Analytica Chimica Acta 1092 (2019) 66e74

Contents lists available at ScienceDirect

Analytica Chimica Acta

journal homepage: www.elsevier.com/locate/aca

An enzyme-free electrochemical biosensor for simultaneous detection

of two hemophilia A biomarkers: Combining target recycling with
quantum dots-encapsulated metal-organic frameworks for signal
amplification
H. Rezaei a, M. Motovali-bashi a, *, S. Radfar b
a
Genetics Division, Biology Department, Faculty of Sciences, University of Isfahan, Isfahan, 81746-73441, Iran
b
Department of Chemistry, Faculty of Sciences, Najafabad Branch, Islamic Azad University, Najafabad, Esfahan, P.O. Box: 517, Iran

h i g h l i g h t s g r a p h i c a l a b s t r a c t

A novel biosensor for simultaneous

detection of two hemophilia A-
related microRNAs was fabricated for
the first time.

The sensitivity of the proposed
biosensor using QDs@ZIF-8 as signal
tags is about 15 times that of a
biosensor using QDs.

The DPV response was intensified by
QDs@ZIF-8 and catalytic hairpin as-
sembly to acquire LOD of 0.19 fM.

Biosensor in enzyme-free detection
showed the good linear ranges of 1
fM to 1mM.

Biosensor could highly specify ds-
RNA from the 1-base mismatch and
non-complementary targets.

a r t i c l e i n f o a b s t r a c t

Article history: A sensitive and selective electrochemical method for simultaneous detection of two hemophilia A-
Received 18 May 2019 related microRNAs (miR-1246 and miR-4521) was developed. This detection tactic was based on gold
Received in revised form nanoparticles (AuNPs), heavy metals quantum dots-encapsulated metal-organic frameworks (QDs@ZIF-
28 August 2019
8), and catalytic hairpin assembly (CHA) for signal application. Primarily, hairpins H1 and H2 were hy-
Accepted 12 September 2019
bridized with targets miR-1246 (T1) and miR-4521 (T2) for forming H1-T1 and H2-T2 duplex stranded
Available online 16 September 2019
DNAs (dsDNAs) that were able to open the hairpins H3 and H4 for the formation of H1eH3 and H2eH4
dsDNAs. Meanwhile, lots of H1eH3 and H2eH4 dsDNAs were created by releasing the target to take part
Keywords:
microRNAs
in the next cycle for signal amplification. And then single stranded fragments of H1eH3 and H2eH4
Hemophilia A dsDNAs were utilized for hybridizing the PbS@ZIF-8-S1 and CdS@ZIF-8-S2 in order to amplify the
Metal-organic frameworks electrochemical signal. The diagnosis of corresponding target miRs using differential pulse voltammetry
Electrochemical biosensor has been possible by releasing Pb (II) and Cd (II) ions from PbS@ZIF-8 and CdS@ZIF-8 tags by HCI
Heavy metal quantum dots leaching. In this context, encapsulation of heavy metals quantum dots (QDs) was done in zeolitic imi-
Catalytic hairpin assembly dazolate framework-8 (ZIF-8) to form QDs@ZIF-8 muti-core-shell particles by in situ growth of ZIF-8 in
the presence of QDs. Since the quantity of QDs tagged to each target miRs grows massively, being
resulted from a huge number of QDs that encapsulated in each QDs@ZIF-8 label, the sensitivity of the

* Corresponding author.
E-mail address: mbashi@sci.ui.ac.ir (M. Motovali-bashi).

https://doi.org/10.1016/j.aca.2019.09.037
0003-2670/© 2019 Elsevier B.V. All rights reserved.
 H. Rezaei et al. / Analytica Chimica Acta 1092 (2019) 66e74 67

biosensor using QDs@ZIF-8 particles as signal tags is about 15 times that of a biosensor using QDs as
signal tags. Several conditions of determination like incubation time for labeling and capture probe, HCl
leaching time, and reaction time of CHA were optimized. Under the optimized conditions, this assay
allowed the detection of target miRs in the range of 1 fM to 1 mM with detection limits of 0.19 fM and
0.28 fM for miR-1246 and miR-4521 (S/N ¼ 3). The biosensor can discriminate complementary, 1-base
mismatched and non-complementary sequences quite well, according to the catalytic hairpin assem-
bly. Furthermore, the biosensor was utilized efficiently for quick and direct analysis of microRNAs in
human serum. Thus, this tactic presents an innovative platform for microRNAs expression profiling in
biomedical research and clinical diagnosis.
© 2019 Elsevier B.V. All rights reserved.

1. Introduction methods, chemiluminescence technology, and capillary electro-

Hemophilia A (HA) is an X-linked bleeding disorder that in-
fluences 1 in 5000e10000 live male birth and is caused by deletion
and/or mutation in the coagulation factor VIII (FVIII) gene [1].
This X-linked bleeding disorder can be treated in an effective
way by infusing plasma-derived-or recombinant-FVIII [2] quite
regularly. However; the expansion of anti-drug antibodies which
inhibits FVIII function (inhibitors) and resides in 30% of patients, is
an important obstacle for the treatment being fruitful [3,4].
Although there have been lots of developments in the FVIII
drug-products, like the advent of recombinant and bioengineered
products since twenty years ago, the outbreak of inhibitors among
HA patients [5] has faced no reduction. Some genetics factors that
are affiliated with the risk of inhibitor expansion [6] include posi-
tive family history of inhibitors, ethnicity, FVIII genotype and
certain polymorphisms in immune modulatory genes (IL-10 and
TNFa).
In addition, quantities of non-genetics factors that affect the
sensitivity of patients to expand inhibitors are as; age at first
treatment, intensity of treatment, continuous infusion [7].
Despite the main unpredictability of this intricacy, the infor-
mation of several major risk factors are causing the classification of
individual patient risk of inhibitor development at the start of
replacement therapy and development in prohibition tactics.
The balanced expression of genes encoding cytokines, tran-
scription factors or other regulatory proteins and also microRNAs
(miRNAs) regulate the expansion and application of immune sys-
tem. MiRNAs act exactly like a part of complicated gene regulatory
networks [8,9] that are endogenous single-stranded non-coding
RNAs, 18e25 nucleotide-long which mediate transcriptional and
post-transcriptional control of target gene expression. Altered
expression of miRNAs in HA patients being compared to control,
suggest that miRNAs can deliver modern clinical, and non-invasive
biomarkers being used for the diagnosis, prognosis or effective
remedy of HA. This issue has been proved by several findings and
reports [10,11]. MiR-1246, and miR-4521, which were described
between HA patients with inhibitor development (HAI), hemo-
philia A patients without inhibitor development (HAWI), and
control (C), are two relative miRNAs that have been displayed to be
affiliated with HA [12].
In order to detect the miRNAs, those analysis that are done by
the use of formal techniques like RNA sequencing, quantitative
Reverse-Transcriptase Polymerase Chain Reaction (qRT-PCR),
microarrays, and Northern blotting will have big challenges which
are compelled by low expression levels, high sequence similarity,
and their small size.
Therefore, in order to improve the sensitivity and flexibility of
detection, novel strategies like colorimetric measurement, fluo-
rescence detection, surface plasmon resonance, electrochemical
detection, bioluminescence technology, electrochemiluminescence
phoresis assays have been developed [13e19]. Since electro-
chemical (EC) biosensors have special features like easy utilization,
reasonable sensitivity, requiring few samples, non-toxic experi-
mental steps, short assay time, quick detection, low detection limit,
low cost, and appropriate operation, there have been more atten-
tion to them. Both miRNA labeling and label-free are involved in EC
techniques [20,21].
One of the most hopeful strategies by target DNA opening a DNA
hairpin and after that being released by other DNA hairpins to gain
the target recycling for signal amplification [22,23], which is called
catalytic hairpin assembly (CHA), has had great attentions recently.
CHA, as an enzyme-free amplification tactic, either is able to facil-
itate the detection conditions and reduce the costs, or to exhibit a
negligible background which shows that it is a proper method to
expand enzyme-free isothermal amplification strategies.
Ultrahigh porosity and large surface areas are provided in metal
organic frameworks (MOFs), which include inorganic metal ions/
clusters and organic ligands [24e29]. Since composite materials
represent superior properties to those of the individual compo-
nents for different functions, there have been special concerns to
the encapsulation of nanomaterials in MOFs to form composite
materials [30,31]. There are lots of fields, in which Quantum dots
(QDs) with unique electrical and optical properties are used such as
solar photon conversion, biological imaging, photocatalysis, and
optical sensors [32e34]. Several QDs have been encapsulated in
MOFs in order to improve the consistency and modulate the optical
properties of QDs [35]. In recent years, there have been lots of at-
tentions regarding the optical properties of QDs-encapsulated
MOFs, but the electrochemical application of QDs-encapsulated
MOFs has been studied scarcely.
Here in, an ultrasensitive electrochemical genosensor based on
Au nanoparticles, PbS and CdS QDs encapsulated ZIF-8 particles as
signal-amplifying tags, and CHA-induced target recycling is fabri-
cated for the simultaneous detection of miR-1246 and miR-4521 in
one single experiment (Scheme 1). The improvement in electrode
conductivity and the rise in its active surface can be resulted from
AuNPs. In order to form H1-T1 and H2-T2 dsDNAs, targets T1 and T2
hybridized with hairpins H1 and H2. This can open the hairpins H3
and H4 for the formations of H1eH3 and H2eH4 dsDNAs.
Meantime, to make lots of H1eH3 and H2eH4 dsDNA for signal
amplification, the targets were released to take part in the next
cycle. After that, the part of the H1eH3 and H2eH4 dsDNAs that
has been emerged recently can bind with signaling DNA1 (S1) and
signaling DNA2 (S2) which labeled the PbS@ZIF-8 and CdS@ZIF-8.
HCl leaching can dissolve these signal-amplifying tags and release
Pb(II) and Cd(II) ions in order to enable the detection of corre-
sponding target miRs by differential pulse voltammetry (DPV). Due
to the encapsulation of a big number of QDs in each QDs@ZIF-8
label, the quantity of QDs labeled to each target miRs had a
massive rise. So, the electrochemical signals were amplified
68 H. Rezaei et al. / Analytica Chimica Acta 1092 (2019) 66e74
Scheme 1. Schematic diagram of the fabrication process of a biosensor.
enormously with the use of QDs@ZIF-8 particles as signal tags. In
situ growth of ZIF-8 in the presence of QDs prepared QDs@ZIF-8
muti-core-shell particles that were proved by high resolution
transmission electron microscopy (HRTEM), powder X-ray diffrac-
tion (PXRD), energy dispersive X-ray (EDX) elemental mapping,
atomic absorption spectrometry (AAS), and fluorescence
spectroscopy.
The biosensor can distinguish complementary and base mis-
matched sequences quite well according to the locked nucleic acids
(LNA) incorporated probe and catalytic hairpin assembly. As far as it
is known, there has been no report on biosensor expansion for the
simultaneous detection of these biomarkers. Accordingly, the se-
lective proposed biosensor may be highly useful for treatment ef-
ficacy of HA and control of inhibitors expression.
2. Experimental
2.1. Instrumentation and reagents
All the miRNAs, LNAs and DNAs oligonucleotides of the sug-
gested survey (Table 1) were synthesized by Bioneer Corporation
(South Korea). In order to utilize oligonucleotides as stock
Table 1
All DNA and miRNA sequences used in the experiment.
Name
miR-1246 (T1)
miR-4521 (T2)
hairpin probe H1
hairpin probe H2
hairpin probe H3
hairpin probe H4
Signaling DNA1(S1)
Signaling DNA2 (S2)
single-base mismatch miRNA-1246
single-base mismatch miRNA-4521
miR-21
solutions, they have been diluted using ultrapure water and kept in
a refrigerator.
Streptavidin protein (SA), cadmium chloride (CdCl2), lead chlo-
ride (PbCl2), sodium sulfide (Na2S), glutaraldehyde (GLU), alumina,
Sodium chloride (NaCl), Tetrachloroauric(III) acid (HAuCl4), and
hexanethiol (96%, HT) were purchased from Sigma-Aldrich. Strep-
tavidin protein (SA), cadmium chloride (CdCl2), lead chloride (PbCl2),
sodium sulfide (Na2S), glutaraldehyde (GLU), alumina, Sodium
chloride (NaCl), Tetrachloroauric(III) acid (HAuCl4), and hexanethiol
(96%, HT) were purchased from Sigma-Aldrich. Mercaptoacetic acid,
sodium hydroxide (NaOH), hydrochloric acid (HCl), ethanol, 2-
methylimidazole, zinc acetate (Zn(Ac)2$H2O), p-aminobenzoic acid,
1-(3-(dimethylamino)-propyl)-3-ethylcarbodiimide hydrochloride
(EDC), N-hydroxysuccinimide (NHS), bovine serum albumin (BSA),
branched polyethylenimine (PEI) have been achieved from Merck.
The procedure, through which phosphate buffer saline (PBS) with
different pH values was obtained, includes utilizing the mixture of
the stock solutions of NaH2PO4 and Na2HPO4 and then adjusting the
pH with 0.1 M NaOH and H3PO4. Milli-Q ultrapure water (Millipore,
18 MU cm) was being used all over. All reagents were analytical
grade and without further purification.
TEM images were achieved utilizing a Philips TECNAI F-30
sequence (50 e30 )
AAUGGAUUUUUGGAGCAGG
GCUAAGGAAGUCCUGUGCUCAG
TTTTGGAGCAGGATGGACATGGACCTGCTCCAAAAATCCATTAGTe(CH2)6eSH
AGTCCTGTGCUCAGTGAGTCATCTCTGAGCACAGGACTTCCTTAGCAGTe(CH2)6eSH
ATGGACATGGATTTTGGAGCAGGTCCATGTCCATCCTGCTGAAGGAGCGACT
TGAGTCATCTAGTCCTGTGCTCAGAGATGACTCACTGAGCAGATTCCACAAAC
NH2-(CH2)6-TTAGTCGCTCCT
NH2-(CH2)6-TTATTTGTGGAA
AAUGGAGUUUUGGAGCAGG
GCUAAGAAAGUCCUGUGCUCAG
UAGCUUAUCAGACUGAUGUUGA
 H. Rezaei et al. / Analytica Chimica Acta 1092 (2019) 66e74
transmission electron microscope. Fourier transform infrared
(FTIR) spectra were recorded on AVATAR 360 FT-IR spectropho-
tometer in the range of 4000e5000 cm1. Powder X-ray diffraction
(PXRD) patterns were recorded on a Bruker D8 Advance X-ray
diffractometer using Cu Ka radiation (l ¼ 1.5418 A), in which the X-
ray tube was operated at 40 kV and 40 mA. Scanning electron mi-
croscopy (SEM) images were achieved using a JSM-6360 field
emission scanning electron microscope. Fluorescence spectra were
recorded using an F-4600 fluorescence spectrometer (Hitachi,
Japan). AAS measurements were done on a WFX-110A Atomic Ab-
sorption Spectrophotometer. The performance of all electro-
chemical experiments was done on a mAutolab III (Eco Chemie B.V.)
potentiostat/galvanostat using NOVA 1.8 software. A modified
glassy carbon electrode (GCE, diameter 4 mm) as the working
electrode (WE), a thin Pt wire as the counter electrode, and a KCl-
saturated calomel electrode (SCE) as the reference electrode (RE)
are the contents of the three-electrode system which was utilized.
2.2. Preparation of QDs and QDs@ZIF-8 particles
PbS QDs (or CdS QDs) were prepared following the reported
synthesis strategy. Briefly, a pure mercaptoacetic acid (MPA) liquid
was injected drop by drop to 30 mL of 0.01 M aqueous PbCl2 (or
CdCl2) under drastic stirring conditional the solution pH changed to
2.0. Also when another 35 min stirring was over, 1 M aqueous NaOH
was injected dropwise to this solution under drastic stirring con-
dition till the solution pH turns to 6.0. 30 mL of 5 mM aqueous Na2S
was appended drop by drop to the very solution under the
mentioned condition and the mixture was being stirred persis-
tently for a period of 60 min. In the end, the MPA-PbS QDs (or MPA-
CdS QDs), that were precipitated by ethanol, were dried in a vac-
uum freeze dryer after they were gathered with the use of centri-
fugation and cleaned by ethanol-water solution three times. 30 mg
of MPA-PbS QDs (or MPA-CdS QDs) were ultrasonically dispersed in
6 mL of 1.5 M 2-methylimidazole aqueous solution in order to
produce PbS@ZIF-8 (or CdS@ZIF-8) particles, after that 1.5 mL of
0.4 M zinc acetate aqueous solution was augmented to the
mentioned solution. After 45 min reaction, the products of
PbS@ZIF-8 (or CdS@ZIF-8) particles gathered by centrifugation at
5000 rpm, cleaned with water and dried in a vacuum freeze dryer.
2.3. Preparation of PbS QDs-S1, CdS QDs-S2, PbS@ZIF-8-S1 and
CdS@ZIF-8-S2 particles
The procedure of preparation of PbS@ZIF-8@PEI (or CdS@ZIF-
8@PEI) particles for inserting amino groups on the surfaces of
PbS@ZIF-8 (or CdS@ZIF-8) particles is as below:
200 mL of 0.1 M PBS (pH 7.4) which contains 1 wt% PEI, was
injected to 1 mL of PBS that includes 2 mg mL-1 PbS@ZIF-8 (or
CdS@ZIF-8). PbS@ZIF-8@PEI (or CdS@ZIF-8@PEI) particles were
achieved by stirring the blend for 60 min continuously.
PbS@ZIF-8-S1 (or CdS@ZIF-8-S2) particles were provided as
below:
The PbS@ZIF-8@PEI (or CdS@ZIF-8@PEI) particles were collected
by centrifugation, cleaned with PBS, and dispersed in 1 mL of PBS
including 0.25 wt% glutaraldehyde. After reaction for 30 min, the
products were gathered with the use of centrifugation, cleaned
with PBS, and dispersed in 0.5 mL PBS. Afterwards, 0.5 mL of PBS
including signaling DNA1 (or signaling DNA2) (1 mg mL1) was
mixed with the above dispersion. After reaction for 2 h (DNA in-
cubation) was done, PbS@ZIF-8-S1 (or CdS@ZIF-8-S2) were gath-
ered by centrifugation, cleaned using PBS, and dispersed in 0.5 mL
of PBS containing 1 wt% BSA. After mild shaking for 30 min, the
PbS@ZIF-8-S1 (or CdS@ZIF-8-S2) particles blocked by BSA were
gathered with the use of centrifugation, cleaned using PBS, and
69
dispersed in 0.5 mL of PBS, stored at 4  C for future utilization.
In addition, to activate facile modification of signaling DNAs on
QDs mercaptoacetic acid becomes capped in QDs. The procedure of
providing PbS QDs-S1 (or CdS QDs-S2) is as follow:
2 mg of MPA-PbS QDs (or MPA-CdS QDs) became dispersed in
1 mL of PBS containing 400 mM EDC and 100 mM NHS. After that,
the mixture, which was being stirred intensively for 60 min, was
collected by centrifugation and cleaned by PBS and finally
dispersed in 1 mL of PBS containing of 100 mg mL1 signaling DNA1
(or signaling DNA2). After intensive shaking for another 6 h, PbS
QDs-S1 (or CdS QDs-S2) were gathered by centrifugation, cleaned
with PBS, and dispersed in 1 mL of PBS including 1 wt% BSA. After
mild shaking for 30 min, PbS QDs-S1 (or CdS QDs-S2) blocked by
BSA were gathered with the use of centrifugation, cleaned with PBS,
and dispersed in 1 mL of PBS, kept at 4  C for future use.
2.4. Preparation of the functionalized electrode
In order to achieve a mirror-like surface, 0.3 mm alumina slurry
was used for polishing the glassy carbon electrode (GCE), and then
water-ethanol-water was utilized for washing it and after that it
was kept in room temperature for being dry. Thereupon, AuNPs
were used for modifying glassy carbon electrode based on the
method suggested by Arotiba et al. [36]. Shortly, GCE was modified
with 5 mM of HAuCl4 solutions by cycling the potential
from 400 mV to 1100 mV for 10 cycles at a scan rate 50 mV s1.
Afterwards 10 mL H1 (3 mM) and 10 mL H1 (3 mM) incubated it for 2 h.
In the end, 10 mL HT (1.5 mM) was used to block the modified GCE
for 40 min. With the help of various concentrations of target
microRNAs, 20 mL H3 (3 mM) and 20 mL H4 (3 mM) were incubated at
the modified GCE for 100 min at room temperature, in order to
achieve lots of H1eH3 and H2eH4 dsDNAs. After rinsing with
double distilled water, 20 mL of PBS containing 4 mg mL1 PbS@ZIF-
8-S1 and CdS@ZIF-8-S2 hybridized with single stranded fragment
of H1eH3 and H2eH4 dsDNAs at 37  C for 90 min.
The stages of fabricating a biosensor that utilizes QDs as signal
tags were the same as the stages of fabricating other biosensors
that apply QDs@ZIF-8 as signal tags, but with this difference that
PbS@ZIF-8-S1 and CdS@ZIF-8-S2 were replaced by PbS QDs-S1 and
CdS QDs-S2.
2.5. Electrochemical measurements
The modified electrode at different fabrication steps were
characterized by electrochemical impedance spectroscopy using
5.0 mM [Fe(CN)6]4-/3- as the probe. Electrochemical impedance
spectroscopy that used 5.0 mM [Fe(CN)6]4-/3- as the probe charac-
terized the modified electrode at various fabrication steps. It was
performed at an AC voltage amplitude of 5 mV in the frequency
range from 1 MHz to 0.01 Hz. As shown in Fig. 3, DPV was accom-
plished to quantitatively detect target miRs. For releasing Pb(II) and
Cd(II) ions from the tags, 5 mL of 0.1 M HCl aqueous solution was
injected to the electrode for 7 min and after that 15 mL of 0.20 M
acetate buffer (pH 5) was dropped on the electrode. On the way
forward, two depositions of potential and time, respectively 1.0 V
and 1 min were implemented in the electrode.
Differential pulse stripping voltammograms were recorded
between 1.0 V and 0.4 V, with pulse amplitude of 50 mV and
pulse frequency of 15 Hz. It is believed that [37], DPV accomplished
in small volume of electrolyte solution can massively accelerate
electrochemical signals because of the efficient capture of Pb(II)
and Cd(II) ions from electrolyte solution.
70 H. Rezaei et al. / Analytica Chimica Acta 1092 (2019) 66e74
3. Results and discussion
3.1. Characterizations of the prepared QDs@ZIF-8
QDs were provided by the use of mercaptoacetic acid as capping
agent. The formation of mono dispersed spherical particles with an
average diameter of 6.7 nm and 6.4 nm respectively for PbS QDs
and CdS QDs are revealed in TEM image in Fig. 1a and b. Clear lattice
fringes that indicate QDs are highly crystalline are shown by
HRTEM images in the inset of Fig. 1a and b. The lattices spacing are
0.34 nm and 0.335 nm, matching to the (111) plane of cubic CdS QDs
and PbS QDs, respectively.
FTIR spectroscopy confirmed the presence of mercaptoacetic
acid on the surfaces of QDs. As shown in Fig. 1c, the intense ab-
sorption peaks are seen at 3423 cm1 for CdS QDs and 3465 cm1
for PbS QDs originated from the hydroxyl bond stretching vibration
of eCOOH group and expanded hydroxyl bond can be attributed to
the solvent [38]. The peaks at 2916 cm1 for CdS QDs and
2917 cm1 for PbS QDs are related to eCH2 asymmetric stretching
vibration modes [39]. Two absorption peaks associated with sym-
metric stretching vibration (1396 cm1 for CdS QDs and 1411 cm1
for PbS QDs) and asymmetric stretching vibration (1559 cm1 for
CdS QDs and 1553 cm1 for PbS QDs) of carboxylate groups, which
reveal the existence of mercaptoacetic acid on the surfaces of QDs.
Also, the absence of distinct SeH characteristic band of mercapto-
acetic acid at 2600e2550 cm1 proves the capping of QDs which is
because of covalent bond between metals of QDs and sulfur of
mercaptoacetic acid [40].
QDs@ZIF-8 particles were achieved by in situ growth of ZIF-8 in
the presence of QDs. Zn (II) ions can be coordinated by both 2-
methylimidazole and COOH groups (on the surfaces of QDs)
which enable the encapsulation of QDs in ZIF-8 particles.
As shown in Fig. 2, the pure QDs and the composite had almost
the same fluorescence spectra with emission peaks at 458 nm and
920 nm upon excitation at 320 nm and 550 nm for CdS QDs and PbS
QDs, respectively. However, pure ZIF-8 had no visible peak, which
substantiated that the quantum dots were incorporated into ZIF-8.
In addition, the synthesized QDs@ZIF-8 composites and the mix-
tures of QDs and ZIF-8 were all washed with large amount of water
for several times to further confirm that the quantum dots were
incorporated into ZIF-8, rather than adsorbed into ZIF-8. After
comprehensive rinsing, no obvious fluorescence peaks were seen
from the mixtures of QDs and ZIF-8, while the QDs@ZIF-8 com-
posites still remained an intense fluorescence peaks, which were
Fig. 1. TEM image (a) and HRTEM image (inset of a) of MPA-CdS QDs, TEM image (b) and HRTEM image (inset of b) of MPA-PbS QDs, FTIR spectrum of MPA-CdS QDs and MPA-PbS
QDs (c).
approximately the same as that before they are washed. Further-
more, the fluorescence stability of QDs@ZIF-8 composites was also
considered by evaluating their fluorescence intensity after 15 days,
and almost no considerable fluorescence peaks quenching were
seen, that recommends their preferable stability.
The size and shape of QDs@ZIF-8 particles were characterized by
SEM and TEM, revealing that both Cd@ZIF-8 (Fig. 3a) and PbS@ZIF-8
(Fig. 3b) particles have regular rhombic dodecahedron shape. The
average diameter of CdS@ZIF-8 and PbS@ZIF-8 are ca. 680 and
710 nm. In addition, the Clear lattice fringes of CdS and Pbs QDs
were shown by HRTEM image of CdS@ZIF-8 (Fig. 3c) and PbS@ZIF-8
(Fig. 3d), this issue confirms that QDs were successfully encapsu-
lated in ZIF-8 particles.
The EDX elemental mapping analysis results, that are shown in
Fig. 3e and f, illustrate that C, N, Zn, S, and Pb in the case of PbS@ZIF-
8 or Cd in the case of CdS@ZIF-8 are uniformly distributed in ZIF-8
particles. This issue verifies that a big quantity of PbS QDs and CdS
QDs, are encapsulated in ZIF-8 particles. The density of pure ZIF-8
(0.95 g cm3) is lower than the density of PbS@ZIF-8 and
CdS@ZIF-8 with 1.18 and 1.11 g cm3 [41]. The contents of Cd and Pb
in CdS@ZIF-8 and PbS@ZIF-8, that ASS quantitatively measured
them, are 9.41 and 8.74 wt%.
Powder X-ray diffraction patterns of ZIF-8 and QDs@ZIF-8 are
shown in Fig. 3g. The PXRD pattern of ZIF-8 corresponded
adequately with reported literature [42]. The characteristic peaks of
ZIF-8 at 2q values of 7.12, 10.17, 12.53, 14.84, 16.31, and 17.71 match
respectively to the planes (011), (002), (112), (022), (013), and (222)
index planes [43]. No change was seen in the PXRD pattern of
QDs@ZIF-8 as compared to ZIF-8 revealing the framework stability
and minimum effect on its crystallinity.
3.2. Electrochemical characterization of the proposed biosensor
EIS of the fabrication process of the biosensor in 5 mM [Fe(CN)
6]3/4 (containing 0.1 M KCl) is presented in Fig. 4. The bare GCE
revealed a small semicircle diameter (curve a). Afterwards, as it is
presented in curve b, there has been a dramatic fall in the semicircle
diameter with AuNPs electrodepositing on the GCE. While H1 and
H2 were immobilizing on the GCE, a notable rise happened in
semicircle diameter (curve c). The reason of this phenomena refers
to this issue that H1 and H2 acted as a nonconductor for blocking
the electron transfer due to the electrostatic repulsion between
negative charges of H1 and H2 phosphate backbone and the
[Fe(CN)6]3-/4ions. Since the mixture of T1, T2, H3, and H4 were
 H. Rezaei et al. / Analytica Chimica Acta 1092 (2019) 66e74 71

Fig. 2. Fluorescence emission spectra of QDs, ZIF-8, QDs@ZIF-8, QDs@ZIF-8 after 15 days, the washed synthesized QDs/CDs@ZIF-8 composite, and the washed mixture of QDs and
QDs@ZIF-8 for CdS@ZIF-8 (a) and PbS@ZIF-8 (b).

Fig. 3. SEM image (a) and TEM image (inset of a) of CdS@ZIF-8 particles, SEM image (b) and TEM image (inset of b) of PbS@ZIF-8 particles, HRTEM image of CdS@ZIF-8 particles (c),
HRTEM image of PbS@ZIF-8 particles (d), EDX elemental mapping of CdS@ZIF-8 particles (e), EDX elemental mapping of PbS@ZIF-8 particles (f), and PXRX patterns of ZIF-8,
CdS@ZIF-8, PbS@ZIF-8.

incubated on the modified GCE (curve d); as a result the semicircle
diameter rose expectedly. Finally, it was figured out that there
happened a rise in Rct value with the formation of QDs@ZIF-8 on
the modified electrode (curve e). This issue showed that the
immobilizing of QDs@ZIF-8 was done prosperously, and the rise in
impedance value observed, was because the framework of
QDs@ZIF-8 hindered the access of the redox probe to the electrode
surface. The prosperous assemble process of the biosensor was
confirmed by all these results that matched completely with the
rationale.
3.3. Optimum condition of reaction
methylimidazole aqueous solution in order to produce QDs@ZIF-8
particles. The maximum current response belonged to QDs@ZIF-8
using 30 gr QDs in its synthesis process. In addition, the quantity
of QDs in each QDs@ZIF-8 particle can be accounted based on the
equation as below: r1V1w ¼ r2V2n, where w is the content QDs, r1 is
the density of QDs@ZIF-8, V1 is volume of QDs@ZIF-8, V2 is volume
of QDs, r2 is the density of QDs, and n is the number of QDs in each
QDs@ZIF-8 particle. Thus, in optimum condition, it can be
concluded that each PbS@ZIF-8 particle includes 8.45  106 PbS
QDs and each CdS@ZIF-8 particle includes 3.96  106 CdS QDs.
Furthermore, as it is shown in Table 2, the experiment condi-
tions were optimized for obtaining the maximum current response.

The intensity of the signal will increase as the number of QDs in 3.4. Analytical performance
the electrode surface rises. So, different amounts of QDs from 5 gr to
40 gr were ultrasonically dispersed in 6 mL of 1.5 M 2- Under optimized assay conditions, the peak currents increased
72 H. Rezaei et al. / Analytica Chimica Acta 1092 (2019) 66e74

Therefore, the DPV signals have been amplified significantly with

the use of QDs@ZIF-8 particles as signal tags. The wide linear ranges
for both analytes were also very notable for practical application.
The subset of the detection range of the proposed method is the
ordinary levels of circulating microRNAs in serum that are from 200
aM to 20 pM [44].
A biosensor was also fabricated using QDs as signal tags. As it is
shown in Fig. 5b, the linear range for miR-1246 detection was from
0.05 pM to 1.0 mM, with a linear regression equation of i ¼ 0.305 log
CmiR-1246þ 5.11(R2 ¼ 0.9967) and also the linear range for miR-4521
detection was from 0.05 pM to 1.0 mM, with a linear regression
equation of i ¼ 0.252 log CmiR-4521þ 3.215(R2 ¼ 0.9949). The slope of
the regression curve (sensitivity) of the biosensor that utilizes
QDs@ZIF-8 as signal tags is about 15 times that of the other one that
utilizes QDs as signal tags.
Fig. 4. The fabrication process of the biosensor: EIS of (a) bare GCE, (b) AuNPs/GCE, (c)
H1/H2/AuNPs/GCE, (d) H1eH3/H2eH4/AuNPs/GCE, (e) H1eH3ePbS@ZIF-8/ 3.5. Reproducibility, repeatability, and long-term stability
H2eH4eCdS@ZIF-8/AuNPs/GCE.

Two important features of the biosensor, reproducibility and

Table 2
Optimum condition of reaction.
incubation time for capture probe
incubation time for QDs@ZIF-8 labeling
HCl leaching time
potential for ion deposition for DPV measurements
ion deposition time for DPV measurements
solution pH for DPV measurements
reaction time of CHA
with the increasing concentration of analytes, as shown in Fig. 5a.
Acceptable linear relationships between the peak currents and the
logarithm of the analytes concentration were displayed by the
calibration plots (Fig. 5b).
For miR-1246, the linear regression equation was i ¼ 4.429 log
CmiR-1246þ 30.75 in the range from 1.0 fM to 1.0 mM with a corre-
lation coefficient of R2 ¼ 0.9959 and also for miR-4521, the linear
regression equation was i ¼ 3.743 log CmiR-4521þ 26.03 in the range
from 1.0 fM to 1.0 mM with a correlation coefficient of R2 ¼ 0.9948.
The detection limits for miR-1246 and miR-4521 were 0.19 fM, and
0.28 fM(S/N ¼ 3), respectively. The low detection limits are due to a
great quantity of QDs that were encapsulated in each QDs@ZIF-8
label, so the number of QDs labeled to each miR rose massively.
repeatability, have been evaluated.
The reproducibility of the responses achieved for 1pM of miR-
1246 and miR-4521 with various biosensors constructed, using
optimal condition
the same protocol, was examined. Voltametric measurements that
120 min were done through 6 biosensors yielded relative standard deviation
90 min
7 min
(RSD) values of 5.1% and 4.4% for miR-1246 and miR-4521.
1.0 V Furthermore, appropriate repeatability was presented by the
1 min fabricated biosensor. The RSD value (n ¼ 6) for the current response
5 to target miRs (1pM) achieved by the biosensors were 6.2% and 5.2%
100 min
for miR-1246 and miR-4521, respectively.
These values confirmed that the present biosensor preparation
protocol has acceptable reliability.
Furthermore, the fabricated biosensor was stored at 4  C for 25
days; it remained about 85% of initial current responses for both
target miRs. The gradual deactivation of the immobilized bio-
molecules can be the reason of the fall in current responses. The
perfect stability of the biosensor was detected by this finding.
3.6. Specificity
Due to the sequence homology of miR family members, an
important challenge in the analysis of miR family members is in the
process of obtaining separation of the target miRs from other miRs
and detecting them in complex blends selectively. To evaluate the
selectivity of the biosensor, the current values measured for the
synthetic targets, sequences with just one central base mismatched
(1-m) with respect to the target miRs (based underlined in Table 1),
blends of the fully non-complementary (NC) sequences containing
or not containing the synthetic targets (each at a concentration of
1pM were compared to each other). Apart from miR-4521 in the
case of miR-1246 detection, and miR-1246 in the case of miR-4521
detection, miR-21 was assayed as the NC sequence. The current of a
fully complementary targets were about 10.8 times higher than the
single base mismatch sequences, and the response of the blends of
the fully non-complementary sequences were almost relinquished,
(Fig. 6). In the end, these findings present this issue that the sensor
had high sequence specificity and excellent discrimination for
similar miRNAs.

3.7. MicroRNA detection in serum samples

To explain the great utility of this approach, a series of synthetic

miR-1246 and miR-4521 at different concentrations (5 fM, 50 fM,
and 0.5 pM) will be spiked into healthy human blood serum to
Fig. 5. Differential pulse voltammograms (a) and standard curve (b) for the detection achieve the electrochemical signals. The actual condition of the
of miR-1246 and miR-4521 using PsS@ZIF-8 and CdS@ZIF-8 particles as signal tags. miRNAs sample can be presented by the electrochemical response
 H. Rezaei et al. / Analytica Chimica Acta 1092 (2019) 66e74
Fig. 6. (A) DPV signals in the presence of miRNA-1246, 1-base mismatch miRNA-1246,
and non-complementary (NC) sequences of miRNAs. (B) DPV signals in the presence of
miRNA-4521, 1-basemismatch miRNA-4521, and non-complementary sequences of
miRNAs (all at a concentration of 1012 M).
of miR-1246 and miR-4521 (Table 3), which shows significant po-
tential for the miRNAs analysis in clinical diagnosis.
4. Conclusion
In summary, an ultrasensitive electrochemical biosensor was
fabricated according to AuNPs, QDs@ZIF-8, and CHA for signal
application for the simultaneous detection of two HA biomarkers.
Firstly, the sensitivity of the proposed biosensor, that utilizes
QDs@ZIF-8 as signal tags, was 15 times that of the conventional
biosensor, which utilizes QDs as signal tags, because of the great
signal-amplifying effect. Secondly, according to the enzyme-free
target recycling for signal amplification, the electrochemical
biosensor presented quick and sensitive detection of target miRs,
which can eliminate some detriments of protein enzymes to
further expand signal response. The biosensor presents great
analytical performance and the most significant aim of hiring it was
to evaluate the endogenous levels of both target miRs directly in
human blood serum. Therefore, based on the results of this
research, it can be concluded that the simultaneous detection of
multiple miRs can be done using a mixture of multiplexed detec-
tion and different RNA probes.
As a conclusion, the proposed biosensor prepared an extended
linear range and a low detection limit for miR-1246 and miR-4521
detections, thanks to the signal amplification strategy. This issue
shows that a novel avenue for multi miRs bioanalysis with highly
important potential function in clinical diagnosis has been created.
Declaration of competing interest
The authors declare that they have no known competing
financial interests or personal relationships that could have
appeared to influence the work reported in this paper.
Table 3
The reliability of the proposed method.
Spiked (M) miR-1246 miR-4521
Measured (M) Recovery Spiked (M) Measured (M) Recovery
rate (%)
5.0  1013
5.21  10 13
104 13
5.0  10 5.08  1013
5.0  1014 5.34  1014 107 5.0  1014 5.52  1014
15
5.0  10 5.75  1015 115 5.0  10 15
5.67  1015
73
Acknowledgment
The authors thank from University of Isfahan (Iran) for financial
supports of this work.
References
[1] C. Witmer, G. Young, Factor VIII inhibitors in hemophilia A: rationale and
latest evidence, Ther. Adv. Hematol. 4 (2013) 59e72.
[2] D. Lillicrap, Improvements in Factor Concentrates Current Opinion in Hema-
tology, vol. 17, 2010, pp. 393e397.
[3] R.A. Higgins, A.J. Goodwin, Automated assays for von Willebrand factor ac-
tivity, Am. J. Hematol. 94 (2019) 496e503.
[4] K.Y. Yoo, S.C. Joo, Y.M. Choi, Long-term course of anti-factor VIII antibody in
patients with hemophilia A at a single center, Blood Res. 51 (2016) 37e43.
[5] S.C. Gouw, et al., F8 gene mutation type and inhibitor development in patients
with severe hemophilia A: systematic review and meta-analysis, Blood 119
(2012) 2922e2934.
[6] A.B. Payne, C.H. Miller, F.M. Kelly, J. Michael Soucie, W. Craig Hooper, The CDC
Hemophilia A Mutation Project (CHAMP) Mutation List: a New Online
Resource Human Mutation, vol. 34, 2013, pp. E2382eE2392.
[7] J. Astermark, et al., Non-genetic risk factors and the development of inhibitors
in haemophilia: a comprehensive review and consensus report, Haemophilia
16 (2010) 747e766.
[8] S. Grosswendt, N. Rajewsky, Essentials of miRNA-dependent control of mRNA
translation and decay, miRNA targeting principles, and methods for target
identification, in: Essentials of Noncoding RNA in Neuroscience, Elsevier,
2017, pp. 19e38.
[9] B. Simonson, S. Das, MicroRNA therapeutics: the next magic bullet? Mini Rev.
Med. Chem. 15 (2015) 467e474.
[10] S. Arshad, A. Singh, N.P. Awasthi, S. Kumari, N. Husain, Clinicopathological
parameters influencing inhibitor development in patients with hemophilia A
receiving on-demand therapy, Ther. Adv. Hematol. 9 (2018) 213e226, https://
doi.org/10.1177/2040620718785363.
[11] S. Hassan, A. Cannavo , S. Gouw, F.R. Rosendaal, J. van der Bom, Factor VIII
products and inhibitor development in previously treated patients with se-
vere or moderately severe hemophilia A: a systematic review, J. Thromb.
Haemost. 16 (2018) 1055e1068.
[12] T. Sarachana, et al., Small ncRNA expression-profiling of blood from hemo-
philia a patients identifies mir-1246 as a potential regulator of Factor 8 gene,
PLoS One 10 (2015), e0132433.
[13] C. Chen, et al., Real-time quantification of microRNAs by stem-loop RT-PCR,
Nucleic Acids Res. 33 (2005) e179, https://doi.org/10.1093/nar/gni178.
[14] C.G. Liu, et al., An oligonucleotide microchip for genome-wide microRNA
profiling in human and mouse tissues, Proc. Natl. Acad. Sci. U.S.A. 101 (2004)
9740e9744, https://doi.org/10.1073/pnas.0403293101.
[15] Y.Q. Liu, M. Zhang, B.C. Yin, B.C. Ye, Attomolar ultrasensitive microRNA
detection by DNA-scaffolded silver-nanocluster probe based on isothermal
amplification, Anal. Chem. 84 (2012) 5165e5169, https://doi.org/10.1021/
ac300483f.
[16] S. Takada, et al., Mouse microRNA profiles determined with a new and sen-
sitive cloning method, Nucleic Acids Res. 34 (2006) e115-e115.
[17] J.M. Thomson, J. Parker, C.M. Perou, S.M. Hammond, A custom microarray
platform for analysis of microRNA gene expression, Nat. Methods 1 (2004)
47e53, https://doi.org/10.1038/nmeth704.
[18] Y. Wen, et al., DNAzyme-based rolling-circle amplification DNA machine for
ultrasensitive analysis of microRNA in Drosophila larva, Anal. Chem. 84 (2012)
7664e7669, https://doi.org/10.1021/ac300616z.
[19] X. Zhu, X. Zhou, D. Xing, in: Label-free Detection of microRNA: Two-step
Signal Enhancement with a Hairpin-Probe-Based Graphene Fluorescence
Switch and Isothermal Amplification Chemistry vol. 19, Weinheim an der
Bergstrasse, Germany, 2013, pp. 5487e5494, https://doi.org/10.1002/
chem.201204605.
[20] Y. Cheng, J. Lei, Y. Chen, H. Ju, Highly selective detection of microRNA based on
distance-dependent electrochemiluminescence resonance energy transfer
between CdTe nanocrystals and Au nanoclusters, Biosens. Bioelectron. 51
(2014) 431e436, https://doi.org/10.1016/j.bios.2013.08.014.
[21] Z. Gao, H. Deng, W. Shen, Y. Ren, A Label-free Biosensor for Electrochemical
Detection of Femtomolar microRNAs Analytical Chemistry, vol. 85, 2013,
pp. 1624e1630, https://doi.org/10.1021/ac302883c.
[22] J. Zhang, et al., A ratiometric electrochemical biosensor for the exosomal
microRNAs detection based on bipedal DNA walkers propelled by locked
nucleic acid modified toehold mediate strand displacement reaction, Biosens.
Bioelectron. 102 (2018) 33e40, https://doi.org/10.1016/j.bios.2017.10.050.
[23] J. Zhao, Z. Ma, Ultrasensitive detection of prostate specific antigen by elec-
trochemical aptasensor using enzyme-free recycling amplification via target-
induced catalytic hairpin assembly, Biosens. Bioelectron. 102 (2018) 316e320,
https://doi.org/10.1016/j.bios.2017.11.044.
rate (%) [24] J. Lee, O.K. Farha, J. Roberts, K.A. Scheidt, S.T. Nguyen, J.T. Hupp, Metal-organic
102 framework materials as catalysts, Chem. Soc. Rev. 38 (2009) 1450e1459,
110 https://doi.org/10.1039/b807080f.
[25] P. Ling, J. Lei, L. Zhang, H. Ju, Porphyrin-encapsulated metal-organic frame-
113
works as mimetic catalysts for electrochemical DNA sensing via allosteric
74 H. Rezaei et al. / Analytica Chimica Acta 1092 (2019) 66e74
switch of hairpin, DNA Anal. Chem. 87 (2015) 3957e3963, https://doi.org/
10.1021/acs.analchem.5b00001.
[26] W. Ma, Q. Jiang, P. Yu, L. Yang, L. Mao, Zeolitic imidazolate framework-based
electrochemical biosensor for in vivo electrochemical measurements, Anal.
Chem. 85 (2013) 7550e7557, https://doi.org/10.1021/ac401576u.
[27] W.J. Shen, Y. Zhuo, Y.Q. Chai, R. Yuan, Cu-based metal-organic frameworks as
a catalyst to construct a ratiometric electrochemical aptasensor for sensitive
lipopolysaccharide, Detect. Anal. Chem. 87 (2015) 11345e11352, https://
doi.org/10.1021/acs.analchem.5b02694.
[28] Z. Wang, S.M. Cohen, Postsynthetic modification of metal-organic frame-
works, Chem. Soc. Rev. 38 (2009) 1315e1329, https://doi.org/10.1039/
b802258p.
[29] L. Chen, R. Luque, Y. Li, Controllable design of tunable nanostructures inside
metal-organic frameworks, Chem. Soc. Rev. 46 (2017) 4614e4630, https://
doi.org/10.1039/c6cs00537c.
[30] Q.L. Zhu, Q. Xu, Metal-organic framework composites, Chem. Soc. Rev. 43
(2014) 5468e5512, https://doi.org/10.1039/c3cs60472a.
[31] R.K. Dutta, A. Kumar, Highly sensitive and selective method for detecting
ultratrace levels of aqueous uranyl ions by strongly photoluminescent-
responsive amine-modified cadmium sulfide quantum dots, Anal. Chem. 88
(2016) 9071e9078, https://doi.org/10.1021/acs.analchem.6b01943.
[32] N. Hildebrandt, et al., Energy transfer with semiconductor quantum dot bio-
conjugates: a versatile platform for biosensing, Energy Harvesting, and Other
Developing Applications, Chem. Rev. 117 (2017) 536e711, https://doi.org/
10.1021/acs.chemrev.6b00030.
[33] X. Michalet, et al. (New York, NY), Quantum Dots for Live Cells, in Vivo Im-
aging, and Diagnostics Science, vol. 307, 2005, pp. 538e544, https://doi.org/
10.1126/science.1104274.
[34] S. Saha, G. Das, J. Thote, R. Banerjee, Photocatalytic metal-organic framework
from CdS quantum dot incubated luminescent metallohydrogel, J. Am. Chem.
Soc. 136 (2014) 14845e14851, https://doi.org/10.1021/ja509019k.
[35] W.W. Zhan, Q. Kuang, J.Z. Zhou, X.J. Kong, Z.X. Xie, L.S. Zheng, Semiconductor@
metal-organic framework core-shell heterostructures: a case of ZnO@ZIF-8
nanorods with selective photoelectrochemical response, J. Am. Chem. Soc.
135 (2013) 1926e1933, https://doi.org/10.1021/ja311085e.
[36] O.A. Arotiba, A. Ignaszak, R. Malgas, A. Al-Ahmed, P.G.L. Baker, S.F. Mapolie,
E.I. Iwuoha, An electrochemical DNA biosensor developed on novel multi-
nuclear nickel (II) salicylald imine metallodendrimer platform, Electrochim.
Acta 53 (2007) 1689e1696, https://doi.org/10.1016/j.electacta.2007.08.016.
[37] K. Saha, S.S. Agasti, C. Kim, X. Li, V.M. Rotello, Gold Nanoparticles in Chemical
and Biological Sensing Chemical Reviews, vol. 112, 2012, pp. 2739e2779,
https://doi.org/10.1021/cr2001178.
[38] D.S. Kumar, et al., Optical properties of colloidal aqueous synthesized 3
Mercaptopropionic Acid stabilized CdS quantum dots, AIP Conf. Proc. 1728
(2016), https://doi.org/10.1063/1.4946213, 020162-1e020162-4.
[39] S.S. Hosseini, et al., Facile microwave approach for synthesis of CdS quantum
dots as barrier layer for increasing dye-sensitized solar cells efficiency,
J. Mater. Sci. Mater. Electron. 27 (2016) 12240e12246, https://doi.org/
10.1007/s10854-016-5380-x.
[40] G. Kaur, et al., Size tuning of MAA capped CdSe and CdSe/CdS quantum dots
and their stability in different pH environments, Mater. Chem. Phys. 143
(2014) 514e523, https://doi.org/10.1016/j.matchemphys.2013.09.003.
[41] J.C. Tan, T.D. Bennett, A.K. Cheetham, Chemical structure, network topology,
and porosity effects on the mechanical properties of Zeolitic Imidazolate
Frameworks, Proc. Natl. Acad. Sci. U.S.A. 107 (2010) 9938e9943, https://
doi.org/10.1073/pnas.1003205107.
[42] J. Yao, et al., High-yield synthesis of zeolitic imidazolate frameworks from
stoichiometric metal and ligand precursor aqueous solutions at room tem-
perature, CrystEngComm 15 (2013) 3601e3606, https://doi.org/10.1039/
C3CE27093A.
[43] M. Zeng, Z. Chai, X. Deng, Q. Li, S. Feng, J. Wang, D. Xu, Coreshell CdS@ZIF-8
structures for improved selectivity in photocatalytic H2 generation from for-
mic acid, Nano Res. 9 (2016) 2729e2734, https://doi.org/10.1007/s12274-
016-1161-3.
[44] M. Tsujiura, et al., Circulating microRNAs in plasma of patients with gastric
cancers, Br. J. Canc. 102 (2010) 1174e1179, https://doi.org/10.1038/
sj.bjc.6605608.