ORIGINAL RESEARCH ARTICLE

Fasting inhibits hepatic stellate cells activation and potentiates anti-cancer activity
of Sorafenib in hepatocellular cancer cells†

Running title: Anti-fibrogenic and anti-cancer properties of fasting in liver cells

Oriana Lo Re1,2, Concetta Panebianco3, Stefania Porto4,5, Carlo Cervi5, Francesca Rappa6,7, Stefano

Di Biase8, Michele Caraglia4,9,10 , Valerio Pazienza3, Manlio Vinciguerra1,5*

1
Center for Translational Medicine (CTM), International Clinical Research Center (ICRC), St. Anne's
University Hospital, Brno, Czech Republic;
2
Department of Biology, Masaryk University, Brno, Czech Republic;
3
Gastroenterology Unit, IRCCS “Casa Sollievo della Sofferenza” Hospital, San Giovanni Rotondo,
Italy;
4
Department of Biochemistry, Biophysics and General Pathology, University of Campania Luigi
Vanvitelli, Naples, Italy;

†This article has been accepted for publication and undergone full peer review but has not been
through the copyediting, typesetting, pagination and proofreading process, which may lead to
differences between this version and the Version of Record. Please cite this article as doi:
[10.1002/jcp.25987]

Additional Supporting Information may be found in the online version of this article.

Received 13 March 2017; Revised 3 May 2017; Accepted 3 May 2017

Journal of Cellular Physiology
This article is protected by copyright. All rights reserved
DOI 10.1002/jcp.25987
This article is protected by copyright. All rights reserved
1
  

5
Institute for Liver and Digestive Health, University College London (UCL), Royal Free Hospital,
London, UK;
6
Department of Experimental Biomedicine and Clinical Neurosciences, Section of Human Anatomy,
University of Palermo, Palermo, Italy;
7
Euro-Mediterranean Institute of Science and Technology (IEMEST), Palermo, Italy;
8
Department of Microbiology, Immunology and Molecular Genetics, University of California, Los
Angeles (UCLA), CA, USA;
9
Sbarro Institute for Cancer Research and Molecular Medicine, Center for Biotechnology, College of
Science and Technology, Temple University, Philadelphia, PA, USA;
10
Department of Medicine, Surgery and Neuroscience, University of Siena, Siena, Italy.
*correspondence to:
Dr. Manlio Vinciguerra, PhD
International Clinical Research Center (ICRC), St. Anne's University Hospital.
E-mail: manlio.vinciguerra@fnusa.cz.

This article is protected by copyright. All rights reserved

2
  

Abstract

BACKGROUND: Hepatocellular carcinoma (HCC) has a poor outcome. Most HCCs develop in the

context of liver fibrosis and cirrhosis caused by chronic inflammation. Short-term fasting approaches

enhance the activity of chemotherapy in preclinical cancer models, other than HCC. Multi-tyrosine

kinase inhibitor Sorafenib is the mainstay of treatment in HCC. However, its benefit is frequently short-

lived. Whether fasting can alleviate liver fibrosis and whether combining fasting with Sorafenib is

beneficial remains unknown.

METHODS: 24 hour fasting (2% serum, 0.1% glucose)-induced changes on human hepatic stellate

cells (HSC) LX-2 proliferation/viability/cell cycle were assessed by MTT and flow cytometry.

Expression of lypolysaccharide (LPS)-induced activation markers (vimentin, SMA) was evaluated by

qPCR and immunoblotting. Liver fibrosis and inflammation were evaluated in a mouse model of

steatohepatitis exposed to cycles of fasting, by histological and biochemical analyses. 24 hours

fasting-induced changes were also analyzed on the proliferation/viability/glucose uptake of human

HCC cells exposed to Sorafenib. An expression panel of genes involved in survival, inflammation and

metabolism was examined by qPCR in HCC cells exposed to fasting and/or Sorafenib.

RESULTS: Fasting decreased the proliferation and the activation of HSC. Repeated cycles of short-

term starvation were safe in mice but did not improve fibrosis. Fasting synergized with Sorafenib in

hampering HCC cell growth and glucose uptake. Finally, fasting normalized the expression levels of

genes which are commonly altered by Sorafenib in HCC cells.

CONCLUSIONS: Fasting or fasting-mimicking diet diets should be evaluated in preclinical studies as a

mean to potentiate the activity of Sorafenib in clinical use. This article is protected by copyright. All

rights reserved

Keywords: hepatic stellate cells; hepatocellular carcinoma; Sorafenib, fasting.

This article is protected by copyright. All rights reserved

3
  

Introduction

Hepatocellular carcinoma (HCC) is the most common of the primary liver cancers. It is the fifth most

common malignancy worldwide and the third most frequent cause of cancer-related deaths (Bosetti et

al., 2014; El-Serag and Rudolph, 2007; Lafaro et al., 2015). The epidemiology of HCC is complex

reflecting, to a large extent, differences in levels of exposure to known predisposing factors such as

obesity-associated non-alcoholic fatty liver disease (NAFLD), the presence of alcohol, chronic infection

hepatitis B virus (HBV) and hepatitis C virus (HCV), and environmental toxin exposure. There is large

interest in understanding the genetic variation and epigenetic predisposition in developing HCC

(Balasus et al., 2016; Barchitta et al., 2014; Podrini et al., 2013). Non-resectable HCC has a poor

survival and is refractory to chemotherapeutic drugs, with the exception of small molecular inhibitor of

intracellular tyrosine and serine/threonine protein kinases such as Sorafenib (Bruix et al., 2017;

Mazzoccoli et al., 2015b). Regardless of the etiology, almost invariably HCC develops on a

background of liver cirrhosis, which in turn is a frequent consequence of the long clinical course of all

chronic liver diseases: it develops in presence of steatohepatitis, with oxidative stress, inflammation

and deposition of extracellular matrix (Sheedfar et al., 2013). The pro-fibrotic microenvironment of the

liver is the result of the interplay of multiple cell types, with the most important role for extracellular

matrix deposition represented by activated hepatic stellate cells (HSC) (Pinzani, 2015). Recent studies

uncovered a potential therapeutic role for Sorafenib that goes beyond HCC, and extends to selective

anti-fibrotic effects mediated through direct inhibition of activated HSC (Mazzoccoli et al., 2015a), a

step that may be important in chemoresistance (Azzariti et al., 2016). Despite Sorafenib being the

golden standard for HCC care since 2007 (Llovet et al., 2008), its therapeutic effects remain marginal,

as it only extends survival by a few months. HCC and any other cancer treatment has remained

relatively similar during the past 30 years with chemotherapy and/or radiotherapy in combination with

surgery remaining the standard therapies although novel therapies are slowly replacing or
This article is protected by copyright. All rights reserved
4
  

complementing the standard ones. The dietary recommendation of physicians for cancer patients

receiving chemotherapy is to increase calorie and protein intake. Short-term fasting (72h-96h) in

combination with chemotherapy demonstrated a wide range of powerful and beneficial effects able to

help prevent malignancies, to prolong healthspan, and increase the efficacy of cancer therapies: this

was proven true in animal studies and in few pilot human studies, for a variety of cancer types

(melanoma, glioma, breast cancer, pancreatic cancer, prostate, lung, leukemia) (Bianchi et al., 2015;

Block et al., 2015; Brandhorst et al., 2015; Brandhorst and Longo, 2016; D'Aronzo et al., 2015; Di

Biase et al., 2016; Di Biase and Longo, 2016; Lee et al., 2012; Safdie et al., 2012; Vernieri et al.,

2016), and corroborated by meta-analyses (Chen et al., 2016; Lv et al., 2014). However, if this

emerging intervention has the potential to be used to prevent and treat liver diseases and HCC is

unknown. In this study we have investigated the efficacy of short-term fasting in i) preventing the

activation of human HSC in vitro and steatohepatitis in an in vivo mouse model and ii) in sensitizing

HCC cells to the effects of Sorafenib on cell growth and viability, metabolism and gene expression.

Our data uncovered protecting roles of short term fasting in vitro against the HSC activation and HCC

proliferation. In vivo, short term fasting cycles were well tolerated in a mouse model of steatohepatitis,

without changes in histological and biochemical parameters.

Material and Methods

Cell cultures and treatments

Immortalised human hepatic stellate cell line (LX-2) was grown in plastic plates/flasks with Iscove's

Modified Dulbecco's Medium IMDM (Gibco) supplemented with 10% Fetal Bovine Serum, 1%

Penicillin/Streptomycin, 0.1 mM sodium pyruvate and 0.1 mM nonessential amino acids (MEA). Cells

were maintained at 37°C in a humidified atmosphere containing 5% carbon dioxide. For fasting and

activation experiments: LX-2 cells were seeded at 0.1 x 106 cells per 12-well plates, and cultured at

37°C with 5% CO2 for 24 hours. After that, LX-2 cells were cultured in a set of two different conditions:
This article is protected by copyright. All rights reserved
5
  

LX-2 cells in normal medium (control), LX-2 cells seeded in fasted medium (FM, 1% FBS, 0.5 g/L

glucose and antibiotics). The experiment was carried out in duplicate in two identical plates. After 48

hours, IMDM serum free was added in both plates for 4 hours. After that, a solution of 0.2% of bovine

serum albumin (BSA), containing LPS (100 ng/ml) was added to the first plate, and a second solution

of only 0.2% of BSA to the second plate. The human hepatocellular carcinoma cell lines HepG2 (a

human hepatocarcinoma cell line; ATCC HB-8065) and Huh7 used in this study were of a low narrow

passage number and were maintained as previously described (Borghesan, 2016). HCC cells were

plated in regular medium containing 10% FBS. 24 h later, the cell medium was removed, cells were

washed twice with PBS and then incubated either in the same medium or in FM. 24 h later cells were

stimulated (or not) with a cytostatic concentration of Sorafenib (Cervello et al., 2012). All cells were

kept at 5% CO2 and 37°C.

Cell cycle and viability

For cell cycle analyses, LX-2 cells were harvested at least 3 hours before the experiment as already

described (D'Aronzo et al., 2015). After fixation with 1ml of 70% cold ethanol at -20°C, as indicated by

the Muse Cell Cycle Kit User’s Guide 200 μl of ethanol-fixed cells were incubated with propidium

iodide and RNase A for 30 minutes at room temperature, before loading on Muse Cell Analyzer

(Millipore, Italy) according to the supplied staining protocol. Viability was determined 72 h later by MTT

(Cell Signaling) or by using C-Chip DHC-NO1-5 technology (Incyto) according to the manufacturer’s

instructions. Alternatively, MTS cell proliferation assay was performed using a kit from Promega (cat n.

G3580), according to manufacturer’s instructions.

Glucose uptake assay

Measurements of 2-deoxy-D-[2,6-3H]-glucose uptake by HepG2 and Huh-7 cells were performed as

previously described (Deblon et al., 2012). Non-specific glucose uptake was determined in the
This article is protected by copyright. All rights reserved
6
  

presence of 10 mM cytochalasin B. Cell-associated radioactivity was measured by liquid scintillation

counting in a β-counter (Wallac 1409, Perkin Elmer).

qPCR

Total RNA was isolated from cells using TRIzol (Invitrogen) and quantified using NanoDrop 1000

spectrophotometer (Thermo Scientific). After RNA quality verification, 100 ng to 1 mg was used to

prepare cDNA. Quantitative PCR was performed using SYBR Green (SIGMA) in a LightCycler®

Instrument (Roche), as described previously (Benegiamo et al., 2012). GAPDH transcripst was used

as internal control for normalization. Primer sequences were as follows: GAPDH, Forward

CGCTCTCTGCTCCTCCTGTTC, Reverse TTGACTCCGACCTCACCTTCC; SMA , Forward

GCATCCACGAAACCACCTA, reverse CACGAGTAACAAATCAAAGC; vimentin, forward

TCCAGCAGCTTCCTGTAGGT, reverse CCCTCACCTGTGAAGTGGAT; VEGF, forward

TGCAGATTATGCGGATCAAACC, reverse TGCATTCACATTTGTTGTGCTGTAG; BIRC5, forward

GCATGGGTGCCCCGACGTTG, reverse GCTCCGGCCAGAGGCCTCAA. For TRIB3 (QT00088543),

LARP6 (QT00221445) and DKK1 (QT00009093) QuantiTect Primer Assays were purchased from

QIAGEN.

Immunoblotting

Protein extracts from LX-2 cells were isolated and processed for immunoblotting as described

previously (McKee et al., 2015; Rappa et al., 2013). Primary antibody against SMA, vimentin, anti-

phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204) and anti-p44/42 MAPK (ERK1/2) were obtained

from Cell Signaling. Antibody against actin and GAPDH (Cell Signaling) was used as total protein

loading control for normalization.

This article is protected by copyright. All rights reserved

7
  

Non-alcoholic steatohepatitis (NASH) mouse model

The non-alcoholic steatohepaptitis (NASH) model, a STAM mouse, was generated as previously

described (Jueliger, 2016; Saito et al., 2015) and outsourced at SMC Laboratories, Tokyo, Japan.

Briefly, C57BL/6J mice were purchased from Charles River (Kanagawa, Japan) at 15 d post

pregnancy. On the second day after birth, male mice were subjected to a single subcutaneous

injection of 200 μg streptozotocin (Sigma, MO, USA). Four weeks after injection, mice were fed a high

fat diet (HFD32, CLEA JAPAN, Tokyo, Japan) ad libitum until sacrifice at 12 weeks. Two experimental

groups were considered, a control group (n = 12) and a group administered cycles of 72 h fasting (n =

12) at week 6. Followed by 6-7 days of high fat diet, to let the mice regain their body weight: 5 cycles

of fasting were thus administered before mice were sacrificed, at week 12. Plasma levels of glucose,

insulin, ALT, AST and triglycerides were assessed by standard biochemical assays (Brandhorst et al.,

2015; Veyrat-Durebex et al., 2009). At 8 weeks, animal experiments were conducted according to

protocols approved by the Animal Research Committee at Research Institute, National Center for

Global Health and Medicine. Mice were maintained according to National Institutes of Health

guidelines for care and use of laboratory animals.

Histology

Liver samples from the STAM model were fixed in 4% buffered paraformaldehyde, embedded in

paraffin, stained with H&E or Masson's trichrome, and examined by light microscopy, as we have

previously described (Borghesan, 2016; Pazienza et al., 2016).

Statistical analyses

Results were expressed as mean ± standard error of the mean (SEM). Comparisons between means

were made by appropriate Student t tests. Differences of proportions were assessed by one-tailed χ2

tests. Differences were considered as significant when P < 0.05.

This article is protected by copyright. All rights reserved
8
  

Results

Fasting-like medium counteracts lipopolysaccharide (LPS)-induced HSC activation

Short-term-starvation was shown to protect normal cells and organs but to sensitize different cancer

cell types to chemotherapy. It is not known the fibrogenic processes occurring in the liver in patients

with advanced fibrosis and cirrhosis are affected by fasting. During liver fibrosis, Kupffer cells can

produce a variety of proinflammatory cytokines to provoke HSC activation and hepatic injury, in which

inflammation may be a bridge between liver injury and fibrosis (Liu et al., 2010). HSCs are the main

producers of extracellular matrix (ECM) in the fibrotic liver, and the targets of proinflammatory

mediators (Bataller and Brenner, 2005). We investigated the in vitro effects of short-term starvation on

quiescent human LX-2 cell line grown under normal or conditions mimicking fasting (1% FBS and low

glucose (0.5 g/L)) for 24 hours (Bataller and Brenner, 2005), followed by additional 48 hours exposure

to LPS, a gram-negative cell wall component that strongly triggers the activation of HSCs (Figure 1)

(Ceccarelli et al., 2015). To this purpose, LX-2 were incubated either in NM or in FM for 24 hours, prior

to treatment with LPS (100 ng/ml) for additional 48 hours. LX-2 exposed to FM and/or LPS were

equally viable, with low apoptotic rates (Supplemental Figure 1). We sought to determine if FM and/or

LPS could affect cell cycle progression. To this purpose, we performed a cell cycle analysis to assess

the effect of FM and/or LPS alone on LX-2. Figure 2A shows that LX-2 cells treated with LPS did not

display differences in cell cycle, while FM induced a significant increase in G0/G1 phase and a

decrease in S phase; combined treatment (FM+LPS) did not restore the number of cells escaping the

S phase (Figure 2A). These findings indicate an inhibition of DNA synthesis and proliferation of LX-2

upon exposure to FM. Consistently, as expected FM decreased LX-2 cell proliferation of ~50%

compared to NM at 72h (Figure 2B). However, LPS increased LX-2 cells proliferation to a similar

extent, ~20% compared to the untreated condition, regardless if they were exposed to NM or to FM

(Figure 2B).
This article is protected by copyright. All rights reserved
9
  

In response to liver injury, quiescent HSCs undergo notable phenotypic alterations, including

expression of α-smooth muscle actin (αSMA) and vimentin (Xu et al., 2005). FM could efficiently block

the increase in αSMA and vimentin induced by treatment of LX-2 cells with LPS, both at the mRNA

(Figure 3A) and at the protein level (Figure 3B). Altogether these data suggest that short term

starvation might be beneficial on HSC and liver fibrosis, because it inhibits cell proliferation and

activation triggered by LPS pro-inflammatory stimulus.

Effect of short term starvation on non-alcoholic steatohepatitis in vivo

NAFLD, an accumulation of intra-hepatic triglycerides, is the most common cause of chronic liver

disease in Western countries with up to one third of the population affected. NAFLD include a

spectrum of disturbances that encompasses various degrees of liver damage ranging from simple

steatosis to non-alcoholic steatohepatitis (NASH) (Podrini et al., 2013). NASH is characterized by

hepatocellular inflammation with HSC activation and fibrosis. Individuals with NASH are also at great

risk of developing HCC. For this reason, here we used the STAM mouse, a model of NASH

progression resembling the disease in humans with type 2 diabetic characteristics (Jueliger, 2016; Van

der Schueren et al., 2015). On the second day after birth, male mice were subjected to a single

subcutaneous injection of 200 μg streptozotocin. Mice were randomized into two groups of 12 mice at

6 weeks of age, the day before the start of the treatment: a control group, where mice were fed high

fat diet (60% energy from lard) ad libitum until sacrifice at 10 weeks; a fasted group, where mice

received 2 cycles of 72h fasting (food starvation, only water ad libitum) followed by 10 days of high fat

diet refeeding, until sacrifice at 10 weeks. This time point was chosen because well characterized

STAM mice develop NASH at week 8 and fibrosis and inflammation at week 10–12 (Saito et al., 2015).

Mice were weighed individually and daily during the whole protocol; variations in body weight reflected

the fasting/refeeding cycles (Figure 4A). At the end of the protocol, the levels of serum transaminases
This article is protected by copyright. All rights reserved
10
  

ALT and AST as well as liver histology were assessed. Periodic fasting did not affect body weight or

the levels of circulating transaminases ALT and AST (Figure 4A-C). Moreover, a similar extent of

characteristic NASH-associated liver damage (lipid accumulation, fibrosis, inflammation and

ballooning) was observed and quantified at the histological level in the liver of control and fasted mice

(Figure 4D, E). We conclude that although cyclic fasting does not seem effective in reducing the

fibrotic burden in vivo in the NASH model used, it is also safe and well tolerated.

Fasting-like medium synergizes with cytostatic doses of Sorafenib in inhibiting human HCC cells

growth and metabolism

Sorafenib has previously been shown to hamper cell growth and viability in human HCC cells in a

dose- and time-dependent manner (Cervello et al., 2012). Using HepG2 and Huh-7 as models of

human HCC cells (Borghesan, 2016; Cervello et al., 2012; Jueliger, 2016), we performed MTS assays,

a colorimetric sensitive quantification of viable cells at different time points (24h, 48, and 72h) with

increasing concentrations of Sorafenib (range: 0.39 µM -50 µM). After 72 h of treatment, while 10 μM

and 50 μM were cytotoxic and triggered 65% and 85% of cell death, respectively, the lower dose 1 μM

Sorafenib had cytostatic effects, inducing only 15% of cell death (Figure 5A). Similar results were

obtained with Huh-7 cell line (data not shown), according to previous studies (Cervello et al., 2012).

The dose of 1 thus retained for further experiments. We investigated the in vitro effects of

fasting HepG2 and Huh-7 HCC cell lines grown under normal or conditions mimicking starvation for 72

hours. One day after exposure to fasting-

Fasting and Sorafenib showed additive cytotoxic effects in both cell lines tested (Figure 5B and C).

Aerobic glycolysis (“Warburg effect”) represents one of the distinctive tracts (“hallmarks”) of the

malignant phenotype. Glucose uptake is a reliable read-out of glucose-dependent metabolic activities

in HCC cells, such as glycogen storage and glycolysis (Pazienza et al., 2014; Vinciguerra et al., 2008),

and it is a therapeutic target to enhance the efficacy of Sorafenib (Zhang et al., 2017). Interestingly, we
This article is protected by copyright. All rights reserved
11
  

found that Sorafenib enhanced glucose uptake in HepG2 and in Huh-7 HCC cells (Figure 6),

corroborating recent findings that the glycolytic pathway in HCC is strengthened in the presence of

Sorafenib (Tesori et al., 2015; Zhang et al., 2017). Glucose uptake was significantly reduced in

presence of a fasting-like medium, which paralleled viability response (Figure 6). Sorafenib increased

glucose uptake to a similar extent, regardless if cells were exposed to a normal or to a fasting-like

medium (Figure 6 and B). Fasting-like medium sensitized cells to insulin, inducing a ~1.5 fold increase

in glucose uptake in response to insulin treatment compared to control medium (Figure 6A and B). The

fasting-dependent blockade of glycolysis greatly reduced Sorafenib-induced glucose uptake in both

HCC cell lines (Figure 6A and B). These data demonstrate unequivocally that HCC cells are hampered

in their growth and ability to uptake glucose by fasting-like conditions, which can decrease the pro-

glycolytic effects of Sorafenib and synergize with its anti-proliferative effects.

Effects of the interaction between fasting-like and Sorafenib on gene expression in human HCC

In HCC cells growth is typically driven by the constitutive activation of downstream signaling cascades,

such as the mitogen-activated protein kinase (MAPK) pathway. Inhibition of these pathways by

Sorafenib occurs rapidly (Sergina et al., 2007). We monitored the phosphorylation status of ERK as a

reading frame for the activity of the MAPK signaling cascade in cells treated with Sorafenib with or

without starvation. Experiments performed with Sorafenib demonstrated a striking reduction of

phospho-ERK after a 1-h treatment in both HepG2 and Huh-7 cells (Figure 7A, B). Starvation did not

affect significantly ERK phosphorylation in any of the cell lines. However, in every instance, the

combination of starvation plus Sorafenib was the most effective at maintaining ERK phosphorylation

inhibition in cancer cells (Figure 7A, B). These findings are in line with those from the viability assays

and suggest that the cooperation between Sorafenib and starvation conditions may rely on the ability

of the latter to prevent compensatory or alternative mechanisms that can bypass signaling cascade

inhibition by Sorafenib. Transcriptomics analyses identifying changes in gene expression both in

This article is protected by copyright. All rights reserved
12
  

common and unique to HepG2 and Huh7 cells following Sorafenib treatment have been recently

reported using DNA microarray technology (Cervello et al., 2012). Taking advantage of these

published data, we considered a signature of genes displaying >2 fold change upon Sorafenib

treatment, which have also been validated by qPCR in both HepG2 and Huh-7 cells as top hits:

BIRC5, DKK1, LARP6, TRIB3 and VEGF (Cervello et al., 2012). BIRC5 is also called survivin, an

inhibitor of apoptosis; Dickkopf-1 (DKK1) is a serum protein marker for HCC; LARP6 or La

ribonucleoprotein domain family, member 6 (LARP6) is a RNA binding protein which regulates

translation of collagen mRNAs and synthesis of type I collagen; TRIB3 is a tribbles pseudokinase 3

that inhibits cancer by blocking AKT activation; and VEGF is a well-known and crucial factor for

vascularization and metastasis of HCC. Sorafenib downregulated significantly BIRC5 and DKK1, while

it inducing an upregulation of LARP6 and TRIB3 in both HepG2 and Huh-7 HCC cell lines (Figure 7C

and D). Fasting alone had no effect on the expression levels of any of these 5 genes; however, it

synergized with Sorafenib in further decreasing BIRC5 and DKK1, and in increasing TRIB3 mRNA

levels (Figure 7C and D). Furthermore, fasting-mimicking conditions prevented Sorafenib-induced

LARP6 increase in gene expression in both cell lines (Figure 7C and D). Finally, a decrease in VEGF

mRNA levels was detected only in presence of both fasting and Sorafenib, but not of each stressor

alone (Figure 7C and D). These findings demonstrate that fasting is able to synergize, at least in part,

with changes in gene expression due by chemotherapy in HCC cells.

Discussion

In the general population, fatty liver can lead to steatohepatitis, cirrhosis and potentially to HCC.

Fibrosis is the diagnostic element that predicts worse outcomes and mortality, and ongoing research

studies are investigating new pathways aimed at reversing it (Noureddin et al., 2016), a goal that still

has not been attained. Similarly, despite the introduction of Sorafenib, which is thought to be both an

anti-fibrotic drug and a chemotherapeutic (Azzariti et al., 2016; Mazzoccoli et al., 2015a), HCC
This article is protected by copyright. All rights reserved
13
  

remains incurable, with life span extension limited to a couple of months with the administration of

Sorafenib to those patients who respond to it, or also with the administration of the new kid on the

block Regorafenib to Sorafenib-resistant patients (Bruix et al., 2017). Recently, dietary interventions

explored the ability of nutrient- or caloric- restricted conditions to protect normal cells, while sensitizing

a wide variety of cancer cells to cytotoxic therapies, by reprogramming metabolic and stress resistance

pathways (Lee et al., 2012; Vernieri et al., 2016). Despite clinical trials exploiting the combination of

restricted feeding or short term fasting with chemotherapy are in place for a number of malignancies

(Vernieri et al., 2016), our knowledge on the impact of these strategies on liver fibrosis and HCC is

very limited. In this study we thus have investigated the possibility the anti-fibrotic potential of fasting

mimicking conditions in vitro in human HSC cells and in vivo in a mouse model of fibrosis, and the

potential synergistic anti-cancer effects of fasting mimicking conditions with Sorafenib in vitro in HCC

cells. These fasting mimicking (FM) conditions, based on low serum and low glucose, have been

previously optimized in several laboratories to reproduce the quantity of circulating nutrients in a

subject undergoing short term starvation, and differ from complete serum starvation or glucose

restriction (Brandhorst et al., 2015; D'Aronzo et al., 2015; Lee et al., 2012). In vivo, during liver fibrosis,

Kupffer cells produce proinflammatory cytokines upon LPS exposure, which provokes HSC activation

and hepatic injury (Seki et al., 2007). LPS can also trigger NF-

cells, which express TLR4 (Paik et al., 2003), with consequent upregulation of classic fibrogenic

(Csak et al., 2015; Sun et al., 2013; Wang et al., 2012). Although FM did

not block LPS-dependent relative increase in LX-2 cell proliferation, it completely prevented LPS-

induced pro-fibrogenic differentiation, which was indicated by the lack of increase in vimentin and

-fibrogenic markers even below basal

levels.

Importantly, the established protocol of LX-2 activation by LPS or other cytokines involve 24h-48h of

serum starvation prior to treatment (Fabre et al., 2014). In our experiments, a reduction of FBS from
This article is protected by copyright. All rights reserved
14
  

10% to 1% and glucose from 4.5 g/l to 0.5 g/l yielded the opposite effect, the protection of LX-2 from

pro-fibrogenic activation, highlighting the biological importance of fine-tuning nutrient composition

when attempting to reproduce FM conditions. Our data on STAM models of fibrosis and NASH, where

mice received 2 cycles of 72h fasting (food starvation) followed by 10 days of high fat diet refeeding,

until sacrifice at 10 weeks, failed to show hepato-protective effects of food starvation. It is possible that

the length or the amount of fasting cycles was not enough to elicit beneficial effects. In this respect,

fasting mimicking diets commercially available would need to be used and optimized in future

approaches (D'Aronzo et al., 2015; Di Biase and Longo, 2016; Longo et al., 2015). Regardless, cycles

of fasting were well tolerated by mice in this NASH model and did not worsen liver function and

morphology. Although this could be encouraging for the clinical setting, malnutrition is often an

important issue in patients with advanced fibrosis/cirrhosis. There is a general consensus of opinion

that nutritional intervention in patients with cirrhosis improves liver function, and therefore fasting-like

dietary short term cycles (2-3 days) would need to be interfaced with optimal nutrition windows to

maintain good liver function. In this study we found that fasting-like medium has additive effects with

cytostatic doses of Sorafenib in inhibiting HCC cells growth and glucose uptake. Our data are fully

consistent with two recent reports of Longo et al. showing that: i) the cytotoxicity of oxaliplatin on

colorectal tumours was enhanced by combining it with 48 hour short term starvation, which also

potentiated the effects of the drug on the suppression of tumor growth and glucose uptake in both in

vitro and in vivo models (Bianchi et al., 2015); ii) short term starvation increases the ability of

commonly administered tyrosine kinase inhibitors (belonging to the same class of drugs as Sorafenib

used in this study), including erlotinib, gefitinib, lapatinib, crizotinib and regorafenib, to block growth

and to inhibit MAPK signaling pathway and downstream transcriptional effects in lung, breast and

colorectal cancer cells (Caffa et al., 2015). In cancer xenografts models generated using the H3122

non-small cell lung cancer cell line or the HCT116 colorectal cancer cell line, both tyrosine kinase

inhibitors and cycles of fasting slowed tumor growth, but, when combined, these interventions were
This article is protected by copyright. All rights reserved
15
  

significantly more effective than either type of treatment alone, as strong effect that we have previously

shown also for gemcitabine and pancreatic cancer (Caffa et al., 2015; D'Aronzo et al., 2015).

The two human HCC cell lines, HepG2 and Huh7, are routinely used to examine the intracellular

events leading to drug-induced HCC cell-growth inhibition, but carry some different biological and

genetic characteristics that affects their response to Sorafenib (Cervello et al., 2012). For this reason

we studied the effect of fasting on the expression pattern of genes previously shown to respond

similarly to a high dose (7.5 of this chemotherapeutic in the two cell types: BIRC5, DKK1, LARP6,

TRIB3 and VEGF (Cervello et al., 2012). Remarkably, fasting synergized with Sorafenib in decreasing

the expression in inhibiting the expression of BIRC5, DKK1, TRIB3 and VEGF, which is consistent with

increased apoptosis (BIRC5), blockage of growth signals (DKK1 and TRIB3) and decreased

angiogenic potential (VEGF); conversely, fasting blocked the Sorafenib-induced upregulation in

LARP6, a critical step in biosynthesis of extracellular matrix. Whereas no studies on fasting and HCC

have been performed in humans, nutritional clinical indications to counteract HCC progression are

controversial: epidemiological studies are discrepant on the role of animal protein intake in protecting

from liver diseases on the one hand, and favoring all causes and cancer mortality on the other

(Vinciguerra, 2015). Much of the clinical response to nutritional strategies and anti-HCC therapies

depend also on the surrounding healthy tissue in the liver, which is the natural metabolic hub for

dietary carbohydrates, proteins and fats. In this respect, our in vitro study presents with several

limitations. The effect of short cycles of fasting has not been investigated in vivo, in mice, which

occasionally develop spontaneous hepatocellular carcinoma in a strain-specific manner. Xenograft

models are useful for drug screening but may not provide valuable information about the hepatic

response to starvation. Similarly, artificial manipulation of oncogene/tumor suppressor expression

involved in growth factor and nutrient signaling might not be a suitable background to study the effects

of starvation, given possible confounding effects. Chemically-induced models (i.e. diethylnytrosamine)

and genetically modified models might be more suitable to reproduce HCC developed in a natural
This article is protected by copyright. All rights reserved
16
  

background of liver damage in future studies (Heindryckx et al., 2009). Moreover, our study did not

analyze the effects of Sorafenib with or without a fasting-mimicking medium on normal primary

hepatocytes, co-cultured or not with HCC cells, to investigate if detoxifying CYP450 activities are

ameliorated in an untransformed cellular setting. As in humans and mice cycles of fasting mimicking

diets are safe, feasible, and effective in reducing markers/risk factors for aging and cancer (Brandhorst

et al., 2015; Wei et al., 2017), our findings provide the rationale to investigate these therapeutic

approaches to cure HCC in pre-clinical and clinical settings.

Acknowledgements

We thank SMC Laboratories Inc and Anna Humber for technical assistance. We thank Prof. Valter D.

Longo for insightful discussions.

Funding

This work was supported by the European Social Fund and European Regional Development Fund -

Project MAGNET (No. CZ.02.1.01/0.0/0.0/15_003/0000492) to MV. PhD fellowship of OLR was

supported by grant No.LQ1605 from the National Program of Sustainability II (MEYS CR).

Author contributions

OLR, SP, FR, CP, CC performed experiments. SDB, MC and VP provided critical intellectual input. MV

designed the study and wrote the paper.

Conflict of interest

None of the authors declare conflict of interest regarding this work.

This article is protected by copyright. All rights reserved
17
  

References

Azzariti A, Mancarella S, Porcelli L, Quatrale AE, Caligiuri A, Lupo L, Dituri F, Giannelli G. 2016.
Hepatic stellate cells induce hepatocellular carcinoma cell resistance to sorafenib
through the laminin-332/alpha3 integrin axis recovery of focal adhesion kinase
ubiquitination. Hepatology 64(6):2103-2117.
Balasus D, Way M, Fusilli C, Mazza T, Morgan MY, Cervello M, Giannitrapani L, Soresi M,
Agliastro R, Vinciguerra M, Montalto G. 2016. The association of variants in PNPLA3
and GRP78 and the risk of developing hepatocellular carcinoma in an Italian population.
Oncotarget 7(52):86791-86802.
Barchitta M, Quattrocchi A, Maugeri A, Vinciguerra M, Agodi A. 2014. LINE-1 hypomethylation
in blood and tissue samples as an epigenetic marker for cancer risk: a systematic review
and meta-analysis. PLoS One 9(10):e109478.
Bataller R, Brenner DA. 2005. Liver fibrosis. J Clin Invest 115(2):209-218.
Benegiamo G, Vinciguerra M, Mazzoccoli G, Piepoli A, Andriulli A, Pazienza V. 2012. DNA
methyltransferases 1 and 3b expression in Huh-7 cells expressing HCV core protein of
different genotypes. Dig Dis Sci 57(6):1598-1603.
Bianchi G, Martella R, Ravera S, Marini C, Capitanio S, Orengo A, Emionite L, Lavarello C,
Amaro A, Petretto A, Pfeffer U, Sambuceti G, Pistoia V, Raffaghello L, Longo VD. 2015.
Fasting induces anti-Warburg effect that increases respiration but reduces ATP-
synthesis to promote apoptosis in colon cancer models. Oncotarget 6(14):11806-11819.
Block KI, Gyllenhaal C, Lowe L, Amedei A, Amin AR, Amin A, Aquilano K, Arbiser J, Arreola A,
Arzumanyan A, Ashraf SS, Azmi AS, Benencia F, Bhakta D, Bilsland A, Bishayee A,
Blain SW, Block PB, Boosani CS, Carey TE, Carnero A, Carotenuto M, Casey SC,
Chakrabarti M, Chaturvedi R, Chen GZ, Chen H, Chen S, Chen YC, Choi BK, Ciriolo
MR, Coley HM, Collins AR, Connell M, Crawford S, Curran CS, Dabrosin C, Damia G,
Dasgupta S, DeBerardinis RJ, Decker WK, Dhawan P, Diehl AM, Dong JT, Dou QP,
Drew JE, Elkord E, El-Rayes B, Feitelson MA, Felsher DW, Ferguson LR, Fimognari C,
Firestone GL, Frezza C, Fujii H, Fuster MM, Generali D, Georgakilas AG, Gieseler F,
Gilbertson M, Green MF, Grue B, Guha G, Halicka D, Helferich WG, Heneberg P,
Hentosh P, Hirschey MD, Hofseth LJ, Holcombe RF, Honoki K, Hsu HY, Huang GS,
Jensen LD, Jiang WG, Jones LW, Karpowicz PA, Keith WN, Kerkar SP, Khan GN,
Khatami M, Ko YH, Kucuk O, Kulathinal RJ, Kumar NB, Kwon BS, Le A, Lea MA, Lee
HY, Lichtor T, Lin LT, Locasale JW, Lokeshwar BL, Longo VD, Lyssiotis CA, MacKenzie
KL, Malhotra M, Marino M, Martinez-Chantar ML, Matheu A, Maxwell C, McDonnell E,
Meeker AK, Mehrmohamadi M, Mehta K, Michelotti GA, Mohammad RM, Mohammed
SI, Morre DJ, Muralidhar V, Muqbil I, Murphy MP, Nagaraju GP, Nahta R, Niccolai E,
Nowsheen S, Panis C, Pantano F, Parslow VR, Pawelec G, Pedersen PL, Poore B,
Poudyal D, Prakash S, Prince M, Raffaghello L, Rathmell JC, Rathmell WK, Ray SK,
Reichrath J, Rezazadeh S, Ribatti D, Ricciardiello L, Robey RB, Rodier F, Rupasinghe
HP, Russo GL, Ryan EP, Samadi AK, Sanchez-Garcia I, Sanders AJ, Santini D, Sarkar
M, Sasada T, Saxena NK, Shackelford RE, Shantha Kumara HM, Sharma D, Shin DM,
Sidransky D, Siegelin MD, Signori E, Singh N, Sivanand S, Sliva D, Smythe C,
Spagnuolo C, Stafforini DM, Stagg J, Subbarayan PR, Sundin T, Talib WH, Thompson
SK, Tran PT, Ungefroren H, Vander Heiden MG, Venkateswaran V, Vinay DS,
Vlachostergios PJ, Wang Z, Wellen KE, Whelan RL, Yang ES, Yang H, Yang X, Yaswen
This article is protected by copyright. All rights reserved
18
  

P, Yedjou C, Yin X, Zhu J, Zollo M. 2015. Designing a broad-spectrum integrative

approach for cancer prevention and treatment. Semin Cancer Biol 35 Suppl:S276-304.
Borghesan M, Fusilli, C, Rappa, F, Panebianco, C, Rizzo, G, Oben, JA, Mazzoccoli, G, Faulkes,
C, Pata, I, Agodi, A, Rezaee, F, Minogue, S, Warren, A, Peterson, A, Sedivy, JM, Douet,
J, Buschbeck, M, Cappello, F, Mazza, T, Pazienza, V, Vinciguerra, M. 2016. DNA
Hypomethylation and Histone Variant macroH2A1 Synergistically Attenuate
Chemotherapy-Induced Senescence to Promote Hepatocellular Carcinoma Progression.
Cancer Res 76(3):594-606. .
Bosetti C, Turati F, La Vecchia C. 2014. Hepatocellular carcinoma epidemiology. Best Pract
Res Clin Gastroenterol 28(5):753-770.
Brandhorst S, Choi IY, Wei M, Cheng CW, Sedrakyan S, Navarrete G, Dubeau L, Yap LP, Park
R, Vinciguerra M, Di Biase S, Mirzaei H, Mirisola MG, Childress P, Ji L, Groshen S,
Penna F, Odetti P, Perin L, Conti PS, Ikeno Y, Kennedy BK, Cohen P, Morgan TE, Dorff
TB, Longo VD. 2015. A Periodic Diet that Mimics Fasting Promotes Multi-System
Regeneration, Enhanced Cognitive Performance, and Healthspan. Cell Metab 22(1):86-
99.
Brandhorst S, Longo VD. 2016. Fasting and Caloric Restriction in Cancer Prevention and
Treatment. Recent Results Cancer Res 207:241-266.
Bruix J, Qin S, Merle P, Granito A, Huang YH, Bodoky G, Pracht M, Yokosuka O, Rosmorduc
O, Breder V, Gerolami R, Masi G, Ross PJ, Song T, Bronowicki JP, Ollivier-Hourmand I,
Kudo M, Cheng AL, Llovet JM, Finn RS, LeBerre MA, Baumhauer A, Meinhardt G, Han
G, Investigators R. 2017. Regorafenib for patients with hepatocellular carcinoma who
progressed on sorafenib treatment (RESORCE): a randomised, double-blind, placebo-
controlled, phase 3 trial. Lancet 389(10064):56-66.
Caffa I, D'Agostino V, Damonte P, Soncini D, Cea M, Monacelli F, Odetti P, Ballestrero A,
Provenzani A, Longo VD, Nencioni A. 2015. Fasting potentiates the anticancer activity of
tyrosine kinase inhibitors by strengthening MAPK signaling inhibition. Oncotarget
6(14):11820-11832.
Ceccarelli S, Panera N, Mina M, Gnani D, De Stefanis C, Crudele A, Rychlicki C, Petrini S,
Bruscalupi G, Agostinelli L, Stronati L, Cucchiara S, Musso G, Furlanello C, Svegliati-
Baroni G, Nobili V, Alisi A. 2015. LPS-induced TNF-alpha factor mediates pro-
inflammatory and pro-fibrogenic pattern in non-alcoholic fatty liver disease. Oncotarget
6(39):41434-41452.
Cervello M, Bachvarov D, Lampiasi N, Cusimano A, Azzolina A, McCubrey JA, Montalto G.
2012. Molecular mechanisms of sorafenib action in liver cancer cells. Cell Cycle
11(15):2843-2855.
Chen Y, Ling L, Su G, Han M, Fan X, Xun P, Xu G. 2016. Effect of Intermittent versus Chronic
Calorie Restriction on Tumor Incidence: A Systematic Review and Meta-Analysis of
Animal Studies. Sci Rep 6:33739.
Csak T, Bala S, Lippai D, Satishchandran A, Catalano D, Kodys K, Szabo G. 2015. microRNA-
122 regulates hypoxia-inducible factor-1 and vimentin in hepatocytes and correlates with
fibrosis in diet-induced steatohepatitis. Liver Int 35(2):532-541.
D'Aronzo M, Vinciguerra M, Mazza T, Panebianco C, Saracino C, Pereira SP, Graziano P,
Pazienza V. 2015. Fasting cycles potentiate the efficacy of gemcitabine treatment in in
vitro and in vivo pancreatic cancer models. Oncotarget 6(21):18545-18557.
Deblon N, Bourgoin L, Veyrat-Durebex C, Peyrou M, Vinciguerra M, Caillon A, Maeder C,
Fournier M, Montet X, Rohner-Jeanrenaud F, Foti M. 2012. Chronic mTOR inhibition by
rapamycin induces muscle insulin resistance despite weight loss in rats. Br J Pharmacol
165(7):2325-2340.
This article is protected by copyright. All rights reserved
19
  

Di Biase S, Lee C, Brandhorst S, Manes B, Buono R, Cheng CW, Cacciottolo M, Martin-

Montalvo A, de Cabo R, Wei M, Morgan TE, Longo VD. 2016. Fasting-Mimicking Diet
Reduces HO-1 to Promote T Cell-Mediated Tumor Cytotoxicity. Cancer Cell 30(1):136-
146.
Di Biase S, Longo VD. 2016. Fasting-induced differential stress sensitization in cancer
treatment. Mol Cell Oncol 3(3):e1117701.
El-Serag HB, Rudolph KL. 2007. Hepatocellular carcinoma: epidemiology and molecular
carcinogenesis. Gastroenterology 132(7):2557-2576.
Fabre T, Kared H, Friedman SL, Shoukry NH. 2014. IL-17A enhances the expression of
profibrotic genes through upregulation of the TGF-beta receptor on hepatic stellate cells
in a JNK-dependent manner. J Immunol 193(8):3925-3933.
Heindryckx F, Colle I, Van Vlierberghe H. 2009. Experimental mouse models for hepatocellular
carcinoma research. Int J Exp Pathol 90(4):367-386.
Jueliger SL, J; Cannito, S; Pata, I; Pata, P; Shkolnaya, M; Lo Re, O; Peyrou, M; Villarroya, F;
Pazienza, V; Rappa, F; Cappello, F; Azab, M Taverna, P; Vinciguerra, M. 2016. Efficacy
and epigenetic interactions of novel DNA hypomethylating agent guadecitabine (SGI-
110) in preclinical models of hepatocellular carcinoma. Epigenetics.
Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW, Ferrell LD, Liu YC,
Torbenson MS, Unalp-Arida A, Yeh M, McCullough AJ, Sanyal AJ, Nonalcoholic
Steatohepatitis Clinical Research N. 2005. Design and validation of a histological scoring
system for nonalcoholic fatty liver disease. Hepatology 41(6):1313-1321.
Lafaro KJ, Demirjian AN, Pawlik TM. 2015. Epidemiology of hepatocellular carcinoma. Surg
Oncol Clin N Am 24(1):1-17.
Lee C, Raffaghello L, Brandhorst S, Safdie FM, Bianchi G, Martin-Montalvo A, Pistoia V, Wei M,
Hwang S, Merlino A, Emionite L, de Cabo R, Longo VD. 2012. Fasting cycles retard
growth of tumors and sensitize a range of cancer cell types to chemotherapy. Sci Transl
Med 4(124):124ra127.
Liu C, Tao Q, Sun M, Wu JZ, Yang W, Jian P, Peng J, Hu Y, Liu C, Liu P. 2010. Kupffer cells
are associated with apoptosis, inflammation and fibrotic effects in hepatic fibrosis in rats.
Lab Invest 90(12):1805-1816.
Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF, de Oliveira AC, Santoro A,
Raoul JL, Forner A, Schwartz M, Porta C, Zeuzem S, Bolondi L, Greten TF, Galle PR,
Seitz JF, Borbath I, Haussinger D, Giannaris T, Shan M, Moscovici M, Voliotis D, Bruix
J, Group SIS. 2008. Sorafenib in advanced hepatocellular carcinoma. N Engl J Med
359(4):378-390.
Longo VD, Antebi A, Bartke A, Barzilai N, Brown-Borg HM, Caruso C, Curiel TJ, de Cabo R,
Franceschi C, Gems D, Ingram DK, Johnson TE, Kennedy BK, Kenyon C, Klein S,
Kopchick JJ, Lepperdinger G, Madeo F, Mirisola MG, Mitchell JR, Passarino G, Rudolph
KL, Sedivy JM, Shadel GS, Sinclair DA, Spindler SR, Suh Y, Vijg J, Vinciguerra M,
Fontana L. 2015. Interventions to Slow Aging in Humans: Are We Ready? Aging Cell
14(4):497-510.
Lv M, Zhu X, Wang H, Wang F, Guan W. 2014. Roles of caloric restriction, ketogenic diet and
intermittent fasting during initiation, progression and metastasis of cancer in animal
models: a systematic review and meta-analysis. PLoS One 9(12):e115147.
Mazzoccoli G, Miele L, Oben J, Grieco A, Vinciguerra M. 2015a. Biology, epidemiology, clinical
aspects of hepatocellular carcinoma and the role of Sorafenib. Curr Drug Targets.
Mazzoccoli G, Tarquini R, Valoriani A, Oben J, Vinciguerra M, Marra F. 2015b. Management
strategies for hepatocellular carcinoma: old certainties and new realities. Clin Exp Med.

This article is protected by copyright. All rights reserved

20
  

McKee C, Sigala B, Soeda J, Mouralidarane A, Morgan M, Mazzoccoli G, Rappa F, Cappello F,

Cabibi D, Pazienza V, Selden C, Roskams T, Vinciguerra M, Oben JA. 2015.
Amphiregulin activates human hepatic stellate cells and is upregulated in non alcoholic
steatohepatitis. Sci Rep 5:8812.
Noureddin M, Anstee QM, Loomba R. 2016. Review article: emerging anti-fibrotic therapies in
the treatment of non-alcoholic steatohepatitis. Aliment Pharmacol Ther 43(11):1109-
1123.
Paik YH, Schwabe RF, Bataller R, Russo MP, Jobin C, Brenner DA. 2003. Toll-like receptor 4
mediates inflammatory signaling by bacterial lipopolysaccharide in human hepatic
stellate cells. Hepatology 37(5):1043-1055.
Pazienza V, Borghesan M, Mazza T, Sheedfar F, Panebianco C, Williams R, Mazzoccoli G,
Andriulli A, Nakanishi T, Vinciguerra M. 2014. SIRT1-metabolite binding histone
macroH2A1.1 protects hepatocytes against lipid accumulation. Aging (Albany NY)
6(1):35-47.
Pazienza V, Panebianco C, Rappa F, Memoli D, Borghesan M, Cannito S, Oji A, Mazza G,
Tamburrino D, Fusai G, Barone R, Bolasco G, Villarroya F, Villarroya J, Hatsuzawa K,
Cappello F, Tarallo R, Nakanishi T, Vinciguerra M. 2016. Histone macroH2A1.2
promotes metabolic health and leanness by inhibiting adipogenesis. Epigenetics
Chromatin 9:45.
Pinzani M. 2015. Pathophysiology of Liver Fibrosis. Dig Dis 33(4):492-497.
Podrini C, Borghesan M, Greco A, Pazienza V, Mazzoccoli G, Vinciguerra M. 2013. Redox
homeostasis and epigenetics in non-alcoholic fatty liver disease (NAFLD). Curr Pharm
Des 19(15):2737-2746.
Rappa F, Greco A, Podrini C, Cappello F, Foti M, Bourgoin L, Peyrou M, Marino A, Scibetta N,
Williams R, Mazzoccoli G, Federici M, Pazienza V, Vinciguerra M. 2013.
Immunopositivity for histone macroH2A1 isoforms marks steatosis-associated
hepatocellular carcinoma. PLoS One 8(1):e54458.
Safdie F, Brandhorst S, Wei M, Wang W, Lee C, Hwang S, Conti PS, Chen TC, Longo VD.
2012. Fasting enhances the response of glioma to chemo- and radiotherapy. PLoS One
7(9):e44603.
Saito K, Uebanso T, Maekawa K, Ishikawa M, Taguchi R, Nammo T, Nishimaki-Mogami T,
Udagawa H, Fujii M, Shibazaki Y, Yoneyama H, Yasuda K, Saito Y. 2015.
Characterization of hepatic lipid profiles in a mouse model with nonalcoholic
steatohepatitis and subsequent fibrosis. Sci Rep 5:12466.
Seki E, De Minicis S, Osterreicher CH, Kluwe J, Osawa Y, Brenner DA, Schwabe RF. 2007.
TLR4 enhances TGF-beta signaling and hepatic fibrosis. Nat Med 13(11):1324-1332.
Sergina NV, Rausch M, Wang D, Blair J, Hann B, Shokat KM, Moasser MM. 2007. Escape from
HER-family tyrosine kinase inhibitor therapy by the kinase-inactive HER3. Nature
445(7126):437-441.
Sheedfar F, Di Biase S, Koonen D, Vinciguerra M. 2013. Liver diseases and aging: friends or
foes? Aging Cell 12(6):950-954.
Sun X, Yang Y, Zhu D, Qian H, Duan Y, He X, Gu X, Sun W, Zhu Y. 2013. Expression of
Septin4 in human hepatic stellate cells LX-2 stimulated by LPS. Inflammation 36(3):539-
548.
Tesori V, Piscaglia AC, Samengo D, Barba M, Bernardini C, Scatena R, Pontoglio A, Castellini
L, Spelbrink JN, Maulucci G, Puglisi MA, Pani G, Gasbarrini A. 2015. The multikinase
inhibitor Sorafenib enhances glycolysis and synergizes with glycolysis blockade for
cancer cell killing. Sci Rep 5:9149.

This article is protected by copyright. All rights reserved

21
  

Van der Schueren B, Vangoitsenhoven R, Geeraert B, De Keyzer D, Hulsmans M, Lannoo M,

Huber HJ, Mathieu C, Holvoet P. 2015. Low cytochrome oxidase 4I1 links mitochondrial
dysfunction to obesity and type 2 diabetes in humans and mice. Int J Obes (Lond)
39(8):1254-1263.
Vernieri C, Casola S, Foiani M, Pietrantonio F, de Braud F, Longo V. 2016. Targeting Cancer
Metabolism: Dietary and Pharmacologic Interventions. Cancer Discov 6(12):1315-1333.
Veyrat-Durebex C, Montet X, Vinciguerra M, Gjinovci A, Meda P, Foti M, Rohner-Jeanrenaud F.
2009. The Lou/C rat: a model of spontaneous food restriction associated with improved
insulin sensitivity and decreased lipid storage in adipose tissue. Am J Physiol Endocrinol
Metab 296(5):E1120-1132.
Vinciguerra M. 2015. Protein intake, chronic liver diseases, and hepatocellular carcinoma.
Hepatology 61(2):730.
Vinciguerra M, Veyrat-Durebex C, Moukil MA, Rubbia-Brandt L, Rohner-Jeanrenaud F, Foti M.
2008. PTEN down-regulation by unsaturated fatty acids triggers hepatic steatosis via an
NF-kappaBp65/mTOR-dependent mechanism. Gastroenterology 134(1):268-280.
Wang PP, Xie DY, Liang XJ, Peng L, Zhang GL, Ye YN, Xie C, Gao ZL. 2012. HGF and direct
mesenchymal stem cells contact synergize to inhibit hepatic stellate cells activation
through TLR4/NF-kB pathway. PLoS One 7(8):e43408.
Wei M, Brandhorst S, Shelehchi M, Mirzaei H, Cheng CW, Budniak J, Groshen S, Mack WJ,
Guen E, Di Biase S, Cohen P, Morgan TE, Dorff T, Hong K, Michalsen A, Laviano A,
Longo VD. 2017. Fasting-mimicking diet and markers/risk factors for aging, diabetes,
cancer, and cardiovascular disease. Sci Transl Med 9(377).
Xu L, Hui AY, Albanis E, Arthur MJ, O'Byrne SM, Blaner WS, Mukherjee P, Friedman SL, Eng
FJ. 2005. Human hepatic stellate cell lines, LX-1 and LX-2: new tools for analysis of
hepatic fibrosis. Gut 54(1):142-151.
Zhang HL, Wang MD, Zhou X, Qin CJ, Fu GB, Tang L, Wu H, Huang S, Zhao LH, Zeng M, Liu
J, Cao D, Guo LN, Wang HY, Yan HX, Liu J. 2017. Blocking preferential glucose uptake
sensitizes liver tumor-initiating cells to glucose restriction and sorafenib treatment.
Cancer Lett 388:1-11.

This article is protected by copyright. All rights reserved

22
  

Figure Legends

Figure 1. Experimental and conceptual flow to investigate whether short term starvation (STS) could

mitigate LPS-induced HSC activation. HSC LX-2 were incubated for 24 hours with a normal medium

(NM, 4.5 g/L glucose, 10% FBS) or with a fasting-like medium (FM, 0.5 g/L glucose, 1% FBS), before

activation by LPS. * p<0.05 vs NM.

Figure 2. Effect of fasting-like medium and LPS on LX-2 cell cycle and proliferation. LX-2 were

incubated either in NM or in FM for 24 hours, prior to treatment with LPS (100 ng/ml) for additional 48

hours. At 72 hours all cells were collected for analysis. A. Cell cycle analysis using the Muse Cell

Analyzer. Table in lower panel shows the quantitative measurements reported as means ± SE. B. Cell

proliferation at 72 hours as assessed by MTS assay. N=3. * p<0.05 vs NM; ** p<0.01 vs NM; # p<0.05

vs FM.

Figure 3. Effect of fasting-like medium and LPS on LX-2 activation, fibrogenic markers. LX-2 were

incubated either in NM or in FM for 24 hours, prior to treatment with LPS (100 ng/ml) for additional 48

hours. At 72 hours all cells were collected for analysis. A. Total RNA was extracted and processed for

qPCR. Relative quantification of vimentin and

comparative CT method with normalization to GAPDH; results were expressed as arbitrary units. B.

LX-2 were processed for immunoblotting with anti-vimentin and anti-

used as a loading control. Left panels: representative immunoblots; right panel: densitometric

quantification of vimentin and - . N=3. * p<0.05 vs

NM; *** p<0.001 vs NM.

Figure 4. Effect of periodic cycles of fasting (72 hours) on liver fibrosis in the STAM mouse model of

NASH. A. Mice body weights were assessed daily upon initiation of the study. B and C. ALT and AST
This article is protected by copyright. All rights reserved
23
  

transaminases levels (U/L) measured in mice sera upon sacrifice. D. Representative pictures of

hematoxylin&eosin (H&E) and trichrome staining in liver samples from control and fasted STAM mice.

E. Non-alcoholic fatty liver disease activity score (NAS) was determined using a semi-quantitative

system (from 0 to 4) that grouped histological features into broad categories (steatosis, hepatocellular

injury, portal inflammation, fibrosis and miscellaneous features (Kleiner et al., 2005). * P<005; **

P<0.01; *** P<0.001, Control vs fasted.

Figure 5. Effect of fasting-like medium and/or Sorafenib on HCC cells (HepG2 and Huh-7) cell

proliferation – MTS assay. A. HepG2 cells were incubated in normal medium with increasing

concentrations of Sorafenib (range; 0.39 µM - 50 µM) and were analyzed at different time points (24h,

48h, and 72h) to determine the cell viability. Results were expressed as percentage of cell

proliferation. B and C. HepG2 or Huh-7 cells were incubated either in control medium or in fasting-like

additional 48 hours. At 72 hours all cells were collected for analysis of proliferation. *** P<0.001, vs

control. ## P<0.01, ### P<0.001 vs control+Sorafenib.

Figure 6. Effect of fasting-like medium and/or Sorafenib on glucose uptake by HCC cells (HepG2 and

Huh-7). HepG2 or Huh-7 cells were incubated either in control medium or in fasting-like medium (FM,

0.5 g/L glucose, 1% FBS) for 24 hours, prior to treatment with Sorafenib (1

hours. At 72 hours all cells were analyzed for glucose uptake using 2-deoxy-D-[2,6-3H]-glucose

uptake. Stimulation with 10−7 mol/L insulin was used as a positive control. Results are expressed as

percentage of controls, means ± SEM of four independent experiments. * P<0.05, ** P<0.01, ***

P<0.001, vs control. &&& P<0.001 vs fasted. ## P<0.01 vs control+Sorafenib.

Figure 7. Effect of fasting-like medium and/or Sorafenib on MAPK activation and on a common gene
This article is protected by copyright. All rights reserved
24
  

expression signature in HCC cells (HepG2 and Huh-7) (Cervello et al., 2012). HepG2 or Huh-7 cells

were incubated either in control medium or in fasting-like medium (FM, 0.5 g/L glucose, 1% FBS) for

24 hours, prior to treatment with Sorafen

from all cells and processed for immunoblottting analysis or qPCR analysis. A, B. Left panels: cell

lysates were prepared and phospho-p42/44 (ERK, Thr202/Tyr204), total p42/p44 and actin were

detected by immunoblotting. Right panels: quantitative measurement of phospho-p42/p44 and

p42/p44 associated signals by densitometry. Values were normalized to actin levels and expressed as

a percentage of control. C, D. Relative quantification of BIRC5, DKK1, LARP6, TRIB3 and VEGF

mRNA levels were performed using the comparative CT method with normalization to GAPDH; results

were expressed as % control. Results are expressed as percentage of controls, means ± SEM of four
# ## ###
independent experiments. * P<0.05, ** P<0.01, *** P<0.001, vs control. P<0.05, P<0.01,

P<0.001, vs Sorafenib-treated cells.

Supplementary Figure 1. Effect of fasting-like medium and LPS on LX-2 viability and
apoptosis. LX-2 were incubated either in NM or in FM for 24 hours, prior to treatment with LPS
(100 ng/ml) for additional 48 hours. Cells were then processed to Annexin-V assay (cat n.
MCH100102) using a Muse cell analyzer (Millipore), according to manufacturer instructions

This article is protected by copyright. All rights reserved

25
  

Figure 1

This article is protected by copyright. All rights reserved

26
  

Figure 2

This article is protected by copyright. All rights reserved

27
  

Figure 3

This article is protected by copyright. All rights reserved

28
  

Figure 4

This article is protected by copyright. All rights reserved

29
  

Figure 5

This article is protected by copyright. All rights reserved

30
  

Figure 6

This article is protected by copyright. All rights reserved

31
  

Figure 7

This article is protected by copyright. All rights reserved

32