR locus length is summed from
first through last repetition sequence without Besides repetition sequence, we also tried
leader and trailer end involved. bp: base pair. to identify and analyze all of the spacer sequences
that composed either CRISPR1 or CRISPR3 in
As shown in Table 1, the length of the KJ2, SY2, and CPY83 isolate. It was found that
CRISPR loci were found varied within these three they shared some identical sequences, but at the
isolates. The length difference correlates to the same time they also had their own unique spacer
number of repetition and spacer sequences that sequences which not found in others. To be exact,
compose a locus. Greater amount of repetition- KJ2 and SY2 shared 14 spacers with identical
spacer sequences will lead to a longer CRISPR nucleotide base order within their CRISPR1 locus;
locus. Different number of spacer sequences found KJ2 and CPY83 shared 9 spacers; while SY2 and
in these three isolates should be the result of CPY83 shared 8 spacers (Figure 2). Uniquely,
different foreign DNA exposure [6, 10]. there was no identical nucleotide base order shared
between CRISPR1 and CRISPR3 either for KJ2 or
SY2, that obtained from yogurt, on the SY2 isolate although they share 2 same spacer
other hand, was found to acquire an additional origins: Streptococcus thermophilus phage Sfi21
spacer either in CRISPR1 or CRISPR3 locus and Streptococcus thermophilus phage 20617.
compared to the culture stock, KJ2. Respectively, These results indicated that CRISPR1/Cas and
the additional spacers are identified as CRISPR3/Cas system work independently whether
Streptococcus thermophilus phage Sfi19 and
in recognizing or acquiring foreign DNA [11].
Streptococcus thermophilus LMD-9 plasmid 1.
This new acquired spacers indicated that S.
thermophilus is vulnerable to foreign DNA
infection, but able to give protection against it
through the activation of CRISPR/Cas system
during the fermentation process.
Page | 487
PROCEEDINGS
Representative Invaded Foreign DNA

within Spacer
Table 2. List of invaded foreign DNA within

spacer
No Name of foreign DNA Accession

number
Figure 2 Graphic representations of spacers Plasmid
among CRISPR1 and CRISPR3 locus in KJ2. 1 Streptococcus CP000420.
SY2. and CPY83. thermophilus LMD-9 1
plasmid 1
Repetition sequences are not included; only 2 Streptococcus DQ295022
spacers are represented. Each spacer is represented by a thermophilus plasmid
combination of alphabets. Same alphabet within the box .1
pSMQ-316
represents spacers with same/identical nucleotide base
order, while an alphabet followed by apostrophe mark Phage
(‗) represents spacers with same foreign DNA origin 1 Streptococcus AF115103
(same subject) but different in their nucleotide base thermophilus
order. bacteriophage Sfi21
2 Streptococcus phage Abc2 FJ236310.
Further, it was found that KJ2‘s CRISPR1 1
locus had 4 unique spacers which were not found
in SY2 and 9 spacers which were not found in 3 Streptococcus AF158601.
CPY83. It was also found that SY2‘s CRISPR1 thermophilus 1
locus had 5 distinct spacers compare to KJ2 and 11 bacteriophage Sfi18 lysin
distinct spacers compare to CPY83, while CPY3
4 Streptococcus AF145054
had 7 distinct spacers to KJ2 and 8 distinct spacers thermophilus
to SY2 (Figure 2). These conditions might be bacteriophage 7201
caused by the diversity of our local phage compare 5 Streptococcus AY699705
to foreign country (in this study: Denmark). The thermophilus phage 2972 .1
numerous distinct spacers an isolate has might be
correlated with the effectiveness and the
6 Streptococcus phage HG424323
efficiencies of CRISPR/Cas system. The 20617
uniqueness of spacer sequences will broaden the .1
recognition scope which then leads to a more rapid
foreign DNA degradation and a robust strain of 7 Streptococcus AY196178
thermophilus
bacteria [11]
bacteriophage kappa3
8 Streptococcus phage FJ226752.
ALQ13.2 complete genome 1
9 Streptococcus AF115102
thermophilus Sfi19
Note: accession number can be accessed through
NCBI.
Page | 488
PROCEEDINGS
We also analyzed spacer origin from all bpA B C D E F G

spacer sequences that compose both CRISPR1 and
CRISPR3 locus in all S. thermophilus isolates.
Identification was done by comparing similarities
to NCBI database and previous study by Horvath
et al. [6]. Results showed that there were 11 spacer
origins identified similar to plasmid and phage
with average sequence length of 29-30 bp.
Specifically, there were 2 strains of plasmid which
identical to Streptococcus thermophilus LMD-9
plasmid 1 and Streptococcus thermophilus plasmid
pSMQ-316; while the phages were found to be
identical to nine different strains, namely Sfi21,
abc2, Sfi18 lysine, 7201, 2972, 20617, kappa3,
ALQ13.2, and Sfi19. Phage Sfi21, 20617 and
Kappa3 were found to have a lysogenic life cycle,
while six other strains were found to have a lytic
life cycle [12, 13]. These identically-known
spacers, either plasmid or phage, are found to be
critical to support the activity of CRISPR/Cas
system where it requires to have a 100% identity Figure 3 CRISPR1 size comparison of local
between spacer and protospacer (in foreign DNA) Streptococcus thermophilus CPY83 and phage-
to provide immunity [6]. infected CPY83 (CPY83F). A: 1 kb ladder. B:
wild-type CPY83 (control). C: CPY83F-5. D:
The Ability of CPY83 to Acquire New CPY83F-9. E: CPY83F-13. F: CPY83F-17. G:
CPY83F-21.
Foreign DNA
Based on gel electrophoresis result in
As previously described by Horvath et al. Figure 3, CPY83F-9, CPY83F-13 and CPY83F-21
[6], an intact and active CRISPR/Cas system can gained length in its CRISPR locus which varied in
be determined by its ability in acquiring a certain size compared to the wild-type. Furthermore, we
foreign DNA sequence called protospacer and did computational analysis within these three
integrates it as a new spacer within the first isolates to identify the amount of length and new
repetition sequence located upstream of the spacer sequences that successfully gained. The
CRISPR locus. As a result, the length of CRISPR results showed that CPY83F-9 gained total of 61
locus will increase. Therefore, we would like to bp extra long with additional of 1 new spacer,
analyze this capacity in our isolate, CPY83. while CPY83F-13 and CPY83F-21 each acquired
Firstly, we prepared the phage that would 2 new spacers with total length gained of 127 bp
be infected to CPY83 from our local fresh milk and 121 bp respectively. Later, it was found out
which obtained from different region, Cibubur, that one of CPY83F-21‘s new spacers was
Indonesia, with assumption that CPY83 will identified identical to Streptococcus thermophilus
acquire spacers of newly-recognized phages. The phage strain Sfi19. This indicated that our local S.
phages were prepared by using double layer plaque thermophilus bacteria CPY83 has an intact and
assay and resulted in 12 visible plaques. All the dynamic CRISPR/Cas system which determined
visible plaques were then infected to CPY83 and by its ability in acquiring new spacers.
we analyzed any length-changes within the
CRISPR locus. Therefore, we compare the
CRISPR locus in some colonies of phage-infected
4. Conclusion
CPY83: CPY83F-5, CPY83F-9, CPY83F-13,
This study succesfully isolate and
CPY83F-17 and CPY83F-21, to wild-type CPY83
characterize a Streptococcus thermophilus from
(without phage infection; control) by PCR
local cow milk (Cipayung, Indonesia which is
amplification and 1.5% gel electrophoresis (Figure
designated as CPY83. Based on PCR amplification
3) with expectation that CPY83 could acquire new
and computational analysis, it was found that
spacer from milk-derived phage as the source of
CPY83 possesses only one CRISPR locus, namely
foreign DNA to give itself a protection from lysis.
CRISPR1 locus, which is different to KJ2 and SY2
where they both possess two locus: CRISPR1 and
CRISPR3. Compared to KJ2 and SY2, CPY83 has
Page | 489
PROCEEDINGS
shorter DNA sequence of CRISPR1 locus. It was H. Haft, P. Horvath, S. Moineau, F. J. M.

found that CRISPR1 and CRISPR3 have distinct Mojica, R. M. Terns, M. P. Terns, M. F.
nucleotide base orders, either it is in repetition White, A. F. Yakunin, R. A. Garrett, J. van der
sequences or in spacer sequences. The spacer Oost, R. Backofen, E. V. Koonin. Nature
sequences itselves were identified similar to 2 Reviews Microbiology, 13 (2015): 722-736.
unique plasmids and 9 unique phages specific to S.
[6] P. Horvath, D. A. Romero, A. Coute-
thermophilus. Challenging local S. thermophilus
Monvoisin, M. Richards, H. Deveau, S.
CPY83 with milk-derived phages could be proved
Moineau, P. Boyaval, C. Fremaux, R.
by the presence of new acquired spacer which
Barrangou. Journal of Bacteriology, 190
indicate the dynamic nature of CRISPR/Cas
(2008): 1401-1412.
system to protect the bacteria against foreign
DNA. One of the spacers obtained is identified [7] A. Fox, Microbiology and Immunology On-
similar to S. Themophilus phage Sfi19. line,
http://www.microbiologybook.org/fox/streptoc
References occi.htm, 2016.
[8] D. Lillehaug. Journal of Applied Microbiology,

[1] R. Sharma, B. S. Sanodiya, G. S. Thakur, P.
83 (1997): 85-90.
Jaiswal, S. Pal, A. Sharma, P. S. Bisen. British
Microbiology Research Journal, 3 (2013): 743- [9] I. Grissa, G. Vergnaud, C. Pourcel. BMC
Bioinformatics, 8 (2007): 172-181.
752.
[2] D. Ishlimova, Z. Urshev. Biotechnology & [10] B. R. Levin, S. Moineau, M. Bushman, R.
Biotechnological Equipment, 27 (2013): 3966- Barrangou. PLOS Genetics, 9 (2013): 1-17.
3971. [11] A. H. Magadan, M.-E. Dupuis, M. Villion,
[3] D. Rath, L. Amlinger, A. Rath, M. Lundgren. S. Moineau. PLoS ONE, 7 (2012): 1-8.
Biochimie, 117 (2015): 119-128. [12] H. Brussow, M. Freimont, A. Bruttin, J.
[4] J. E. Samson, A. H. Magadan, S. Moineau. Sidoti, A. Constable, V. Fryder. Applied and
Nature Reviews Microbiology, 11 (2013): Environmental Microbiology, 60 (1994):
675-687. 4537-4543.
[5] K. S. Makarova, Y. I. Wolf, O. S. Alkhnbashi, [13] D. Mora, S. Arioli,

F. Costa, S. A. Shah, S. J. Saunders, R. http://www.ncbi.nlm.nih.gov/ nuccore/588
Barrangou, S. J. J. Brouns, E. Charpentier, D. 295077, 2014.
Page | 490
PROCEEDINGS
CLONING AND ACTIVITY ASSAY OF REKOMBINANT

SUCROSE ISOMERASEKLEBSIELLA PNEUMONIAE IN
ESCHERICHIA COLIBL21(DE3)
Feraliana, Sony Suhandono, Tati Kristianti, Maelita Ramdani Moeis
School of Life Science and Technology, Biotechnology, ITB, Labtex XI, Bandung, 40132,
Indonesia
Genetics and Molecular Biotechnology Group, ITB, Labtex XI, Bandung, 40132, Indonesia
Email: maelita@sith. itb.ac.id
Abstract
Sucrose isomerase (SIase) is an enzyme that catalyzes the isomerization of sucrose into isomaltulose.
Isomaltulose which contains an a 1,6-glycosidic bond between glucose and fructose. Unlike sucrose,
isomaltulose is non cariogenic sugar. Isomaltulose has been found to inhibit the formation of insoluble
glucans, more stable under acidic condition, and less hygroscopic than sucrose. Isomaltulose is digested
and released much more slowly into the blood stream compare to sucrose, therefore sucrose is suitable for
diabetics. A SIase producting bacteria, Klebsiella pneumoniae, was isolated from mango fruit. In order to
maximize sucrose isomerase production, the SIase gene of K. pneumoniae was cloned into pTXB1
expression vector and expressed in Escherichia coli BL21(DE3). The gene was cloned using fusion
cloning PCR. Recombinant SIase was induced by 0,4 mM IPTG and collected 4 hours after induction.
SIase activity was assayed using DNS reagent. The measurement was made on bacterial pellet,
extracellular enzyme, cytoplasmic, periplasmic, inner membrane and outer membrane fractions. The
SIase activity from the bacterial pellet was 3.844,2 U/mL. The SIase activities from the cell fractions
showed the highest activity in the outer membrane fraction (2.457,8 U/mL).
Keywords : isomaltulosa, sucrose isomerase, SIase, pTXB1, In Fusion PCR Cloning, outer membrane
protein
1. Introduction difficult to synthesize chemically isomaltulose. So,

recombinant techniques is done to get maximum
Sucrose is present that contained in rice, production of sucrose isomerase. Therefore, in this
com, wheat, bread, syrup and other processed research, cloning the gene encoding sucrose
foods. Sucrose can be rapidly hydrolyzed to isomerase (SIase) from Klebsiella pneumoniae into
glucose and fructose. This would cause increasing expression vectors pTXB1 then expressed in
in blood glucose level and insulin respons. In the Escherichia coli BL21 (DE3)..
last few decades, many food and beverages
manufacturers have been looking for alternative 2. Methods and Material
sugar that have low glycemic index. Isomaltulose
could be strong candidate for this since it has many Sucrose isomerase gene cloning (SIase).
advantages, such as low glicemic index, inhibit the
the formation of insoluble glucans, more stable SIase coding genes that used in this study
under acidic condition, and less hygroscopic than came from Klebsiella pneumoniae that living in
sucrose. Other characteristic of isomaltulose is mango cultivars Cengkir. The procedure that used
prebiotic, non cariogenic, has the same physical to clone genes of Klebsiella pneumoniae SIase
and organoleptic with sucrose sweetness level based methods In Fusion PCR Cloning [4]. Slase
except that only 42% [1-3]. Production of gene sequences of Klebsiella pneumoniae and the
isomaltulose is commercially done using sucrose sequence pTXB1 expression vector (New England
isomerase enzyme (SIase) because it is very Biolabs) were used to design primers for In-Fusion
Page | 491
PROCEEDINGS
PCR Cloning (Spiliotis, 2012). A primer (5'- 0.5. IPTG was added to a final concentration of 0.4
CGCGAATTCCTCGAGATGTCTTT mM and incubation was continued for 4 hours. 250
TGTTACGCTACGTACCG-‗3) contained SIase gL of this culture was used as inoculum for LB 4%
gene and pTXB1 sequence (underline). Primer B sucrose to be used as a test sample of
(5'-CCGCAGCTTATACACACCTGC-‗3) aniline/diphenylamine and the rest of the culture
contained the 3‘end of SIase gene sequence was centrifuged at 5000g- at 4°C for 15 minutes.
without the stop codon. Stop codon sequence was The supernatants were the extracellular enzyme
removed so that the intein and Carbohydrate fraction. The pellets were resuspended in 20 mM
Binding Domain (CBD) that were located at the 3‘ Tris-Cl pH 8.5, 500 mM NaCl and 1 mM EDTA
end of SIase on pTXB1 could be translated. Primer for use in analysis of enzyme subcellular location.
C (5'-pGGCTCTTCCTGCATCACGG-'3) [1st Analysis of Siase Fusion Location. Two methods
Base] is a pTXB1 sequence containing phosphate were used to determine the location of the enzyme,
groups at the 5'. In-Fusion PCR Cloning was done in silico and experimental method. In the in silico
in two stages using a BioRad T100 Thermal method, analysis of signa peptides was performed
Cycler. In the first stage, the Siase gene was using software signal 4.0, analysis of enzyme used
amplified by PCR using Primers A and B. The software PSLpred [5] and Cello2GO [6]. In the
composition of the reaction consisted of 2.5 gL experimental method, SIase activity was measured
primer A, primer B 2.5 gL, 2 gL SIase gene, Q5 5x in whole cells and in cell fractions.
reaction buffer (New England Biolabs) 10 gL, Q5
High-Fidelity DNA Polymerase (New England Analysis of enzyme activity in whole cell
Biolabs) 0.5 gL, 10 gM dNTPs (New England
Biolabs) 1 gL, 5x Q5 High GC enhancer (New slase fusion.
England Biolabs) 10 gL and Nuclease free water
[Fermentas] 215 gL to obtain a total volume of 50 250 pL of induced culture was used to
gL. Amplification was done with predenaturation inoculate 2.5 mL LB+ampicillin+4% sucrose,
at 98oC for 30 seconds followed by 25 cycles of Incubated at 30°C, 200 rpm for 16 hours. The
denaturation at 98oC for 10 seconds, annealing at culture was centrifuged at 11.000g for 10 minutes
46.4oC for 30 seconds and elongation at 72oC for and the pellet was suspended in 3 mLcitrate
1 minute. A final elongation at 72oC for 2 minutes phosphate buffer containing 50% sucrose. This
was performed. After electrophoresis of the was incubated at 30°C, 200 rpm for 24, 48 and 72
amplicon, it was purified using Gel Extraction Kit hours, then was centrifuged at 11.000g for 20
[Geneaid]. In the second stage, the Siase gene was minutes and the supernatant was stored at -20°C.
cloned into pTXB1 (Siase- fusion) with In-Fusion The Siase activity product in the supernatant was
PCR Cloning using Primers B and C. The detected by two methods, aniline/diphenylamine
composition of the reaction consisted of 1.5 gL test and HPLC. The aniline/diphenylamine test
primer B, primer C 1.5 gL, 170.9 nM SIase distinguished between a 1,4- and a 1,6- glycosidic
amplicon from the first stage 4 gL, 2.4 nM pTXB1 bonds [7]. Whatman No. 1 filter paper with a
2 gL, 2x Kappa mix [Biosystems] 25 and Nuclease diameter of 22 cm was placed in a petri dish. Then
free water [Fermentas] 16 gL to obtain a total 3 pL of the supernatant was spotted onto the filter
volume of 50 gL. PCR was done with paper and dried for 20 minutes. After dying, the
predenaturation at 95°C for 3 min and 25 cycles of filter paper was dipped into the of aniline/
denaturation at 98oC for 20 seconds, annealing at diphenylamine reagent, removed using tweezers
53oC for 15 seconds and elongation at 72oC for 4 and transferred to a new petri dish. The filter paper
minutes 30 seconds. A final elongation at 72oC for was dried for 1 hour. then incubated at 70°C for 5-
9 minutes was performed. To circularize the 10 minutes[8] and photographed using a digital
amplicon, both ends were ligated with T4 DNA camera..
Ligase [Fermentas]. The ligated amplicon was Preparation of cytoplasmic.
used to transform Escherichia coli BL21 (DE3). periplasmic. inner membrane and outer
Protein Expression of Siase. One single
colony of transformant was inoculated into 100 ml
membrane enzyme fractions.
of LB broth containing 100 ppm ampicillin in a The cell pellet obtained from 200 ml
250-ml Erlenmeyer flask. The culture was induced culture was resuspended in 8 mL of buffer
incubated at at 37°C, 16¬18 hours, 200 rpm. 50 ml containing 20% (w/v) sucrose, 0.5 mg/mL
of this culture was used as inoculum to a 1 L lysozyme and 1 mM EDTA and incubated at 4°C
erlenmeyer flask containing 500 mL of LB broth for 10 minutes. Then 8 mL of deionized water was
containing 100 ppm ampicillin. This was cultured added and incubated at 4°C for 10 minutes. The
in a shaker incubator (200 rpm at 37°C) until OD cell suspension was centrifuged at 6000g- 4°C for
Page | 492
PROCEEDINGS
10 minutes. The resulting supernatant was the Table 3.1 PSLpred

periplasmic fraction 1. This treatment was repeated
for the pellet to periplasmic fraction 2. The pellet Location Score for different subcellular
was resuspended in 20 mM Tris-Cl buffer pH 8.5 location
containing 500 mM NaCl and 1 mM EDTA, Cytoplasm -1.23
sonicated with 25 cycles of 10 seconds off and 10 Inner membrane -1.36
seconds on, then centrifuged at 6000g-,4°C for 10 Periplasm -0.67
minutes. The supernatant was the cytoplasmic Outer Membrane -0.85
enzyme fraction [9]. 4.4 mL triton X-100 2% was Extracelular -0.31
added to the pellet and the suspension was
incubated at 4°C for 30 minutes [10], then Table 3.2 Cello2GO
centrifuged at 11.000g for 1 minute. The
supernatant was the inner membrane fraction and Location Probability of enzyme
the pellet was the outer membrane fraction. The Score for different location
pellet was resuspended in Tris-Cl buffer pH 8.5. subcellular
Each fractions were tested for Slase activity using location
DNS reagent to determine the location of the Cytoplasm 0.96 13.6 %
enzyme translocated. Inner 0.89 l2.7 %
Membrane
3. Result and Discussion Periplasm 0.65 9.2 %
Outer 2.43 34.8 %
In silico analysis of siase-fusion Membrane
subcellular location. Extracellular 2.08 29.7 %
To ascertain the subcellular location of the Slase- Figure 3.1 shows that the cell culture supernatant
Fusion, in silico analysis using PSLpred and of cells with plasmid pTXB1- Fusion that had been
Cello2GO softwares were performed. Slase-fusion induced by IPTG and incubated with 50% sucrose
consisted of Slase - intein - CBD domains. for 24 hours, 48 hours and 72 hours produced the
In Table 3.1 it could be seen that the extracellular same yellow color with the control palatinosa
fraction have the highest score compared to the (isomaltulose). While P. rubrum which was
other subcellular locations. This suggests that the supposed to be the positive control is colored
amino acid of SIase without signal peptide will be brown. This indicates that SIase- Fusion of
translocated out of the cell. Slase subcellular Klebsiella pneumoniae that was cloned in
location analysis before and after fusion with Escherichia coli had a higher capacity to convert
intein and CBD (data not shown) showed that sucrose into isomaltulose compared to P. rubrum.
Slase Fusion would only be translocated out of the Non induced cells containing pTXBl-Fusion and
cell after the addition of intein and CBD pTXB1 as well as IPTG induced cells containing
sequences. So based on this in silico analysis, it pTXBl that were incubated with 50% sucrose for
could be concluded that the addition of intein and 24 hours, 48 hours and 72 hours did not produce
CBD sequences was sufficient to affect the process isomaltulose altogether. This is evidenced by the
of translocation of the enzyme. Whereas in Table stain color that is similar to sucrose, meaning that
3.2 can be seen that the outer membrane has the all three samples were not capable of converting
highest score and highest probability compared to sucrose into isomaltulose.
the other subcellular locations. However,
extracellular also has a high score and probability.
It could be concluded that most of the enzymes
would be translocated to the outer membrane and
out of the cell.
Page | 493
PROCEEDINGS
Figur Figure 3.1 Aniline/diphenylamine

staining of cellculture supernatants that had been Figure 3.2 HPLC of induced pTXBl-Fusion cell
incubated with 50% sucrose. A) pTXBl, B) culture supernatant that had been incubated
pTXBl+IPTG C) pTXBl Fusion, D) pTXBl with 50% sucrose. A. Standard; B. Sample with
Fusion+IPTG. 50x dilution: isomaltulose (l) and unknown (2)
3.3 SIase Fusion Enzyme Activity

HPLC
Cell fraction
SIase could convert sucrose into isomaltulose and
other sugars. HPLC graph in Figure 3.2 shows that SIase activity (U/mL)
SIase Fusion was able to convert sucrose to whole cell 3.844.2
isomaltulose and other sucrose isomer. Extracellular 0
Isomaltulose had a concentration of 6.7 ppm (77%) outer membrane 2.457.8
and the other sucrose isomer had a concentration
periplasm 1 16.6
of 2.0 ppm (23%).
periplasm 2 79.9
inner membrane 15.1
SIase activity in the subcellular
fractions. Cytoplasm 46.1
SIase assays were performed on the extracellular, 4. Conclusion

outer membrane, periplasmic, inner membrane and
cytoplasmic fractions. Table 3.3 shows that SIase Based on aniline/diphenylamine assay,
activity was mainly present in the outer membrane SIase- Fusion of Klebsiella pneumoniae that was
fraction, which meant that SIase-Fusion was cloned in Escherichia coli had a higher capacity to
translocated from the cytoplasm to the outer convert sucrose into isomaltulose compared to P.
membrane. This result confirmed the in silico Rubrum. In silico analysis with PSLpred software
enzyme location using Cello2 GO as shown in showed that the Siase-Fusion enzyme was
Table 3.2 translocated out of the cell, whereas Cello2Go
analysis showed that the Siase- Fusion enzyme
was translocated to the outer membrane.
Experimental analysis demonstrated that the SIase
enzyme of K. pneumoniae that had been fused with
an intein and CBD in E. coli was mainly
translocated to the outer membrane. However, the
mechanism of translocation of the enzyme into its
outer membrane is not yet known. Quantitative
analysis using HPLC showed that 77% of the
sucrose was converted into isomaltulose, and 23%
was converted into another isomer.
Page | 494
PROCEEDINGS
References [6] Yu. C. S., C. W. Cheng, W. C. Su, K. C.

Chang, S. W. Huang, J. K. Hwang, C. H.
[1] Li, X., C. Zhao., Q. An and D. Zhang. Lu. CELLO2GO: A Web Server for
Substrate Induction of Isomaltulose Protein subcellular Localization
Synthase in A Newly Isolated Klebsiella Prediction with Functional Gene
sp. LX3. Applied Microbiology J. 95 Ontology Annotation. Plos One. 9 (2014)
(2003)521-527. e99368.
[2] Krastanov, A., D. Blazheva., I. Yanakieva [7] Schwimmer, S., and A. Bevenue.
and M. Kratchanova. Conversion of Reagent for differentiation of 1,4- and
Sucrose Into Palatinose in A Batch and 1,6 linked glucosaccharides. Science. 123
Continuous Processes by Immobilized (1956)543-544
Serratia plymuthica Cells. Enzyme and
Microbial Technology J. 39 (2006) 1306- [8] Wu, L. and R.G. Birch. Characterization
1312. of Pantoea dispersia UQ68J : Prooducer
of a Highly Efficient Sucrose Isomerase
[3] Zhang, D., Li, X. & Zhang, L. H. Isomaltulosa Biosynthesis. J. Appl.
Isomaltulose synthase of Klebsiella sp. Environ. Microbiol. 71 (2004) 1581 -
LX3 : Gene Cloning and Characterization 1590.
and Engineering of Thermostability.
Appl. Environ. Microbiol. 68 (2002) [9] French, C., Keshavarz-Moore, E., Ward,
2676 2682. J.M., Development of a Simple Method
for the Recovery of Recombinant
[4] Spiliotis, M. Inverse Fusion PCR Cloning. Proteins from the Escherichia coli
J.Plos one. Vol 7 Issue 4. Institut fur Periplasm. Enzyme Microbial.Technol.
Parasitologis, Universitat bern, 19 (1996) 332-338.
Switzerland. (2012) E35407.
[10] Sato K, Sakai E, Veith PD et al.
[5] Bhasin, M., Aarti G. and G. P. S. Identification of a new membrane-
Raghawa. PSLpred: Prediction of associated Protein that influences
Subselullar Localization of Bcterial transport/maturation gingipains
Proteins. Bioinformatics 21 (2005) 2522 and adhesion of Porphyromonas
- 2524. Gingivalis. J Biol Chem. 280 (2005)
8668-8677.
Page | 495
PROCEEDINGS
MICROBIAL DESALINATION CELL USING TEMPE

WASTEWATER AS SUBSTRATE WITH VARYING PHOSPHATE
BUFFER CONCENTRATION AND SALINITY
Ginasesharita Hardiyanti1, Rita Arbianti1, Tania Surya Utami1, Heri Hermansyah1
1.
Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, Depok, 16424,
Indonesia
E-mail: nana@che.ui.ac.id
Abstract
In the next few years, Indonesia will experience a water crisis, because the needs for water continues to
increase every year. The water crisis will affect the quality of life, especially in terms of sanitation and
health, so it is necessary to find the solutions. Microbial Desalination Cell (MDC) is a good technology to
desalinate salt water into fresh water because MDC at the same time can generating electricity. Tempe
wastewater used as a substrate by using their source of microorganisms to efficiency the price of
operations. To improve the performance of the MDC, the experiment focused on the use of phosphate
buffer solution with varying concentrations of 0.025 M, 0.05 M, 0.1 M and 0.15 M in the anode and the
cathode chamber and the variation of the pH with pH 6.6 , pH 7.0, pH 7.4 and pH 7.8 in the anode
chamber. The use of buffer solutions to the MDC system will decrease the pH imbalance that occurs
during experiment due to the formation of hydroxyl and proton from redox reactions in the anode and
cathode chamber. Besides that, using buffer solution can also cutting the operational cost. The experiment
shows that MDC using model tempe wastewater, with a concentration of 0.1 M phosphate buffer solution
in anode and cathode chamber and pH 6.6 in the anode chamber gave the best performance with salt
removal 11.78% and average power density 23.36 mW /m2..
Keywords: Desalination, microbial cells desalination, phosphate buffer solution, tempe wastewater, pH
1. Introduction This experiment used liquid tempe

wastewater as their substrate, because in addition
In the next few years, Indonesia will as desalination technology, MDC can also be used
experience a water crisis, because the needs for as a wastewater treatment technology by taking the
water continues to increase every year. The water advantage of the presence of bacteria and organic
crisis will affect the quality of life, especially in material in wastewater.
terms of sanitation and health, so it is necessary to To improve the performance of the MDC,
find the solutions. One of the solution is the research focused on the use of a phosphate
desalination. It is a process that separate the buffer solution instead of electrolyte solution and
dissolved components in seawater into fresh water. examine the effect of varying concentrations and
Desalination selected because the availability of pH phosphate buffer. The use of buffer solutions to
sea water is very abundant in Indonesia, where as the MDC system will certainly cut costs, because
an archipelagic country, Indonesia has 5.8 million the cost of the electrolyte solution is more
km2 sea area which is dominating total territorial expensive than the buffer solution. pH imbalance
area. in the anode and cathode chamber are also taken
Microbial Desalination Cell (MDC) is a into consideration on the MDC system that uses
good technology to desalinate salt water into fresh electrolyte solution. A decrease in pH of the anode
water because MDC at the same time can chamber can inhibit microbial activity, while high
generating electricity. MDC can generate pH in the cathode chamber can cause significant
electricity by using the exoelectrogenic bacterium potential loss of electrical voltage, and decreasing
that produces electricity [1]. the rate of desalination and formation of electricity
Page | 496
PROCEEDINGS
[2]. This occurs due to the presence of membrane and CEM preparation. For the preparation of
AEM and CEM on the MDC reactor that blocking electrodes used HCl and NaOH solution.
proton and hydroxyl that formed from redox
reactions at the anode and cathode chamber to Reactor construction
move. In the anode chamber, the protons that
generated from the oxidation reaction cannot MDC reactor with three chamber was made
diffuse into the cathode chamber where the from acrylic with a comparison between the
hydroxyl formedfrom reduction reaction. This is volume of the anode chamber:saline
causing the pH imbalance in the chamber so that waterchamber:cathodechamber respectively were
the pH will decrease in the anode chamber and 4: 1: 2 [6]. The volume of the anode chamber,
increase in the cathode chamber. Therefore saline water chamber, and a cathode chamber in
phosphate buffer substitute the used of electrolyte this study was 400 mL, 100 mL and 200 mL.
solution with expectations of pH in the anode and
cathode chamber did not change significantly.
Variations of the concentration and pH
buffer solution were done to get the optimum
performance of desalination. Variations of the
concentration conducted to determine the optimum
concentration because higher concentration not
guarantee good results. Variations in pH value of
buffer solution devoted only at the anode chamber. Figure 1. MDC reactor.
Performance of exoelectrogenic bacteria to
produce electric current will decrease if the pH in The anode chamber was filled with a
the anode chamber is less than 5 [3]. Microbial mixture of model tempe wastewater and phosphate
sensitivity towards pH indicate that a decrease in buffer solution,saline water chamber was filled
pH at the anode chamber was one factor of with a solution of NaCl 30g / L while the cathode
decreasing MDC performance. chamber was filled with phosphate buffer solution.
2. Methods Operation condition

Tools and materials The first trial began by comparing the use
of buffer solution as catholyte with electrolyte
In this study, MDC reactor with three
solution of potassium permanganate 0.1 M. The
chambers separated by Anion Exchange
next stage is the concentration variation of
Membrane (AEM) and Cation Exchange
phosphate buffer solution with concentration 0.025
Membrane (CEM) was used for the experiment.
M, 0.05 M, 0.1 M and 0.15 M and variation pH
The contact surface area of the membrane for
value of buffer solution that is used as a mixture of
AEM and CEM is 113.04 cm2. Graphite rods used
anolyte with pH 6.6, pH 7.0, pH 7.4 and pH 7.8.
as the anode and cathode 10 x 6 x 0.8 cm
After all variations have been done and get
dimensions with 145.6 cm2 of surface area. The
the optimum results for the MDC system, then
anode and cathode are connected with copper
further experiments was performed to determine
cable and fitted with a 10 ohm resistor as external
the effect of MDC system thet used industrial
barriers. The result of electric voltage is measured
tempe wastewateras substrate. These experiments
by multimeter APPA 109N and KRISBOW
were analyzed based on the percentage of salt
KW06-796 that connect to a computer, while the
removal, the rate of desalination and power
conductivity of saline solution measured by
density. All experiments were performed at room
conductivity meter LUTRON CD-4301.
conditions (37 ° C).
Model tempewastewater was made from the
boiled soybeans with a mass ratio of soybeans:
volume of water 3: 5 [4]. Tempe wastewater must Calculations
be incubated for 65 hours before used as a
Conductivity data will be usedto know
substrate[5]. Buffer solution for this study is a
concentration of saline solution by using the
phosphate buffer solution with varying
standard curve equation that was created earlier.
concentrations and pH values, while KMnO4 is
The data is then processed to obtain the value of%
used for the electrolyte solution. NaOH solution is
salt removal and desalination rate. Salt Removal
used as a model saline water and membrane AEM
(SR) is percentage of the moles of salt that are
eliminated against initial moles [7].
Page | 497
PROCEEDINGS
Thoseresult of data processing shownhow much

production of electricity.
With: 3. Results and Discussion

SR :Salt removal (%) The effect of using tempe wastewater as
co :Initial salt concentration (g / L) substrate
ci :Concentration of salt after desalination (g/L) This experiment compared the performance
of MDC between tempe wastewater and distilled
The calculation of desalination rate is to determine water as substrate. Based on Fig. 2, MDC that used
the decline rateof moles of salt at one time. tempe wastewater had salt removal 11,16% and
average power density 2474.6 mW/m2, while
MDC with distilled water as substrate had salt
removal 4.39% and average power density 42.9
mW/m2for 50 hours operating time. The use of
With: tempe wastewater could improve salt removal into
6.77%. The results were higher for tempe
DR :Desalination rate (mmol/hour)
wastewater because inside that there was catabolic
no :Initial salt moles (mmol) microorganisms activity that triggering
desalination [8],so the presence of the tempe
ni : moles of salt after desalination (mmol) wastewater as substrates affect the peforma of
MDC system.
t :Desalination time (hour) Significant difference results of electricity
in the MDC system that uses tempe wastewater
From the electric voltage data measured on the proved that microorganisms or bacteria in the
multimeter. can be known the value of electric inside were able to oxidize substrate and produce
current (I) then can be used to determine the electrons to be delivered from anode to cathode.
generating power density. Electric current shows The desalination process still occurred for the used
how many electrons that flowing in the system. of distilled water with lower desalination rate
because there was osmotic pressure difference
between chambers and different concentrations of
ions that allowed ion transfer occurs passively.
With: 30
(A)
I : Electric current (mA) 29,5
V : Voltage (mV) 29
Salinity (g/L)
Rex: External resistance (Ohm) 28,5
Power density is the power that is released per unit 28
of surface area of the electrodes

27,5
27 Tempe Wastewater
Without Tempe Wastewater
26,5
With: 0 10 20 30 40 50
Operating Time (hours)
Pd:Power density(mW/m2)
Rex: External resistance (Ohm)
I : Electric current (mA)
A :Surface area of electrode (m2)
Page | 498
PROCEEDINGS
7000 30
Tempe Wastewater
6000 Without Tempe Wastewater
29,5
5000
Power Density (mW/m )
29
2
Salinity (g/L)
4000 28,5
3000 28
2000 27,5
(A)
1000
27 Electrolyte Solution
(B) Buffer Solution
0
26,5
0 10 20 30 40 50
0 10 20 30 40 50
Operating Time (hours) Operating Time (hours)
Figure 2.The effect of using tempe wastewater 7000
as substrate towards (A)salinity and (B) power Electrolyte Solution

6000 Buffer Solution
density.
5000

2
The effect of using buffer solution as
catholyte 4000
3000
In this experiment, the MDC that used
buffer solution had salt removal 9.87% and 2000
average power density 1734.08 mW/m2, while the
MDC that used electrolyte solution such as 1000
(B)
KMnO4 had salt removal 11.16% and average
0
power density 2474.59 mW/m2. The result of 0 10 20 30 40 50
desalination of saline water by using electrolyte Operating Time (hours)
solution was greater than using a buffer solution

even though the difference ofthe decreasing salt Figure 3. The effect of using buffer solution as
concentration not much different from the use of catholyte towards (A) salinity and (B) power
buffer solution. Electrolyte solution of salt removal density.
only increase as much as 1.29%. The result of
decreasing salinity and power density can be seen Variation of concentration of phosphate
in Fig. 3. buffer solution
Based on the analysis of raw material prices
on the catholytethat used buffer solution and MDC with concentration buffer
electrolyte solution (Table 1). Prices of electrolytic solution 0.1 M was able to reduce the salinity
solution was 2.05 times greater than the price of with the largest result from 29.79 g/L to 26.85
buffer solution, buttheir value of salt removal was g/L with salt removal 9.87% and an average
not much different from using a buffer solution. power density 1734.08 mW/m2. MDC with
Therefore, a buffer solution without electrolyte
buffer solution 0.025 M was able to reduce
will be used for the next step in this research,
considering the price is much cheaper. salinity from 28.73 g/L to 26.54 g/L with salt
removal 7.59 % and an average power density
Table 1. The difference of catholyte price with 27.01 mW/m2. MDC with buffer solution
their salt removal 0.05 M was able to reduce salinity from 29.46
g/L to 27.01 g/L with salt removal 8.32 % and
Variable Price Salt average power density 132.20 mW/m2. MDC
Removal with buffer solution 0.15 M was able to
reduce salinity from 29.96 g/L to 27.56 g/L
Electrolyte Solution Rp 9.655.37 11.15 %
with salt removal 8,0 % and average power
Buffer Solution Rp 4.687.25 9.87 % density 53.52 mW/m2.
Based on the Fig. 4 (B), four types of
buffer concentration variation curves had the
Page | 499
PROCEEDINGS
same trend of curves. The curve has increased 700
in the early operating time, and then continued 600 (A)

to decline up to the end of MDC operation.
500

2
The value of power density at concentration
buffer solution 0.1 M is very much different 400
from other concentration which generated 300
smaller power density. This significant

200
difference could be caused by the internal pH
pH
6,6
7,0
resistance in the MDC system during the 100
pH
pH
7,4
7,8
displacement flow process that result 0

decreasing voltage [9]. 0 10 20 30
40 50
30
30
29,5
29,5
29 (B)
29 28,5
Salinity (g/L)
Salinity (g/L)
28
28,5
27,5
28
27
pH 6,6
27,5 pH 7,0
26,5 pH 7,4
0,025 M pH 7,8
0,05 M
27 0,1 M 26
0,15 M 0 10 20 30 40 50
26,5
0 10 20 30 40 50
Figure 5. The effect of pH value variation of
7000
buffer phosphate solution towards (A) salinity
and (B) power density.
6000
The result of power density from all

5000
variation of pH indicates that the results are not

2
4000 much different from their curve trend. The highest

result of power density at the beginning of the
3000 experiment was because at that time the activity of
2000
0,025 M
0,05 M
the microorganisms in the substrate is still high.
0,1 M
0,15 M
The value of power density is quite small
1000 compared to previous experiments due to the
internal resistance of the reactor, especially on the
0
0 10 20 30 40 50 performance of ion exchange membrane. During
Operating Time (hours) the experiment, the membranes were not replaced
with the new ones so that the surface of membrane
Figure 4. The effect of concentration phosphate
form fouling which makes performance of ion
buffer solution variation towards (A) salinity
transfer were reduced.
Variation of pH value of buffer The effect of using industrial tempe

phosphate solution in anode chamber. wastewater
Fig. 6 shown a decreasing salinity of the
Based on theFig. 5 the MDC that using
MDC which uses model tempe wastewater and
buffer solution pH 6.6 in the anode chamber is able
industrial tempewastewater, with 147 hours
to decrease the salinity with the largest result from
operating time.
29.91 g/L to 26.38 g/L with salt removal 11.78%
and average power density 23.36 mW/m2
Page | 500
PROCEEDINGS
32 driving force of the desalination process at MDC

(A) because it determines the amount of salt that is
30 transferred through the membrane [10]
28 Decreasing COD value of tempe

Salinity (g/L)
wastewater
26
COD test was also conducted toward

24 industrialtempe wastewater. This test was
performed to see the effect of the MDC system and
22
Model Tempe Wastewater
its potential as wastewater treatment process.Based
Industrial Tem pe Wastewater on Fig. 7, there was 55.75% COD that decrease
20 from the original 12,968 mg/L to 5,738 mg/L with
0 50 100 150 147 hours operationtime. Although the COD value
has not yet entered the quality standard of 300
mg/L (Regulation of the Minister of Environment
5
Model Tem pe Wastewater
No. 15 year 2008), the MDC system can be used
Industrial Tempe Wastewater (B) as aearly stage of wastewater treatment system so
4 it can be reduced the burden on the next
wastewater treatment process system. Moreover,
2
3 the use of tempewastewater as anolyte in MDC,

was able to increase the usefulness of the
2
wastewater in terms of desalinate and produce
electricity.
4
1,4 10
1
4
1,2 10
0
4
0 50 100 150 1 10
Operating Time (hour)
COD (mg/L)
8000
Figure 6. The effect of using industrial and
model tempe waste water towards (A) salinity 6000

4000
The use of industrial tempewastewater as

2000
anolyte had decreasing salinity that slightly larger
than the model tempewastewaters. During 147 0
hours of operation, the salt concentration for both Before After
types of waste tempe dropped from 30.09 g/L to

21.49 g/L for the industrial tempe wastewater and Figure 7. The difference of COD value of tempe
22.37 g/L for model tempe wastewater. MDC that wastewater before and after MDC experiment.
using industrial tempe wastewater had salt removal
28.57% and average power density 0.672 mW/m2. 4. Conclusion
MDCthat using model tempewastewater had salt
25.65% and average power density of 0.206 The use of tempewastewater as a substrate,
mW/m2. with phosphate buffer solution 0.1 M in the anode
The value of power densitywere slightly and cathode chamber and pH6.6 in the anode
greater at MDC that used industrial chamber gives the best results with salt removal
tempewastewater because the aviability of 11.78% and a power density of 23.36 mW/m2.The
nutrient/substrate that contained in it were bigger optimum concentration of phosphate buffer to
than the model tempewatewater. Abundant amount produce electricity and desalinate salt is 0.1 M,
of substrate is capable to produce greater power with salt removal 9.87% and an average power
(Kartiko, 2013). Results of salt removal was density 1734.08 mW/m2. pH value of phosphate
greater because the power density that generated in bufferin the anode chamber that was able to
the MDC with industrial tempewastewater is desalinate salt water with the best result was pH
greater than the MDC with model tempe 6.6 with salt removal 11.78%.
wastewater. Production of electricity is one of the
Page | 501
PROCEEDINGS
References [6] Zhang, F. & He, Z. (2015). Scaling up

microbial desalination cell system with a
[1] Chen, X., Xia, X., Liang,P., Cao, X. Sun, post-aerobic process for simultaneous
H.T., & Huang, X. (2011) Stacked microbial wastewater treatment and seawater
desalination cells to enhance water desalination. Desalination, 360, 28-34
desalination efficiency. Environ. Sci.
Technol., 45, 2465–2470. [7] Jacobson, K.S., Drew, D.M., & He, Z. (2011)
Use of a liter-scale microbial desalination cell
[2] Qu, Y., Feng, Y., Wang, X., Liu, J., Lv, as a platform to study bioelectrochemical
Jiangwei, He, W., & Logan, B.E. (2013). Salt desalination with salt solution or artificial
Removal Using Multiple Microbial seawater. Environ. Sci. Technol., 45, 4652-
Desalination Cells under Continuous Flow 4657.
Conditions. Desalination, 317, 17–22.
[8] Betts, K. (2009). Using Microbes and
[3] Kim, Y. & Logan, B.E. (2012). Microbial Wastewater to Desalinate Water. Environ.
Desalination Cells for Energy Production and Sci. Technol., 43, 6895.
Desalination. Desalination, 308, 122-130.
[9] Logan, B.E., et.al. (2006). Microbial Fuel
[4] Nout, M.J.R., Rombouts, F.M. 1990. Recent Cells: Methodology and Technology.
developments in tempe research. Journal of Environ. Sci. Technol., 40, 5181 – 5192.
Applied Bacteriology, 69, 609-633.
[10] Eurodia. (2010). Electrodialysis. Retrieved
[5] Zuhri, Fachryan., (2015). Evaluasi Kinerja May 20, 2013, from Eurodia:
Microbial Desalination Cell Melalui http://www.eurodia. com/html/elep.html
Pemanfaatan Substrat Limbah Tempe dengan
Variasi Konsentrast Metilen Biru dan Varia,
Depok: FTUI.
Page | 502
PROCEEDINGS
MICROBIAL DESALINATION CELL WITH LEACHATE AND

SODIUM PERCARBONATEASNATURALLY BUFFERING
ELECTROLYTES
Etri Dian Kamila1, Tania Surya Utami1,Rita Arbianti1, Heri Hermansyah1
1.
Chemical Engineering Department, Faculty of Engineering, Universitas Indoneasia, Depok, 16424,
Indonesia
E-mail: nana@che.ui.ac.id
Abstract
Microbial Desalination Cell (MDC) is a remarkable solution to overcome Jakarta‘s fresh water deficite
which can also produce electricity. Imbalance of pH between chambers has always been an obstacle for
MDC system and several approaches give impact to capital and operational cost increment. To answer the
problem economically, leachate (L) and sodium percarbonate (SP) are used as naturally buffering
electrolyte in this researchfor their production of bicarbonate buffering system. The effect of buffer
addition (1:1 v/v ratio) in L as anolyte and SP as catholyte has been examined and MDC L-SP, which
MDC with no buffer addition in the two electrolytes comes with the best result (SR = 20,30%; P D average =
5,5 mW/m2).
Keywords:Microbial Desalination Cell,imbalance of pH, leachate, sodium percarbonate, naturally

buffering electrolyt
1. Introduction cathode. The moving electron is then captured by

the electron acceptor in the cathode chamber
Fresh water deficite in Indonesia has (usually O2 or catholyte), to produce water with the
occurred in various regions, including the region of aid of proton. Because of IEM presence, the anions
the capital city Jakarta, because fresh water of salt solution in desalination chamber migrate to
demand of 26.1 m3 per second per day can only be anode chamber while cationsmigrate to cathode
met by 17 m3 per second per day fresh water chamber, thus resulting desalination [4].
supply [1]. Jakarta sea, which covers about 6,977 pH imbalance due to pH decrease in the
km2[2] has the potential to become a raw water anode chamber and pH increase in the cathode
alternative for the fresh water production through chamber has always been a trouble in MDC
desalination process. The high energy system [5] that can inhibit the activity of bacteria,
consumption of the already exist desalination shorten the desalination cycle, and lower voltage
methods, such as reverse osmosis and distillation, of 95 mV per pH unit drop [6-7-8]. Several
with a range of 2-15 kWh/m3[3], makes the approaches tried to solve this pH imbalance
development of non-external energy desalination problem, such as adding pH 7 buffer into
methods is required. electrolytes [6-9], replacing electrolytes
Desalination method with no external periodically during the operation cycle [10] and
energy requirement is Microbial Desalination Cell recirculating electrolytes with a modified reactor
(MDC), which is a modification of [11] have increased the capital and operating costs
bioelectrochemical system Microbial Fuel Cell of the MDC.
(MFC), so it has the ability to desalinate water and Electrolytes which have natural carbonate-
produce electricity simultaneously. MDC consists bicarbonate buffering system, such as leachate and
of three chamber separated by ion exchange sodium percarbonate (2Na2CO3 · 3H2O2[12-13],
membrane (IEM). Organic matter is oxidized by were used in this study to address issues of MDC
exoelectrogen bacteria in the anode chamber and pH imbalance economically. Leachate, which is
the bacteria transfer electron from anode to the garbage heap leach water and rich in bacteria
Page | 503
PROCEEDINGS
population [14], is used for its abundant existence two fiber bundles of carbon fiber cloth with 200
and environment pollute properties as a result of fiber strands in length of 20 cm. To remove metal
heavy metals and inorganic compounds dissolved contaminants and inorganic compounds after use
[12]. Testing of leachate as anolyte in the MFC [18], electrodes were immersed in 0.1 M HCl
system has been carried out by Jambeck and solution for one day, then were rinsed with
Damiano [15] and generates a voltage >400 mV. distilled water, followed by immersion in 0.1 M
Sodium percarbonate is an electrolyte solution that NaOH solution for one day then rinsed again with
is less expensive, anti-fouling, and distilled water and remain stored in distilled water
environmentally friendly. In MFC system, sodium until use. The anode and cathode were connected
percarbonate generate power density of 9.600 by copper wire with external resistance of 10 Ω..
mW/m3 and proved to have a stable buffer
capacity [16]. MDC operation
Addition of buffer in the leachate and
sodium percarbonate was varied to see its MDC operated in a batch system at room
influence on the effectiveness of both natural temperature, with 50 hours operation time per cyle,
buffering electrolytes toward desalination where the electrolyte was only added to the system
performance and electricity generation in MDC at the beginning of the cycle. No-treatment
system. leachate from IPAS III inlet TPST Bantargebang,
Bekasi, was inoculated into anode chamber (as
2. Methods anolyte) immediately after taking. 0.1 M phosphate
buffer pH 7 was used from a mixture of K 2HPO4
MDC configuration and KH2PO4 · 3H2O. The ratio of the electrolyte
and buffer was 1: 1 (v/v), i.e., 200 ml anolyte and
Cube-shaped MDC was made of 200 ml buffer solution in the anode chamber and
polymethyl methacrylate (PMMA), consisting 100 ml catholyte and 100 ml buffer solution in the
three chambers: the anode chamber, desalination cathode chamber.
chamber and cathode chamber (Fig. 1). The ratio Four systems MDC were compared (Table
of MDC was 4 : 1 : 2 [17], with the effective 1), namely (1) L-SP, with leachate and sodium
volume of anode chamber, desalination chamber percarbonate without addition of buffer, (2) LB-
and cathode chamber, was 400 mL, 100 mL and SP, with the addition of buffer only in the leachate,
200 mL respectively. The anode chamber and (3) L-SPB, with the addition of buffer only on
desalination chamber was separated by AEM sodium percarbonate, and (4) LB-SPB, with the
(AMI-7001, Membrane International, Inc.), while addition of buffer in the leachate and sodium
the desalination chamber and cathode chamber was percarbonate
separated by CEM (CMI-7000, Membrane
International, Inc.). Data analysis
NaCl conductivity value was measured
using conductometer (Lutron CD - 4301) and the
data was processed into salt concentration value
(g/L), the power supply voltage was measured
with a digital multimeter (XIOLE XL830L) and
calculated into power density value (mW/m2), and
the electrolyte pH was measured at the beginning
and the end of the experiment using a pH meter
(EUTECH Instrument Model EcoTestr pH 2).
Desalination performance was known by
salinity reduction (g/L) and the percentage of salt
removal was calculated using equation SR (%) =
100% x [(Co - Ci) / Co], where Coand Ci is the
initial and final concentration
Figure 1.MDC configuration scheme.
Four graphite rods from D-size batteries

were used as the anode with 41.12 cm2 total
effective surface area. The cathode used was the
Page | 504
PROCEEDINGS
Table 1.MDC system with varied buffer addition
MDC Leachate : Buffer(v/v) S. Percarbonate : Buffer(v/v)
L-SP 1:0 1:0

LB-SP 1:1 1:0
L-SPB 1:0 1:1
LB-SPB 1:1 1:1
area [20] by equation PD (mW/m2) = (IxV) / Aanode. where I is the current strength (A).V is the voltage
measured (V). and Aanode is the total effective area of the anode.
3. Results and Discussion 25
(B)
Desalination Performance
20
Salt Removal (%)

Four MDC systems with buffer addition
variation in the electrolyte were operated 15
simultaneously by using leachate on the same day.
Figure 2 shows that L-SP obtained the highest
salinity decrease from 29.92 g/L up to 23.85 g/L. 10
L-SP SR (20.30%) was higher than LB-SP SR
(11.67%) (Figure 3) and it showed that leachate
with noaddition.. 5
32
(A) 0
L LB L LB
30
SP SP SPB SPB
Salinity (g/L)
28 Figure 2. Desalination performance of MDC

variation of buffer addition. based on: (A)
salinity reduction dan (B) salt removal .
26
L-SP Percentageof buffer produce better
LB-SP performance of desalination than the one with
24 buffer addition. The production of electricity is a
L-SPB
LB-SPB major factor driving the rate of desalination [4] and
pure leachate without dilution provided higher
22
0 10 20 30 40 50 power density than the diluted ones [21]. Leachate
without dilution has high bacterial cells
Time (hr) concentration triggering more flow of electrons
(electricity) through the circuit [22].
The addition of buffer in sodium
percarbonate also decreased the performance of
desalination, seen by higher L-SP SR and lower L-
SPB SR (16.18%). HCO3-⇌ CO32- reaction in
sodium percarbonate has a pKa value of 10.3 [23],
where this value is higher than the pK of H2PO4-⇌
HPO42- reaction, which is 7.21 [24], results in
more OH- ions which can increase the power
density [16-25] on improving desalination.
Mixture of sodium percarbonate and buffer lower
the pKa value so that the production of electricity
decreased and led to a decline in the desalination
performance.
Page | 505
PROCEEDINGS
Electricity Production
20 L-SP
Figure 3A shows power density (P D) of the LB-SP
four MDC system in 50 hours operation and it can L-SPB
be seen that the average value of PD was 15 LB-SPB
P (mW/m )
2
proportional to the SR value in Figure 2B. L-SP
was also gave the highest average PD (5.5 mW/m2) 10
(B)
and maximum PD (20.5 mW/m2) compared to the
D
other MDC systems in this experiment.
As well as desalination triggered by power 5
surges, power density decrease in LB-SP occurred
due to leachate dilution on the substrate [21-22] 0
and a decrease in L-SPB power density was caused
by low levels of OH- in the catholyte mixture of 0 10 20 30 40 50
sodium percarbonate and buffer which resulted in Time (hr)
lower electricity generated.
Based on power density for 50 hours Gambar 3. Electricity production of MDC
operation (Figure 3B), L-SP and L-SPB had PD variation of buffer addition. based on: (A)
value of 20.5 mW/m2 and 9.5 mW/m2 respectively power densityin 50-hr operation time and
in the beginning of the cycle then dropped (B)average and maximum power density.
dramatically at hour 3 (0.5 mW/m2 and 1.4
mW/m2) up to 27 hours (0.6 mW/m2 and 0.03 pH Changes
mW/m2) and increased very rapidly during the
hour 45 (7.6 mW/m2 and 6.9 mW/m2). This power The pH value of the pure leachate on L-SP
density profile can be affected by bacteria growth and L-SPB at the beginning of the experiment was
[26] where at the hour 45 bacteria in leachate 8.3, which the leachate could be categorized as a
experienced log phase. type of methanogenic leachate [28]. Unlike the
Explanation of high power density in the common MFC/MDC researches that more likely to
beginning of the cycle can be associated with the experienced a decrease in pH, in the anode
conductivity of the electrolytes. The electrolyte chamber of this experiment, pH increase was
conductivity is proportionalwith the electricity happened with ΔpH range from 0.4 to 0.5 due to
production bioelectrochemical system [27] though the methane formation reaction by methanogenic
it is not known as the main factor triggering the bacteria involving bicarbonate ions and resulted in
electron flow. decrease of H+ ions and acidic components in the
leachate, such as volatile fatty acids (VFA) [21-
25 22]. Reactions involving methane formation of
Average P bicarbonate ions in the anode chamber can be seen
D in the Eq. (1) and Eq. (2)[13-29].
20 Maximum P
D
HCO3- + H+→ CO2 + H2O
(1)
(mW/m )
2
15 (A)
4H2 + CO2 →CH4 + 2H2O (2)
10 In the cathode chamber. L-SP and LB-SP In
D
P
the cathode chamber, L-SP and LB-SP had

increase in pH (ΔpH = 0.4 to 0.5) which was not
5
much different from the L-SPB and LB-SPB (ΔpH
= 0.2). It showed that sodium percarbonate was
0 proven by its natural buffering and can maintain
L LB L LB stable pH with no use of buffer. The reaction of the
SP SP SPB SPB carbonate-bicarbonate buffer ions to OH- ions at
the cathode chamber contained in the Eq. (3)[13]].
HCO3- + OH-⇌ CO32- + H2O (3)
Page | 506
PROCEEDINGS
4. Conclusion [12] P. Kjeldsen, M.A.Barlaz, A.P.Rooker,

A.Baun, A. Ledin,
Using leachate and sodium percarbonate as T.H.Christensen,Environmental Science &
natural buffering electrolytes twas an economic Technology 32/4 (2002)297-336.
solution to overcome the pH imbalance problem in [13] OECD SIDS, Sodium Percarbonate (CAS N°:
MDC system. MDC with anolyte leachate and 15630-89-4), UNEP Publications.
catholyte sodium percarbonate without addition of
buffer (L-SP), resulted in maximum performance [14] W. Zhang, B.Yue, Q.Wang, Z.Huang,
of desalination (SR = 20.30%) and the highest Z.Zhang,Journal of Environmental
power production (PD average = 5.5 mW/m2). Sciences23/11 (2011) 1770–1777.
[15] J. Jambeck, L. Damiano,Microbial Fuel Cells
Acknowledgment in Landfill Applications, Final
Report,Environmental Research and
This research was supported by the Education Foundation, Virginia, 2010.
Laboratory of Bioprocess Engineering, [16] C. Forrestal, Z. Huang, Z.J. Ren,Bioresource
Department of Chemical Engineering, Faculty of Technology17 (2014) 429–432.
Engineering, Universitas Indonesia..
[17] F. Zhang, Z. He,Bioresource Technology172
References (2014)429–432.
[18] M. Prabu, M. Durgadevi, M. Tamilvendan,
[1] Hilal,Jakarta Krisis Air Bersih, Metro TV P.T. Kalaichelvan, V. Kaviyarasan,Journal of
News, Modern Biotechnology1/1 (2012) 19-25.
http://news.metrotvnews.com/read/2016/01/2
[19] K.S. Jacobson, D.M. Drew, Z.
1/214323/jakarta-krisis-air-bersih,2016.
He,Environmental Science & Technology45
[2] Badan Pusat Statistik,Jakarta in Figures,SK (2011) 4652–4657.
Gubernur No. 171 Tahun 2007, 2008.
[20] B.E. Logan,Microbial Fuel Cells, John Wiley
[3] H. Luo, P.Xu, Z. Ren,Bioresource & Sons, New York,2008, p. 71.
Technology120 (2012)187-193.
[21] J. Greenman, J. Ieoropoulos,Enzyme and
[4] Y. Kim, B.E.Logan,Desalination 308 (2012) Microbial Technology44 (2009) 112–119.
122-130.
[22] R.K. Arifah, T.S. Utami, and R. Arbianti,
[5] N.A. Shehab,G.L. Amy, B.E. Logan, Proceeding of the Seminar Nasional Teknik
P.E.Saikaly,Journal of Membrane Science Kimia Indonesia, Sleman, 2015.
469 (2014)364- 370.
[23] MP Biomedicals, Sodium
[6] X. Cao, X.Huang, P.Liang, K. Xiao, Bicarbonate,http://www.mpbio.com/product.p
Y.Zhou,X. Zhang, B.E.Logan,Environmental hp?pid=02194553, 2016.
Science & Technology43 (2009)7148-7152.
[24] E.R. Gauthier,Biochemistry I (CHMI 2227 E)
[7] R.A. Rozendal, H.M.V.Hamelers, Problems and Solutions, Department of
K.Rabaey,J. Keller, C.J.N. Buisman,Trends Chemistry and Biochemistry, 2007.
Biotechnol.26 (2008)450-459.
[25] S.C. Popat, D.Ki, B.E.Rittmann,
[8] F. Zhang, K.S.Jacobson, P.Torres, Z. C.I.Torres,ChemSusChem5 (2012) 1071 -
He,Energy & Environmental Science3 1079.
(2010)1347–1352.
[26] K. Ganesh, Master Thesis, B. Tech, Graduate
[9] M. Mehanna, T. Saito, J. Yan, M.Hickner, X. Faculty, The Univeristy of Georgia, Georgia,
Cao, X. Huang, B.E.Logan,Energy & 2009.
Environmental Science 3 (2010)1114–1120.
[27] Z. Ge, Z. He,Bioresource Technology109
[10] X. Chen, X.Xia, P.Liang, X.Cao, H.Sun, X. (2012) 70 - 76.
Huang,Environmental Science & Technology
[28] L. Rastas.A Literature Review: Typical
45 (2011) 2465-2470.
leachate - does it exist? SBA199, Senior
[11] Y. Qu, Y. Feng, W.Xi, Design Project Report, Division of Waste
B.E.Logan.Bioresource Technology106 Science & Technology Luleå University of
(2012)89–94. Technology, Luleå, 2002.
[29] M.J. Khalil, M. Gupta, K.
Sharma,International Journal of Engineering
and Technical Research(2014) 10-14.
Page | 507
PROCEEDINGS
TOPIC FIELD: MARINE AND

VETERENIARY BIOTECHNOLOGY
Page | 508
PROCEEDINGS
STRUCTURE AND MUCOPOLYSACCARIDE TYPE OF MAJOR

SALIVARY GLANDS OF THE SUNDA PORCUPINES
(HYSTRIX JAVANICA)
Teguh Budipitojo1), Elvinkan Ruth1), Fitri Wulandari1),
Guntari Titik Mulyani2), Yuda Heru Fibrianto3)
1
Department of Anatomy, 2Department of Internal Medicine, 3Department of Physiology, Faculty of
Veterinary Medicine, Universitas Gadjah Mada, Yogyakarta 55281, Indonesia.
.
E-mail: budipitojo@ugm.ac.id
Abstract
Sunda porcupines is one of the rodent species endemic to Indonesia. Although the conservation
status of Sunda porcupine is the least concern, their populations in the wild tend to dramatically decrease
due to high interest of human consumption. Moreover, information related to the anatomical structure of
their organ system is still limited. Thepurpose of this study is to identify the topography, anatomical
structures and types of mucopolysaccharides produced by the major salivary glands of Sunda porcupine.
The study used four female Sunda porcupines. Tissue samplesof major salivary glands which include
parotid, submandibular and sublingual glands were processed for paraffin method and analyzed using
macroscopic observation, Hematoxylin-Eosin (HE), Alcian Blue-Periodic Acid Schiff (AB-PAS) and
lectin histochemistry forsaphora japonica agglutinin (SJA) andwheat germ agglutinin(WGA). Theparotid
gland was found in the preauricular region and along the posterior surface of the mandible,while the
submandibularand sublingual glands were located on the floor of the mouth posterior to each mandibular
canine. The parotid gland was divided into two lobules, each composed by different types of aciniin a
separate lobulation. HE staining showed that parotid gland looks unique because in the anterior lobe, the
acini are dominated by serous cell-type, while the acini of posterior lobe are composed by mixed of
serous and mucous cell-types. Submandibular gland acini consist of serous cells-type and sublingual
gland acini are covered by mucous cell-type. All of three major salivary glands have complete duct
system comprising intercalated, striated and excretory ducts. The acini of parotid gland contains acid and
neutral mucopolysaccharides, the submandibular gland contain neutral mucopolysaccharides and
sublingual glands contain acid mucopolysaccharides according to the AB-PAS staining method. Lectin
staining using SJA and WGA indicates that acini in salivary glands of sunda porcupine contain sugar
residue of N-acetylgalactosamine and N-acetylglucosamine which is a derivative of galactose and glucose
by the order of intensity from weak to strong in the parotid, sublingual and submandibular glands. The
present results provide the first time data on the anatomical structure and mucopolysaccharides type
produced by major salivary glands of Sunda porcupines.
Keywords: Sunda porcupine, major salivary gland, anatomical structure, mucopolysaccharides
1. Introduction The Sunda porcupine has a distinct

gastrointestinal system. Even the histological
The Sunda porcupines(Hystrix javanica) is structure of pancreatic tissues of Sunda porcupine
one of the rodent species endemic to Indonesia. similar to the other mammalian species [1], its
Although the conservation status of Sunda contains four types of major pancreatic endocrine
porcupine is the least concern, their populations in cells with approximately similar distribution
the wild tend to dramatically decrease due to high patterns to the other rodents, except for abundant
interest of human consumption. Moreover, there is glucagon cells in the peripheral area of the islets of
lack information on the anatomical structure of Langerhans [2].
their organ systems.
Page | 509
PROCEEDINGS
Histochemistry can be defined as the as samples. Salivary gland tissuesof Hystrix

chemistry of tissue components and its relation to javanicawere fixed for 24 hours in Bouin's
tissue morphology. In histochemical study, lectins solution, dehydrated in ethanol, cleared in xylene,
have extensively been used as probes in studying and embbeded in parrafin.
the cell surface interaction and carbohydrate Tissue samples of major salivary
composition in many tissues because lectins, glands(parotid, submandibular and sublingual
naturally polypeptides, can bind specifically to glands) were processed for paraffin method,cut
carbohydrate residues in term of glycoconjugates serially in 4∼5µm thickenessesand stained by
[3]. Many authors have focused on the importance hematoxylin and eosin (HE) for conventional
of glycoconjugates in salivary glands of histological evaluation. Alcian Blue-Periodic Acid
mammalian species and correlated them with body Schiff (AB-PAS) and lectin histochemistry
functions such as, transporting of macromolecules forsaphora japonica agglutinin (SJA) andwheat
for digestive efficiency, preventing proteolytic germ agglutinin(WGA) were applied for further
damage on epithelia, and defending against analysis of sugar residues in the glycoconjugates
bacteria [4, 5]. of majaor salivary gland. Sections were examined
Anatomical structures and types of with a conventional light microscope, and
mucopolysaccharides produced by the major photomicrographs were taken with OptiLab digital
salivary glands of Sunda porcupine, however, are camera.
not available. Therefore, the study was conducted
conventional staining for histological analysis and 3. Results and Discussion
lectin histochemical methods for detecting sugar
residues in the glycoconjugates of major salivary Theparotid gland was found in the
gland. preauricular region and along the posterior surface
of the mandible, while the submandibularand
2. Methods sublingual glands were located on the floor of the
mouth posterior to each mandibular canine. The
Fourmajor salivary glands of adult Sunda parotid gland is divided into two lobules, each
porcupines, Hystrix javanica, about 67 cm in composed by different types of aciniin separated
length, were purchased from a merchant in lobes.
Tawangmangu, Central java, Indonesia were used
Page | 510
PROCEEDINGS
Figure 1. Alcian Blue-Periodic Acid Achiff (AB-PAS) staining reaction in the submandibular.
sublingual and parotis glands of Sunda porcupines (520x). The submandibular (A)
and anterior lobe of parotis glands (B) positive with PAS. The sublingual (C) and
posterior lobe of parotis gland (D) positive with AB. Stars and arrows indicated the
acini and ducts of the glands.
Page | 511
PROCEEDINGS
Figure 1. Lectin histochemistry for saphora japonica agglutinin (SJA) and wheat germ
agglutinin (WGA) in the major salivary glands of Sunda porcupine (520x). Lectin
histochemistry method showed that SJA (A. B. C) and WGA (D. E. F) were
detected in all major salivary glands of Sunda porcupine by the order of intensity
from strong. medium and weak in the submandibular. sublingual and
parotidglands. respectively. Stars and arrows indicated the acini and ducts of the
glands.
Page | 512
PROCEEDINGS
Routine histologic examination of acetylglucosamine which is a derivative of glucose

hematoxylin and eosinstained sections revealed [14].
that the submandibular and sublingual glands were
located in close proximity, separated by thin 4. Conclusion
fibrous connective tissue. HE staining showed that
submandibular gland acini consist of serous cells- The present results provide the first time
type and sublingual gland acini are covered by data on the anatomical structure and
mucousmucosa cell-type. Parotid gland looks mucopolysaccharides type produced by major
unique because in the anterior lobe, the acini are salivary glands of Sunda porcupines.
dominated by serous cell-type, while the acini of
posterior lobe are composed by mixed of serous
Acknowledgment
and mucous cell-types. As a major salivary gland
of the body, a submandibular, sublingual and This study was fully supported by the Grant
parotid gland of different rodents shows a variety for Scientific Research (PUPT UGM 2016) from
in the lobes and form of its secretory endpieces. In the Directorate General of Higher Education
agreement with our finding in Sunda porcupine, (DIKTI). Ministry of Research. Technology and
the submandibular and sublingual secretory Higher Education of Indonesia with contract
endpieces of rat [6] and european hamster [7] number 112/LPPM UGM/2016.
showed serous and seromucosa cell-types,
respectively. However, in contrast with other
rodents which consist of 1 lobe with serous cell-
References
type acini [6, 7], the parotid gland of Sunda
porcupine consist of 2 lobes with serous cell-type [1] Budipitojo T., Fibrianto Y. H., Mulyani G. T.,
in the anterior lobe and seromucous cell-type in the Kondoh D., Sasaki M. and Kitamura N. (2016).
posterior lobe. The Pancreas Morphology of Sunda Porcupine
In the present study, the three major (Hystrix Javanica), J Vet Adv 6(2): 1211-1216.
salivary glands of Sunda porcupin have complete
duct system comprising intercalated, striated and [2] Budipitojo T., Fibrianto Y.H. and Mulyani G.T.
excretory ducts. Similar results were found in the (2016). The types of endocrine cells in the
rodents [6, 7]. pancreas of Sunda porcupine (Hystrix javanica),
The acini of submandibular gland contain Vet World, 9(6): 563-567.
neutral mucopolysaccharides, sublingual glands [3] Alroy J., Ucci A.A. and Pereira M.E.A. (1988).
contain acid mucopolysaccharides and the parotid Lectin histochemistry. An update. In: advances in
gland contains acid and neutral immunohistochemistry. DeLellis R.A. (ed).
mucopolysaccharides according to the AB-PAS Raven Press. New York. pp 93-131.
staining method. The acidic mucopolysaccharides
are thought to contain terminal sialic acid residues [4] Berger E.G., Buddecke E., Kamerling J.P., Kobata
[8] and neutral mucopolysaccharides compose of A., Paulson J.C. and Uliegenthart J.F.G. (1982).
free aldehyde groups within the monosaccharide Structure, biosynthesis and function of
units [9]. Predominant glycoconjugates with glycoproteins glycans, Experientia, 38, 1129-
terminal sialic acid in serous cells may coat the 1262.
mucosal surface so as to provide an environment [5] Danguy A.. Akif F., Pajak B. and Gabius H-J.
designed to preserve hydration [10] and to protect (1994). Contribution ofcarbohydrate
the cell from pathogenic organisms [11, 12]. histochemistry to glycobiology,Histol.
The identification of sugar residues was Histopathol., 9:155-171.
improved by using lectin histochemistry in
comparison with conventional histochemistry. [6] Amano, O., Mizobe, K., Bando, Y., dan Sakiyama,
Lectin histochemistry method showed that SJA K. 2012. Anatomy and Histology of Rodent and
and WGA were detected in all major salivary Human Major Salivary Glands, Acta Histochem.
glands of Sunda porcupine by the order of Cytochem., 45(5): 241-250.
intensity from weak to strong in the parotid,
[7] Khojasteh, S. M. and Delashoub, M. (2012).
sublingual and submandibular glands. Lectin
Microscopic anatomy of the parotid and
staining using SJA indicates that acini in salivary
submandibular salivary glands in European
glands of sunda porcupine contain sugar residue of
hamster (Cricetus cricetus L.). IRJABS, 3(7):
N-acetylgalactosamine [13]. Lectin staining using
1544-1548.
WGA indicates that acini in salivary glands of
sunda porcupine contain sugar residue of N-
Page | 513
PROCEEDINGS
[8] Suprasert A. and Fujioka T. (1987). Lectin [12] Schulte B.A., Spicer S.S. and Miller R.L. (1984).
histochemistry of glycoconjugates in esophageal Histochemical localization of
mucous gland of the chicken. Jpn J Vet Sci. sialoglycoconjugates with a sialic acid specific
1987;49:555-557. lectin from the slug Limax flavus. J Histochem.,
16:1125-1132.
[9] Goldstein I.J., Hayes C.E. (1978). The lectins:
carbohydrate binding proteins of plant and [13] Al-Banaw A., Kenngott R., Al-Hassan J.M.,
animal. Adv Carbohydr Chem Biochem., 35:127- Mehana N. and Sinowatz F. (2010) Histochemical
340. analysis of glycoconjugates in the skin of a catfish
(arius tenuispinis, day). Anat Histol Embryol.,
[10]. Jeanloz R.W. and Codington J.F. (1976). The
39(1):42-50.
biological role of sialic acid at the surface of the
cell. In: Rosenberg A, Schengrund CL, editors. [14] Park C., Ahn M., Kim J., Kim S., Moon C. and
Biological roles of sialic acid. New York: Plenum Shin T. (2015). Histological and lectin
Press; 1976. p. 201-238. histochemical studies on the olfactory mucosae of
the Korean roe deer, Capreolus pygargus, Tissue
[11] Montreuil J. (1980). Primary structure of
Cell, 47(2):221-227.
glycoprotein - glycans: basis for the molecular
biology of glycoproteins.Adv Carbohydr Chem
Biochem., 37:157-213.
Page | 514
PROCEEDINGS
TEMPORARY RECOVERY OF PANCREATIC Β-CELLSIN TYPE

2 DIABETES MELLITUS INDUCED MESENCHYMAL STEM
CELL-CONDITIONED MEDIUM
Widagdo Sri Nugroho1), Dwi Liliek Kusindarta2), Heru Susetya1), Ida Fitriana3).
Tri Wahyu Pangestiningsih2), Yuda Heru Fibrianto4),Sri Gustari5), Teguh Budipitojo2)
1
Department of Veterinary Public Health, 2Department of Anatomy, 3Department of Pharmacology,
4
Department of Physiology, 5Department of Reproduction, Faculty of Veterinary Medicine, Universitas
Gadjah Mada, Yogyakarta, Indonesia.
Abstract
The previous study showed that human umbilical cord mesenchymal stem cell-derived conditioned
medium regenerate the pancreatic β-cells damage in Wistar rats (Rattus norvegicus) with type 1 diabetes
mellitus (DM), structurally and functionally. Therefore, this study was aimed to investigate the role of
human umbilical cord mesenchymal stem cell-derived conditioned medium (CM) on the functional
recovery of pancreatic β-cells in Wistar rats (Rattus norvegicus) with type 2DM. The type 2 diabetic rats
were prepared by applying combination injection of nicotinamide and streptozotocyn. The 0.2 ml CM
induction was applied to the type 2 diabetic rats in weeks 1, 2, 3, and 4. One week after each CM
induction, the pars duodenalis pancreas was collected in Bouin‘s solution, processed by paraffin method,
stained with Hematoxillin-Eosin and immunohistochemical method for insulin.Microscopic observation
indicated the decrease in the number of immunoreactive cells and its intensity againts insulin after the
combination injection of nicotinamide and streptozotocyn. Immunohistochemically, the presence of
numerous numbers and hight intensity of insulin-positive cells could be recognized at duodenal regions of
pancreas, 1 week after the first and second induction of 0.2 ml CM. The number of insulin-positive cells
and the intensity of staining decreased dramatically in 1 week after the third induction of 0.2 ml CM and
almost dissapeared in 1 week after the fourth induction of 0.2 ml CM, in all the pancreas islets. This study
showed very clear evidence that human umbilical cord mesenchymal stem cell-derived conditioned
medium has ability to temporary recovered the insulin production of pancreatic β-cells in Wistar rats
(Rattus norvegicus) with type 2DM. The next research should be emphasis to find the best doses and time
administration of the CM to permanently recover the insulin production from the condition of type 2 DM.
Keywords: conditioned-medium, type 2 diabetes mellitus, pancreatic β-cells, temporary recovery
1. Introduction a medium that contain secretion factors produced

by cultured stem cells [5].
Recent study showed that stem cells have There are some advantages on the use of
ability to produce tropic factors which can CM compared to the use of stem cells itself as it
regenerate the reparation of damaged tissues [1]. can be manufactured, freeze-dried, packaged, and
Moreover, some studies on stem cell-derived transported more easily. Furthermore, as it is
secreted factors indicated that the secreted factors devoid of cells, there is no need to match the donor
alone without the stem cell can repair tissue in and the recipient to avoid rejection problems.
various conditions involving damaged tissue/organ Therefore, the stem cell-derived conditioned
[2, 3, 4]. The secreted factors can be detected in a medium has a promising prospect to be produced
medium where the stem cells are cultured, so as alternative pharmaceuticals for regenerative
called conditioned medium or CM [5]. The term of medicine [6].
conditioned medium or CM was used to determine Various study reported that conditioned
medium contains various growth factors,
Page | 515
PROCEEDINGS
interleukin and others tissue regenerative agents, cells and the intensity of staining decreased
which are secreted by the cultured stem cells [7, 8, dramatically in 1 week after the third induction of
9, 10, 11]. Moreover, the previous study using 0.2 ml CM (Fig. 1E) and almost dissapeared in 1
human umbilical cord mesenchymal stem cell- week after the fourth induction of 0.2 ml CM (Fig.
derived conditioned medium showed that CM can 1E), in all the pancreas islets. Insulin
regenerate the pancreatic β-cells damage in Wistar immunoreactive cells are β cells in the islets of
rats (Rattus norvegicus) with type 1 diabetes Langerhans pancreas [15].
mellitus, structurally and functionally. Therefore, The present studies showed significant
this study was aimed to investigate the role of decrease of the insulin immunoreactive cells
human umbilical cord mesenchymal stem cell- number in the islets after the combination injection
derived conditioned medium (CM) on the of single dose intra-peritoneal of nicotinamide and
functional recovery of pancreatic β-cells in Wistar strptozotocyn.Some β cells still detected with very
rats (Rattus norvegicus) with type 2 diabetes light insulin immunoreactivy, indicate small
mellitus. number insulin production. Combination injection
of nicotinamide and strptozotocynhas been used to
2. Methods generate type 2 diabetes in rats, rabbits, dogs,
monkeys, and cats [16]. This diabetes is
Thirty male Wistar rats (Rattus norvegicus) characterized by insufficient insulin production
weighing 150-250 grams were used in this study. from beta cells[17],and present experiments
The rat samples were divided into 2 groups: confirmed this condition.
control group and diabetic group. Conditioned Type 2 diabetes is due to insufficient
Medium was prepared from the media culture at insulin production from beta cells in the setting of
the passage 3 of human umbilical cord insulin resistance [17]. Insulin resistance, which is
mesenchymal cells culture [12]. Type 2 diabetes the inability of cells to respond adequately to
mellitus condition was made using combination normal levels of insulin, occurs primarily within
injection of single dose intra-peritoneal injection of the muscles, liver, and fat tissue [18]. In the liver,
230 mg of nicotinamide per kg body weight and 65 insulin normally suppresses glucose release.
mg of strptozotocyn in natrium sitrat solution pH However, in the setting of insulin resistance, the
4.5 per kg body weight [13]. liver inappropriately releases glucose into the
The 0.2 ml CM induction was administered blood [19]. The proportion of insulin resistance
to the diabetic rat group in weeks 1, 2, 3, and 4 by versus beta cell dysfunction differs among
the intramuscular injection. After weighing, the rat individuals, with some having primarily insulin
samples were euthanized, the pancreases were resistance and only a minor defect in insulin
collected and fixed in Bouin‘s solution for 24 secretion and others with slight insulin resistance
hours. The duodenal parts of pancreases were and primarily a lack of insulin secretion [17].
processed for paraffin block tissues and cut serially The number of people affected by type 2
to 5 micron thickness. One serial slide of pancreas diabetes mellitus is approximately 90 % compared
tissues was stained with Hematoxillin-Eosin for with 10 % of type 1 diabetes mellitus [20].
basic structure observation and the others were According to the International Diabetic Federation,
used to visualize the presence of insulin in the there are 387 million diabetics worldwide, 9
islets of Langerhans by applying million in Indonesia only, which makes the
immunohistochemical method with Histofine [14]. country ranked seventh in the world at the present
time. Type 2 diabetes can often be treated just by
3. Results and Discussion losing weight and exercising more, as these
increases the body‘s sensitivity to insulin. A
This study showed the decrease of a
medicine called Metformin is often prescribed,
number and intensity of insulin immunoreactive
which works by helping the fat and muscle cells of
cells (Fig. 1B) in the islets after the combination
the body listen to the signal from insulin to take up
injection of a single dose of streptozotocyn and
sugar from the blood [21].Injections of insulin may
nicotinamide, compare with the islets of control
either be added to oral medication or used alone
rats (Fig. 1A). The presence of abundance with
[21]. Suprisingly, conditioned medium
hight intensity of insulin immunoreactive cells was
derivedfrom human umbilical cord mesenchymal
detected in 1 week after the first induction of 0.2
stem cellcan regenerate the pancreatic β-cells
ml CM in the pancreatic islets (Fig. 1C). The
damage in Wistar rats (Rattus norvegicus)
number and intensity of insulin immunoreactive
withtype 1 diabetes mellitus, structurally and
cells was constantly detected in 1 week after
functionally[14].
second induction of 0.2 ml CM in the pancreatic
islets (Fig. 1D).The number of insulin-positive
Page | 516
PROCEEDINGS
Base on the role of stem cells-derived pancreatic β-cells function in Wistar rats (Rattus
conditioned medium for β-cells regenerationin the norvegicus) with type 2 diabetes mellitus. Since
type 1 DM,CM not only improve the structural the present study showed that after third and fourth
regeneration of β-cells, but also induce and induction the insulinpositive cells dramatically
maintain their function to produce insulin after decreasedand almost dissapeared,the next research
islets destruction. The results of present study, should be emphasis to find the best doses and time
however, showed very strong evidence that human administration of the CM to permanently recover
umbilical cord mesenchymal stem cell-derived the insulin production from the condition of type 2
conditioned medium can temporary recovered the DM.
Figure 1. Immonolocalization profile of insulin immunoreactive cells in pancreatic β cells of control,

type 2 diabetic and CM treated rats. More numerous and stronger intensity of insulin
immunoreactive cells were detected in the islets of control rat (Fig. 1A)compared with in
the type 2 diabetic rat (2A) as indicated by arrows. The presence of abundance with
strong intensity of insulin immunoreactive cells was detected in 1 week after the first
induction of 0.2 ml CM in the pancreatic islets (Fig. 1C). The number and intensity of
insulin immunoreactive cells was constantly detected in 1 week after second induction of
0.2 ml CM in the pancreatic islets (Fig. 1D).The number of insulin-positive cells and the
intensity of staining decreased dramatically in 1 week after the third induction of 0.2 ml
CM (Fig. 1E) and almost dissapeared in 1 week after the fourth induction of 0.2 ml CM
(Fig. 1E), in all the pancreas islets.Stars indicated non β cells or β cells with no insulin
immunoreactivities in the islets.
Page | 517
PROCEEDINGS
Currently, there are three types of cell [2] Timmers L., Lim S. K., Hoefer I. E., Arslan
sources in the field of regenerative medicine to F., Lai R, C., van Oorschot A. A., Goumans
produce β-cells. They are stem cells, endocrine M. J., Strijder C., Sze S. K., Choo A., Piek J.
progenitors, and other mature cells in the pancreas J., Doevendans P. A., Pasterkamp G. and de
and β-cell itself [22]. On the other hand, it is also Kleijn D. P. (2011) Human mesenchymal
possible to produce β-cells from duct-lining and stem cell-conditioned medium improves
acinar cells [23], or hepatocytes [24], even though cardiac function following myocardial
it is still under a controversial discussion. It infarction, Stem. Cell. Res., 6 (3): 206–214.
remains unclear which types of cells will prove
ultimately to be successful in clinical applications. [3] Mishra P. J. and Banerjee D. (2012) Cell-free
To date it remains to be a significant challenge to derivatives from mesenchymal stem cells are
generate sufficient biologically functional β-cells effective in wound therapy, World J. of Stem
to replace damaged or malfunctional β-cells. Most Cells, 4 (5): 35-43.
likely, the future of diabetes therapies rely on the
combination of fabrication of novel constructor [4] Hynes B., Kumar A.H.S. , O'Sullivan
with integration of cell, signal molecule, and J., Buneker C. K., Leblond A. L., Weiss
biomaterial that mimics microenvironment that is S., Schmeckpeper J.,Martin K. and CapliceN.
suitable for islet β-cell development in the body M. (2013) Potent endothelial progenitor cell-
[25]. Our CM may contains signal molecules and conditioned media-related anti-apoptotic,
biomaterials that mimics microenvironment that is cardiotrophic, and pro-angiogenic effects post-
suitable for islet β-cell development from myocardial infarction are mediated by insulin-
endocrine progenitor cells and/or duct lining and like growth factor-1, Eur. Heart J., 34 (10):
acinar cells in the pancreatic tissues of diabetic 782-789.
Wistar rats.
[5] Kim H.O. and Choi S. (2013) Mesenchymal
stem cell-derived secretome and microvesicles
4. Conclusion
as a cell-free therapeutics for
neurodegenerative disorders, J. Tissue Eng.
The results of present study showed very
Regen. Med., 10 (3):93-101.
strong evidence thatCMcan temporary recovered
the pancreatic β-cells function in Wistar rats [6] Pawitan J. A. (2014) Prospect of Stem Cell
(Rattus norvegicus) with type 2 diabetes mellitus. Conditioned Medium in Regenerative
However, since after third and fourth induction the Medicine - A Review,Bio. Med. Res. Int.,
insulinpositive cells dramatically decreasedand Article ID 965849, 14 pages.
finally almost dissapeared,the next research should
be emphasis to find the best doses and time [7] White N.H., Sun W., Cleary P.A., Danis R.P.,
administration of the CM to permanently recover Davis M.D., Hainsworth D.P., Hubbard L.D.,
the insulin production and functions. Lachin J.M. and Nathan D. M. (2008)
Prolonged Effect of Intensive Therapy onthe
Acknowledgment Risk of Retinopathy Complications in Patients
with Type 1 Diabetes Mellitus: 10 Years after
This study was fully supported by the Grant the Diabetes Control and Complications Trial,
for Scientific Research (PUPT UGM 2016) from Arch. Ophthalmol.,126(12): 1707-1715.
the Directorate General of Higher Education
(DIKTI), Ministry of Research, Technology and [8] Ho J.C.Y, Lai W. and Li M. (2012) Reversal of
Higher Education of Indonesia with contract endothelial progenitor cell dysfunction in
number 112/LPPM UGM/2016. patients with type 2 diabetes using a
conditioned medium of human embryonic
References stem cellderived endothelial cells,
DiabetesMetab. Res., 28 (5): 462-473.
[1] Yang D., Wang W. and Li L. (2013) The [9] Zagoura D.S., Roubelakis M.G. and Bitsika V.
relative contribution of paracine effect versus (2012) Therapeutic potential of a distinct
direct differentiation on adipose-derived stem population of human amniotic fluid
cell transplantation mediated cardiac mesenchymal stem cells and their secreted
repair,PLoS. ONE, 8 (3): article ID e59020. molecules in mice with acute hepatic failure,
Gut, 61 (6): 894-906.
Page | 518
PROCEEDINGS
[10] Bhang S.H., Lee S., Shin J.Y., Lee T.J., Jang [17] Shoback, edited by David G. Gardner,
H.K. and Kim B.S. (2014) Efficacious and Dolores (2011). Greenspan's basic & clinical
clinically relevant conditionedmedium of endocrinology (9th ed.). New York: McGraw-
human adipose-derived stem cells for Hill Medical. pp. Chapter 17.
therapeutic angiogenesis, Mol. Ther.
Oncolytics,22 (4): 862. [18] Tfayli H. and Arslanian S. (2009).
Pathophysiology of type 2 diabetes mellitus in
[11] Sze S.K., de Kleijn D.P.V. and Lai R.C. youth: the evolving chameleon, Arquivos
(2007) Elucidating the secretion proteome of brasileiros de endocrinologia e metabologia,
human embryonic stem cell-derived 53 (2): 165–74.
mesenchymal stem cells, Mol. Cell.
Proteomics, 6(10): 1680-1689. [19] Szkudelski T., Kandulska K. and Okulicz
M.(1998) Alloxan in vivo does not only exert
[12] Shen C., Lie P., Miao T., Yu M., Lu Q., Feng deleterious effects on pancreatic B
T., Li J., Zu T., Liu X. and Li H. (2015) cells,Physiol. Res., 47:343-346.
Conditioned medium from umbilical
cord mesenchymal stem cells induces [20] Chabot J.M. (2002) A Report from the World
migration and angiogenesis,Mol. Med. Rep., Health Organization, Rev. Prat., 52(19): 2155-
12(1): 20-30. 2156
[13] Ghasemi A., Khalifi S. and Jedi S. (2014) [21] Ripsin C.M., Kang H. and Urban R.J. (2009).
Streptozotocin-nicotinamide-induced rat Management of blood glucose in type 2
model of type 2 diabetes (review), Acta diabetes mellitus, Am Fam Physician 79 (1):
Physiol Hung., 101(4):408-420. 29–36.
[14] Nugroho W.S., Kusindarta D.L., Susetya [22] Borowiak M. and Melton D. A. (2009) How
H., Fitriana I., Mulyani G.T., Fibrianto Y.H., to make beta cells?, Curr. Opin. Cell. Biol.,
Haryanto A. and Budipitojo T. (2016) The 21(6): 727-32.
structural and functional recovery of
pancreatic β-cells in type 1 diabetes mellitus [23] Bonner-Weir S. 1. and Weir G. C. (2005)
induced mesenchymal stem cell-conditioned New sources of pancreatic beta-cells, Nat.
medium, Veterinary World, 9(5): 535-539. Biotechnol., 23(7): 857-61.
[15] Budipitojo T., Fibrianto Y.H. and Mulyani [24] Porat S. 1. and Dor Y. (2007) New sources of
G.T. (2016). The types of endocrine cells in pancreatic beta cells, Curr. Diab. Rep., 7(4):
the pancreas of Sunda porcupine (Hystrix 304-308.
javanica), Veterinary World, 9 (6): 563-567.
[25] Alismail H. and Jin S. (2014)
[16] Goldner M. G.and Gomori G. (1944)Studies Microenvironmental stimuli for proliferation
on the Mechanism of Alloxan Diabetes. of functional islet β-cells, Cell. Biosci., 4(1):
ISRNEndocrinol., 35 (4): 241. 4-12.
Page | 519
PROCEEDINGS
GASTRIN-RELEASING PEPTIDE RECEPTOR (GRPR) IN THE

BOVINE UTERUS AND PLACENTA
Teguh Budipitojo1), Motoki Sasaki2,3), Guntari Titik Mulyani4), Daisuke Kondoh2), and
Nobuo Kitamura2,3)
1
Department of Anatomy, Faculty of Veterinary Medicine, Gadjah Mada University, Yogyakarta 55281,
Indonesia; 2Laboratory of Veterinary Anatomy, Department of Basic Veterinary Medicine, Obihiro
University of Agriculture and Veterinary Medicine, Hokkaido 080-8555, Japan; 3United Graduate School
of Veterinary Medicine, Gifu University, Gifu 501-1193, Japan; and 4Department of Internal medicine,
Faculty of Veterinary Medicine, Gadjah Mada University, Yogyakarta 55281, Indonesia
Abstract
Gastrin-releasing peptide (GRP), which is a 27 amino acid peptide, the mammalian homologue of
bombesin, has been identified in various organs including the uterus and placenta. The effects of GRP are
mediated by the gastrin-releasing peptide receptor (GRPR), one of the seven transmembrane-spanning G
protein-coupled receptors. Although the localization of GRP has been reported in each cell type of the
placenta, that of GRPR currently remains unknown. Therefore, the aim of the present study was to
immunohistochemically examine the localization of GRPR in the bovine uterus and placenta. In the
placental tissues, GRPR immunoreactivity was detected in the cytoplasm of uninucleate trophoblast cells
(trophoblast cells), but not in binucleate trophoblast giant cells or maternal tissues including the uterine
glands. The distribution of these GRPR-immunoreactive cells was consistent throughout the pregnancy
period. In nonpregnant animals, GRPR was localized in the endometrial epithelial cells of the caruncle
only. The differences observed in the localization of GRPR in the chorionic epithelium in the present
study demonstrated that GRP directly affected trophoblast cells, but not binucleate trophoblast giant cells
differentiated from trophoblast cells. In the present study,the localization of GRPR in the bovine placenta
demonstrated is the first in mammalian placentas.
Keywords: GRPR, uterus, placenta, bovine
1. Introduction ion transport [13] through GRPRs on the cell

membrane of each target cell.
Gastrin-releasing peptide (GRP) is the a 27 GRP acts as a growth factor in tumor cells
amino acid peptide, the mammalian homologue of [14, 15, 16, 17] and also in normal tissues, for
bombesin with a wide range of bioactivities, example, the gastrointestinal tract [18, 19, 20, 21],
including regulation of the digestive system, such pancreas [22, 23, 24] and other tissues [25, 26].
as the stimulated release of gastrointestinal GRP has also been detected in reproductive
hormones, modulation of gastrointestinal motility organs, and the abundant expression of GRP has
and promotion of pancreatic secretions [1, 2]. The been reported in the uterus and/or placenta of some
effects of GRP are mediated by a specific seven mammals, including humans [27, 28], sheeps[29],
transmembrane-spanning G protein-coupled cattles[30] and opossums [31]. These findings
receptor, the gastrin-releasing peptide receptor suggested the autocrine and/or paracrine effects of
(GRPR) [3, 4, 5]. GRP are widely expressed in GRP in uterine and placental tissues. However,
central and enteric nervous systems as GRPR mRNA is not expressed in the ovine
neuropeptides [6] and regulate normal pregnant endometrium and cotyledonary placenta,
physiological functions, such as satiety [7], whereas very low expression levels of GRPR have
thermoregulation [8, 5], circadian rhythms [9], been detected in the conceptus [31]. The aim of the
smooth muscle contraction [10, 11], the release of present study was to investigate the GRPR
other peptide hormones [1, 12] and endometrial localization in the bovine uterus and placenta. We
Page | 520
PROCEEDINGS
herein demonstrated that in bovine, GRP and with a digital camera (Digital Sight DS-5M,
GRPR were localized in the endometrial epithelial Nikon, Tokyo, Japan).
cells of nonpregnant caruncle, placental
trophoblast cells and provided evidence to support 3. Results and Discussion
this peptide hormone acting as an autocrine and or
paracrine factor in uterine and placental tissues. GRPR immunoreactivity was detected in
bovine uteri and placentas (placentomes). In
pregnant bovine, GRPR immunoreactivity was
2. Methods
present in the cytoplasm of uninucleate trophoblast
cells (trophoblast cells) that lined the chorionic
Fourteen placentas and 6 nonpregnant of
villi of the cotyledon, the so-called fetal placenta
adult bovine uteri were used in the present study.
(Fig. 1A & B). However, the immunoreactivity
The gestational day (51- to 251-day of pregnancy)
was not detected in binucleate trophoblast giant
of samples was estimated from the crown-rump
cells (trophoblast giant cells) or the trophoblast
length of fetuses (CRL5-90 cm) [32]. Samples
cells of the intercotyledon (Fig. 1A & B).
were obtained from a local slaughterhouse
Moreover, GRPR immunoreactivity was absent in
(Obihiro, Hokkaido, Japan). Tissue samples were
endometrial tissues including the uterine glands of
collected from the caruncle and intercaruncle of
the caruncular (maternal placenta) and
the uterus, and from the placentome (comprising
intercaruncular parts (Fig. 1A-C). The
the caruncle and cotyledon) and interplacentome.
immunohistochemical localization of GRPR was
After fixation in Bouin‘s fluid for 24 hr, tissue
consistent throughout the pregnancy period.
samples were dehydrated in ethanol, cleared in
In nonpregnant bovine, GRPR was
xylene, embedded in paraffin (Paraplast 6 Plus®,
localized in the endometrial epithelial cells of the
Kendall, MA, USA) and cut serially at a thickness
caruncle (Fig. 1D), but not in those of the
of 4 μm.
intercaruncle. Furthermore, GRPR
The ImmPRESS™ polymerized reporter
immunoreactivity was not detected in the uterine
enzyme staining system (Vector Laboratories, Inc.,
glandular cells, similar to pregnant animals.
Burlingame, CA, USA) was employed for
Immunoreactivity for GRPR was absent in
immunohistochemical detection. Tissue sections
negative controls.
were deparaffinized in xylene, rehydrated in
GRPR has been identified in human cancer
descending series of ethanol concentrations,
cell lines of the lung [15], breast [16], prostate [17]
washed in distilled water (DW), and then treated in
and colon [33]. Furthermore, the expression of
target retrieval solution (1:10, S1699;
GRPR in various human tumors was summarized
DakoCytomation, Inc., Carpintaria, CA, USA) for
by Cornelio et al. [34]. In normal human tissues,
15 min at 95 ºC to retrieve antigens. After washing
GRPR has been detected in intestinal smooth
in DW, sections were incubated with 0.3% H2O2 in
muscle cells [35], the colonic mucosal epithelium
methanol for 10 min at room temperature (RT) to
during gut development [18], breast tissue [36], the
block endogenous peroxidase activity. After a
kidney [37] and prostate [38]. Moreover, the
treatment with normal horse serum for 30 min at
expression of GRPR was previously reported in
RT, sections were incubated overnight with a
the myometrium, uterine glands, and endometrial
rabbit anti-human GRPR antibody (1:500,
blood vessels of nonpregnant human uteri [39] and
GTX13339, GeneTex, Inc., San Antonio, USA) at
also in the human uteroplacental tissue; however,
4 ºC in a moisture chamber. After incubation with
the cell types expressing GRPR were not identified
a primary antibody, ImmPRESS horse anti-rabbit
[27]. GRPR has also been identified in the rat
IgG (ImmPRESS™ reagent, MP-7401, Vector
uterus [40, 41] However, few studies have
Laboratories, Inc.) was applied as the secondary
described the localization of GRPR in the female
antibody for 30 min at RT. Binding sites were then
genital organs of domestic animals. We herein
visualized by acetonitrile (Vector® SG Substrate
demonstrated immunohistochemically, for the first
Kit, SK-4700, Vector Laboratories, Inc.) or 0.02%
time, the localization of GRPR in placental tissues.
3,3‘-diaminobenzidine tetrahydrochloride (DAB)
In this study on the nonpregnant bovine
in 50 mM Tris-HCl (pH 7.4) containing 0.006%
uterus, GRPR immunoreactivity was localized in
H2O2. The sections visualized by DAB were
the endometrial epithelial cells of caruncle only. In
counterstained with Mayer‘s hematoxylin.
the bovine placenta, GRPR immunoreactivity was
Negative control sections were treated with the
detected in trophoblast cells, but not in binucleate
omission of the primary antibody. Immunostained
trophoblast giant cells. On the other hand, GRPR
sections were examined with a conventional light
was absent in the uterine glandular cells of bovine
microscope, and photomicrographs were taken
uterine and placental tissues. The absence of
Page | 521
PROCEEDINGS
GRPR in trophoblast giant cells and glandular was demonstrated in the endometrial epithelial
epithelial cells was contrary to our expectations cells of nonpregnant caruncle and placental
because we previously reported the abundant trophoblast cells, suggesting the regulation among
expression of GRP in the binucleate trophoblast the same cell types and/or that by other GRP
giant cells and glandular epithelial cells of sources, such as uterine glandular cells and
nonpregnant and pregnant uteri [30, 42] and the trophoblast giant cells. Previous studies showed
autocrine and paracrine feedback systems among that GRP was mainly produced by uterine
the same cell types were expected. Therefore, the glandular cells in nonpregnant and pregnant cows
secretion of GRP from trophoblast giant cells and [30, 42]. Therefore, GRPR-positive cells such as
glandular epithelial cells may be regulated by other trophoblast cells and endometrial epithelial cells
factors, unlike the autocrine and paracrine systems may predominantly be affected by GRP secreted
through GRPR. On the other hand, the localization from uterine glandular cells.
of GRP [30, 42] and GRPR (in the present study)
Figure 1. Immonohistochemical localization of GRPR in the bovine placenta and uterus. A:

Placenta (194-day/CRL60 cm). The section shows a higher magnification (x520) of A. B:
Placenta (251-day/CRL90 cm). C: Endometrial uterine glands below the placentome
(251-day/CRL 90 cm). D. Caruncle of nonpregnant uterus. Immunoreactivity for GRPR
was detected in the uninucleate trophoblast cells (arrow heads) and endometrial
epithelial cells (large arrows). but not in binucleate trophoblast giant cells (small
arrows) or uterine glandular cells. c: chorionic villi. e: endometrium. u:uterine gland.
Coloring of acetonitrile (A) and DAB (B-D).
Page | 522
PROCEEDINGS
Ruminants have a synepitheliochorial subunits need to be investigated further in bovine

placenta in which binucleate trophoblast giant cells uninucleate trophoblast cells.
are formed in the chorionic epithelium, migrate In the bovine placenta, cytochrome P450
towards the endometrium and fuse with 17β-hydroxylase/c17,20 lyase (P450c17) was
endometrial epithelial cells, producing immunohistochemically detected in uninucleate
fetomaternal hybrid syncytial cells [43]. Binucleate trophoblast cells only whereas cytochrome P450
trophoblast giant cells have been shown to solely aromatase (P450arom) was only identified in
produce several proteins, such as placental binucleate trophoblast giant cells [45]. These
lactogen, prolactin-related protein-1, pregnancy- findings suggest that uninucleate trophoblast cells
associated glycoproteins (PAG-1 subgroup) and in the bovine placenta produce androgen, change
estrogen [44, 45, 43, 46]. In the present study, the the expression of steroidogenic enzymes with their
GRPR expression in the placenta was only differentiation into the binucleate trophoblast giant
detected in trophoblast cells, and not in trophoblast cells and eventually produce estrogen from the
giant cells. Therefore, GRP may not be directly accumulated androgen [46].
involved in the maturation or functions of Schuler et al. [45] suggested that the
binucleate trophoblast giant cells. Binucleate expression of P450c17 in trophoblast cells may be
trophoblast giant cells are considered to develop regulated by factors secreted from maternal tissues
from uninucleate trophoblast cells by acytokinetic because its expression was not detected in
mitoses [47, 48, 49]. Trophoblast giant cells are trophoblast cells lining chorionic plates, which had
formed from uninucleate trophoblast cells by two no close relationship with the maternal placenta.
subsequent mitoses [43, 50]; the first mitosis of a Therefore, the abundant secretion of GRP from
uninucleate trophoblast cell produces two cells, endometrial epithelial and uterine glandular cells
one without apical tight junctions, and this cell in bovine placentas under normal conditions [30]
continuously undergoes acytokinetic mitosis, may be one of the factors regulating the synthesis
which leads to a binucleate cell with diploid of androgen in uninucleate trophoblast cells and
nuclei. GRP is known to possess a mitogenic promoting cell proliferation. It is interesting for us
capacity in normal tissues [18, 19, 22, 2]. Thus, we to investigate the placental reactions with addition
speculated that GRPR on uninucleate trophoblasts of GRP in the next step.
cells may be involved in an acytokinetic mitosis The endometrium is a complex tissue and
process for the formation of binucleate trophoblast mainly consists of epithelial and stromal cells [58].
giant cells. However, previous studies reported The physiological function of epithelial and
that, in culture with GRP-free medium, bovine stromal cells currently remains unclear.
trophoblast cell line (BT-1) cells were induced into Progesterone (P4), estrogens, and oxyocin have
binucleate trophoblast giant cells that synthesize been shown to mainly regulate morphological and
placental lactogen [51, 52]. Therefore, GRP may functional changes in the endometrium throughout
merely be involved in the acceleration of the estrous cycle [59, 60]. The secretory cells of
uninucleate trophoblast cell proliferation. The the endometrial epithelium produce and release
disappearance of GRPR in binucleate trophoblast mucus on the epithelial surface [59, 61]. A
giant cells may further inhibit cell division in order previous study reported that the secretion of mucus
to initiate their maturation and migration. in the nasal mucosa was stimulated by GRP [62].
Trophoblast cells and the endometrial epithelium Moreover, the secretion of mucus from the
have been shown to possess the receptor for bronchial mucosa has been suggested to be
epithelial growth factor (EGF) [53, 54, 55]. induced by the stimulation of GRP binding to the
Hambruch et al. demonstrated that EGF strongly submucosal glands and epithelium [63]. In the
promoted cell proliferation together with Ras present study on bovine uteri, GRPR was
activation and increases in mitogen-activated immunolocalized in endometrial epithelial cells,
protein kinase (MAPK) phosphorylation in a which suggested that the expression of GRPR was
bovine trophoblast cell line [54]. GRP is known to involved not only in autocrine and paracrine
activate members of the MAPK family including feedback systems, but also in the production of
extracellular-signal-regulated kinase 1/2 (ERK1/2), secretions including mucus. In addition, the
c-Jun N-16 terminal kinase (JNK), p38 MAPK and proliferation of endometrial epithelial cells may
ERK5 [4, 2]. Moreover, synergistic effects have also be induced by GRP because of its ability to
been reported between GRP/ GRPR and promote cell division.
EGF/EGFR in head and neck cancer [56, 57].
Therefore, the proliferative activity of GRP and
stimulated cascade downstream of G protein
Page | 523
PROCEEDINGS
4. Conclusion circadian timing system. J Neurosci 11, 846–

851.
In conclusion, we here demonstrated that
GRPR was localized in the uterine epithelial cells [10] Severi CR, Jensen RT, Erspamer V, D‘Arpino
of nonpregnant and uninucleate trophoblast cells of L, Coy DH, Torsoli A, Delle Fave G (1991)
pregnant bovine, verifying the autocrine and Different receptors mediate the action of
paracrine actions of GRP in bovine uteri and bombesin-related peptides on gastric smooth
placentas. To the best of our knowledge, the muscle cells. Am J Physiol 260, G683–G690.
detection of the localization of GRPR in bovine
[11] Tica AA, Dun E, Tica V, Cojocaru V, Tica
placentas in the present study is the first in
OS and Berceanu S (2011) The autonomic
mammalian placentas.
innervation of the uterus. GINECOeu 7, 86-
91.
References
[12] Knigge U, Holst JJ, Knuhtsen S, Petersen B,
[1] Ghatei MA, Jung RT, Stevenson JC, Hillyard Krarup T, Holst-Pedersen J and Christiansen
CJ, Adrian TE, Lee YC, Christofides ND, PM (1984) Gastrin-releasing peptide:
Sarson DL, Mashiter K, MacIntyre I and pharmacokinetics and effects on gastro-
Bloom SR (1982) Bombesin: action on gut entero-pancreatic hormones and gastric
hormones and calcium in man. J Clin secretion in normal men. J Clin Endocrinol
Endocrinol Metab 54, 980-985. Metab 59, 310-315.
[2] Thomas RP, Hellmich MR, Townsend CM Jr [13] Matthews CJ, Redfern CP, Thomas EJ and
and Evers BM (2003) Role of gastrointestinal Hirst BH (1993) Bombesin and gastrin-
hormones in the proliferation of normal and releasing peptide stimulate electronic ion
neoplastic tissues. Endocr Rev 24, 571-599. transport in cultured human endometrial
epithelial cell layers. Exp Physiol 78, 19 715-
[3] Corgay MH, Dobrzanski DJ, Way JM, Viallet 718.
J, Shapira H, Worland P, Sausville EA and
Battey JF (1991) Two distinct bombesin [14] Carroll RE, Matkowskyj KA, Chakrabarti S,
receptor subtypes are expressed and functional McDonald TJ and Benya RV (1999) Aberrant
in human lung carcinoma cells. J Biol Chem expression of gastrin-releasing peptide and its
266, 18771–18779. receptor by well-differentiated colon cancers
in humans. Am J Physiol Gastrointest Liver
[4] Dorsam RT and Gutkind JS (2007) G-protein- Physiol 276, 655-665.
coupled receptors and cancer. Nature Rev
Cancer 7, 79-94. [15] Cuttitta F, Carney DN, Mulshine J, Moody
TW, Fedorko J, Fishler A and Minna JD
[5] Kroog GS, Jensen RT and Battey JF (1995) (1985) Bombesin-like peptides can function
Mammalian bombesin receptors. Med Res Rev as autocrine growth factors in human small-
15, 389-9 417. cell lung cancer cells. Nature 316, 823–826.
[6] Patel O, Shulkes A and Baldwin GS (2006) [16] Giacchetti S, Gauville C, De Cremoux P,
Gastrin-releasing peptide and cancer. Biochim Bertin L, Berthon P, Abita J-P, Cuttitta F and
Biophys Acta 1766, 23-41. Calvo F (1990) Characterization, in some
human breast cancer cell lines, of gastrin-
[7] McCoy JG and Avery DD (1990) Bombesin:
releasing peptide-like 18 receptors which are
potential integrative peptide for feeding and
absent in normal breast epithelial cells. Int J
satiety. Peptides 11, 595–607.
Cancer 46, 293–298.
[8] Brown MR, Carver K and Fisher LA (1988)
[17] Reile H, Armatis PE and Schally AV (1994)
Bombesin: central nervous system actions to
Characterization of high-affinity receptors for
affect the autonomic nervous system. Ann N Y
bombesin/gastrin-releasing peptide on the
Acad Sci 547, 174–182.
human prostate cancer cell lines PC-3 and
[9] Albers HE, Liou SY, Stopa EG and Zoeller DU-145: internalization of receptor bound
RT (1991) Interaction of colocalized 125I-[Tyr4] bombesin by tumor cells.
neuropeptides: functional significance in the Prostate 25, 29–38.
Page | 524
PROCEEDINGS
[18] Carroll RE, Matkowskyj KA, Saunthararajah [27] Whitley JC, Giraud AS and Shulkes A (1996)
Y, Sekosan M, Battey JF and Benya RV Expression of gastrin-releasing peptide
(2002) Contribution of gastrin-releasing (GRP) and GRP receptors in the pregnant
peptide and its receptor to villus development human uterus at term. J Clin Endocrinol
in the murine and human gastrointestinal Metab 81, 3944-3950.
tract. Mech Dev 113, 121–130.
[28] Xiao Q, Han X, Challis JRG, Hill DJ, Spindel
[19] Chu KU, Higashide S, Evers BM, Ishizuka J, ER, Prasad CJ, Akagi K and McDonald TJ
Townsend Jr CM and Thompson JC (1995) (1996) Gastrin-releasing peptide-like
Bombesin stimulates mucosal growth in immunoreactivity is present in human
jejunal and ileal Thiry-Vella fistulas. Ann maternal and fetal placental membranes. J
Surg 221, 602–609. Clin Endocrinol Metab 81, 3766-3773.
[20] Chu KU, Higashide S, Evers BM, Rajaraman [29] Fraser M, McDonald TJ, Spindel ER, Fahy
S, Ishizuka J, Townsend CM Jr and M, Hill D and Challis JRG (1994) Gastrin-
Thompson JC (1994) Bombesin improves releasing peptide is produced in the pregnant
survival from methotrexate-induced ovine uterus. Endocrinology 135, 2440-2445
enterocolitis. Ann Surg 220, 570-576.
[30] Budipitojo T, Matsuzaki S, Cruzana MBC,
[21] Evers BM, Izukura M, Townsend CM Jr, Baltazar ET, Hondo E, Sunaryo S, Kitamura
Uchida T and Thompson JC (1990) N and Yamada J (2001) Immunolocalization
Differential effects of gut hormones on of gastrin-releasing peptide in the bovine
pancreatic and intestinal growth during uterus and placenta. J Vet Med Sci 63, 11-15.
administration of an elemental diet. Ann Surg
211, 630-636. [31] Kumano A, Sasaki M, Budipitojo T, Kitamura
N, Krause WJ and Yamada J (2005)
[22] Fiorucci S, Bufalari A, Distrutti E, Immunohistochemical localization of gastrin-
Lanfrancone L, Servoli A, Sarpi L, Federici releasing peptide, neuronal nitric oxide
B, Bartoli A, Morelli A and Moggi L (1998) synthase and neuron-specific enolase in the
Bombesin-induced pancreatic regeneration in uterus of the North American Opposum,
pigs is mediated by p46Shc/p52Shc and Didelphis Virginiana. Anat Histol Embryol
p42/p44 mitogen-activated protein kinase 34, 225-231.
upregulation. Scand J Gastroenterol 1 33,
1310–1320. [32] Rexroad JR CE, Casida LE and Tyler WJ
(1974) Crown-rump length of fetuses in
[23] Poston GJ, Saydjari R, Lawrence JP, Chung purebred Holstein-Friesian cows. J Dairy Sci
D, Townsend CM Jr and Thompson JC 57, 346-347.
(1991) Aging and the trophic effects of
cholecystokinin, bombesin and pentagastrin [33] Frucht H, Gazdar AF, Park JA, Oie H and
on the rat pancreas. Pancreas 6, 407-411. Jensen RT (1992) Characterization of
functional receptors for gastrointestinal
[24] Upp JR Jr, Poston GJ, MacLellan DG, hormones on human colon cancer cells.
Townsend CM Jr, Barranco SC and Cancer Res 52, 1114–1122.
Thompson JC (1988) Mechanisms of the
trophic actions of bombesin on the pancreas. [34] Cornelio DB, Roesler R and Schwartsmann G
Pancreas 3, 193-198. (2007) Gastrin-releasing peptide receptor as a
molecular target in experimental anticancer
[25] Rozengurt E and Sinnett-Smith J (1983) therapy. Ann Oncol 18, 1457-1466.
Bombesin stimulation of DNA synthesis and
cell division in cultures of Swiss 3T3 cells. [35] Welton ML, Mantyh CR, Gates TS, Popper P,
Proc Natl Acad Sci USA 80, 2936–2940. Vigna SR, Maggio JE, Passaro Jr E and
Mantyh PW (1988) Localization of bombesin
[26] Willey JC, Lechner JF and Harris CC (1984) receptors in the human gastrointestinal tract
Bombesin and the C-terminal using quantitative receptor autoradiography.
tetradecapeptide of gastrin-releasing peptide Ann NY Acad Sci 547, 468–470.
are growth factors for normal human
bronchial epithelial cells. Exp Cell Res 153, [36] Gugger M and Reubi JC (1999) Gastrin-
245–248. releasing peptide receptors in non-neoplastic
Page | 525
PROCEEDINGS
and neoplastic human breast. Am J Pathol C17,20-lyase and aromatase cytochrome

155, 2067-2076. P450 during bovine trophoblast
differentiation: a two-cell system drives
[37] Dumesny C, Whitley JC, Baldwin GS, Giraud placental oestrogen synthesis. Reproduction
AS and Shulkes A (2004) Developmental 131, 669-679.
expression and biological activity of gastrin-
releasing peptide and its receptors in the [46] Xie S, Low BG, Nagel RJ, Beckers JF and
kidney. Am J Physiol Renal Physiol 287, 578- Roberts RM (1994) A novel glycoprotein of
585. the aspartic proteinase gene family expressed
in bovine placental trophectoderm. Biol
[38] Bartholdi MF, Wu JM, Pu H, Troncoso P, Reprod 51, 1145-1153.
Eden PA and Feldman RI (1998) In situ
hybridization for gastrin-releasing peptide [47] Igwebuike UM (2006) Trophoblast cells of
receptor (GRP receptor) expression in ruminant placentas - A minireview. Anm
prostatic carcinoma. Int J Cancer 79, 9 82-90. Reprod Sci 93, 185-198.
[39] Fleischmann A, Waser B, Gebbers JO and [48] Wimsatt WA (1951) Observations on the
Reubi JC (2005) Gastrin-releasing peptide morphogenesis, cytochemistry, and
receptors in normal and neoplastic human significance of the binucleate giant cells of
uterus: involvement of multiple tissue the placenta of ruminants. Am J Anat 89,
compartments. J Clin Endocrinol Metab 90, 233–282.
4722–4729.
[49] Wooding FB (1992) Current topic: the
[40] Amiot F, Leiber D, Marc S and Harbon S synepitheliochorial placenta of ruminants:
(1993) GRP-preferring bombesin receptors binucleate cell fusions and hormone
increase generation of inositol phosphates production. Placenta 13, 101-113.
and tension in rat myometrium. Am J Physiol
265, C1579–C1587. [50] Wooding FBP and Flint APF (1994)
Placentation. In: Marshall’s Physiology of
[41] Kilgore WR, Mantyh PW, Mantyh CR, Reproduction. (Lamming GE, ed), pp230-
McVey DC and Vigna SR (1993) 446, Charpman and Hall, London.
Bombesin/GRP-preferring and neuromedin
B-preferring receptors in the rat urogenital [51] Nakano H, Shimada A, Imai K, Takezawa T,
system. Neuropeptides 24, 43–52. Takahashi T and Hashizume K (2002)
Bovine trophoblastic cell differentiation on
[42] Budipitojo T, Sasaki M, Matsuzaki S, collagen substrata: formation of binucleate
Cruzana MB, Iwanaga T, Kitamura N and cells expressing placental lactogen. Cell
Yamada J (2003) Expression of gastrin- Tissue Res 307, 225-235.
releasing peptide (GRP) in the bovine uterus
during the estrous cycle. Arch Histol Cytol [52] Shimada A, Nakano H, Takahashi T, Imai K
66, 337-346. and Hashizume K (2001) Isolation and
characterization of a bovine blastocyst-
[43] Wooding FBP and Burton GJ (2008) derived trophoblastic cell line, BT-1:
Comparative placentation. Structure, function development of a culture system in the
and evolution. 301p, Springer, Berlin. absence of feeder cell. Placenta 22, 652-62.
[44] Klisch K, Boos A, Friedrich M, Herzog K, [53] Duello TM, Bertics PJ, Fulgham DL and Van
Feldmann M, Sousa N, Beckers J, Leiser R Ess PJ (1994) Localization of epidermal
and Schuler G (2006) The glycosylation of growth factor receptors in first- and third-
pregnancy-associated glycoproteins and trimester human placentas. J Histochem
prolactin-related protein-I in bovine Cytochem 42, 907-915.
binucleate trophoblast giant cells changes
before parturition. Reproduction 132, 791- [54] Hambruch N, Haeger JD, Dilly M and Pfarrer
798. C (2010) EGF stimulates proliferation in the
bovine placental trophoblast cell line F3 via
[45] Schuler G, Özalp GR, Hoffmann B, Harada Ras and MAPK. Placenta 31, 67-74.
N, Browne P and Conley AJ (2006)
-hydroxylase-
Page | 526
PROCEEDINGS
[55] Muhlhauser J, Crescimanno C, Kaufmann P, [59] Mitko K, Ulbrich SE, Wenigerkind H,

Hofler H, Zaccheo D and Castellucci M Sinowatz F, Blum H, Wolf E and Bauersachs
(1993) Differentiation and proliferation S (2008) Dynamic changes in messenger
patterns in human trophoblast revealed by RNA profiles of bovine endometrium during
cerbB-2 oncogene product and EGF-R. J the oestrous cycle. Reproduction 135, 225-
Histochem Cytochem 41, 165-173. 240.
[56] Lui VW, Thomas SM, Zhang Q, Wentzel AL, [60] Spencer TE, Johnson GA, Burghardt RC and
Siegfried JM, Li JY and Grandis JR (2003) Bazer FW (2004) Progesterone and placental
Mitogenic effects of gastrin-releasing peptide hormone actions on the uterus: insights from
in head and neck squamous cancer cells are domestic animals. Biol Reprod 71, 2–10.
mediated by activation of the epidermal
growth factor receptor. Oncogene 22, 6183- [61] Tsutsumi Y (1965) Cyclic changes in the
6193. female genital mucosa of the normal estrous
rabbit. J Fac Agr Hokkaido Univ 54, 151-
[57] Zhang Q, Bhola NE, Lui VW, Siwak DR, 170.
Thomas SM, Gubish CT, Siegfried JM, Mills
GB, Shin D and Grandis JR (2007) [62] Gawin AZ, Baraniuk JN, Lundgren JD and
Antitumor mechanisms of combined gastrin- Kaliner M (1993) Effects of gastrin-releasing
releasing peptide receptor and epidermal peptide and analogues on guinea pig nasal
growth factor receptor targeting in head and mucosal secretion. Am J Physiol 264, 345–
neck cancer. Mol Cancer Ther 6, 1414-1424. 350.
[58] Fortier MA, Guilbault LA and Grasso F [63] Baraniuk JN, Lundgren JD, Shelhamer JH and
(1988) Specific properties of epithelial and Kaliner MA (1992) Gastrin releasing peptide
stromal cells 6 from the endometrium of (GRP) binding sites in human bronchi.
cows. J Reprod Fertil 83, 239–248. Neuropeptides 21, 81-84. 7
Page | 527
PROCEEDINGS
CYTOTOXICITY AND APOPTOSIS INDUCTION OF EMESTRIN

B FROM MARINE DERIVED FUNGUS EMERICELLA NIDULANS
Muhammad Nursid and Nurrahmi Dewi Fajarningsih
Research and Development Center for Marine and Fisheries Product

Competitiveness and Biotechnology, Jl.KS.Tubun Petamburan VI Jakarta, 10260, Indonesia
Email : mnursid@kkp.go.id
Abstract
Marine fungi have become an important research subject of natural products with significant value due to
its diversity in chemical structures and biological activities. Epipolythiodioxopiperazines (ETPs) which
are characterized by the disulfide bridge or polysulfide dioxopiperazine six membered ring have been
reported to have wide ranges of bioactivities. This research was aimed to isolate, identify and investigate
anticancer properties of emestrin B produced by Emericella nidulans marine fungus. Emestrin B was
isolated from mycelium of the E.nidulans fungus that cultivated on malt extract broth medium for 4
weeks by using repeated column chromatography.Elucidation of molecular structure using spectra data
analysis of UPLC-ESI-ToF-MS, 1H-NMR, and 13C-NMR techniques concluded that the compound was
emestrin B. The molecular formula of emestrin B was established as C 27H22N2O10S3 (m/z) 631.0525
[M+H]+. Emestrin B was cytotoxic against T47D, HeLa, and WiDr cells with IC 50 values of 0.16; 1.56;
and 1.02 μg/ml, respectively. Based on flowcytometric analysis, emestrin B could induce apoptosis in
T47D cells.
Keywords:Marine fungus, Emericella nidulans, emestrin B,cytotoxicity, apoptosis
1. Introduction properties and molecular taxonomy, this

funguswasidentified as Emericella nidulans.
Marine fungi have much attention as an An epipolythiodioxypiperazine, emestrin A,
important source of biologically active secondary was isolated from mycelium of this fungus.
metabolites1 due to its diversity in chemical Emestrin A exhibited anticancer properties against
structures and biological activities 2. Marine- several cancer cell lines6. Continuing our
derived fungi have different characteristic from previously study, the objective of this study was to
terrestrial fungi, such as salt tolerance, and yield isolate, identify and investigate another anticancer
many unique secondary metabolites 3. compound from mycelium of Emericella nidulans
Majority of compounds that were isolated marine fungus.
from marine-derived fungi strains are
polyketidederived, alkaloids, terpenes, peptides 2. Methods
and compounds of mixed biosynthesis. These
compounds are representative groups of secondary a. Fungus Material and Culture
metabolites produced by these fungi. The chemical
Culture of E.nidulans, a fungus derived
diversity of marine-derived fungi secondary
from the marine ascidia Aplidium longithorax, was
metabolites, along with the strains novelty, points
maintained on malt extract agar.The fungus was
this group of microorganisms as much interest for
cultured in static liquid culture of malt extract
isolation of unusual bioactive natural products 4.
broth medium containing 0.3% malt extract, 0.3%
The genus ofAspergillus and Penicillium were
yeast extract, 0.5% peptone and seawater (salinity
major contributor to active compounds of marine
of 30 ppt). The fungus was cultured (1 L x 20
fungi origin 5. flasks) for 5 weeks at 27-29oC.
In our previous study, we found that crude
extract of marine fungus strain MFW-39-08
mycelium, inhibited the growth of T47D (breast
cancer) cell line. Based on morphological
Page | 528
PROCEEDINGS
b. Isolation of Emestrin B
f. Flowcytometry Analysis.
The mycelium extract was fractionated by
vacuum column on silica gel using n-hexane – The analysis and discriminationbetween
EtOAc (8:1), n-hexane – EtOAc (1:1), EtOAc apoptosis and necrosis cancer cells was conducted
100%, and MeOH 100%. Fraction 3 was then using Annexin-V-FLUOS staining kit (Roche).
separated by silica gel vacuum column using n- After T47D cells treated with 1.0μg/ml ofemestrin
hexane – EtOAc (8:1), (5:1), (1:1), EtOAc 100% B for 24 h, the cells were trypsinized, washed with
and EtOAc – MeOH (5:1). Fraction 3.7 was then PBS, and the cell pellet was resuspended in 100 μl
purified using silica gel preparative TLC to get of Annexin-V-FLUOS reagent. The cells were
emestrin B. then incubated in dark room for 10 minutes at 20 –
25 oC. Apoptotic and necrotic cells were measured
c. Compound Identification. by FACSCalybur (Becton-Dickinson) flow
cytometer.
Identification of bioactive compound was
determined using UPLC-ESI-ToF-MS (Waters),
1
H-NMR, and 13C-NMR (JEOL 500 Mhz). 3. Results and Discussion
d. Cytotoxic Bioassay Cultivation of Emericella nidulans in 1 L x

20 flasks yielded498.4 gram of mycelium. The
Three human cancer cell lines (T47D, HeLa mycelial extract of the fungus was separated by
and WiDr) were routinely grown and maintained SiO2 column chromatographyand TLC preparative
in RPMI medium with 10% FBS and 1% chromatographywhich yielded20.0 mg emestrin B.
penicillin/streptomycin. All cell lines were Analysis of UPLC-ESI-qTOF-MS data determined
incubated in a moisture-saturated atmosphere the molecular formula of emestrin B as
containing 5% CO2. To each well of the 96-wells C27H21N2O10S3.
microplate containing 100 μL of cell suspension The 1H-NMR spectrum of emestrin B
(1.5 ×104 cells) was added 100 μL of active (Figure 1) in CDCl3 showedmethoxy group (3 – 4
compound (dissolved in RPMI-1640 medium) and ppm) and olefinic proton/sp2 (4 – 6 ppm) and
the plate was then incubated in a CO2 incubator at aromatic proton ( 6 – 8 ppm). Two proton signals
37 °C for 24 h. After the addition of 100 μL of 3- singlet derived methoxy proton (2 – NCH3 dan 2‖-
(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H- OCH3) detected at 3 – 4 ppm. The chemical shift
tetrazolium bromide saline solution (0.5 mg/mL) of 2‖-OCH3 more downfield than 2 – NCH3 caused
to each well of microplate, the plate was then 2‖-OCH3 containing oxygen atom that more
incubated for 4 h under the same conditions in the electronegative than nitrogen atom.
CO2 incubator. After incubation, the optical The 13C-NMR spectrum of emestrin B
density was measured at 570 nm in a microplate displayed 27 carbon signals. Chemical shift of 0 -
reader (Thermo Scientific). The inhibition 60 ppm indicated sp3 carbon and chemical shift of
concentration 50 (IC50) values defined as the 70 – 85 ppm showed atomic carbon bonded
concentrations of compound which inhibited 50% electronegative atom. Alkene and benzoic aromatic
of the cell growth. IC50 value was determined by detected at 100 – 160 ppm (sp2) whereas area of
using Minitab probit analysis version 14.0. 160 – 180 ppm showed chemical shift of lactam
carbonil and esther indicating structure of emestrin
e. DNA Fragmentation B. The summary of 1H-NMR and 13C-NMR of
emestrin B was summarized in Table 1.
The T47D cell was seeded at a final
concentration of 106 cells/well in 6-wells 10
OH
11 O
microplate and incubated for 12 h in CO2 incubator O 11a 1
(37oC, 5% of CO2 flow). The active compound 8
10a
5a
was added to the cells at final concentration of 6 N S3 N
1.0μg/mland then incubated for 6, 12 and 24 h. At 7 4
3
the end of the incubation period, medium was O
O
O 7' OH
collected from each of the treatment wells and
attached cells were tripsynized (0.025% trypsin 4" 6" 2' 6'
EDTA) from the microplate, followed by

3" 5'
centrifugation at 10.000 rpm for 5 minutes to O
collectt the cells. Isolation of genomic DNA and O OH
DNA electrophoresis conducted according to
Figure 1. Molecular structure of emestrin B.
reagent manufacturer (Apoptotic DNA Ladder Kit,
Roche).
Page | 529
PROCEEDINGS
The MTT test was used for evaluating A B

cytotoxic properties of emestrin B. The growth-
inhibitory effects of emestrin B was tested in three
cell lines, including T47D (breast cancer), HeLa
(cervix cancer) and WiDr (colon cancer).
Morphological changes in the cells caused by
emestrin B were observed by microscopy as shown
in Figure 2. After 24 h treatment of 1.0 µg/ml C D
emestrin B, the morphology change of T47D,
HeLa and WiDr cells were observed. In contrast,
there were no morphological changes in untreated
cells (control). Probit analysis showed that
emestrin B had strong cytotoxicity activity to
T47D, HeLa and WiDr cells with IC50 value of E F
0.16; 1.56; and 1.02 μg/ml, respectively. As
emestrin B showed the best cytotoxic activity
against T47D cells, we used T47D cells for further
study.
Figure 2. Effect of emestrin B (1 µg/ml) to HeLa
Table 1. 1H and 13C NMR Spectroscopic Data (B), WiDr (D), and T47D (F) cells compare to
for Emestrin in CDCl3 untreated cells (control) of HeLa (A), WiDr (C)
and T47D (E).
δ (ppm) δ (ppm)
1 13
Proton H-NMR Carbon C-NMR The T47D cells were exposed to emestrin B
2-NMe 3.5395 1 165.69 for 6, 12, and 24 h and then the DNA was
5a-H 5.4034 2-NMe 29.04 extracted. Electrophoresis of DNA was performed
6-H 5.3359 3 83.34 and a typical DNA ladder pattern of apoptosis was
7-H 5.0143 4 165.40 observed. The DNA gel electrophoresis image
8-H 6.3555 5a 59.17 showed that emestrin B was abble to cause DNA
10-H 6.8159 6 74.87 fragmentation, although it was not too clear, as
11-H 5.2387 7 110.01 early indication of apoptosis as seen in figure 3. In
2’-H 8.7162 8 139.16 contrast, a clear DNA ladder was visible in the
5’-H 6.8354 10 143.18 lyophilized apoptotic U937 cells as a positive
6’-H 6.9288 10a 108.51 control.
7’-H 4.8132 11 76.82
2”- 4.0674 11a 78.14
OMe 7.0287 1’ 127.19
3”-H 7.8575 2’ 123.39
4”-H 8.3517 3’ 147.42
6”-H 4’ 154.69
5’ 114.62
6’ 126.99
7’ 79.98
1” 146.62
2” 149.86
2”-OMe 56.65
3” 112.14
4” 127.78
5” 122.77 Figure 3. Analysis of DNA fragmentation in
6” 130.49 T47D cells treated with emestrin B. M (marker);
7” 168.34 KS (untreated cells); E6, E12, E24 (cells were
treated for 6, 12 and 24 hours, respectively);
U937 (apoptotic of U937 cells treated with
camptothecin, positive control)
Since the induction of apoptosis in T47D

cells by emestrin B cells was not clearly observed
by analysis of DNA fragmentation, other analysis
Page | 530
PROCEEDINGS
were used to determine whether the growth ascomycetes (Dothideomycetes, Eurotiomycetes,

inhibition of T47D cells by emestrin B associated Lecanoromycetes, Saccharomycetes and
with the induction of apoptosis. In this research Sordariomycetes) were known produce ETPs. At
flow cytometry analysis was performed by using least two basidiomycetes, Stereum hirsutum and a
annexin V-propidium iodide staining. According Hyalodendron sp., produce ETPs epicorazine and
to this method, T47D cells were treated by hyalodendrin, respectively7, 11. Emestrin is
emestrin B for 24 hours. Doxorubicin was used to action at the chemokine receptor has lead to its
induce apoptosis in T47D cells as a positive consideration as a possible treatment for
control. Based on the flow cytometry analysis, autoimmune disorders including rheumatoid
emestrin B could induce apoptosis in T47D cells. arthritis, atherosclerosis, multiple sclerosis, and
Percentage of apoptotic cells treated with emestrin infectious diseases 12, 13.
B was 74.1% whereas that treated with Some ETPs exhibit potent anti-tumor
doxorubicin was 74.8% (Figure 4). activity so which made them interesting to be
explored. For example gliotoxin that showed not
only immunosuppressive effect but also causes
apoptotic and necrotic cell death in vitro. The
toxicity of ETPs has made them attractive as
potential therapeutic agents for diseases such as
cancer14.An ETP, 11,11′-dideoxyverticillin,
which is isolated from Shiraia bambusicola,
exhibits potent cytotoxicity against a broad
spectrum of cancer cell lines in vitro 15.
Furthemore, a novel 11′-deoxyverticillin A
derivative (G226), exhibits potent cytotoxic
activity against 9 breast cancer cell lines with a
mean IC50 value of 48.5 nmol/L. The anticancer
mechanism of G226 through triggering autophagy
and caspase-dependent apoptosis 16.
In our previous study, we found that
Figure 4. Apoptosis and necrosis were induced emestrin A inhibited the growth of T47D cells
in T47D cells detected by annexin-PI staining. through the G phase of the cell cycle 6. In this
Viable cells : lower left quadrant, apoptotic research, we assayed the ability of emestrin B to
cells : lower right quadrant and necrotic cells :
upper right quadrant.
induce apoptosis in T47D cells through DNA
fragmentation and flowcytometry analysis. The
Emestrin is a member of formation of distinct DNA fragments is a
epipolythiodioxopiperazines (ETPs) group which biochemical hallmark of apoptosis, with
is a group of toxic secondary metabolites made internucleosomal DNA cleavage activity as a
only by fungi7. Emestrin A and B were major characteristic. In many systems, this DNA
originally isolated from mycelial acetone extract fragmentation was from activation of an
of Emericellastriata 8, 9. Emestrin A, the first endogenous Ca2+and Mg2+ dependent nuclear
reported example of 15-membered macrocyclic endonuclease. This enzyme selectively cleaves
ETP with strong antifungal activity, was formally DNA at sites located between nucleosomal units
derived from two molecules of phenylalanine and (linker DNA) generating mono- and
one molecule of benzoic acid 10. Emericella oligonucleosomal DNA fragments. These DNA
nidulans, isolated from the surface of marine fragments reveal, upon agarose gel electrophoresis,
ascidia Aplidium longithorax, also produced a distinctive ladder pattern consisting of multiples
emestrin Awhich showed anticancer properties of an approximately 180 bp subunit17,18.
against several cell lines 6. Changes at the cell surface occur when a
Recently, more than 14different ETPs cell undergoes apoptosis. One of plasma
(excluding those with minor modifications) are membrane alteration is the translocation of
known. The diversity of structures stems from the phosphatidylserine (PS) from the inner part of the
amino acids of the core ETP moiety, as well as the plasma membrane to the outer layer, by which PS
modifications of these amino acids. All natural becomes exposed at the external surface of the
ETP isolated to date contain at least one aromatic cells. PS exposure therefore represent a useful
amino acid. A diverse range of filamentous assay for the apoptosis. PS present on the outer
ascomycetes produce ETPs. Five classes of layer can be detected using Annexin V 19.
Annexin V is Ca2+-dependent phospholipidbinding
Page | 531
PROCEEDINGS
protein with high affinity for PS. This protein can Javaroti,M.H.R. Seleghim,B.C. Cavalcanti,
hence be used as a sensitive probe for PS exposure C.Pessoa, M.O. Moraes,B.A. Lima, R.
upon the outer layer of the cell membrane and is, Gonçalves,R.C.B. Santos, L.D. Sette, and
therefore, suited to detect apoptosis cells. Necrotic R.G.S. Berlinck. Evaluating methods for the
cells also expose PS, and will therefore also bind isolation of marine-derived fungus strains and
Annexin V. To differentiate between apoptotic and production of bioactive secondary
necrotic cells, PI is often used in conjunction with metabolites. Rev. Bras. Farmacogn. Braz. J.
Annexin V. PI will mark necrotic cells, but Pharmacogn.,vol. 22, no. 2, pp. 257-267,
notapoptotic cells. In this assay, Annexin V binds 2012.
the phospholipid PS, marking apoptotic and 5T.S. Bugni, and C.M. Ireland. Marine-derived
necrotic cells, while PI bind DNA, marking only fungi: a chemically and biologically diverse
necrotic cells 17. group of microorganisms. Natural Product
Reports, 21,pp. 143-163, 2004. ―doi:
4. Conclusion 10.1039/b301926h‖
Marine fungi Emericella nidulans produced 6M. Nursid, E. Chasanah, Murwantoko, and S.
emestrin B, a member of a Wahyuono. Isolation and identification of
epipolythiodioxopiperazines (ETPs) group that emestrin from Emericellanidulansand
exhibited cytototoxic activity against T47D, HeLa investigation of its anticancer properties.
and WiDr cells with IC50 value of 0.16; 1.56; and Microbiol. Indones., vol.5, no. 4, pp. 160-
1.02 μg/ml, respectively. Based on flowcytometry 169, 2011. ―doi: 10.5454/mi.5.4‖.
analysis, emestrin B could induced apoptosis in 7D.M. Gardiner, P. Waring, and B.J. Howlett.
T47D cells. The epipolythiodioxopiperazine (ETP) class
of fungus toxins: distribution, mode of action,
Acknowledgment functions and biosynthesis. Microbiology,
151, pp. 1021 – 1032, 2005. ―doi:
This research was funded by Ministry of Marine 10.1099/mic. 0.27847-0‖.
and Fisheries Affairs, Republic of Indonesia. We 8K. Nozawa, S. Udagawa, S. Nakajima, and K.
thanks to Pathology Clinic Laboratory, Gadjah Kawai. Studies on Fungus Products: XIV,
Mada University, Yogyakarta, Center for Emestrin B, a new ETP, from Emericella
Assessments of Biotechnology-BPPT; Research striata. Chem. Pharm. Bull., vol. 35, no.8, pp.
Center for Chemistry-LIPI; and Ms. Asri Pratitis 3460 – 3461, 1987.
for the fungus isolation.
9K. Seya, S. Nakajima, and K. Kawai. Structure
References and absolute configuration of emestrin, a new
macrocyclic epidithiodioxopiperazine from
1J.W. Blunt, B.R.Copp, W.P. Hu, M.H.G. Emericella striata. J. Chem. Soc. Chem.
Munro, P.T. Northcote, and M.R. Prinsep. Commun., 117, pp. 657 – 658, 1985.
Marine natural products.Natural Product 10C.S. Jiang, and Y.W.
Reports,24,pp. 31-86, 2007. Guo.Epipolythiodioxopiperazines from fungi:
2M.P.L. Gresa, N.Cabedo,M.C.G. Mas, M.L. chemistry and bioactivities. Mini-Reviews in
Ciavatta, C. Avila, and J. Primo.Terretonins Medicinal Chemistry, 11, pp. 728-745, 2011.
E and F, inhibitors of the mitochondrial 11C.J. Guo, H.H. Yeh, Y.M. Chiang, J.F.
respiratory chain from the marine-derived Sanchez, S.L. Chang, K.S. Bruno, and C.C.C
fungus Aspergillus insuetus. J. Nat. Prod.,72, Wang. Biosynthetic pathway for the
pp. 1348–1351, 2009. ‖doi: epipolythiodioxopiperazine acetylaranotin in
0.1021/np900085n‖. Aspergillus terreusrevealed by genome-based
3M. Ishino, K. Kinoshita, K. Takahashi, T. deletion analysis. J. Am. Chem. Soc., vol.135,
Sugita, M. Shiro, K. Hasegawa, and K. no.19, pp. 7205–7213, 2013.
Koyama. Phomactins K-M, three novel ―doi: 10.1021/ja312365‖.
phomactin-type diterpenes from a marine- 12 K.B. Herath, H. Jayasuriya, J.G. Ondeyka,
derived fungus. Tetrahedron, 68, pp. 8572– J.D. Polishook, G.F. Bills, A.W.
8575, 2012.―doi:10.1016/j.tet.2012.08.013‖ Dombrowski, A. Cabello, P.P. Vicario, H.
4M.H. Kossuga,S. Romminger,C. Xavier,M.C. Zweerink, Z. Guan, and S.B. Singh. Isolation
Milanetto,M.Z. Valle,E.F. Pimenta,R.P. and structures of novel fungus metabolites as
Morais, E. Carvalho,C.M. Mizuno,L.F.C. chemokine receptor (CCR2) antagonists. J.
Coradello,V.M. Barroso,B. Vacondio,D.C.D. Antibiot., vol. 58, no. 11, pp. 686-94, 2005.
Page | 532
PROCEEDINGS
13 K. Terao, E. Ito, K. Kawai, K. Nozawa, S. apoptosis in human breast cancer cells in
Udagawa. Experimental acute poisoning in vitro. Acta. Pharmacol. Sin.,vol. 35, no. 8,
mice induced by emestrin, a new mycotoxin pp. 1055–1064, 2014. ―doi:
isolated from Emericella species. 10.1038/aps.2014.47‖.
Mycopathologia, vol. 112, no. 2, pp. 71-79,
1990. 17Ranalli, M., Oberst, A., Corazzari, M. and
Laurenzi, V.D. Flow cytometric studies of
14D.M. Vigushi, N. Mirsaidi,G. Brooke, C. Sun, cell death. In D. Hughes and H. Mehmet, H
P. Pace, L. Inman, C.J. Moody, and R.C. (Eds), Cell proliferation and apoptosis.
Coombes. Gliotoxin is a dual inhibitor of Oxford: BIOS Scientific Publisher Limited,
farnesyl transferase and 2003.
geranylgeranyltransferase I with antitumor
activity against breast cancer in vivo. Med. 18F.R. Yu, X.Z. Lian, H.Y. Guo, P.M. McGuire,
R.D. Li, R. Wang, and F.H. Yu. Isolation
Oncol., 21, pp. 21–30, 2004.
and characterization of methyl esters and
15B.W. Son, P.R. Jensen, C.A. Kauffman, and derivatives from Euphorbia
W. Fenical. New cytotoxic kansui(Euphorbiaceae) and their inhibitory
epidithiodioxopiperazines related to effects on the human SGC-7901 cells. J.
verticillin A from a marine isolate of the Pharmacol. Pharm. Sci.,vol. 8, no. 3, pp.
fungus Penicillium. Nat. Product Lett.,13, pp. 528-531, 2005.
213–22, 1999.
19S. Elmore. Apoptosis: A review of
16P.X. He, Y.S. Che, Q.J. He, Y. Chenand J. programmed cell death. Toxicologic
Ding. G226, a novel Pathology, 35, pp. 495–516, 2007. ―doi:
epipolythiodioxopiperazine derivative, 10.1080/01926230701320337‖
induces autophagy and caspase-dependent
Page | 533

Proceedings The 6th Ibc - Rev 2.compressed - 2

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Proceedings The 6th Ibc - Rev 2.compressed - 2

Uploaded by

Copyright:

Available Formats

ISBN : 978-602-14235-6-1

DESIGN & LAYOUT:

The 6th IBC Chairman

Prof. Dr. Ir. Ahmad Yunus, M.S.

TIME EVENT SPEAKER

14.15-14.40 Marine organism as a source of natural Prof. Dr. Taifo

Seni Kurnia Senjaya, Genetic Yanti, Wilson Effect of sugar palm

Saptowo J. Pardal, Molecular and Ana Indrayati, Collagen deposition and

Denia Apriliani Rahman, Techno economic Apon Zaenal Construction of

DAY – II, SEPTEMBER 7th, 2016

Bambang Exploration of some Muhammad Nursid, Cytotoxicity of

Risky Azlia Edrina, Determination of mass Yusro Nuri Fawzya, Microbial

Choiroel Anam, Exploration potential Lisa Charisa Wijaya, Examination of

15.20 – 15.30 CLOSING REMARKS

DAY – III, SEPTEMBER 8th, 2016

14. Efectivity of Soaking Period of Arenga Fiber And Coconut Water to

29. Genetic Analysis Of Orchid Hybrids (Dendrobium) With Random

Topic Field: Medical Biotechnology ...................................................... 414

42. The Comparison of Batch and Column Based Affinity Chromatography

Topic Field: Microbiology Biotechnology............................................. 471

Topic Field: Marine and Vetereniary Biotechnology .......................... 508

OVERVIEW OF ROLE OF QUALITY INFRASTUCTURE TO

MUTATIONS OF THE COAT PROTEIN OF

MOLECULAR PHYSIOLOGY OF ACID SOIL RESISTANCE OF

MOLECULAR BREEDING & MARKER ASSISTED SELECTION

CELL LINE DEVELOPMENT OF HUMAN ERYTHROPOIETIN

Adi Santoso Ph.D

WILD WATERMELON AND JATROPHA:

INVESTIGATING THE BIOSYNTHETIC PATHWAYS OF

Agustinus R. Uria1 dan Jorn Piel2

SUGARCANE RESEARCH AT GUANGXI UNIVERSITY

ASSISTED REPRODUCTIVE TECHNOLOGY AS A NEW

ROLES OF MERCK IN BIOFUEL INDUSTRY

TOPIC FIELD: AGRICULTURE AND

EFFICIENCY OF SIMPLE SEQUENCE REPEATS (SSR)

Restu, Muhammad 1, Gusmiaty1, Larekeng, Siti Halimah1*

Keywords:Band patterns, Jabon Merah, Molecular breeding, Polymorphisms, SSR marker

1. Introduction selection strategies are needed to support the

identification. Identifications using molecular 2. Methods

No. Locus Accession Repeat motif Primer (5'-3')

No Locus Accession no. Annealing Fragment Characteristics

Figure 1. An example of polymorphic band pattern of 12 DNA samples amplified by microsatellite

GENETIC DIVERSITY OF SULAWESI EBONY IN IN SITU

Larekeng, Siti Halimah1*, Restu, Muhammad1, Gusmiaty1,

1. Introduction Genetic diversity can be analyzed using

diversity analysis Mondini et al [3]; Park et al [4] Microsatellite analysis

3. Result and Discussion (locus8917DC591591). Average PIC was 0,37.

Locus name/ Tm Allele size

Table 2.Numberof alleles (Na), number of effective alleles (Ne), observed

No Locus Name Na Ne Ho He PIC

Table 3.Number of alleles (Na), number of effective alleles (Ne), observedheterozygosity(Ho),

No Locus Name Na Ne Ho He PIC

No Individual name Stage Number of private Locus of private allele

B29.3 B29.5 B24.1

Genetic diversity in tree and seedling to 2,00. In addition, ssrDK29DQ097497 locus

Reference Genetic Diversity of Cultivated Tropical

[13] Y. Liang, H Weijuan, S. Peng, L. Jinjun, W.

[14] Y.T. Seng, R. Singh, Q.Z. Faridah, S.G. Tan,

[15] R. Peakall, P.E. Smouse, Mol. Ecol. Notes. 6

[16] X. Perrier, A. Flori, F. Bonnot, in: P. Hamon,

POLLEN DISPERSAL DISTANCES OF A VULNERABLE

1. Introduction Ebony individuals in those provenances showed a

Table 2. Number of alleles, Number of heterozygote and homozygote individuals, observed